Post on 04-Jun-2018
transcript
8/13/2019 02 Insect Biochemistry Molecular
1/137
Insect Biochemistry and Molecular BiologyVolume 35, Issue 10, Pages 1073-1208 (October 2005)
1. Identification and recombinant expression of a novel chymotrypsin from
Spodoptera exigua ARTICLE
Pages 1073-1082
Salvador Herrero, Eliette Combes, Monique M. Van Oers, Just M. Vlak, Ruud A.de Maagd and Jules Beekwilder
2. Acquisition, transformation and maintenance of plant pyrrolizidine alkaloids
by the polyphagous arctiid Grammia geneura ARTICLE
Pages 1083-1099
T. Hartmann, C. Theuring, T. Beuerle, E.A. Bernays and M.S. Singer
3.Molecular characterization and evolution of pheromone binding protein genes
inAgrotismoths ARTICLE
Pages 1100-1111
David Abraham, Christer Lfstedt and Jean-Franois Picimbon
4. TheBmChi-hgene, a bacterial-type chitinase gene ofBombyx mori, encodes a
functional exochitinase that plays a role in the chitin degradation during the
molting process ARTICLE
Pages 1112-1123
Takaaki Daimon, Susumu Katsuma, Masashi Iwanaga, WonKyung Kang and Toru
Shimada
5. Effect of chloroquine on the expression of genes involved in the mosquito
immune response toPlasmodiuminfection ARTICLE
Pages 1124-1132
P. Abrantes, L.F. Lopes, V.E. do Rosrio and H. Silveira
6. Accumulation of 23 kDa lipocalin during brain development and injury in
Hyphantria cunea ARTICLE
Pages 1133-1141Hong Ja Kim, Hyun Jeong Je, Hyang Mi Cheon, Sun Young Kong, JikHyun Han,
Chi Young Yun, Yeon Su Han, In Hee Lee, Young Jin Kang and Sook Jae Seo
7. The transcriptome of the salivary glands of the female western black-legged
tickIxodes pacificus(Acari: Ixodidae) ARTICLE
Pages 1142-1161
Ivo M.B. Francischetti, Van My Pham, Ben J. Mans, John F. Andersen, Thomas N.
Mather, Robert S. Lane and Jos M.C. Ribeiro
8/13/2019 02 Insect Biochemistry Molecular
2/137
8. Development and characterization of a double subgenomic chikungunya virus
infectious clone to express heterologous genes inAedes aegyptimosqutioes ARTICLEPages 1162-1170
Dana L. Vanlandingham, Konstantin Tsetsarkin, Chao Hong, Kimberly Klingler,
Kate L. McElroy, Michael J. Lehane and Stephen Higgs
9. Molecular cloning and analysis of a novel teratocyte-specific carboxylesterase
from the parasitic wasp,Dinocampus coccinellae ARTICLE
Pages 1171-1180
Ravikumar Gopalapillai, Keiko Kadono-Okuda and Takashi Okuda
10. The extensible alloscutal cuticle of the tick,Ixodes ricinus ARTICLE
Pages 1181-1188
Svend Olav Andersen and Peter Roepstorff
11. Uptake and turn-over of glucosinolates sequestered in the sawflyAthalia
rosae ARTICLE
Pages 1189-1198
Caroline Mller and Ute Wittstock
12. MutantMos1 marinertransposons are hyperactive inAedes aegypti ARTICLE
Pages 1199-1207David W. Pledger and Craig J. Coates
Copyright 2006 Elsevier Ltd. All rights reserved
8/13/2019 02 Insect Biochemistry Molecular
3/137
InsectBiochemistry
andMolecularBiology
Insect Biochemistry and Molecular Biology 35 (2005) 10731082
Identification and recombinant expression of a novel chymotrypsin
from Spodoptera exigua
Salvador Herreroa,b,, Eliette Combesb, Monique M. Van Oersb, Just M. Vlakb,Ruud A. de Maagda, Jules Beekwildera
aBusiness Unit Bioscience, Plant Research International B.V., Wageningen University and Research Centre, Wageningen, The NetherlandsbLaboratory of Virology, Wageningen University, Binnenhaven 11, 6709 PD Wageningen, The Netherlands
Received 2 March 2005; received in revised form 29 April 2005; accepted 2 May 2005
Abstract
A novel chymotrypsin which is expressed in the midgut of the lepidopteran insect Spodoptera exigua is described. This enzyme,
referred to as SeCT34, represents a novel class of chymotrypsins. Its amino-acid sequence shares common features of gut
chymotrpysins, but can be clearly distinguished from other serine proteinases that are expressed in the insect gut. Most notable,
SeCT34 contains a chymotrypsin activation site and the highly conserved motive DSGGP in the catalytic domain around the active-
site serine is changed to DSGSA. Recombinant expression of SeCT34 was achieved in Sf21 insect cells using a special baculovirus
vector, which has been engineered for optimized protein production. This is the first example of recombinant expression of an active
serine proteinase which functions in the lepidopteran digestive tract. Purified recombinant SeCT34 enzyme was characterized by its
ability to hydrolyze various synthetic substrates and its susceptibility to proteinase inhibitors. It appeared to be highly selective for
substrates carrying a phenylalanine residue at the cleavage site. SeCT34 showed a pH-dependence and sensitivity to inhibitors,
which is characteristic for semi-purified lepidopteran gut proteinases. Expression analysis revealed that SeCT34 was only expressed
in the midgut of larvae at the end of their last instar, just before the onset of pupation. This suggests a possible role of this protein inthe proteolytic remodelling that occurs in the gut during the larval to pupal molt.
r 2005 Elsevier Ltd. All rights reserved.
Keywords: Serine proteinase; Chymotrypsin; Trypsin; Baculovirus; Proteinase inhibitor; Lepidoptera
1. Introduction
Serine proteinases (SP) belong to one of the largest
gene families in the animal kingdom. Within the human
genome, for instance, around 500 proteinase-encoding
genes have been identified, of which around 30% are SP
or SP homologues (SPH) (Southan, 2001). A similar
complexity exists in the Drosophila melanogaster gen-
ome, where around 200 SP- and SPH-encoding genes
have been identified (Ross et al., 2003). SPs are involved
in a wide range of physiological functions, includingdigestion of dietary proteins, blood coagulation, im-
mune responses, signal transduction, hormone activa-
tion and development (Barrett et al., 2003). In insects,
the most abundant and best studied group of SPs
contains those expressed in the larval midgut, and these
are supposed to be involved in the digestion of dietary
protein.
Usually, the architecture of such proteinases is
comparatively simple. While most regulatory SPs, for
ARTICLE IN PRESS
www.elsevier.com/locate/ibmb
0965-1748/$- see front matter r 2005 Elsevier Ltd. All rights reserved.
doi:10.1016/j.ibmb.2005.05.006
Abbreviations: SeCT34, Spodoptera exigua chymotrypsin 34; BAp-
NA,Na-benzoyl-L-arginine p-nitroanilide; SAAPFpNA, N-succinyl-alanine-alanine-proline-phenylalanine p-nitroanilide; SAAPLpNA, N-
succinyl-alanine-alanine-proline-leucine p-nitroanilide; SAAApNA,N-
succinyl-alanine-alanine-alanine p-nitroanilide; EFLpNA, pyrogluta-
myl-phenylalanine-leucine p-nitroanilide; BBI, BowmanBirk trypsin
inhibitor; PMSF, phenylmethylsulfonyl fluoride; TPCK, N-tosyl-L-
phenylalanine chloromethyl ketone; EDTA, ethylenediamine tetra-
acetic acid.Corresponding author. Present address: Department of Genetics,
University of Valencia, 46100 Burjassot, Spain. Tel.: +34 96 354 30 06;
fax: +3496 35430 29.
E-mail address: sherrero@uv.es (S. Herrero).
http://www.elsevier.com/locate/ibmbhttp://www.elsevier.com/locate/ibmb8/13/2019 02 Insect Biochemistry Molecular
4/137
instance those involved in polyphenol-oxidase activation
(Cerenius and Soderhall, 2004;Ji et al., 2004), or those
involved in dorsoventral patterning (Rose et al., 2003),
have a number of non-proteolytic protein modules
attached to their N-terminus, the SP genes isolated
from lepidopteran midgut do not contain such modules,
and have a relatively small size (i.e. less than 300 amino-acids) (Bown et al., 1997). Generally, the immature
protein (also called zymogen) contains a signal for its
secretion into the gut lumen and a pro-protein part
which keeps the protein in an inactive form until it is
cleaved off (Barrett et al., 2003).
The study of digestive proteinases in lepidoptera is
generally motivated by the fact that many lepidoptera
are severe agricultural pests and that their digestive
system is a suitable target for crop-protection strategies.
For instance, herbivory ofManduca sexta on tobacco
plants can be reduced by expressing a recombinant
potato proteinase inhibitor in the leaves (Johnson et al.,
1989). Proteinase inhibitors are also employed by the
natural defence of plants against insects (Zavala et al.,
2004). The inhibitors function by blocking the digestive
proteinases in the larval gut, thereby limiting the release
of amino acids from food protein. As a consequence, the
larvae are arrested in development and eventually die.
However, this strategy has not worked in all cases.
Polyphagous insects like Helicoverpa zea and Spodop-
tera exiguahave been shown to adapt to the presence of
proteinase inhibitors in their diet, by switching to the
production of proteinases that are resistant to plant
proteinase inhibitors (Jongsma et al., 1995;Mazumdar-
Leighton and Broadway, 2001b). Lepidopteran midgutSPs have also been studied in relation to their
interaction with the Cry toxins from the entomopatho-
genic bacterium Bacillus thuringiensis (Oppert, 1999).
Cry toxins accumulate in the bacteria in a protoxin form
which, upon ingestion by the insect, is converted into an
active form by action of the insects SP. In addition, SP
are also involved in the inactivation of such toxins by
degradation. Resistance to Cry toxins has been de-
scribed to be mediated both by down-regulation of
proteinase expression thereby decreasing the activation
of the protoxin (Oppert et al., 1997;Herrero et al., 2001)
as well as by up-regulation of SPs increasing toxininactivation (Forcada et al, 1996).
Despite their importance, not much is known about
the catalytic properties of individual midgut SPs from
lepidopteran insects. They have been studied following
two different approaches. In a biochemical approach,
the SPs have been purified from the midgut of the
insects, which allowed characterization of their activity
(Volpicella et al., 2003). By this approach, only the most
abundant proteins in the mixture have been identified
and characterized. In a genomic approach, sequences
from different proteinases have been obtained from
cDNA libraries (Bown et al., 1997) or by RT-PCR
techniques using conserved primers (Mazumdar-Leight-
on and Broadway, 2001a). This approach does consider
low abundant proteins, but no information on the
catalytic characteristics of these proteins has so far been
obtained due to the absence of a suitable expression
system.
In the current work, we studied a novel and lowabundant midgut proteinase from the beet armyworm,
S. exigua. The proteinase is characterized by sequence
comparison with related proteinases and detailed
analysis of recombinant expressed protein. A recombi-
nant baculovirus (Autographa californica multicapsid
nucleopolyhedrovirus, AcMNPV) containing a deletion
of the chitinase and cathepsin genes was employed for
the expression of a functional proteinase in insect cells.
Purified recombinant enzyme was characterized by its
ability to hydrolyze synthetic substrates, its kinetic
parameters and its susceptibility to different proteinase
inhibitors.
2. Material and methods
2.1. Proteinase substrates and inhibitors
Synthetic substratesNa-benzoyl-L-argininep-nitroanilide
(BApNA), N-succinyl-alanine-alanine-proline-phenylala-
nine p-nitroanilide (SAAPFpNA), N-succinyl-alanine-
alanine-proline-leucine p-nitroanilide (SAAPLrNA),
N-succinyl-alanine-alanine-alanine p-nitroanilide (SAA
ApNA) and pyroglutamyl-phenylalanine-leucine p-ni-
troanilide (EFLpNA) were purchased from Bachem AG(Bubendorf) and Sigma-Aldrich Chemie BV (Zwijn-
drecht). Proteinase inhibitors aprotinin, BowmanBirk
trypsin inhibitor (BBI), phenylmethylsulfonyl fluoride
(PMSF), N-tosyl-L-phenylalanine chloromethyl ketone
(TPCK), ethylenediamine tetra-acetic acid (EDTA) and
antipain were purchased from Sigma-Aldrich Chemie
BV (Zwijndrecht). Stock solutions were prepared
according the suppliers specifications.
2.2. Insect RNA isolation
S. exigualarvae were continuously reared on artificialdiet at 28 1C as described before (Smits and Vlak, 1988).
RNA was isolated at different instars from whole larvae,
from the larval midgut, the adult gut, hemocytes, and
eggs. Larval midguts were pulled from the larvae after
cutting off the hindbody between the last two pseudoleg
pairs. Next, midguts were cut longitudinally with
scissors and washed in phosphate-buffered physiological
saline to remove the gut contents. Adult guts were
obtained by longitudinally cutting of the abdomen.
Although attention was given to remove all non-gut
tissues during dissections, minor contamination could
not be ruled out. For hemocyte isolation hemolymph
ARTICLE IN PRESS
S. Herrero et al. / Insect Biochemistry and Molecular Biology 35 (2005) 107310821074
8/13/2019 02 Insect Biochemistry Molecular
5/137
was obtained from last instar larvae by a small incision
in the last pseudoleg. Hemolymph was collected and
mixed (1:1) with anticlotting solution (1.5 mM K2HPO4,
8 mM NaH2PO4, 1 mM CaCl2, 3 mM KCl, 0.5 mM
MgCl2, 0.3 mM NaCl) and the hemocytes were collected
by centrifugation for 5 min at 12,000g. Samples were
stored at 801
C until further use or used directly forRNA isolation. Samples for RNA isolation were homo-
genized or incubated (for hemocytes) in TripureTM
reagent (Roche, Mannheim) and RNA was subse-
quently isolated according to the protocol described by
the manufacturer.
2.3. Cloning of the SeCT34 gene
An expressed sequence tag (EST) with homology to
chymotrypsins was obtained from a suppression sub-
tractive hybridization (SSH) library from 5th instar
midgut of S. exigua. Library construction will bedescribed elsewhere (manuscript in preparation). The
EST fragment has a size of 270 nucleotides and covers
nucleotides 131400 in the final ORF of the SeCT34
gene. Both the 30 and 50 cDNA fragments were amplified
using the SMART RACE-kit (Clontech, Palo Alto).
cDNAs produced from reverse transcribed mRNA
isolated from midguts of 5th instar larvae ofS. exigua
were used to amplify 50 and 30 ends of the SeCT34 by a
nested PCR procedure. Primers for amplification were
designed based on the cDNA fragment obtained from
the subtractive library. For the 50-end the primers were
50-CCCATTGTGGATGCATGTGGTAGCCC-3 0 for
primary PCR and 5-ACCATCATCAGCTATGAAA
GAC-30 for the nested PCR. For the 30-end the primers
were 50-GCAGGCGGCTTATGTTGACTGCAGCC-3 0
and 50-TGGAACTCAGGAGGCACCATGG-3 0 for the
primary and nested PCR, respectively. Amplified
cDNA-ends were purified using a QIAquick PCR
purification kit (Qiagen Benelux B.V., Venlo) and
ligated into pGEM-T Easy (Promega Benelux B.V.,
Leiden). Several clones were sequenced for each frag-
ment and assembled using the Seqman program
(DNAstar package, DNASTAR Inc., Madison).
2.4. Sequence analysis
Comparison of the deduced amino acid sequence of
the SeCT34 gene and phylogenetic reconstructions were
performed using the ClustalX program (Thompson
et al., 1997). Phylogenetic reconstruction was obtained
by the neighbor-joining method (Saitou and Nei, 1987)
together with bootstrap analysis using 100 replicates.
Kimura correction for multiple substitutions was
applied (Kimura, 1983). When specific residues in the
sequence are referred to, the bovine chymotrypsin
numbering is used (Brown and Hartley 1966). Presence
of a signal peptide was predicted using Signal P program
(Nielsen et al., 1997).
In order to simplify the phylogenetic reconstruction, a
total of 15 insect protease sequences was deployed in the
final analysis, representing the branches for lepidopteran
trypsin and chymotrypsins known to be expressed in the
gut and dipteran chymotrypsins identified by BLASTsearch. Other insect proteinases families appeared to be
more distantly related (not shown), and were left out for
clarity.
2.5. Expression analysis by reverse transcription-
polymerase chain reaction (RT-PCR)
The mRNA abundance of SeCT34 in different tissues
and larval instars was estimated by RT-PCR. Total
RNA from the different samples was isolated using
TriPureTM
reagent. A total of 0.5 mg RNA was reverse
transcribed into cDNA using an oligo-dT primer and
SuperScriptTM II reverse transcriptase (Invitrogen,
Breda). A total of 5 ml of a 1:5 dilution of cDNA were
used for PCR amplification. PCRs were carried out for
35 cycles of 20 s at 94 1C, 15 s at 541C and 60 s at 72 1C.
The primers employed were 50-AGTCTTTCATAGCT
GATGATGG-30 (forward) and 50-CTCCCTTGTCAC
CAATACTG-30 (reverse). Ribosomal RNA was used as
a control for the RNA concentration in the samples.
2.6. Generation of recombinant baculovirus
The full length open reading frame (ORF) of SeCT34
was amplified from cDNA from the midgut of last instarlarvae by PCR using a forward primer adding a BamHI
restriction site (50-GAGGATCCGATTAAGTTTCTA
AATTCGAAAATGG-3 0) and a reverse primer contain-
ing the coding sequence for a polyhistidine tag, a stop
codon and a HindIII restriction site (50-GGAA
GCCTTAATGGTGATGGTGATGGTGGTCCTCAT
AGAGTGCCATGGTAGAC-3 0). The resulting frag-
ment was cloned in pGemT-easy and sequenced. The
BamHI-HindIII fragment was recloned in plasmid
pFBD-GFP (Kaba et al., 2002) downstream of the
AcMNPV polyhedrin (ph) promoter to generate the
pFBD-GFP-SeCT34 vector. This plasmid, also containsthe GFP protein downstream of the AcMNPV p10
promoter to facilitate screening and tritation in insect
cells. Plasmid pFBD-GFP was employed subsequently
as a negative control.
To generate recombinant baculoviruses, Escherichia
coli DH10BAC cells containing the AcMNPV DCC
bacmid (a recombinant bacmid from which thechitinase
and v-cathepsin genes were deleted (Kaba et al.,
2004)) and the pMON7124 helper plasmid (Luckow
et al., 1993) were transformed with pFBD-GFP
and pFBD-GFP-SeCT34 plasmids. Putative recombi-
nant AcMNPV bacmids were selected by white/blue
ARTICLE IN PRESS
S. Herrero et al. / Insect Biochemistry and Molecular Biology 35 (2005) 10731082 1075
8/13/2019 02 Insect Biochemistry Molecular
6/137
8/13/2019 02 Insect Biochemistry Molecular
7/137
Fig. 1. Multiple alignment of the predicted amino acid sequence for SeCT34 (AY820894) with bovine chymotrypsin (Bt:Bos taurus, P00766) and insec
Ae:Aedes aegypti,AF487334. Dm: Drosophila melanogaster,NP_732210. Si: Solenopsis invicta,1EQ9A. Ha:Helicoverpa armigera,CAA72950. BmCT:B
motives containing each of the catalytic triad residues are boxed. The black arrow on theN-terminal part indicates the predicted activation site, the gray
chymotrypsin.activity.
8/13/2019 02 Insect Biochemistry Molecular
8/137
which are universally conserved among SPs and
constitute the catalytic triad. The presence of a glycin
residue at position 189 has been found in insect
chymotrypsins, such as the fire ant (Solenopsis invicta)
chymotrypsin (Botos et al., 2000). Therefore, the
SeCT34 was putatively classified as a chymotrypsin-like
protein.The SeCT34 protein was aligned and compared with
representative SPs from different species (Fig. 1). Blast-
X analysis (Altschul et al., 1997) of SeCT34 against the
NCBI database did not show high homology to any
known lepidopteran SP. The highest homology was
found with a chymotrypsin from the cat flea, Ctenoce-
phalides felis and dipteran chymotrypsin-like proteins. A
blast search against the Bombyx mori Silkworm EST
database (Mita et al., 2003) revealed homology to a
cDNA fragment (mg0778), encoding a putative
chymotrypsin (BmCT0778 in this work). SeCT34 has
two insertions of approximately six amino acids relative
to bovine chymotrypsin, and to the dipteran chymo-
trypsins (Fig. 1). Insertions are also present in
BmCT0778 at these locations, although their size is
different. The regions around the catalytic-triad resi-
dues, which are conserved in most SPs (TAAHC
around His59, DIAL around Asp102), have also been
conserved in SeCT34. However, both SeCT34 and
BmCT0778 show a remarkable change in the conserved
GDSGGP region (around the catalytic Ser195) to
GDSGSA.
SeCT34 clearly forms a distinct group among the
lepidopteran SPs. This becomes obvious when the
protein is included in a phylogenetic tree with lepidop-teran trypsins and chymotrypsins known to be expressed
in the midgut (Fig. 2). These proteinases, presumab-
ly involved in digestion of dietary protein, are
only distantly related to SeCT34, whereas the dipteran
chymotrypsins that came out of the homology
analysis appeared to be more closely related to it.
Only the B. mori protein BmCT0778 is located at the
same branch of the tree; this branch remains sepa-
rate when all known insect SP are included in the tree
(Fig. 2).
3.2. Expression analysis of SeCT34
Expression of SeCT34 was examined by RT-PCR on
RNA from S. exigua eggs, neonates, 2nd, 3rd and 4th
instar larvae, early and late 5th instar larvae, in midgut
tissue from 4th, early 5th and late 5th instar larvae and
from mature insects, and in hemocytes from larvae 1 day
into their 5th instar (Fig. 3). Expression was detected
exclusively in the midgut of late 5th instar larvae. Under
the conditions employed, we did not detect SeCT34
expression when RNA from the whole late 5th instar
larvae was used as a template, probably as a result of the
dilution of midgut RNA in the total body RNA.
3.3. Heterologous expression and purification of SeCT34
SeCT34 protein was expressed in Sf21 insect cells,
using the baculovirus-insect cells expression system. For
this purpose the SeCT34 gene was fused to the
polyhedrin promoter, and to a C-terminal 6xHis-tag
encoding DNA. The expression of the recombinantSeCT34 (rSeCT34) protein was monitored by Western
blot analysis, using an antibody against the 6xHis tag.
At 48 h.p.i, rSeCT34 was detected in the medium as well
as in the cells (Fig. 4A). The rSeCT34 was purified from
the medium by 6xHis affinity chromatography, to a level
where less than 10% contaminant protein was detected
by silver-staining (Fig. 4B). Purified rSeCT34 protein
showed an estimated mobility of around 30 KDa, which
is close to the predicted molecular weight (29 KDa) of
the mature rSeCT34 protein on the basis of the gene
sequence, including the 6xHis-tag. The estimated yield
of purified rSeCT34 was around 100mg/l of medium.
ARTICLE IN PRESS
0.1
100
100
94
100
SeCT34
BmCT0778
96
98
9483
100
100
10065
99
AiT (L)
PiT (L)
MsT (L)
HzT (L)
HaT (L)
HvCT (L) HaCT (L) SfCT (L)
AeCT (L)
MsCT (L)
DsCT (D)
DmCT (D)
AaeCT (D)
AdCT (D)
AaCT (D)
Fig. 2. Unrooted phylogenetic tree derived from a ClustalX alignment
of selected insect trypsin and chymotrypsin-like proteins. Numbers on
the branches report the level of confidence as determined by bootstrap
analysis (100 bootstrap replicates). T in the name indicates trypsin and
CT indicates chymotrypsin. Letter in parenthesis indicates the insect
order L for lepidopera, D for diptera. The proteins used in the tree are:
AdCT: Anopheles darlingi, AAD17494. AeCT: Anopheles aquasalis,
AAD17492. AaeCT: Aedes aegypti AAL93243. DmCT: Drosophila
melanogaster, NP_732210, Dp: Drosophila pseudoobscura, EAL27112.
HzT: Helicoverpa zea, AAF74742. PiT: Plodia interpunctella,
AAF24226. AiT: Agrotis ipsilon,, AAF74752. MsT: Manduca sexta,
T10109. HaT: Helicoverpa armigera, CAA72962. HaCT: Helicoverpa
armigera, CAA72966. SfCT: Spodoptera frugiperda, AAO75039.
HvCT: Heliothis virescens, AAF43709. MsCT: Manduca sexta,
AAA58743. AiCT: Agrotis ipsilon, AAF71516. BmCT0778: Bombyxmori,mg-0778. The scale bar indicates an evolutionary distance of 0.1
amino acid substitutions per position in the sequence.
S. Herrero et al. / Insect Biochemistry and Molecular Biology 35 (2005) 107310821078
8/13/2019 02 Insect Biochemistry Molecular
9/137
3.4. Characterization of the recombinant SeCT34
(rSeCT34) activity
Chymotrypsins are known to cleave peptide bonds
behind Phe, Tyr, Trp and Leu residues (Barrett et al.,
2003). To determine the substrate preference of
rSeCT34, the enzyme was incubated with five different
synthetic substrates. Maximum activity was obtainedwith SAAPFpNA, while hydrolysis of SAAPLpNA was
low (5% of the activity obtained with SAAPFpNA).
Under the conditions employed, rSeCT34 was not able
to hydrolyze SAAApNA (an elastase substrate), BAp-
NA (a trypsin substrate) and EFLpNA (a thiol-
proteinase substrate).
The pH optimum of activity was analyzed by
measuring the hydrolysis of SAAPFpNA in a pH range
from 5 to 11 (Fig. 5). rSeCT34 was more active at basic
pH values, with a maximum activity at pH 11. We could
not test higher pH values, as the substrate appeared to
be unstable at pH411.
Kinetic parameters were obtained at two different pH
values. Under our assay conditions (i.e. in the presence
of BSA, which may compete as a substrate but stabilizes
the enzyme), the Km value for the hydrolysis of
SAAPFpNA was around 4-fold higher at pH 11
(Km 6.2 mM) than at pH 8 (Km 1.6 mM). Substrate
turnover at pH 11 (Kcat 1.8s1) was around 10-fold
higher than at pH 8 (Kcat 0.17 s1). Catalytic
efficiency values (Kcat/Km) were around 3-fold higher
at pH 11 than at pH 8. The observed 3-fold higher
catalytic efficiency at pH 11 is in agreement with the
differences previously found in the activity studies
performed at different pH range (Fig. 5).Since lepidopteran midgut proteinases are targets for
plant proteinase inhibitors, rSeCT34 was also charac-
terized with regard to its sensitivity to different
proteinase inhibitors. Proteinaceous inhibitors such as
aprotinin and BBI almost fully inhibited the activity of
the rSeCT34 proteinase at all the concentrations tested.
The most active inhibitor was aprotinin, which showed
values of 100% inhibition at the lowest concentration
tested. In contrast, synthetic inhibitors such as PMSF
and Antipain could only inhibit around 50% of the
activity at the highest concentrations tested. Inhibitors
as TPCK and EDTA hardly affected the activity ofrSeCT34 even at the highest concentrations tested
(Table 1).
4. Discussion
4.1. Recombinant expression of lepidopteran gut
proteinases
In this study, we describe the characterization and
funtional expression of SeCT34, a novel chymotrypsin
expressed in the midgut ofS. exigua.To our knowledge
ARTICLE IN PRESS
Fig. 3. RT-PCR of SeCT34 transcripts in different tissues and
development stages. rRNA refers to ribosomal RNA.
Fig. 4. Expression and purification of insect-cell expressed rSeCT34.
Panel A, detection of the 6xHis-tag from rSeCT34 by western analysis
in the medium and in the cell extract of Sf21 cells culture infected with
baculovirus expressing rSeCT34 (34) or infected with the control
baculovirus lacking rSeCT34 (C). Panel B, silver stained 12% SDS-
PAGE of rSeCT34 purified from the medium of cells infected with
baculovirus expressing rSeCT34 (34) or with a control baculovirus
lacking rSeCT34 (C). Crude, refers to crude protein extract loaded
onto the column and Pure, refers to the elution from the column of the
purified protein.
4 5 6 7 8 9 10 11 12
0
20
40
60
80
100
120
NaAc
Tris
Gly
pH
%r
elativeactivity
Fig. 5. Influence of pH on the activity of rSeCT34. Different buffers
were employed to cover the whole pH range as indicated by different
marks (see also Section 2).
S. Herrero et al. / Insect Biochemistry and Molecular Biology 35 (2005) 10731082 1079
8/13/2019 02 Insect Biochemistry Molecular
10/137
this is the first report of the functional expression of a
recombinant midgut serine proteinase from insects,
despite the availability of many SP sequences from a
broad range of insect species. Sf21 cells, in which
rSeCT34 was expressed, are derived from S. frugiperda,
a lepidopteran species closely related to S. exigua Thus,
the applied recombinant protein expression system isclosely related to the insect species where SeCT34 was
isolated from. Another contribution to the successful
expression of rSeCT34 was possibly made by the use of
an improved baculovirus expression vector, from which
the viralcathepsinandchitinasegenes had been removed
(Kaba et al., 2004). V-cathepsin is a cysteine proteinase
involved, in conjunction with the chitinase, in liquefac-
tion of the insect host cell at the end of the baculovirus
infection (Hawtin et al., 1997). Production and stability
of recombinant proteins has been described to be
enhanced when both genes had been eliminated (Kaba
et al., 2004; Berger et al., 2004). Therefore the system
used here may well be applicable to other lepidopteran
midgut SPs, though still some may proof difficult to
express without damage to the expression system.
However, in the case of SeCT34 we have not observed
any indications of such damage.
4.2. Features of SeCT34
SeCT34 is a representative of a novel subgroup of
lepidopteran chymotrypsins, which map in a distinct
branch of the lepidoptera SP phylogenetic tree (Fig. 2).
Characteristic for this sub-group seems to be the
substitution of GP-SA in the highly conservedGDSGGP domain around the catalytic Ser195 residue.
These substitution occur in both SeCT34 and its
homologue in B. mori(BmCT0778). Some variation is
known to exist at these residues in the SP family fromD.
melanogaster(Ross et al., 2003). Out of 148 members of
the SP family, 11 are different in either of these two
residues. Out of 6 members where the Gly197 position is
different, 4 have the change Gly-Ser. Similarly,
sequence analysis of human SP (subfamily S1A)
revealed that only two out of 79 proteins had changed
the Gly197 residue, both of them Gly-Ser, and from
the four members where Pro198 is different, three ofthem have Pro-Ala (Yousef et al., 2004). These
observations suggest that the GP-SA substitution is
typical for the SeCT34 subgroup and is one of the very
rare variations allowed at this position that still yields a
functional protein. It is likely that phylogenetic compar-
ison of the SPs from other insect orders reveals the
presence of this sub-group in other orders. In the crystal
structure of bovine chymotrypsin and fire ant chymo-
trypsin (Hynes et al., 1990; Botos et al., 2000) the
Gly197 residue (Ser in SeCT34) localizes adjacent to the
catalytic triad His57, Asp102, and Ser195, though it is
not in direct contact with the substrate. This suggests
that Gly197 may have a possible role in positioning of
the catalytic triad relative to the substrate, rather than in
positioning the substrate relative to the enzyme.
The rSeCT34 is a true chymotrypsin, as can be
deduced from its ability to hydrolyze SAAPFpNA.
However, in contrast to most vertebrate chymotrypsins
(Barrett et al., 2003) and invertebrate chymotrypsins(Lee and Anstee, 1995;Valaitis, 1995), which hydrolyze
SAAPLpNA with similar efficiency, rSeCT34 does not
digest the substrate having Leu at the P1 position very
well. This suggests that SeCT34 may have a specific
function, rather than being involved in general digestion
of dietary protein.
The activation site of SeCT34 is atypical. Most
proteinases that are expressed in the gut, both in man
and in insects, are activated by a trypsin-like activity,
which acts on an Arg residue at position 15 (bovine
chymotrypsin numbering) (Brown and Hartley, 1966).
This holds true for trypsins, carboxypeptidases and
chymotrypsins. SeCT34 is an exception to this rule, as it
carries a Phe in this position, suggesting that it is
activated by chymotrypsin rather than by a trypsin. Our
activity assays showed chymotrypsin activity for
SeCT34 without the need of pre-incubation with trypsin,
and the migration of rSeCT34 as a single band. This
suggests that the proteinase activates itself.
4.3. Physiological role of SeCT34
The role of SeCT34 in the midgut ofS. exiguaremains
unclear. The pH optimum of the recombinant enzyme
(at pH411) is very similar to that of the total gutproteinase activity (Jongsma et al., 1996). This suggests
that it functions in a similar environment as the
proteinases involved in digestion of dietary protein, i.e.
the gut lumen. This is further supported by our
observation that both SeCT34 and the total gut
proteolytic activity of S. exigua are relatively sensitive
to proteinaceous inhibitors such as BBI and aprotinin
(Table 1;Jongsma et al., 1996).
The possible role of SeCT34 in insect gut physiology
can be inferred from the timing of its expression. The
SeCT34-encoding transcript could exclusively be de-
tected in the fifth instar insect, just prior to pupation. Togain further support for this apparent restricted expres-
sion of SeCT34, expression data for the B. mori
homologue, BmCT0778, available on the Internet were
searched (http://kaikocdna.dna.affrc.go.jp/page_pub.
html). BmCT0778 has only been identified in the
mg-B. mori cDNA library, which was obtained from
the midgut of larvae four days after molting to 5th
instar. No similar fragment has been found in 39 other
cDNA libraries obtained from different tissues and
developmental instars. Thus, both SeCT34 and
BmCT0778 seem to be exclusively expressed during the
transition from 5th instar larvae to pupae. Specific
ARTICLE IN PRESS
S. Herrero et al. / Insect Biochemistry and Molecular Biology 35 (2005) 107310821080
http://kaikocdna.dna.affrc.go.jp/page_pub.htmlhttp://kaikocdna.dna.affrc.go.jp/page_pub.htmlhttp://kaikocdna.dna.affrc.go.jp/page_pub.htmlhttp://kaikocdna.dna.affrc.go.jp/page_pub.html8/13/2019 02 Insect Biochemistry Molecular
11/137
proteolytic events occur during this period, when the
midgut epithelium is replaced completely and the
material is recycled by the action of digestive proteinases
(Uwo et al., 2002). Expression levels of SeCT34 were
low in comparison with levels of other midgut protei-
nase genes (data not shown). The precise tuning of its
expression, its auto-activation and its relatively narrowsubstrate specificity could mean that SeCT34 is involved
in the activation of other proteinases, which are
involved in midgut remodeling upon pupation. Knock-
out experiments should be carried out to confirm the
role of SeCT34 in this process. Although the specific role
of SeCT34 remains unclear, the functional expression of
SeCT34 in the baculovirus-insect cell system opens a
wide range of possibilities for the study of insect SPs.
Mutational studies could be applied to determine the
role of the different residues in the interaction with plant
proteinase inhibitors or in substrate specificity. Most
significantly, we have demonstrated that the baculovirus
system is capable of expressing a lepidopteran midgut
SP, and this system should be tested with other
lepidopteran SP genes relevant to digestion of dietary
protein.
Acknowledgments
S. Herrero was supported by a Marie Curie fellowship
contract No. HPMF-CT-2002-01994 from the EU. R.
de Maagd was supported by Program subsidy 347 of the
Dutch Ministry of Agriculture, Nature Management
and Fisheries.
References
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z.,
Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST:
a new generation of protein database search programs. Nucl. Acids
Res. 25, 33893402.
Barrett, A.J., Rawlings, N.D., Woessner, J.F., 2003. Handbook of
Proteolytic Enzymes. Academic Press, New York.
Berger, I., Fitzgerald, D.J., Richmond, T.J., 2004. Baculovirus
expression system for heterologous multiprotein complexes. Nat.
Biotechnol. 22, 15831587.
Botos, I., Meyer, E., Nguyen, M., Swanson, S.M., Koomen, J.M.,2000. The structure of an insect chymotrypsin. J. Mol. Biol. 298,
895901.
Bown, D.P., Wilkinson, H.S., Gatehouse, J.A., 1997. Differentially
regulated inhibitor-sensitive and insensitive protease genes from the
phytophagous insect pest, Helicoverpa armigera, are members of
complex multigene families. Insect Biochem. Mol. Biol. 27,
625638.
Brown, J.R., Hartley, B.S., 1966. Location of disulphide bridges by
diagonal paper electrophoresis. The disulphide bridges of bovine
chymotrypsinogen A. Biochem. J. 101, 214228.
Cerenius, L., Soderhall, K., 2004. The prophenoloxidase-activating
system in invertebrates. Immunol. Rev. 198, 116126.
Forcada, C., Alcacer, E., Garcera, M.D., Martinez, R., 1996.
Differences in the midgut proteolytic activity of two Heliothis
virescens strains, one susceptible and one resistant to Bacillus
thuringiensis toxins. Arch. Insect Biochem. Physiol. 31, 257272.
Hawtin, R.E., Zarkowska, T., Arnold, K., Thomas, C.J., Gooday,
G.W., King, L.A., Kuzio, J.A., Possee, R.D., 1997. Liquefaction of
Autographa californica nucleopolyhedrovirus-infected insects is
dependent on the integrity of virus-encoded chitinaseandcathepsin
genes. Virology 238, 243253.
Herrero, S., Oppert, B., Ferre, J., 2001. Different mechanisms ofresistance toBacillus thuringiensistoxins in the Indianmeal Moth.
Appl. Environ. Microbiol. 67, 10851089.
Hynes, T.R., Randal, M., Kennedy, L.A., Eigenbrot, C., Kossiakoff,
A.A., 1990. X-ray crystal structure of the protease inhibitor
domain of Alzheimers amyloid beta-protein precursor. Biochem-
istry 29, 1001810022.
Ji, C., Wang, Y., Guo, X., Hartson, S., Jiang, H., 2004. A pattern
recognition serine proteinase triggers the prophenoloxidase activa-
tion cascade in the tobacco hornworm, Manduca sexta. J. Biol.
Chem. 279, 3410134106.
Johnson, R., Narvaez, J., An, G., Ryan, C., 1989. Expression of
proteinase inhibitors I and II in transgenic tobacco plants: effects
on natural defense againstManduca sextalarvae. Proc. Natl. Acad.
Sci. USA 86, 98719875.
Jongsma, M.A., Bakker, P.L., Peters, J., Bosch, D., Stiekema, W.J.,1995. Adaptation ofSpodoptera exigua larvae to plant proteinase
inhibitors by induction of gut proteinase activity insensitive to
inhibition. Proc. Natl. Acad. Sci. USA 92, 80418045.
Jongsma, M.A., Peters, J., Stiekema, W.J., Bosch, D., 1996.
Characterization and partial purification of gut proteinases of
Spodoptera exigua Hubner (Lepidoptera: Noctuidae). Insect
Biochem. Mol. Biol. 26, 185193.
Kaba, S.A., Nene, V., Musoke, A.J., Vlak, J.M., van Oers, M.M.,
2002. Fusion to green fluorescent protein improves expression
levels ofTheileria parva sporozoite surface antigen p67 in insect
cells. Parasitology 125, 497505.
Kaba, S.A., Salcedo, A.M., Wafula, P.O., Vlak, J.M., van Oers, M.M.,
2004. Development of a chitinase and v-cathepsin negative bacmid
for improved integrity of secreted recombinant proteins. J. Virol.
Methods 122, 113118.
Kimura, M., 1983. The Neutral Theory of Molecular Evolution.
Cambridge, England.
King, L.A., Possee, R.D., 1992. The Baculovirus Expression System: A
Laboratory Guide. Chapman & Hall, London.
Lee, M.J., Anstee, J.H., 1995. Endoproteases from the midgut of larval
Spodoptera littoralis include a chymotrypsin-like enzyme with an
extended binding-site. Insect Biochem. Mol. Biol. 25, 4961.
Luckow, V.A., Lee, S.C., Barry, G.F., Olins, P.O., 1993. Effi-
cient generation of infectious recombinant baculoviruses by site-
specific transposon-mediated insertion of foreign genes into a
baculovirus genome propagated in Escherichia coli. J. Virol. 67,
45664579.
Mazumdar-Leighton, S., Broadway, R.M., 2001a. Identification of six
chymotrypsin cDNAs from larval midguts ofHelicoverpa zea andAgrotis ipsilon feeding on the soybean (Kunitz) trypsin inhibitor.
Insect Biochem. Mol. Biol. 31, 633644.
Mazumdar-Leighton, S., Broadway, R.M., 2001b. Transcriptional
induction of diverse midgut trypsins in larval Agrotis ipsilon and
Helicoverpa zea feeding on the soybean trypsin inhibitor. Insect
Biochem. Mol. Biol. 31, 645657.
Mita, K., Morimyo, M., Okano, K., Koike, Y., Nohata, J., Kawasaki,
H., Kadono-Okuda, K., Yamamoto, K., Suzuki, M.G., Shimada,
T., Goldsmith, M.R., Maeda, S., 2003. The construction of an EST
database for Bombyx mori and its application. Proc. Natl. Acad.
Sci. USA 100, 1412114126.
Nielsen, H., Engelbrecht, J., Brunak, S., von Heijne, G., 1997.
Identification of prokaryotic and eukaryotic signal peptides and
prediction of their cleavage sites. Protein Eng. 10, 16.
ARTICLE IN PRESS
S. Herrero et al. / Insect Biochemistry and Molecular Biology 35 (2005) 10731082 1081
8/13/2019 02 Insect Biochemistry Molecular
12/137
Oppert, B., 1999. Protease interactions with Bacillus thuringiensis
insecticidal toxins. Arch. Insect Biochem. Physiol. 42, 112.
Oppert, B., Kramer, K.J., Beeman, R.W., Johnson, D., McGaughey,
W.H., 1997. Proteinase-mediated insect resistance to Bacillus
thuringiensis toxins. J. Biol. Chem. 272, 2347323476.
Rose, T., LeMosy, E.K., Cantwell, A.M., Banerjee-Roy, D., Skeath,
J.B., Di Cera, E., 2003. Three-dimensional models of proteases
involved in patterning of the Drosophila embryo. Crucial role ofpredicted cation binding sites. J. Biol. Chem. 278, 1132011330.
Ross, J., Jiang, H., Kanost, M.R., Wang, Y., 2003. Serine proteases
and their homologs in the Drosophila melanogaster genome: an
initial analysis of sequence conservation and phylogenetic relation-
ships. Gene 304, 117131.
Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method
for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406425.
Smits, P.H., Vlak, J.M., 1988. Quantitative and qualitative aspects in
the production of a nuclear Polyhedrosis-virus in Spodoptera
exigua larvae. Ann. Appl. Biol. 112, 249257.
Southan, C., 2001. A genomic perspective on human proteases as drug
targets. Drug Discov. Today 6, 681688.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins,
D.G., 1997. The CLUSTAL_X windows interface: flexible
strategies for multiple sequence alignment aided by quality analysistools. Nucl. Acids Res. 25, 48764882.
Uwo, M.F., Ui-Tei, K., Park, P., Takeda, M., 2002. Replace-
ment of midgut epithelium in the greater wax moth, Galleria
mellonela, during larval-pupal moult. Cell Tissue Res. 308,
319331.
Valaitis, A.P., 1995. Gypsy moth midgut proteinases: purification and
characterization of luminal trypsin, elastase and the brush border
membrane leucine aminopeptidase. Insect Biochem. Mol. Biol. 25,
139149.Vaughn, J.L., Goodwin, R.H., Tompkins, G.J., McCawley, P.,
1977. The establishment of two cell lines from the insect
Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro 13,
213217.
Volpicella, M., Ceci, L.R., Cordewener, J., America, T., Gallerani, R.,
Bode, W., Jongsma, M.A., Beekwilder, J., 2003. Properties of
purified gut trypsin from Helicoverpa zea, adapted to proteinase
inhibitors. Eur. J. Biochem. 270, 1019.
Yousef, G.M., Elliott, M.B., Kopolovic, A.D., Serry, E., Diamandis,
E.P., 2004. Sequence and evolutionary analysis of the human
trypsin subfamily of serine peptidases. Biochim. Biophys. Acta
1698, 7786.
Zavala, J.A., Patankar, A.G., Gase, K., Hui, D., Baldwin, I.T., 2004.
Manipulation of endogenous trypsin proteinase inhibitor produc-
tion in Nicotiana attenuata demonstrates their function asantiherbivore defenses. Plant Physiol. 134, 11811190.
ARTICLE IN PRESS
S. Herrero et al. / Insect Biochemistry and Molecular Biology 35 (2005) 107310821082
8/13/2019 02 Insect Biochemistry Molecular
13/137
InsectBiochemistry
andMolecularBiology
Insect Biochemistry and Molecular Biology 35 (2005) 10831099
Acquisition, transformation and maintenance of plant pyrrolizidine
alkaloids by the polyphagous arctiid Grammia geneura
T. Hartmanna,, C. Theuringa, T. Beuerlea, E.A. Bernaysb, M.S. Singerc
aInstitut fur Pharmazeutische Biologie der Technischen Universitat Braunschweig, Mendelssohnstrasse 1, D-38106 Braunschweig, GermanybDepartment of Entomology, University of Arizona, P.O. Box 210088, Tucson, AZ 85721-0088, USA
cDepartment of Biology, Wesleyan University, Hall-Atwater Labs, Rm. 259, Middletown, CT 06459, USA
Received 9 March 2005; accepted 6 May 2005
Abstract
The polyphagous arctiidGrammia geneuraappears well adapted to utilize for its protection plant pyrrolizidine alkaloids of almost
all known structural types. Plant-acquired alkaloids that are maintained through all life-stages include various classes of macrocyclic
diesters (typically occurring in the Asteraceae tribe Senecioneae and Fabaceae), macrocyclic triesters (Apocynaceae) and open-chain
esters of the lycopsamine type (Asteraceae tribe Eupatorieae, Boraginaceae and Apocynaceae). As in other arctiids, all sequestered
and processed pyrrolizidine alkaloids are maintained as non-toxic N-oxides. The only type of pyrrolizidine alkaloids that is neither
sequestered nor metabolized are the pro-toxic otonecine-derivatives, e.g. the senecionine analog senkirkine that cannot be detoxified
by N-oxidation. In its sequestration behavior, G. geneura resembles the previously studied highly polyphagous Estigmene acrea.
Both arctiids are adapted to exploit pyrrolizidine alkaloid-containing plants as drug sources. However, unlike E. acrea,G. geneura
is not known to synthesize the pyrrolizidine-derived male courtship pheromone, hydroxydanaidal, and differs distinctly in its
metabolic processing of the plant-acquired alkaloids. Necine bases obtained from plant acquired pyrrolizidine alkaloids are re-
esterified yielding two distinct classes of insect-specific ester alkaloids, the creatonotines, also present in E. acrea, and the
callimorphines, missing in E. acrea. The creatonotines are preferentially found in pupae; in adults they are largely replaced by thecallimorphines. Before eclosion the creatonotines are apparently converted into the callimorphines by trans-esterification. Open-
chain ester alkaloids such as the platynecine ester sarracine and the orchid alkaloid phalaenopsine, that do not possess the unique
necic acid moiety of the lycopsamine type, are sequestered by larvae but they need to be converted into the respective creatonotines
and callimorphines by trans-esterification in order to be transferred to the adult stage. In the case of the orchid alkaloids, evidence is
presented that during this processing the necine base (trachelanthamidine) is converted into its 7-(R)-hydroxy derivative
(turneforcidine), indicating the ability ofG. geneura to introduce a hydroxyl group at C-7 of a necine base. The creatonotines and
callimorphines display a striking similarity to plant necine monoesters of the lycopsamine type to which G. geneurais well adapted.
The possible function of insect-specific trans-esterification in the acquisition of necine bases derived from plant acquired alkaloids,
especially from those that cannot be maintained through all life-stages, is discussed.
r 2005 Elsevier Ltd. All rights reserved.
Keywords: Grammia geneura (Lepidoptera; Arctiidae); Alkaloid sequestration; Alkaloid processing; Pyrrolizidine alkaloids; Insect alkaloids;
Creatonotines; Callimorphines; Chemical defense
1. Introduction
Among insects that sequester plant pyrrolizidine
alkaloids and utilize them for their own chemical defense,
the tiger moths (Lepidotpera: Arctiidae) represent an
impressive example. The ability to sequester pyrrolizidine
alkaloids from the larval diet is most parsimoniously
ARTICLE IN PRESS
www.elsevier.com/locate/ibmb
0965-1748/$- see front matter r 2005 Elsevier Ltd. All rights reserved.
doi:10.1016/j.ibmb.2005.05.011
Corresponding author. Tel.: +49 5313 915681;
fax: +49 5313 918104.
E-mail address: t.hartmann@tu-bs.de (T. Hartmann).
http://www.elsevier.com/locate/ibmbhttp://www.elsevier.com/locate/ibmb8/13/2019 02 Insect Biochemistry Molecular
14/137
inferred to have arisen at the ancestral node of the
subfamily Arctiinae (Weller et al., 1999; Conner and
Weller, 2004). Subsequent loss of alkaloid-use within the
Arctiinae appears to have occurred multiple times as have
switches from larval to adult alkaloid feeding.
The success of pyrrolizidine alkaloids as plant-
acquired defense compounds in various insect speciesis attributed to a unique propertyan ability to exist in
two interchangeable forms: the pro-toxic free base
(tertiary amine) and its non-toxic N-oxide (Hartmann,
1999;Hartmann and Ober, 2000). All adapted insects so
far studied that recruit pyrrolizidine alkaloids from their
plant hosts have evolved strategies to avoid accumula-
tion of detrimental concentrations of the free bases in
metabolically active tissues. Pyrrolizidine alkaloid-
sequestering Arctiinae maintain the plant-acquired
alkaloids in the state of their N-oxides. They possess a
specific enzyme (senecionine N-oxygenase) localized in
the hemolymph that efficiently converts any pro-toxic
free base into its non-toxic N-oxide (Lindigkeit et al.,
1997; Naumann et al., 2002). The acquisition of this
enzyme in ancestral Arctiinae appears to be a mechan-
istic prerequisite for pyrrolizidine alkaloid sequestra-
tion. A second mechanistic requirement for pyrrolizidine
alkaloid sequestration is the ability to recognize the
alkaloids or alkaloid-sources. It has long been known
that pyrrolizidine alkaloids are larval feeding stimulants
(Boppre , 1986;Schneider, 1987) but only recently arctiid
caterpillars have been shown to possess single sensory
neurons in both the lateral and medial styloconic sensilla
of the galeae that respond specifically and sensitively
(threshold of response 1012
109
M) to a variety ofpyrrolizidine alkaloids (Bernays et al., 2002a, b).
Among Arctiinae that are adapted to recognize, recruit
and detoxify pyrrolizidine alkaloids from their larval diets
at least three distinctive strategies exist: (i) monophagous
species that as larvae utilize specific host-plants as both
nutrient and alkaloid source, e.g. Tyria jacobaeae, feeding
on Senecio jacobaea (Asteraceae) or Utetheisa ornatrix
feeding onCrotalaria(Fabaceae); (ii) polyphagous species,
e.g. Creatonotos transiens, Estigmene acrea, or Grammia
geneura, that as larvae feed on a variety of different plant
species including the local range of pyrrolizidine alkaloid-
containing species; (iii) Among both types there are somespecies like U. ornatrix, C. transiens or E. acrea that
possess androconial organs (coremata) in which they
produce and emit the pyrrolizidine alkaloid-derived male
courtship pheromone, hydroxydanaidal, while others like
T. jacobaeaeandG. geneurado not possess coremata and
are not known to produce hydroxydanidal. These
differences may greatly affect the individual strategies to
deal with pyrrolizidine alkaloids. The pyrrolizidine alka-
loid specialist just needs to be adapted to the type of
alkaloids present in its host plant while polyphagous
species are opportunistically able to utilize a variety of
plant pyrrolizidine alkaloids from different sources and to
maintain them in the non-toxic state. In fact, we previously
showed that E. acrea is able to sequester, detoxify and
process pyrrolizidine alkaloids of almost any known
structural type with one exception: otonecine derivatives
(e.g. senkirkine) that cannot be detoxified by N-oxidation
(Hartmann et al., 2005). Senkirkine is neither sequestered
nor metabolized but tolerated. Moreover, E. acrea is ableto convert all kinds of retronecine and heliotridine esters
into insect-specific retronecine esters, the creatonotines,
which appear to be the common precursor for the
formation of the male pyrrolizidine alkaloid-signal hydro-
xydanaidal (Hartmann et al., 2003a, 2004b). The role of
hydroxydanaidal as a male alkaloid signal emitted from
scent brushes (coremata) has been most completely
elucidated by Thomas Eisner and his colleagues with U.
ornatrix (Eisner et al., 2002). During close-range pre-
copulatory behavior, males use the pheromone to signal
the females the amount of their pyrrolizidine alkaloid
load. Females can differentiate between males that contain
different quantities of hydroxydanaidal and appear to
favor males having higher levels (Conner et al., 1990;
Dussourd et al., 1991). At mating the male transmits a
portion of his alkaloids to the female during insemination.
At oviposition these alkaloids together with the females
own load are transmitted to the eggs (Dussourd et al.,
1988; Iyengar et al., 2001). E. acrea shows a similar
pheromone-affected mating behavior (Davenport and
Conner, 2003; Jordan et al., 2005) and male-to-female-
to-eggs alkaloid transfer (Hartmann et al., 2004a).
Like E. acrea, G. geneura inhabits arid savanna and
grasslands of the southwestern USA. In this paper we
show that this arctiid, like E. acrea, is well adapted toexploit almost any naturally occurring pyrrolizidine
alkaloid containing plant as a drug source. To a great
extent the two arctiids show similar mechanisms of
alkaloid sequestration and processing but also display
distinct differences. Although G. geneura is not known
to synthesize pyrrolizidine-derived pheromones, insect-
specific pyrrolizidine alkaloids play an important role,
but the creatonotines, typical of E. acrea, are largely
replaced by the callimorphines. Our results show a
striking structural similarity of creatonotines and
callimorphines with plant monoesters of the lycopsa-
mine type that are maintained through all life-stages.We therefore hypothesize that a fundamental function
of the insect-specific necine esters is to sustain the
transfer of pro-toxic pyrrolizidine alkaloid across
different life-stages of the insect.
2. Materials and Methods
2.1. Insects
Caterpillars (penultimate or final instar larvae) ofG.
geneura(Strecker) were collected from a field population
ARTICLE IN PRESS
T. Hartmann et al. / Insect Biochemistry and Molecular Biology 35 (2005) 108310991084
8/13/2019 02 Insect Biochemistry Molecular
15/137
where Senecio longilobus Benth. and Plagiobothrys
arizonicus (A.Gray) Greene ex A. Gray were the only
abundant alkaloid containing host plants. Caterpillar
cultures were reared on a wheat-germ-based artificial
diet (Yamamoto, 1969). Larvae were raised individually
in 200-ml plastic cups containing a small cube of plain
diet (alkaloid-free) that was replaced daily. Fifth instarlarvae received a cube of diet (approximately
10mm 10 mm) containing approximately 1 mg of test
alkaloid(s) for 24 h in place of the plain diet. In most
cases the alkaloid meal was completely consumed within
24 h. Afterwards larvae were allowed to complete
development on the plain diet. Some larvae and pupae
(within 48 h after the start of pupation) were frozen for
alkaloid analysis. Pupae retained for obtaining adults
were sexed and individually kept in 200-ml cups. All
samples were preserved within 24 h of eclosion by
freezing. Samples allotted to alkaloid analysis were
lyophilized and kept in closed vials until analysis.
2.2. Exuviae from field collected caterpillars of G.
geneura
In spring 2002, caterpillars from several field sites
were opportunistically collected during one of the final
three larval stages (Table 8). In most cases, any G.
geneuracaterpillar found was collected. On one occasion
(Table 8, C), the collected individuals were chosen
haphazardly. These caterpillars were taken to the
laboratory and kept individually in 200-ml plastic cups
containing plain diet, as described above. The exuviae
molted from the stage of collection were saved inEppendorf tubes and stored at ambient laboratory
conditions. These exuviae were expected to contain
any pyrrolizidine alkaloids sequestered from host plants
eaten in nature.
2.3. Origin and preparation of pure pyrrolizidine
alkaloids and alkaloid mixtures
Pure pyrrolizidine alkaloids were prepared or ob-
tained as follows: retronecine by hydrolysis of mono-
crotaline (Carl Roth, Karlsruhe, Germany), heliotridine
by hydrolysis of heliotrine, sarracine (containing 5%sarracinine) was isolated from Senecio silvaticus (Witte
et al., 1990), senkirkine (containing 3% retronecine
esters) was isolated from flower heads ofSenecio vernalis
(Hartmann and Zimmer, 1986).
Purified alkaloid extracts were prepared from the
following plant sources: pyrrolizidine alkaloids of the
senecionine type: field-grownSenecio congestus(shoots),
field-grown S. jacobaea (flower heads), field-grown S.
vernalis (flower heads after removal of senkirkine);
pyrrolizidine alkaloids of the lycopsamine type: field-
grown Eupatorium cannabinum (inflorescences), green-
house-grown Heliotropium indicum (inflorescences);
pyrrolizidine alkaloids of the parsonsine type: in vitro-
grown plantlets ofParsonsia laevigata(Hartmann et al.,
2003b); pyrrolizidine alkaloids of the phalaenopsine
type (orchid alkaloids): commercially available Phalae-
nopsis hybrids (flowers). The alkaloid extracts were
purified as follows: methanolic or aqueous acidic plant
extracts were evaporated, the residue dissolved in1 M H2SO4 and incubated with an excess Zn dust for
5 h to reduce the pyrrolizidine alkaloidN-oxides. Then
the solution was extracted three times with ethyl ether,
the organic phase was discarded and the aqueous
solution made basic (pH 11) with ammonia and
extracted three times with ethyl ether. The solvent was
evaporated and the residue saved and directly applied in
the feeding experiments.
The identity and purity of the individual pyrrolizidine
alkaloids was confirmed by gas chromatography
(GC)MS basing on their retention indices (RI),
molecular ions and mass fragmentation patterns in
comparison to reference compounds and our compre-
hensive data base. The quantitative composition of
alkaloid mixtures and total alkaloid contents were
determined by quantitative GC (Witte et al., 1993).
2.4. Alkaloid analysis
Single freeze-dried insects (larvae, pupae, adults) were
weighed and then ground in 0.22 ml 1 M HCl in a mortar,
extracted for 23 h and then centrifuged. The pellet was
dissolved in a small volume of HCl and again extracted.
The combined supernatants were extracted with 2 ml
dichloromethane, the aqueous phase was recovered, mixedwith excess of Zn dust and stirred for 3 h at room
temperature for complete reduction of the pyrrolizidine
alkaloid N-oxides. Then the mixture was made basic with
25% ammonia and applied to an Extrelut (Merck) column
(size adapted to 1.4ml solution/g Extrelut). Pyrrolizidine
alkaloids (free bases) were eluted with dichloromethane
(6 ml/g Extrelut). The solvent was evaporated, and the
residue dissolved in 10100ml methanol prior to GC or
GCMS. Routine GC was performed as described
previously (Witte et al., 1993; Hartmann et al., 2004b).
Quantitative analyses were performed via the FID signals
with heliotrine or monocrotaline as internal standards.The GCMS data were obtained with a Hewlett
Packard 5890A gas chromatograph equipped with a
30 m 0:32 mm analytical column (ZB1, Phenomenex).
The capillary column was directly coupled to a triple
quadrupole mass spectrometer (TSQ 700, Finnigan).
The conditions applied were: Injector and transfer line
were set at 250 1C; the ion source temperature was
150 1C; the temperature program used was: 100 1C
(3 min)-310 1C at 6 1C/min. The injection volume was
1 ml. The split ratio was 1:20, the carrier gas flow was
1.6 mlmin1 He, and the mass spectra were recorded at
70 eV. CI mass spectra were recorded in the positive
ARTICLE IN PRESS
T. Hartmann et al. / Insect Biochemistry and Molecular Biology 35 (2005) 10831099 1085
8/13/2019 02 Insect Biochemistry Molecular
16/137
mode with the same GCMS system using ammonia as a
reagent gas; Ion source temperature was 1301C.
2.5. Identification of insect alkaloids
The creatonotines and isocreatonotines A and B and
the three callimorphines, i.e. callimorphine, homocalli-morphine and deacetylcallimorphine were identified by
their characteristic RIs, molecular ions and mass
fragmentation patterns as described elsewhere (Hart-
mann et al., 2004b).
Callimorphine analogs like the 1,2-dihydrocallimor-
phines and 7-deoxy-1,2-dihydrocallimorphines were
tentatively identified by GCMS and the structures
subsequently confirmed by analysis of necine bases
obtained after hydrolysis. For hydrolysis of callimor-
phine analogs containing 1,2-unsaturated necine bases
purified extracts were kept in 15% ammonia for 2 days
at room temperature. Subsequently the samples were
dried, directly dissolved in N-Methyl-N-(trimethylsilyl)-
trifluoro-acetamid (MSTFA) (Fluka) and heated to
75 1C. After 30 min the necine bases (i.e. platynecine,
turneforcidine, trachelanthamidine, isoretronecanol)
were analyzed by GCMS and identified by their RI-
values and mass fragmentation patterns (see data below)
in comparison to reference compounds.
The identity of 7-(S)-callimorphines (heliotridine es-
ters) was deduced as follows: (i) they showed the same
molecular ions and mass fragmentation patterns as the
respective R-configurated callimorphines (retronecine
esters) but differed in their RIs (Table 7); (ii) they were
only detected in feeding experiments with heliotridine;(iii) hydrolysis of the respective alkaloid extracts (in 10%
NaOH at 100 1C for 2h) revealed a mixture of
heliotridine and retronecine that were identified by their
characteristic RI-values (Table 7) and identical fragmen-
tation pattern in comparison to reference compounds.
GCMS properties of the novel callimorphine analogs:
(1S)-1,2-Dihdrocallimorphine (necine base: platyneci-
ne)(Fig. 3B): RI 2016; GC-EIMS, m/z (rel. int.): 299
([M]+, 11), 255 (32), 140 (18), 138 (7), 96 (16), 95 (10 0),
82 (78), 73 (8), 55 (10), 43(17).
(1R)-1,2-Dihdrocallimorphine (necine base: turnefor-
cidine)(Fig. 3B): RI 1975; GC-EIMS, m/z (rel. int.): 299([M]+, 11), 255 (32), 140 (18), 138 (7), 96 (16), 95 (10 0),
82 (78), 73 (8), 55 (10), 43(17).
(1S)-1,2-Dihydrohomocallimorphine (necine base:
platynecine)(Fig. 3B): RI 2097; GC-EIMS, m/z (rel.
int.): 313 ([M]+, 9), 269 (33), 141 (8), 140 (20), 138 (7),
96 (27), 95 (1 0 0), 82 (78), 57 (26), 55 (11).
(1R)-1,2-Dihydrohomocallimorphine (necine base:
turneforcidine)(Fig. 3B): RI 2053; GC-EIMS, m/z (rel.
int.): 313 ([M]+, 9), 269 (33), 141 (8), 140 (20), 138 (7),
96 (27), 95 (1 0 0), 82 (78), 57 (26), 55 (11).
7-deoxy-(1R)-1,2-Dihdrocallimorphine (necine base:
trachelanthamidine)(Fig. 3C): RI 1833; GC-EIMS, m/z
(rel. int.): 283 ([M]+, 7), 125 (12), 124 (1 0 0), 122 (6), 95
(5), 83 (17), 82 (8), 73 (4), 55 (8),43 (9).
7-deoxy-(1R)-1,2-Dihydrohomocallimorphine (necine
base: trachelanthamidine)(Fig. 1C): RI 1913; GC-EIMS,
m/z(rel. int.): 297 ([M]+,4), 125 (13), 124 (1 0 0), 123 (3),
122 (4), 95 (4), 83 (17), 82 (7), 57 (10), 55 (7).
7-Chloromethoxy-(1S)-1,2-Dihydrohomocallimor-phine (necine base platynecine): RI 2207;
GC-EIMS,m/z(rel. int.): 284 (8), 255 (54), 196 (10),
188 (13), 96 (23), 95 (1 0 0), 82 (75), 73 (12), 55 (14), 43
(22). GC-CIMS, m/z (rel. int.): 348 (100;
[M( 35Cl)+H]+), 350 (32, [M( 37Cl)+H]+).
7-Chloromethoxy-(1S)-1,2-Dihydrohomocallimor-
phine (necine base platynecine): RI 2282;
GC-EIMS,m/z (rel. int.): 269 (66), 188 (9), 97 (5), 96
(39), 95 (1 0 0), 83 (11), 82 (83), 57 (40), 55 (13), 41 (7).
GC-CIMS, m/z (rel. int.): 362 (100; [M( 35Cl)+H]+),
364 (32, [M( 37Cl)+H]+).
GCMS properties of the trimethylsilyl derivatives of
necine bases obtained by hydrolysis of 1,2-saturated
plant and insect derived pyrrolizidine alkaloids:
Trimethylsilyl-(-)-trachelanthamidine (obtained from
phalaenopsine and 7-deoxy-1,2-dihydrohomocallimor-
phine): RI(ZB1) 1350; EIMS, m/z (rel. int.): 213 (27,
[M]+), 212 (14), 198 (24), 185 (27), 124 (12), 122 (13),
110 (23), 84 (19), 83 (1 0 0), 82 (36).
Trimethylsilyl-(-)-isoretronecanol (obtained from
phalaenopsine and 7-deoxy-1,2-dihydrohomocallimor-
phine): RI(ZB1) 1377; EIMS, m/z (rel. int.): 213 (25,
[M]+), 212 (14), 198 (21), 185 (27), 110 (23), 84 (19), 83
(1 0 0), 82 (38), 73 (14), 55(13).
Di-trimethylsilyl-(-)-turneforcidine (obtained from in-sects fed with phalaenopsine): RI(ZB1) 1569; EIMS,m/
z(rel. int.): 301 (7, [M]+), 286 (10), 212 (4), 211 (17), 187
(3), 186 (9), 185 (74), 83 (5), 82 (1 0 0), 73 (15).
Di-trimethylsilyl-(-)-platinecine (obtained from platy-
phylline and sarracine and callimorphine analogs of
insects fed with sarracine and platyphylline): EIMS, m/z
(rel. int.): RI(ZB1) 1611; EIMS, m/z (rel. int.): 301 (5,
[M]+), 286 (6), 211 (14), 186 (9), 185 (73), 147 (3), 122
(4), 83 (6), 82 (1 0 0), 73 (15).
3. Results
3.1. Sequestration and processing of macrocyclic
pyrrolizidine alkaloids
Extracts of pyrrolizidine alkaloids from three Senecio
species with structurally different alkaloid profiles were
fed to larvae. We were particularly interested to see how
larvae deal with macrocyclic pyrrolizidine alkaloids
which contain unusual necine bases like platynecine
and otonecine. The alkaloids of S. jacobaea and S.
vernalis are all sequestered and transmitted almost
unaltered to the adult stage (Table 1). A distinct change
ARTICLE IN PRESS
T. Hartmann et al. / Insect Biochemistry and Molecular Biology 35 (2005) 108310991086
8/13/2019 02 Insect Biochemistry Molecular
17/137
in the relative pyrrolizidine alkaloid composition was
only observed with the two 15,20-epoxides jacobine
(Fig. 1A) and jacozine, which in comparison to the plant
profile are less abundant in the insects alkaloid profile.
Since the relative proportions of jacoline and jaconine,the respective hydrolytic and chlorolytic derivatives of
jacobine, are clearly increased in comparison to their
dietary proportions, some degradation of the epoxide
during sequestration seems likely. Although an artificial
degradation cannot be excluded, this appears unlikely
since degradation was neither observed under identical
extraction conditions with the artificial diet nor in
analogous insect feeding experiments with E. acrea
(Hartmann et al., 2005).
Besides small amounts of the retronecine esters
senecionine/integerrimine, the dietary pyrrolizidine al-
kaloid mixture from S. congestus contains mainly their
platynecine analogs platyphylline/neoplatyphylline, and
senkirkine, the otonecine analog of senecionine.
Whereas the two macrocyclic platynecine esters are
sequestered and stored with almost the same efficiency
as their retronecine analogs, senkirkine is entirelyexcluded. Neither senkirkine itself nor insect-specific
otonecine esters are detectable in insect extracts.
Senkirkine (Fig. 1C) is as toxic as senecionine but
cannot be detoxified by N-oxidation (Lindigkeit et al.,
1997; Fu et al., 2004). To confirm the ability of G.
geneura to exclude senkirkine from being sequestered,
an additional feeding experiment with 97% pure
senkirkine was performed (Table 2). No traces of
senkirkine or potential metabolites were recovered from
the analyzed adults. However, the insects did contain
four retronecine esters that were present as impurities in
the senkirkine sample. One can calculate that larvae
ARTICLE IN PRESS
Fig. 1. Plant-acquired pyrrolizidine alkaloids sequestered and maintained by G. geneurathrough all life-stages comprise: (A) Various types of
macrocyclic retronecine esters, and (B) open-chain monoesters of the lycopsamine type. In the latter case adults preferentially contain alkaloids with
(7R)- and (3S)-configuration; alkaloids with opposite configuration are largely epimerized. (C) Macrocyclic otonecine esters that cannot form N-
oxides are neither sequestered nor metabolized.
T. Hartmann et al. / Insect Biochemistry and Molecular Biology 35 (2005) 10831099 1087
8/13/2019 02 Insect Biochemistry Molecular
18/137
Table 1
Profiles of the pyrrolizidine alkaloids established by GCMS for G. geneurathat as larvae (penultimate instar) had received about 1 mg per individual of t
added to the artificial diet
Alkaloids recovered m/z[M+] RI Relative abundance (%)
Alkaloid mixture from Senecio jacobaea Alkaloid mixture fromSenecio vernalis A
Diet Larvae
n 2
Males
n 3
Females
n 4
Diet Larvae
n 2
Males
n 4
Females
n 3
D
Plant acquired alkaloids
9-Angeloylplatynecine 5
Senecivernine 335 2283 73 74.570.5 5870.6 7173.8
Senecionine 335 2274 3 570 8.371.5 5.870.3 6 6.570.5 1170.5 7.370.3 3
Seneciphylline 333 2293 13 21.570.5 2870.8 2271.1 4 4.070 6.370.5 4.370.3
Spartioidine 333 2325 o1 170 1.370.3 170 3 3.070 3.570.3 2.071.0
Integerrimine 335 2335 3 670 7.770.3 7.070.7 10 1270 1570.3 1370.7 3
Unknown senecivernine derivative 349 2400 4 470 170 2.071.0
Platyphylline 337 2328 24
Neoplatyphylline 337 2354 2
Jacobine 351 2420 46 1570. 11.371.5 16.570.9
Jacozine 349 2440 9 2.570.5 1.270.4 1.770.3
Senkirkine 365 2450 59
Jacoline 369 2471 7 2072 2174.3 2371.4
Jaconine 387 2507 8 2372 1370.3 1570.7
Dehydrojaconine 385 2540 < 0.270.1
Eruciflorine 351 2591 2 2.570.5 2.070.6 1.570.3
Creatonotines
Creatonotine B 269 1978 Tr Tr
Callimorphines
Desacetylcallimorphine 255 1821 0.270.1 0.270.1
Callimorphine 269 1972 3.771.7 3.570.5 4.371.4 2.771.8
Homocallimorphine 311 2033 0.570.3 1.470.6 1.370.6 Tr
(1S)-1,2-Dihydrocallimorphine 299 2015 (1S)-1,2-Dihydrohomocallimorphine 313 2096
Total alkaloid (mg/individual) 189753 227766 2437106 390736 186724 81752
Total alkaloid (mg/g dry wt) 1.370.5 2.470.8 1.470.6 2.770.2 1.970.1 0.770.2
8/13/2019 02 Insect Biochemistry Molecular
19/137
accumulate about 50% of the trace amounts of these
alkaloids present in their larval food. No toxic or
detrimental effects of senkirkine were observed in the
experiment during further larval development, indicat-
ing that the larvae are well adapted to tolerate otonecine
derivatives present in their alkaloid meals.
In all feeding experiments callimorphines (Fig. 2B)could be recovered as insect alkaloids from adults but
not larvae. Creatonotines (Fig. 2A) were only detected
in trace amounts in larvae and males fed on S. jacobaea
alkaloids. Insects fed on S. congestus alkaloids con-
tained 1,2-dihydrocallimorphines indicating insect-spe-
cific esterification of platynecine obtained from the
plant-acquired platyphyllines (Fig. 3B).
Pyrrolizidine alkaloid-containing species of the Apoc-
ynaceae often possess unique macrocyclic triesters.
Examples are 14-deoxyparsonsianidine and 14-deoxy-
parsonsianine (Fig. 1A) the major alkaloids ofParsonsia
laevigata. Larvae are able to sequester and store these
alkaloids (Table 3). It is interesting to note that 14-
deoxyparsonsianine, the less abundant pyrrolizidine
alkaloid in the larval diet, accumulates in adults as the
major component. The two pyrrolizidine alkaloids differ
in just one carbon atom (Fig. 1A). In adults the
callimorphines represent a considerable portion (15 to
38%) of total pyrrolizidine alkaloids.
3.2. Sequestration and processing of pyrrolizidine
alkaloids of the lycopsamine type
Alkaloids of the lycopsamine type are characterized by
their unique necic acid moiety, 2-isopropyl-2,3-dihydrox-ybutyric acid. At least three stereoisomers of this rare
acid are known to occur in alkaloids of the lycopsamine
type: (-)-trachelanthic acid with (2R)(3S)-configuration
in indicine; (-)-viridifloric acid, (20S)(3S), in lycopsamine
and echinatine and (+)-trachelanthic acid, (2S)(3R), in
intermedine and rinderine (Fig. 1B). Alkaloids of this
type are typical for pyrrolizidine alkaloid-containing
species of the Boraginaceae, Apocynaceae and the tribe
Eupatorieae of the Asteraceae. For example, indicine and
lycopsamine (from Heliotropium indicum) were seques-
tered and maintained without discrimination (Table 4). It
is notable that the concentration of 3acetylindicine, analkaloid that is only detectable in trace amounts in the
larval diet and larval extract, is considerably increased in
adults; it is accompanied by trace amounts of 3-
acetyllycopsamine which does not occur in the larval diet.
Feeding of a purified alkaloid extract from Eupator-
ium cannabinum gave more complex results (Table 4).
Rinderine as a major alkaloid in the larval diet was
found at already decreased levels in larvae and only in
traces in adults which instead contained lycopsamine
and echinatine as major alkaloids. Obviously, alkaloids
with a 3S-configuration (Fig. 1B) are preferentially
transferred to the adult life-stage. While for larvae the
changed alkaloid composition could be accomplished by
uptake discrimination, this explanation can be excluded
for adults. In particular, the strong increase in the
lycopsamine level indicates an insect-specific epimeriza-
tion of (3R)-configurated alkaloids, probably accom-
panied by the known (see Chapter 3.4) epimerization of
(7S)-configurated alkaloids (Fig. 1B).
In addition, like in the experiment with indicine small
amounts of acetyl derivatives are detectable, which were
not present in the larval diet and thus must have been
formed by the insect. Interestingly, besides 3-acetyl
derivatives, 7-acety esters are detected.
In both feeding experiments considerable amounts ofcallimorphines are detectable. In the experiment withH.
indicum alkaloids the insect-specific alkaloids account
for 1012%, while in the E. cannabinum experiment, the
callimorphines add up to 27% (males) and 50%
(females) of total alkaloids (Table 4).
ARTICLE IN PRESS
Table 2
Pyrrolizidine alkaloid profile established by GCMS for G. geneura that as larvae (penultimate instar) had received about 1 mg senkirkine per
individual added to the artificial diet
Pyrrolizidine alkaloids recovered from insects m/z[M+] RI Relative abundance (%)
Diet Larvae (n 2) Males (n 3) Females (n 4)
Plant acquired alkaloids
Senecivernine 335 2267 2 42.571.5 38.572.5 40.071.4
Senecionine 335 2275 1 28.071.0 33.571.5 32.070.9
Seneciphylline 333 2288 Tr 12.071.0 13.570.5 12.770.8
Integerrimine 335 2335 Tr 12.070 13.571.5 14.370.5
Senkirkine 365 2460 97 5.571.5a Nd Nd
Callimorphines
Homocallimorphine 311 2037 1.171.0 1.170.6
Total alkaloid (mg/individual 18.9710.8 14.371.3 12.872.8
Total alkaloid (mg/g dry wt) 0.0770.04 0.1670.02 0.0970.03
aMost likely due to the gut content
T. Hartmann et al. / Insect Biochemistry and Molecular Biology 35 (2005) 10831099 1089
8/13/2019 02 Insect Biochemistry Molecular
20/137
3.3. Sequestration and metabolism of open-chain
platynecine and trachelanthamidine esters
Feeding of a dietary alkaloid mixture that contained
the open-chain platynecine diester sarracine (containing
5% of its (E)(Z)-isomer sarracinine) (Fig. 3B) (Table 5).
In contrast, adults did not contain even traces of
the plant-derived pyrrolizidine alkaloids but instead
stored the respective platyphylline analogs of creatono-
tines and callimorphines, i.e. (1S)-1,2-dihydrocreatono-
tines and (1S)-1,2-dihdyrocallimorphines (Table 5).
Hydrolysis of the insects alkaloids recovered from
ARTICLE IN PRESS
Fig. 2. Retronecine and heliotridine are converted into insect-specific monoesters. (A) Creatonotines are found in pupae and probably synthesized atearly stages of pupation, (B) callimorphines are found in adults and probably are synthesized shortly before eclosion at the expense of creatonotines,
and (C) (7S)-Configurated heliotridine is partly epimerized yielding (7R)-configurated retronecine and partly converted into callimorphine derivatives
with (7S)-configuration.
T. Hartmann et al. / Insect Biochemistry and Molecular Biology 35 (2005) 108310991090
8/13/2019 02 Insect Biochemistry Molecular
21/137
adults and GC-MS analysis of the necine base fraction
revealed the presence of platynecine as exclusive necine
base. The two chlorinated alkaloids are most likely
artifacts generated during treatment with dichloro-
methane.
Insects given the dietary mixture of T-phalaenopsine
(trachelanthamidine ester, 80%) and Is-phalaenopsine(isoretronecanol ester, 20%) (Fig. 3C) did not, as
adults, contain even trace amounts of the dietary
pyrrolizidine alkaloids. Instead the respective 7-deso-
xy-1,2-dihydrocreatonotines and 7-desoxy-1,2-callimor-
phine were present (Table 6). Most interestingly
adults were found to contain as major alkaloids 1,2-
dihydrocallimorphine and 1,2-dihydrohomocallimor-
phine which account for more than 60% of total
pyrrolizidine alkaloids recovered from the insects.
The two compounds display mass fragmentation
patterns identical to those of the 1,2-dihydrocallimor-
phines identified after feeding of plant-acquired platy-
necine esters, i.e. S. congestus (Table 1) and sarracine
(Table 5) but show different RI values (Fig. 4).
Hydrolysis of the alkaloid mixtures recovered from
adults and analysis of the TMS-derivatives of the necine
base fraction revealed the presence a necine base with a
fragmentation pattern identical to that of platynecine
but with a different RI. It was identified as the
platynecine isomer turneforcidine with (1R)-configura-
tion like trachelanthamidine (Fig 3). Trachelanthami-
dine itself was identified in the same experiment
accompanied by only traces of its (1S)-configurated
isomer, i.e. isoretronecanol. This confirms, firstly, that
the alkaloids recovered from the insects have (1R)-configuration (Table 6) and, secondly, that, G. geneura
must be able to hydroxylate the trachelanthamidine
moiety at C-7 (Table 6;Fig. 3B, C).
ARTICLE IN PRESS
Fig. 3. Formation of insect-specific necine esters with insect-specific
necic acids, i.e. creatonotic acids and callimorphic acids (A). (B)
Formation of 1,2-dihydro derivatives from plant-acquired platynecine,
and (C) formation of 7-deoxy-1,2-dihdyro derivatives from plant
acquired trachelanthamidine and insect-specific 7-hydroxylation of
trachelanthamidine yielding turneforcidine.
Table 3
Pyrrolizidine alkaloid profiles established by GCMS for G. geneurathat as larvae (penultimate instar) had received about 2 mg per individual of an
alkaloid mixture derived from in vitro cultivated Parsonsia laevigata plantlets added to the artificial diet
Pyrrolizidine alkaloids recovered from insects m/z[M+] RI Relative abundance (%)
Diet Larvae (n 2) Males (n 4) Females (n 3)
Plant acquired alkaloids
14-Deoxyparsonsianine 425 2773 23 45.077.0 35.776.5 44.371.214-Deoxyparsonsianidine 439 2860 61 52.574.5 22.575.9 38.070.6
Heterophyllinea 453 2920 5 1.571.5
Parsonsianidine 455 2935 7
17-Methylparsonsianidine a 469 2993 3
Creatonotines
Creatonotine B 269 1973 Tr 2.371.3 0.470.3
Callimorphines
Deacetylcallimorphine 255 1821 1.070.99 1.070.6
Callimorphine 297 1955 14.574.8 8.771.3
Homocallimorphine 341 2033 23.376.7 6.770.9
Total alkaloids (mg/individual) 37.2736.8 14.374.0 33.078.2
Total alkaloids (mg/g dry wt) 0.370.3 0.1170.07 0.270.06
aTentatively identified
T. Hartmann et al. / Insect Biochemistry and Molecular Biology 35 (2005) 10831099 1091
8/13/2019 02 Insect Biochemistry Molecular
22/137
3.4. Metabolism of retronecine and heliotridine:
formation of creatonotines and callimorphines
To study the specificity and temporal sequence of the
formation of insect-specific necine esters, retronecine
and heliotridine were fed with larval diet to G. geneura.
The results are summarized in Table 7. Pupae of
individuals that as larvae received retronecine contain,
besides a small proportion of residual retronecine, the
full set of creatonotines (Fig. 2A) but not even traces of
ARTICLE IN PRESS
Table 4
Profiles of the pyrrolizidine alkaloids established by GCMS forG. geneurathat as larvae (penultimate instar) had received about 1 mg per individual
of the indicated plant derived alkaloid mixtures added to the artificial diet
Alkaloids recovered m/z[M+] RI Relative abundance (%)
Alkaloid mixture from Eupatorium cannabinum Alkaloid mixture from Heliotropium indicum
Diet Larvaen 4
Malesn 4
Femalesn 2
Diet Larvaen 2
Malesn 1
Femalesn 5
Plant acquired alkaloids
Supinine 283 1967 8 5.070.4
Amabiline 283 1972 Tr 5.872.2
Indicine 299 2120 88 83.572.5 64 50.873.6
Intermedine 299 2131 3 1.870.6
Lycopsamine 299 2145 1 1.871.2 32.5713.9 3575 12 15.071.0 9 8.270.7
Rinderine 299 2151 60 36.576.6 Tr
Echinatine 299 2164 19 42.874.4 30.5711.2 2.570.5
30-Acetylindicin 341 2182 Tr Tr 15 27.873.4
30-Acetylrinderine 341 2210 9
70-Acetyllycopsmaine 341 2210 5.071.8 0.670.2
70-Acetylechinatine 341 2228 6.571.7 2.570.7 0.370.2
30-Acetyllycopsamine 341 2239 Tr 2.370.5 7.570.5 Tr 1.570.4
30-Acetylechinatine 341 2269 1.470.7 0.470.2Creatonotines
Estigmine B 253 1830 Tr 0.870.3
Creatonotine A 255 1880 Tr
Creatonotine B 269 1973 Tr
Callimorphines
Isodeacetylcallimorphine 255 1814 0.370.1 1.071.0
Deacetylcallimorphine 255 1822 1.570.3 5.070
Callimorphine 297 1955 20.572.4 40.571.5 Tr 9 9.070.52
Homocallimorphine 5.372.4 5.573.5 3 1.670.4
Total alkaloid (mg/individual) 75.8716.5 47.378.5 58.5720.5 186759 105 165722
Total alkaloid (mg/g dry wt) 0.3370.09 0.3570.12 0.3570.15 1.1870.42 0.9 0.9870.09
Table 5
Pyrrolizidine alkaloid profiles established by GCMS for G. geneura that as larvae (penultimate instar) had received about 1 mg per individual ofsarracine/sarracinine added to the artificial diet
Pyrrolizidine alkaloids recovered from insects m/z[M+] RI Relative abundance (%)
Diet Larvae (n 2) Males (n 7) Females (n 1)
Plant acquired alkaloids
Sarracine 337 2390 95 56.072.0
Sarracinine 337 2401 5 10.1710.0
9-Angeloylplatynecine 239 1842 34.078.0
Creatonotines
(1S)-1,2-Dihydrocreatonotine A 257 1923 Tr Tr Tr
(1S)-1,2-Dihydrocreatonotine B 271 2032 Tr 11.974.2 Tr
Callimorphines
(1S)-1,2-Dihydrocallimorphine 299 2016 54.475.6 60
(1S)-1,2-Dihydrohomocallimorphine 313 2097 30.076.0 30
7-Chlormethoxy-(1S)-1,2-dihydrocallimorphinea 347 2207 2.571.9 8
7-Chlormethoxy-(1S)-1,2-dihydrohomocallimorphinea 361