2, Gerardo Gallego¹, Wilson Vasquez 3ciat-library.ciat.cgiar.org/Articulos_Ciat... · Jorge Mario...

transcript

Geographic Differentiation of Colombian Neoleucinodes elegantalis (Lepidoptera:

Crambidae) haplotypes: evidence for Solanaceae host plant association and Holdridge life

zones for genetic differentiation

Jorge Mario Londoño¹, Ana Elizabeth Díaz2, Gerardo Gallego¹, Wilson Vasquez3, Harold Suárez¹ and Joe Tohme¹

Figure 1. Haplotype frequencies obtained for the evaluation of 272 samples, the most frequent haplotypes are H5

(light blue) and H1 (dark blue).

Figure 3. Genetic distances inferred using Neighbor-Joining (NJ). Classification follows the faunistic zones proposed by

Kattan et al (2004): yellow (Inter-Andean Slopes), blue (Cauca Valley watershed), violet (Magdalena Valley watershed),

red (Ecuador), deep blue (Honduras).

The composition and heterogeneity analysis of COI sequences allowed the establishment of variability at the inter and intra

specific levels. This variation could identify significative divergence between individuals of N. elegantalis.

Figure 3. Heterogeneity

(He) of the COI in N.

elegantalis.

Figure 2. a) Geographical distribution of most common N. elegantalis haplotypes in Colombia, b) Clasification of

the 5 sub-regions proposed by Kattan et al., (2004), also refered to by the author as faunistic zones. Cauca Valley,

Central Cordillera and Magdalena Valley are the three sub-regions where all Colombian individuals come from.

DIAZ A E., SOLIS M A 2007. A New species and species distribution records of Neoleucinodes (Lepidoptera:

Crambidae:Spilomelinae) from Colombia feeding on Solanum sp. Proceedings of the Entomological Society of Washington.

109 (4):897–908.

HOLDRIDGE L R 1947. Determination of World Plant Formations from Simple Climatic Data. Science Vol, 105 No. 2727:

367-368.

HEBERT P D N., CYWINSKA A., BALL S L., DE WAARD J R. 2003. Biological identifications through DNA barcodes. Proc.

R. Soc. B. 270, 313-321.

KATTAN G H., FRANCO P., ROJAS V., & MORALES G. Biological diversification in a complex region: a spatial analysis of

faunistic diversity and biogeography of the Andes of Colombia

DNA Barcoding was an accurate tool for the identification of haplotypes as well as discrimination of species (N. silvane) reported previously by Díaz & Solís (2007) using geometric morphology. The number of haplotypes obtained revealed a possible role

of biogeographic isolation between valleys and of possible human pressure through the use of pesticides inducing divergent selection in N. elegantalis. The NJ analysis shows a wide distribution of the species along the Magdalena valley watershed, this

sub-region is located between the Central and Eastern Cordilleras. The distribution of N. elegantalis in this region could explain the wide range of altitudinal adaptation of the species that could facilitate dispersal. With regard to the Cauca Valley, diversity

centers on the southwestern slope of the Central Cordillera and on the East of Western Cordillera. The classification of regions proposed by Kattan et al (2004), are highly correlated to the grouping of haplotypes recovered in the species.

The DNA Barcoding tool shows high sensitivity in N. elegantalis haplotype identification, and to correlation with the sub-regions of colombia which

suggest at least 3 different geographic groups, related to both biogeographic separation, and human intervention through the use of pesticides.

This is the first genetic analysis of N. elegantalis and the first attempt to obtain a molecular characterization of the species.

Genetic differentiation could mean that there is partial reproductive isolation in N. elegantalis; further research could center on resolving this issue.

Through this methodology we confirm the existance of a new species of Neoleucinodes genera (N. silvanie) previously proposed by Díaz & Solís (2007)

with the use of morphological characters.

INTRODUCTION

¹Agrobiodiversity and Biotechnology Proyect, Centro Internacional de Agricultura Tropical (CIAT), Palmira, Valle del Cauca - Colombia

²Corporación Colombiana de Investigación Agropecuario (CORPOICA), Centro de Investigación La Selva, Rionegro, Antioquía - Colombia 3Instituto Nacional Autonomo de Investigaciones Agropecuarias (INIAP, Ecuador)

g.gallego@cgiar.org

METHODOLOGY

RESULTS

DISCUSSION

Nucleotide composition and haplotype frequencies of N. elegantalis

Amplification of the mitochondrial gene COI produced a 658 bp fragment from a total of 272 individuals with

average base (nucleotide) frequencies of A=34.06%, T=34.06%, C=15.94%, G=15.94%. The number of haplotypes

obtained was 9 in which the most frequent haplotype, with 87 sequences, was H5 representing 32.2% including 90%

of the Ecuadorian individuals. H5 was followed by H1 with 82 individuals and corresponds to 50% of Colombian

sequences. Moreover, H1 was found in the Magdalena valley watershed while H3 correspond to Inter-Andean slopes

and H2 to Cauca valley watershed. The number of substitutions at the nucleotide level varied between 9 and 24 in all

haplotypes observed.

CONCLUSIONS

ACKNOWLEDGMENTS

REFERENCES

Special thanks to Fondo Regional de Tecnología Agropecuaria FONTAGRO for financial support.

Neoleucinodes elegantalis, known as tomato fruit borer, is an insect of Neotropical origin, widely distributed in Central America and South America. This species is considered one of the most important pests for fruit production in the

Solanaceae. N. elegantalis is adapted to a wide altitudinal range (0 – 2600 m.a.s.l), a considerable diversity of natural enemies, and exhibits variability in terms of oviposition and pupation habit, besides a wide spectrum of host wild

Solanaceae, and a differential behavior to sexual pheromone Neoelegantol. Using the DNA Barcode tool, 272 samples were processed and analyzed through Cytocrhome oxidase I (COI) gene, which represents a standard segment of

the mitochondrial genome ( 650 base pairs). The geographical differentiation and population structure in relation to host-plant association and to Holdridge life zones were examined. The mains goals of this study are to evaluate the

utility of DNA barcoding in the identification of haplotypes in the populations of N. elegantalis from Colombia and Ecuador, and to establish a DNA barcode database for this species.

DNA extraction from 163 individuals collected in 14 departments of Colombia and 95 individuals from

Ecuador was performed using the GF – 1 Nucleic Acid Extraction Kit (GF1-100-Vivantis). Amplification was

carried out using universal primers that flank the COI region, with COI-Forward

(5’GGTCAACAAATCATAAAGATATTGG3’) and COI-Reverse (5’

TAAACTTCAGGGTGACCAAAAAATCA 3’).

Purification of the PCR product was performed using the PCR Clean up system (Promega). The sequences

were obtained using an automatic sequencer ABI 3730 (Perkin Elmer/Applied Biosystem) and the assembled

with Sequencher 4.6 (Gene codes corporation Ann Arbor; MI).

Different bioinformatic tools were used for alignment and verification of sequence quality, nucleotide

composition for each sample, genetic distances and heterogeneity among sequences. Additionally, the

geographic distribution for each sample was determined, using the software ArcGIS – ArcMap (ERSI 1999 –

2008).

Ecuado

Ecuador

0 Ecuador

Ecuador

ador 25

ador N

ador 05

ador N

ador 59

ador 08

TACH 1

Ecuador 5

Ecuador N

CH 101 b

Ecuador N

AY12 M

Ecuador N

AY13 M

Ecuador 4

Ecuador 5

Ecuador NG512 H

Ecuador NCO11 M

Ecuador 14

Ecuador 68

Ecuador 01

Ecuador 02

Ecuador 03

Ecuador 12

Ecuador 13

Ecuador 15

Ecuador 23

Ecuador 24

Ecuador 29

Ecuador 30

Ecuador 31

Ecuador 32

Ecuador 33

Ecuador 34

Ecuador 36

Ecuador 37

Ecuador 38

Ecuador 39

Ecuador 45

Ecuador 46

Ecuador 47

Ecuador 52

Ecuador 53

Ecuador 55

Ecuador 62

Ecuador 63Ecuador 64Ecuador 65Ecuador 66Ecuador 67Ecuador 69Ecuador 70Ecuador 71

Ecuador 75Ecuador NRV31 HEcuador NRV31 MEcuador NRV11 H

Ecuador NRV11 MEcuador NRV12 H

Ecuador NRV21 MEcuador NRV21 H

Ecuador 44Ecuador 51

Col Mlena 48Col Mlena 49

Col NteStder 45

Col NteStder 41

Col NteStder 39

Col Stder 37

Col NteStder 35

Col NteStder 34

Col NteStder 31

Col Stder 29

Col Nd 28

Col Nd 27

Col Nar 18

Col Stder 26

lena 50

Col Stder 25

tder 79

tder 80

tder 73

32Col A

auca 121

tder 76

un 170

ITa897-A

l Boy 0

l Tol 1

I ColC

auca 1

l Cauca 1

auca 1

m313-C

1989-A

tder 7

0 0 0 0 0 0 0 0 0 0 0 0

0 0 0 0 0 0 0 0 0 2

ASDRTa

Hondura

Honduras

Honduras 0

Honduras 05 2

Honduras 01 9

Honduras 04 86

Honduras 08

Honduras 11

Honduras 02Honduras 13

Honduras 10

Col ASDRTa113-Ant

Col ASDRTa858-Ant

Col ASDRTa903-Ant 100

Col Qdio 54Col DosQ 69

Col APSITa853-Ant

Col RSLALu346-RisaCol CMLETa304-CalCol Vcau 82

Col RSLLTm297-RisaCol RSLLTm316-RisaCol CMERTm337-Cal

Col AJCLu527-AntCol AJILu847-AntCol AJTTa1932-Atq 45

Col AJILu931-Ant

Col Nar 117Col Nar 118

Col Nar 116

Col Vcau 115

Col AJCLu601-Ant

Col RSLALu289-Risa

Col RSLLTm340-Risa

Col RSLLTm272-Risa

Col CMERTm350-Cal

Col CMERTm320-Cal

Col Vcau 81

Col Cal 63

Col Risa 56

Col RSLALu92-StaRosa

Col RSLALu318-Risa46

Col CMERTm300-Cal

Col AJCLu1875-Ant

Col Cal 290

Col AJCLu1400-Ant

Col AJCLu1654-Ant

Col APLGTm1763-Ant

Col AJTTa1666-Ant

Col AJILu737-Ant

Col AJCLu1726-Ant

Col AJCLu1026-Ant

Col AJCLu400-Ant

Col RSLGLu331-Risa

Col Cal 65

Col CMERTm273-Cal

Col AJCLu1492-Ant

Col AJTTa1467-Ant

Col-CMLETa59-Cal

Col Ant 85

Col Ant 86

Col Ant 87

Col AJC

Lu453-Ant

Col AJC

Lu911-Ant

Col AJC

Lu1307-Ant

JCLu1585-A

JCLu1797-A

JCLu1917-A

JCLu1931-A

1475-Ant

JTTa1829-A

nt 109

JCLu256-A

JCLu703-A

JCLu971-A

JCLu998-A

JCLu1166-A

JLLLu708-A

Lu106-S

Col cu

ador S

Ecuador S

ECUADOR

HONDURAS

COLOMBIA –

Inter-Andean

Slopes

COLOMBIA –

Magdalena

Valley

watershed

COLOMBIA –

Cauca Valley

watershed

The genetic distances between sequences were calculated using Neighbor-Joining/UPGMA algorithm implemented in MEGA

5. These distances yield 5 groups, of which 2 belong to Ecuador and Honduras. Additionally, 14 individuals from Honduras,

which were used as the outgroup, formed a separate group; and 3 Colombian groups can be distinguished. The faunistic

classification proposed by Kattan et al (2004) in order to group the origins of the samples.

0.4 0.4 1.9

H1H2H3H4H5H6H7

2, Gerardo Gallego¹, Wilson Vasquez 3ciat-library.ciat.cgiar.org/Articulos_Ciat... · Jorge Mario...

Documents