Post on 17-Jan-2017
transcript
HORIZON DISCOVERY
An Introduction To CRISPR Genome Editing
Chris Thorne, PhD | Commercial Marketing Manager
2
Disclaimer
2
• This Presentation does not constitute or form any part of an offer to sell, or invitation to purchase or apply for or enter into any contract or make any other commitment whatsoever in relation to, securities. Although reasonable care has been taken to ensure that the facts stated in this Presentation are accurate and that the opinions expressed are fair and reasonable, the contents of this Presentation have not been formally verified by Horizon Discovery plc (the “Company”) or any other person. Accordingly, no representation or warranty, expressed or implied, is made as to the fairness, accuracy, completeness or correctness of the information and opinions contained in this Presentation and no reliance should be placed on such information or opinions. Further, the information in this Presentation is not complete and is subject to updating, revision, further verification and amendment. Neither the Company, nor any of its subsidiaries, nor any of its respective members, directors, officers or employees nor any other person accepts any liability whatsoever for any loss howsoever arising from any use of such information or opinions or otherwise arising in connection with this Presentation.
• Accordingly, information contained in the Presentation is being supplied to you solely for your information and may not be copied, reproduced or further distributed to any person or published in whole or in part, for any purpose. In particular, the distribution of this Presentation in certain jurisdictions may be restricted by law, and persons into whose possession this Presentation comes should inform themselves about, and observe, any such restrictions. Any failure to comply with these restrictions may constitute a violation of laws of any such jurisdiction.
• This Presentation includes certain forward-looking statements, estimates and projections with respect to the anticipated future performance of Horizon Discovery plc, its products and the markets in which it operates. Forward-looking statements involve risks and uncertainties. Actual events could differ materially from those projected herein and such statements, estimates and projections reflect the various assumptions made by the Company which assumptions may or may not prove to be correct. These forward-looking statements speak only as at the date of this Presentation. The Company expressly disclaims any obligation or undertaking to disseminate any updates or revisions to any forward-looking statements contained in the Presentation to reflect any change in the Company’s expectations with regard thereto or any change in events, conditions or circumstances on which any such statements are based.
• No part of this Presentation, or the fact of its distribution, should form the basis of or be relied upon in connection with any contract or commitment or investment decision whatsoever. This Presentation does not constitute a recommendation regarding the securities of the Company.
• By participating in and/or accepting delivery of this Presentation you agree to be bound by the foregoing restrictions and the other terms of this disclaimer.
3
Presenter
Chris Thorne, PhD | Commercial Marketing ManagerChris has been working at Horizon for four years, during which he has been responsible for the genetic validation of all cell lines in Horizon’s catalogue, has been part of the launch of Horizon’s diagnostic reference materials and has supported hundreds of academic labs as they implement CRISPR genome editing with Horizon’s tools.
Prior to Horizon Chris completed his PhD at the University of Liverpool.
4
Contents
1. The Case for Genome Editing
2. What is Genome Editing and how is it done?
3. CRISPR-Cas9 – origins and it’s application to genome editing
5
The Genomic Era…
6
The Genomic Era…
1. Elucidate the organisation of genetic networks and their contribution to cellular and organismal phenotypes
2. Understand heritable variations and their association with health and disease
3. Translate genome-based knowledge into health benefits
Adapted from The US National Human Genome Research Institute, (2003) Nature
7
Gene function analysis | Patient-derived cell lines
Human cell lines contain pre-existing mutations
are derived directly from human tumors
Immense genetic diversity
However Lack of wild type controls
Availability of rare mutation models
Cell line diversity makes it very hard link observations to specific genetics
(Domke et al Nat. Comms 2013)
8
Gene function analysis | RNAi
Problems with RNAi can result in false positives or negatives
Loss of function analysis using RNAi is
inexpensive and widely applicable
Incomplete knockdown
However Lack of reproducibility
Off-target effects
Brass et al.Science
273 genes
König et al.
Cell
213 genes
Zhou
et al
.
Cell H
ost M
icrob
e
300 g
enes
Total overlap only 3 genes
Shalem et al Science 2014 HIV Host Factors
9
Gene function analysis | Overexpression
Overexpression of oncogenes can over represent their role in disease biology
Gain of function analysis using
overexpression is inexpensive and widely
applicable
Result may be artefact of overexpression
HoweverDifficult to achieve long-
term overexpression
• Large growth induction phenotype• Transforming alone
• Milder growth induction phenotype• Non-transforming alone
10
The Opportunity: Genome Editing
11
The Opportunity: Genome Editing
Adapted from The US National Human Genome Research Institute, (2003) Nature
1. Elucidate the organisation of genetic networks and their contribution to cellular and organismal phenotypes
2. Understand heritable variations and their association with health and disease
3. Translate genome-based knowledge into health benefits
Knockouts
Knock-ins
Gene Therapy
12
Genome Editing Tools
Non-Nuclease Nuclease
ZFNs
TALENS
Meganucleases
CRISPR-Cas9
rAAV
13
Nuclease mediated genome editing
Exon 1 Exon 2 Exon 3
Exon Exon 2 Exon 31
Nuclease-induced DNA double-strand break
Non-homologous end joining
Exon 1
Homology-directed repair
Exon 2
Exon 2Exon 2Exon 1Frameshift mutation
Exon 1
14
CRISPR-Cas system: Adaptive immunity in bacteria
15
CRISPR-Cas9 | How does it work?
Crispr (cr) RNA + trans-activating (tra) crRNA combined = single guide (sg) RNA
16
CRISPR mediated genome editing
Exon 1 Exon 2 Exon 3
Exon Exon 2 Exon 31
Cas9 nuclease-induced DNA double-strand break
Non-homologous end joining
Exon 1
Homology-directed repair
Exon 2
Exon 2Exon 2Exon 1Frameshift mutation
Exon 1
17
CRISPR-Cas9: How does it work?
AGCTGGGATCAACTATAGCG CGGgRNA target sequence PAM
18
CRISPR Specificity
Cas9 Wild type Cas9 Nickase (Cas9n)
Induces double strand break Only “nicks” a single strand
Only requires single gRNA Requires two guide RNAs for reasonable activity
Concerns about off-target specificity Reduced likelihood of off-target events
High efficiency of cleavage Especially good for random indels (= KO)
Guide efficiency dictated by efficiency of the weakest gRNA
Nishimasu et al Cell
19
Hsu et al. Cell. 2014
20
... HOWEVER …
Cell Line
Engineered cells!
Genome Editing Vector
Screen for clones
21
Next time: The Key Considerations For CRISPR Gene Editing
Cell Line
Gene Target
Modification
Choice of guide
Strategy Design
Screening
Validation
Is it suitable?
Is it essential/expressed/amplified?
Knockin vs knockout
Efficiency vs specificity
Donor design to maximise efficiency
How many clones to find a positive?
Is my engineering as expected?
22
And then… CRISPR modified cell lines
What’s possible and how they will impact your research
Exon 8 Exon 9 NanoLuc polyA
Exon 1 Exon 3
Translocations and Fusions
Gene tagging
Chromosomal deletions
Chr 1 Chr 19
Point mutations
Exon 8 Exon 9
*
Your Horizon Contact:
t + 44 (0)1223 655580f + 44 (0)1223 655581e info@horizondiscovery.comw www.horizondiscovery.comHorizon Discovery, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom
Your Horizon Contact:
t + 44 (0)1223 655580f + 44 (0)1223 655581e info@horizondiscovery.comw www.horizondiscovery.comHorizon Discovery, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom
Chris Thorne, PhDCommercial Marketing Managerc.thorne@horizondiscovery.com +44 1223 204 799