Post on 03-Jan-2016
transcript
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping I
• Based on recombination frequencies– The further away two points are on a
chromosome, the more recombination there is between them
• Because recombination frequencies vary along a chromosome, we can obtain a relative position for the loci
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping II
• Genetic mapping requires that a cross be performed between two related organisms – The organism should have phenotypic
differences resulting from allele differences at two or more loci
• The frequency of recombination is determined by counting the F2 progeny with each phenotype
A map of the 12 tomato chromosomes• Genetic distance is measured by
recombination frequency• A relative map can be constructed based
on genetic distances
Genetic vs. Molecular Maps
• What is the relationship of genetic distance to molecular distance?
• How can genetic and molecular relationships be reconciled?
• How can one be used to locate the other?
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic markers
• Genetic mapping between positions on chromosomes– Positions can be genes
• Responsible for phenotype– Examples: eye color or disease trait
– Positions can be physical markers• DNA sequence variation
Physical markers
• Physical markers are DNA sequences that vary between two related genomes
• Referred to as a DNA polymorphism• Usually not in a gene
– Examples• SSLP (microsatellite)• SNP
– RFLP– Intergenic SNP– Silent intragenic SNP– Causative point mutation
© 2005 Prentice Hall Inc. / A Pearson Education Company /
Upper Saddle River, New Jersey 07458
SSLP• Simple-sequence length polymorphism
• Most genomes contain repeats of three or four nucleotides• Length of repeat varies• Use PCR with primers external to the repeat region• On gel, see difference in length of amplified fragment
ATCCTACGACGACGACGATTGATGCT
12
18
1 2
2
1
ATCCTACGACGACGACGACGACGATTGATGCT