Post on 10-May-2020
transcript
Authentication of the Panax genus plants used in Traditional
Chinese Medicine (TCM) using Randomly Amplified
Polymorphic DNA (RAPD) Analysis.
by
Catherine Rinaldi
Supervisors: Dr Guan Tay
Centre for Forensic Science
The University of Western Australia
Assoc/Prof Ian Dadour
Centre for Forensic Science
The University of Western Australia
This thesis is submitted in part fulfilment for the award of Master of
Forensic Science at the University of Western Australia
2007
i
I declare that the research presented in this 36 point thesis, as part of the 96
point Masters degree in Forensic Science, University of Western Australia,
is my own work. The results of the work have not been submitted for
assessment, in full or part, within any other tertiary institute.
Catherine Rinaldi
ii
ACKNOWLEDGEMENTS
First, I would like to thank my supervisors Dr Guan Tay and Associate Professor Ian
Dadour. Guan for providing guidance, support and knowledge for the duration of this
project. Ian for providing the facilities and support for the completion of this project.
To the members of the lab who provided their friendship, support and reviews of my
written work. Angelina Lim and Yvette Hitchens who put up with me in the lab on a
daily basis and kept my time in the lab enjoyable. Dr. Michelle Harvey who helped me
on a daily basis by dispensing much of her knowledge on the day to day problem
solving relating to DNA based research. The other members of Guan’s research group
Rebecca Ford, Haifa Khoory and Steve Iaschi who provided knowledge, support and
friendship.
I would like to thank Danielle Molan and the other members of staff at the Centre for
Forensic Science who keep the Masters course running smoothly.
Finally, to my family without whose constant support, understanding and patience I
would not have made it to the end of this project.
iii
PREFACE
The main objective of the research undertaken here was to apply DNA profiling
techniques to material used in Traditional Chinese Medicine (TCM). Specifically this
study was established, to distinguish different species within the Panax plant genus
(including the common ginseng), using Randomly Amplified Polymorphic DNA
(RAPD) profiling. With specific consideration to whether DNA could be extracted and
amplified from materials that are sold commercially. This material is likely to contain
highly degraded DNA that will be difficult to analysis using DNA profiling.
It is important to accurately distinguish between different species within the Panax
genus or any material used in TCM because they treat different ailments and
adulterations with substitutes diminishs their efficacy. Furthermore, the different types
of raw material used in TCM have different commercial values depending on cultivator
and origin. Although difficult to quantify substitution is known to occur. The ability to
distinguish plant species will enable greater policing of the trade in the materials used
for TCM. Once techniques are established for one sample they can be applied to other
materials used in TCMs, including other plant material as well as animal material. The
use of animal parts is not only a barbaric act but many of the animal parts used are
derived from species that are endangered.
The results of research undertaken to fulfil these aims are presented in this thesis in
three sections. The first section is an introduction that provides background to the TCM
trade and justification for this research. The introduction begins with an outline of the
use and trade in traditional medicines, then proceeds to the reasons to authenticate
material used in TCM and the methods available. The aims and rationale of the
experimental design of this research are then outlined.
Subsequently, in the second section of this thesis, two manuscripts which have been
submitted to journals for review are presented. These manuscripts are presented as per
the requirements for submission of each journal.
iv
The first of the two manuscripts is titled “Differentiation of Ginseng species using
Randomly Amplified Polymorphic DNA (RAPD)” and was submitted to Forensic
Science, Medicine and Pathology. This manuscript contains the results of RAPD
analysis of dried roots of three different Panax species, Panax ginseng, Panax
quiquefolium and Panax notoginseng. Results are also presented of the analysis of
liquid samples, as TCM are sold in a variety of forms ranging from intact roots to
indistinguishable powders and liquids the authentication of liquid samples is necessary.
In many situations, plant materials are mixed to augment the value of the active
ingredient. Consequently, mixing experiments were performed in order to determine
whether RAPD analysis is sensitive enough to distinguish the materials within mixtures.
The second manuscript titled “Identification of Panax plant species within mixtures
using Randomly Amplified Polymorphic DNA (RAPD)” was submitted to the journal
Planta Medica and presents the results of analysis of mixture samples. Samples of three
Panax species were mixed together and analysed. P. ginseng was also mixed with a
genetically unrelated positive control (potato).
Following the two papers is a general discussion and conclusions section that brings
together the material presented in the manuscripts and outlines where the results fit
within the currently available research literature. The bibliography presented after the
concluding section contains all references used within the thesis. After the bibliography
Appendix A contains the recipes for solutions and the methodologies used in the
laboratory for this research.
All laboratory bench work completed for this thesis was performed by me. I collected
the samples and systematically labeled them to ensure no cross contamination between
species. I extracted the DNA from each sample. The primers used for analysis were
selected from my review of the relevant literature and genomic databases. I performed
all PCR experiments and electrophoresis interrogation.
I attended the 17th
Meeting of the International Association of Forensic Sciences in
2005. I collated all the data for the first manuscript and presented it at the 18th
International Symposium on the Forensic Sciences held by the Australian and New
v
Zealand Forensic Science Society (Fremantle, Australia, 2007). The manuscripts were
written by myself and revised in consultation with my supervisors.
vi
TABLE OF CONTENTS
ACKNOWLEDGEMENTS .......................................................................................... ii
PREFACE .................................................................................................................... iii
TABLE OF CONTENTS ............................................................................................ vii
ABSTRACT ............................................................................................................... viii
DEFINITIONS ............................................................................................................... x
ABBREVIATIONS AND SYMBOLS ...................................................................... xiii
SCIENTIFIC AND COMMON NAMES ................................................................ xivv
SECTION 1: GENERAL INTRODUCTION ................................................................ 1
1 Background ............................................................................................................. 2
2 Traditional Medicine ............................................................................................... 3
3 Forensic Significance .............................................................................................. 4
3.1 Reasons to Authenticate TCM composition .................................................... 4
3.1.1 Misrepresentation on labelling. ................................................................ 4
3.1.2 Substitution with alternative species. ........................................................ 4
3.1.3 Poisonous Materials ................................................................................. 5
3.1.4 Identification of endangered species. ........................................................ 6
3.2 Authentication of TCM .................................................................................... 7
3.2.1 Traditional methods .................................................................................. 7
3.2.1.1 Morphological and Histological Analysis .......................................... 7
3.2.1.2 Chemical Analysis ........................................................................... 10
3.2.1.3 Immunological Authentication......................................................... 11
3.2.2 An Alternative Technique – DNA Analysis ............................................. 13
4 DNA Profiling ....................................................................................................... 15
4.1 Background to DNA ...................................................................................... 15
4.1.1 The Structure of DNA .............................................................................. 15
4.2 Polymerase Chain Reaction ........................................................................... 17
4.2.1 Types of DNA Polymorphisms ................................................................ 19
4.3 Use of DNA profiling to authenticate TCM .................................................. 22
4.3.1 Low C0t DNA profiling ............................................................................ 22
4.3.2 Restriction Fragment Length Polymorphism .......................................... 24
vii
4.3.3 DNA Sequencing ..................................................................................... 24
3.3.4 Microsatellites ......................................................................................... 26
3.3.5 Randomly Amplified Polymorphic DNA (RAPD) ................................... 27
3.3.6 Sequence Characterised Amplified Region (SCAR) ................................ 28
4 Aims and Rationale of Experimental Design ........................................................ 30
SECTION 2.1: Differentiation of Ginseng species using Randomly Amplified
Polymorphic DNA (RAPD). ........................................................................................ 33
SECTION 2.2: Identification of Panax plant species within mixtures using a Randomly
Amplified Polymorphic DNA (RAPD) method. .......................................................... 48
SECTION 3: GENERAL DISCUSSION AND CONCLUSIONS .............................. 62
Summary of Conclusions ......................................................................................... 69
BIBILOGRAPHY ........................................................................................................ 70
APPENDIX A .............................................................................................................. 83
viii
ABSTRACT
Traditional medicines are used by millions of people throughout the world as their
primary source of medical care. A range of materials are in used traditional medicines
including plant and animal parts. Even though the traditional medicine trade is
estimated to be worth sixty billion dollars annually the trade remains largely
unregulated. Unscrupulous practices by vendors to increase their profit margins such as
substituting and adulterating expensive material with cheaper varieties go unchecked.
This can be dangerous to consumers because some substitutions involve poisonous
material. Also, animal parts from endangered species can find their way into traditional
medicines, therefore there needs to be a way to identify them in traditional medicines to
prosecute poachers.
The traditional techniques used for the identification of material used in Traditional
Chinese Medicine (TCM) include, morphological, histological, chemical and
immunological analysis. However, these techniques have their limitations. This makes
applying multiple techniques essential to provide thorough authentication of the
material. DNA profiling provides a technique well suited to analysing material used in
TCM.
DNA profiling is advantageous over other techniques used to authenticate material used
in TCM because it requires only a small sample amount, can determine the cultivator,
be used on all forms of TCM and potentially distinguish the components of mixtures.
Limited research has been done to DNA sequence the materials used in TCM, therefore
a technique not requiring any DNA sequence information needs to be employed.
Randomly Amplified Polymorphic DNA (RAPD) analysis uses a single arbitrary primer
of between 10 and 20 base pairs in length to amplify DNA. As the primer is not
designed to be specific to a sample the primer binds at a number of locations along the
DNA sequence of the sample creating a number of fragments of varying sizes. The
number and size of the fragments produced varies from one DNA sequence to the next.
ix
Therefore, profiles of different species/individual are different and species’ can be
distinguished.
Commercially sold traditional medicines are processed which is likely to degrade the
DNA of the sample making extraction and amplification difficult. Here an organic
Phenol:Chloroform extraction technique extracted DNA from commercial dried root
samples. The extracted DNA was amplifiable using RAPD primers. The RAPD
primers used here produced enough polymorphic bands to distinguish different plant
species. They were used to distinguish commercial samples that were sold as three
different species within the Panax genus, Panax ginseng, Panax quinquefolium and
Panax notoginseng and genetically unrelated plant material; Potato and
Eleutherococcus senticosus.
Liquid samples and mixtures were also profiled with the RAPD primers to determine
whether the RAPD primers provide enough distinguishing ability to analyse these forms
of TCM. DNA was extracted from the liquid samples, one a ginseng drink and the
other an ginseng extractum. However, there was no reliability in the production of PCR
products. The analysis of the mixture samples found that not enough polymorphic
bands were produced by the RAPD primers used here to identify Panax species within
mixtures of two Panax species. While when P. ginseng was mixed with a genetically
unrelated sample there was enough polymorphism to differentiate the two samples in
the mixture.
The results of this research show that RAPD analysis provides a simple and inexpensive
technique to begin analysis of materials used in TCM. Using RAPD analysis it is
possible to distinguish Panax plant species from each other. However, the RAPD
primers used here did not provide enough reproducibility or polymorphism to analyse
liquid and mixtures of Panax species plants.
x
DEFINITIONS
Antibody A large molecule produced by the body
in response to a foreign antigen that
enters the body. The antibody is
complementary to the antigen so the
antibody and antigen bind.
DNA The genetic information contained within
the nucleus each cell within an organism.
DNA Sequencing
Determining each nucleotide in a
segment of the DNA genome.
Low C0t DNA DNA with a highly repetitive sequence
that is separated from other DNA
fragments based the time it takes to
reanneal after denaturing.
Microsatellite A short sequence of bases that is repeated
a number of times in a row. As referred
to as Short Tandem Repeats (STR).
Molecular Marker Molecule A chemical compound when present in a
sample indicates that the sample is a
particular substance, for example Panax
plant species are indicated by
ginsenosides.
Nucleotide The smallest unit of DNA molecule. A
base attached to a sugar molecule.
xi
Polymerase Chain Reaction
A method used in DNA profiling that
amplifies the number of copies of a
fragment of DNA.
Polymorphisms
Differences in the sequences of samples.
These polymorphisms are deletions,
inclusions and single point switches.
Primers
Short strands of nucleotides of known
sequence, which bind to the DNA and to
which nucleotides are added to build a
new strand of DNA during PCR.
Randomly Amplified Polymorphic DNA
(RAPD)
A DNA profiling technique where short
arbitrary primers are used that are not
specific to the sample being tested.
Restriction Fragment Length
Polymorphism (RFLP)
Restriction enzymes cut the DNA at sites
along the DNA sequence and differences
in the sequence between the sites is
measured by the length of the DNA
fragments produced.
Sequence Characterised Amplified
Region (SCAR)
A DNA profiling technique that
sequences polymorphic DNA fragments
from RAPD primers and creates primers
that only amplify when testing the sample
that had the polymorphic band.
Single Nucleotide Polymorphism (SNP) DNA profiling technique that examines
differences in single nucleotides of
samples.
xii
Taq Polymerase
An enzyme used for PCR to copy a
fragment of DNA.
Traditional Chinese Medicine (TCM) Medicines using natural products which
originated in China. These medicines use
plant and animal material for the
treatment of ailments. The medicines are
available in a variety of forms from
whole plant materials through pills,
potions, powders and mixtures.
xiii
ABBREVIATIONS AND SYMBOLS
DNA Deoxyribonucleic acid
EDTA Ethylenediaminetetraacetic Acid
PCR Polymerase Chain Reaction
RAPD Randomly Amplified Polymorphic DNA
RFLP Restriction Fragment Length Polymorphism
SCAR Sequence Characterised Amplified Region
SNP Single Nucleotide Polymorphism
STR Short Tandem Repeat
TBE Tris Borate EDTA
TCM Traditional Chinese Medicine
WHO World Health Organisation
BSA Bovine Serum Albumin
ddNTP dideoxynucleotide triphosphate
dNTP deoxynucleotide triphosphate
TE Tris EDTA Buffer
MgCl2 Magnesium Chloride
µ Micro
oC Degrees Celsius
xiv
SCIENTIFIC AND COMMON NAMES
Scientific Name Common Name
Panax ginseng Chinese ginseng
Panax quinquefolium American ginseng
Panax notoginseng Sanchi ginseng
Eleutherococcus senticosus Siberian ginseng
Mirabilis jalapa Four O’clock Flower
Phytolacca acinosa Indian Poke
Radix Angelica Dang-gui
Crocus sativus Saffron crocus
Radix astragali Milk-Vetch
Pterocaulon sphacelatum Apple Bush
Stephania tetrandra Han fang ji
Aristolochia fangchi Guang fang ji
Angelica acutiloba Dong dang gui
Fritillaria cirrhosa Chuan bei mu
Coleus forskohlii Makandi
Symplocarpus foetidus Skunk cabbage
Pinellia ternata Crowdipper
Gastrodia elata Tien ma
1
SECTION 1
GENERAL INTRODUCTION
2
1 Background
Traditional and natural medicines are used throughout the world as a primary source of
medical care for millions of people especially those without access to western medicines.
Many cultures continue to practise medical treatments used by their ancestors for thousands
of years (Barnes & Prasain, 2005; Chan et al., 1993). Within western societies natural and
traditional medicines are growing in popularity with large proportions of the population
using these medicines as alternatives to conventional treatments.
The scope of traditional medicine is evidenced by the fact, that the natural medicine trade is
estimated to be worth approximately sixty billion dollars annually (World Health
Organisation, 2003; Yee et al., 2005). The World Health Organisation (WHO) also
estimates that up to 80% of the African population use traditional medicines for primary
health care (World Health Organisation, 2003). In Europe, North America and other
industrialised regions over half the population have reportedly used complementary or
alternative medicines (World Health Organisation, 2003). Traditional medicines have also
become conventional medicines; 25% of modern medicines are plant based, where the
plants were used initially in traditional treatments (World Health Organisation, 2003).
Even though the traditional medicine trade is worth an estimated sixty billion dollars
annually the industry remains largely unregulated (Yee et al., 2005). This allows
unscrupulous practises by vendors to go unnoticed. Therefore, techniques need to be
developed to authenticate the materials sold and used in traditional and natural medicines.
3
2 Traditional Medicine
The natural flora and fauna of a region people inhabit can be investigated by the inhabitants
to determine which can be used to remedy ailments. For example, Australian Aborigines
used Pterocaulon sphacelatum a perennial herb of Australia as a treatment for colds
(Semple et al., 1999). Since pre-Columbian times South American Indians have used
tobacco for medical, magical and recreational purposes (Wilbert, 1991). Within Africa
herbal remedies have been used as everything from antibacterial, anti-malaria and anti-
inflammatory agents to treatments for mental illnesses including depression and
Alzheimer’s disease (Fennell et al., 2004).
Traditional Chinese Medicines (TCM) are one of the most commonly used natural based
medicines in the world (World Health Organisation, 2003). The use of TCM was first
recorded in China over 2,000 years ago (Hon et al., 2003). TCM treats ailments by
restoring the balance between Ying and Yang, two opposing forces within the body that
when unbalanced cause illnesses. The restoration of Ying and Yang returns the
physiological conditions within the body to a balance (Guili & Chengbo, 1997). Materials
used in TCM include; plant and animal parts and they come in a variety of forms from pills
and powders to liquids and extracts.
A commonly used material in TCM is the roots of the Panax genus plants (Coleman et al.,
2003). There are a number of different species within this genus each used for the
treatment of different conditions (Guili & Chengbo, 1997). Species within this genus are
commonly referred to as ginseng with different species identified by their country of origin,
for example there are Chinese, Korean, American and Siberian ginsengs available.
However, each country does not indicate a different plant species, Chinese and Korean
ginsengs are both the Panax ginseng species. American ginseng is Panax quinquefolium
while Siberian ginseng is not a member of the Panax genus but Eleutherococcus
senticosus. There are a number of factors that determine the price of Panax roots, these
4
include country of origin, whether it is wild grown or farm grown and whether it is fresh or
dried.
3 Forensic Significance
As TCM is such a profitable industry world-wide the introduction of fraudulent items and
the lowering of expensive materials concentrations by vendors has become an unfortunate
reality. These practises break laws in different countries and in order to prosecute
perpetrators police require evidence. Therefore, it is important to develop forensic
techniques robust enough to allow illegal practises to be identified.
3.1 Reasons to Authenticate TCM composition
3.1.1 Misrepresentation on labelling.
The diminishing sources of raw material coupled with soaring prices, have lead to a
temptation for vendors to use lower concentrations of raw material than indicated on
packaging. This practise is easily accomplished when TCM are mixtures or pill, potion and
extract forms. Cui et al. (1994) found that six of fifty samples they tested contained no
detectable traces of ginsenosides, the chemical marker for Panax plant species, although
they claimed to contain P. ginseng. More recently, using Randomly Amplified
Polymorphic DNA (RAPD) and DNA sequencing, Mihalov et al. (2000) found that two out
of ten samples claiming to contain P. ginseng did not contain detectable traces of the plant.
3.1.2 Substitution with alternative species.
Counterfeiting is also common practice in the trade of TCM. This is when cheaper material
is exchanged for more expensive material when the two look-alike or in other forms of
TCM. The study by Mihalov et al. (2000) found two samples claiming to contain P.
ginseng that were identified by DNA analysis as containing soybean. Chan et al. (2000)
found that of twelve commercial ginseng products a quarter contained substitutions for an
5
item described on their label. But (1994) described cases of people falling ill after taking
TCM, the cause of the illness was traced to them having received poisonous material
substituted for other material. In these cases, the material was substituted by both the
pharmacist and the distributor, indicating a number of people in the supply chain benefit
from substitution of alternative species.
A famous case of the substitution of one material for another was the case where between
1990 and 1992, some 100 patients at a Belgium weight loss clinic became critically ill
(Schaneberg & Khan, 2004). The patients became ill with kidney failure and some required
dialysis or transplants. The case was attributed to the substitution of Stephania tetrandra
with Aristolochia fangchi, which is poisonous. Chan et al. (2005) also reported
substitutions of Stephania tetrandra with Aristolochia fangchi resulting in illness.
3.1.3 Poisonous Materials
The sale or importation of poisonous material is an illegal and dangerous practice. While
some poisonous materials are used in TCM after some processing or in a mixture with a
neutralising agent (Dickens et al., 1994). It is when they are sold as adulterations or
substitutes to unsuspecting consumers that they pose a serious threat to consumer’s health.
Examples of the substitution of indicated material for poisonous alternatives are described
throughout the research literature. For example, two common adulterants of P. ginseng are
Mirabilis jalapa (the Four O’Clock Flower) and Phytolacca acinosa (Indian Poke) are
poisonous (Ngan et al., 1999). These substitutions may not be harmful in most cases unless
someone self medicates and increases the amount of material they are consuming, then
problems occur. Another example is the case of the Belgium weight loss clinic described
above.
Not only can TCM contain poisonous plant and animal materials but toxic metals have also
been found in samples. Espinoza et al. (1996) analysed twelve commercial herbal balls and
found that eight contained Arsenic and/or Mercury; only two samples contained neither.
6
The authors outlined how by taking the recommended daily dose of the herb balls (2 per
day) people consumed up to 73mg of Arsenic and 1,200g of Mercury a day. Those levels
are above the previously reported levels of consumption that caused chronic poisoning of
12mg and 262mg per day for Arsenic and Mercury respectively (Kew et al., 1993; Tay &
Seah, 1975).
3.1.4 Identification of endangered species.
TCM are not exclusively plant material, parts of animals many of which are endangered are
common ingredients (Still, 2003). Poaching occurs illegally throughout the world and a
common end point for the resulting animal material is as part of traditional medicines.
DNA profiling of endangered animals so they can be identified when sold has been
undertaken on a number of animals to try and stop poaching (Lorenzini, 2005; Manel et al.,
2002; Palsboll et al., 2005)
An example of endangered animal material used in TCM is that of the tiger (Panthera
tigris). Bones of tigers are used in combination with other animal and plant extracts in pills
and plasters for the treatment of rheumatism and other ailments (Still, 2003; Wetton et al.,
2002). Since it is illegal to trade in endangered species, it is important to develop methods
to authenticate the presence of animal material in TCM, in order to enforce legislation
against the poaching of animals.
Wetton et al. (2002) described a highly sensitive tiger-specific real-time PCR assay using
primers specific to the mitochondrial cytochrome b gene of tigers. DNA was successfully
amplified from blood, hair, bone and TCM spiked with bone from the tiger. Other DNA
research has been done to identify tigers using microsatellites (Singh et al., 2004; Xu et al.,
2005). DNA profiling research has been used to identify snake (Yau et al., 2002), elephant
ivory (Comstock et al., 2005), seahorse (Zhang et al., 2003) and turtles (Lo et al., 2006).
Similar strategies can be developed for other endangered animal species including
rhinoceros, bears, and primates.
7
Cruel and inhumane treatment of wildlife by people continues to occur for the collection of
material to use in traditional medicine. An example is keeping live bears in cages with
catheters in their Gall Bladders to milk their bile (Espinoza et al., 1993; Espley, 2006).
When keeping the bears alive is too much trouble, countless numbers are slaughtered across
Asia each year and their Gall Bladders removed. The Gall Bladder of bears is thought by
many to provide relief from fever, detoxify the liver and reduce pain and swelling
(Espinoza et al., 1993; Espley, 2006).
3.2 Authentication of TCM
3.2.1 Traditional methods
Methods traditionally used to authenticate material used in Traditional Chinese Medicine
(TCM) include, morphological, histological, chemical and immunological analysis. These
methods are able to provide authentication of materials used in TCM with varying levels of
success. Each technique has advantages and disadvantages; as such it is best to use a
combination of techniques to provide more reliable conclusions. A comparison of the
techniques available to authenticate material used in TCM is given in Table 1.
3.2.1.1 Morphological and Histological Analysis
Morphological identification of materials used in TCM has been practiced for as long as
TCM has been used. Morphological analysis provides fast and accurate identification that
anyone can use, based on their experiences with the material. This is especially true for
material commonly encountered such as Panax plant species. Morphological identification
relies on a person’s experience to identify material based on its appearance.
For many plants their appearance is enough to accurately distinguish them from other
plants, as they look considerably different to others. For example, when dried, P.
notoginseng is a black root that is easily distinguishable from P. ginseng and P.
quinquefolium. However, P. ginseng and P. quinquefolium are not easily distinguished
8
from each other, as they both are light brown/yellow in colour after drying and have similar
shapes, see Figure 1.
Advantages of using morphological analysis to identify material used in TCM include ease
and accuracy. Experts with years of knowledge on which to rely can simply examine the
material and identify it. However, these advantages rely on what is a major limitation of
the technique, that an expert is required which means it is not a quantitative technique.
This is a considerable problem when no expert is available and it is time consuming and
expensive for a person to gain enough experience to be considered an expert. Also, the
identification remains the expert’s subjective opinion if samples are not compared to an
exemplar.
There are a number of other serious limitations when using morphological analysis to
identify material used in TCM. Firstly, two plant species may have very similar
morphologies making it difficult to distinguish between them. Another limitation is that
morphological analysis cannot be used on all forms of TCM. For instance, plants are sold
in many different forms ranging from slices to processed powders or liquids which cannot
be authenticated using morphological analysis, see Figure 1 for examples of the variety of
material sold as TCM. Finally, TCM are commonly mixtures, the components of which are
very difficult to distinguish using morphological analysis.
Histological analysis is when the cells of the sample are examined under a microscope.
Morphology and other characteristics of the cells are used as indicators of the material the
cells are from. Hence the sample can be identified.
Limitations of histological analysis are similar to those of morphological analysis,
including, that it cannot be applied to TCM of all forms. For example, it is unlikely that
whole cells will be found in liquid TCM. Also, drying and processing samples prior to
their sale may affect the structure of the cells differently depending on the procedures used,
complicating their identification.
9
Figure 1. Examples of the different forms of TCM. A. The different ginseng
products shown in this picture include liquid samples, both an extractum and
a liquid drink, whole dried root material, slices and dried root pieces.
B. Samples of Panax species, clockwise from top left whole P. ginseng
root, P. quinquefolium pieces, P. notoginseng pieces and P. ginseng pieces.
A
B
10
3.2.1.2 Chemical Analysis
Chemical analysis involves the determination of the chemical composition of material in
order to identify it. There are a large variety of techniques available to do this. Chemical
analysis is advantageous over the morphological techniques outlined above, as it can be
applied to any form of TCM.
A commonly used chemical analysis type for material used in TCM is to use specific
marker molecules. This method is routinely used for the authentication of materials used in
TCM (Chan et al., 2000; Cui et al., 1994; Dou et al., 1996; Feng & Li, 2002; Liu et al.,
2001; Tawab et al., 2003; van Breemen et al., 1995; Zhang et al., 2002; Zhao et al., 2003).
It involves the detection of molecules identified as being specific to a certain species or
genus. For example, the presence of ginsenosides, a group of saponins, indicates a sample
is of the Panax genus (Assinewe et al., 2003; Chan et al., 2000; Dou et al., 1996; Du et al.,
2003; Fuzzati, 2004; Mallol et al., 2001; Zhang et al., 2002). While the presence of ferulic
acid with Z-ligustilide indicates a sample is Radix Angelica (Lao et al., 2004; Zhao et al.,
2003).
Chemical analysis provides the advantage over other techniques of being able to be used to
determine the pharmacologically active components of traditional medicines. For example,
many of the specific indicator molecules that are used to identify materials used in TCM
are the active components of the material. This is not possible with other techniques such as
DNA profiling.
Reliance on specific indicator molecules to identify a single plant genus is not possible.
Ginsenosides that are considered to be specific to one of the Panax species can be found in
the Panax other species (Popovich & Kitts, 2004). Also, ginsenosides have been extracted
from plants not in that genus (Tanaka et al., 2005). Tanaka et al (2005) were able to extract
ginsenoside Rb1 from Kalopanax pictus in higher concentrations then found in P. ginseng.
This means that the presence of specific marker molecules cannot be relied upon
exclusively, to identify genus or species of plants (Dong et al., 2003; Lao et al., 2004).
11
One problem with TCM analysis is trying to determine cultivators and where the sample is
grown. One possible way to distinguish cultivators is by comparing the abundances of the
chemical within the sample because the abundances vary depending on where the sample is
grown (Dong et al., 2003; Lao et al., 2004). So, the abundance of athe particular molecular
marker in a plant can be related back to other plants from its region of growth.
Other limitations of chemical analysis include that it requires a substantial amount of
material to be tested, which is not always available when analysing TCMs. Distinguishing
the components of a mixture is difficult using chemical analysis because the analysis only
provides a chemical profile of the whole sample and identification of ingredients may not
be possible. When trying to identify the components of a mixture, testing for the presence
of ginsenosides does not identify which species is in a mixture if it contains multiple Panax
species.
3.2.1.3 Immunological Authentication
Antibodies have also been used for the identification of material used in TCM (Fukuda et
al., 1999; Fukuda et al., 2000a; Fukuda et al., 2000b; Fukuda et al., 2001; Kitagawa et al.,
1997; Putalun et al., 2002; Putalun et al., 2004; Shoyama et al., 1999). Antibodies are large
immunoglobulins produced by the body’s immune system in response to a foreign
pathogen, called an antigen (Roitt, 1991). Antibodies produced in response to an antigen
have a complementary structure to that antigen so when they are later encountered they
bind together. When bound in required concentrations the antibody-antigen complex
precipitates, this property of the antibody-antigen complex allows for the identification of
material using a variety of immunological techniques. These techniques range from simple
Ouchterlony methods where antibodies and possible antigens are mixed and precipitation is
checked for, to ELISA where multiple antibody-antigen bindings occur with fluorescent
labelling and light detection.
Antibodies tend to be produced against the chemical components within a sample, for
example, antibodies were made against an activating pectin found in the roots of Angelica
12
acutiloba (Wang et al., 1999), forskolin from the plant Coleus forskohlii (Yanagihara et al.,
1996) and tetrahydrocannabinolic acid from Cannabis sativa (Tanaka & Shoyama, 1999).
Antibodies have been produced against a number of the ginsenoside compounds contained
within samples of Panax genus plants (Fukuda et al., 1999; Fukuda et al., 2000a; Fukuda et
al., 2000b; Fukuda et al., 2001; Jung et al., 2002; Nah et al., 2000; Putalun et al., 2002;
Putalun et al., 2004; Saita et al., 1993; Tanaka et al., 1999; Tanaka et al., 2006; Yoon et al.,
1998).
Fukuda et al. (2000) produced antibodies against ginsenoside Rg1, one form of the
ginsenoside compound found in Panax species. They showed that the different Panax
species could be distinguished from each other using competitive ELISA to measure the
antigen content within the sample. Tanaka et al. (1999) found that they could produce
antibodies against ginsenoside Rb1 and could discriminate Panax species using the same
method as Fukuda et al. (2000). Antibodies have also been produced against ginsenosides
Rf and Rg2 (Yoon et al., 1998). Tanaka et al. (2006) used monoclonal antibodies against
ginsenoside Rb1 to identify Panax ginseng, Panax notoginseng, Panax quinquefolius and
Panax japonicus. Their protocol used ELISA and western blotting.
An advantage of using antibodies is that field tests can be developed which maybe
marketed or added to forensic police kits as a presumptive test. These tests could be based
on already available designs such as pregnancy tests where the binding of the antibody and
the antigen causes a colour change on the testing stick. Alternatively a small Ouchterlony
based assay could be developed.
A limitation of antibody research is that the cultivators of the material are difficult to
determine based only on the antigens present in the sample because the presence of
ginsenosides in a sample, as detected using antibodies, will not vary from one cultivator to
the next. Also it will be difficult to distinguish the components of a mixture, for example, a
mix of more than one species of Panax genus.
13
3.2.2 An Alternative Technique – DNA Analysis
An alternative to the techniques described above is to analysis TCM ingredients using DNA
profiling techniques. DNA analysis of material used in TCM requires the application of
DNA protocols generally used for profiling human, animal and plant to TCM. DNA
analysis has been applied to a number of different materials used in TCM using a number
of different techniques (Boehm et al. 1999; Chung et al. 2002; Cui et al. 2003b; Ha et al.
2001; Hon et al. 2003; Tanaka et al. 2006).
Advantages of using DNA profiling over more traditional techniques described above
include, the requirement of only a small sample amount, TCM in any form including slices,
pills, powders, potions or extracts can be analysed and most importantly DNA techniques
can potentially distinguish the components of a mixture, which is not possible using
traditional techniques.
14
Table 1: Comparison of Advantages and Disadvantages of different identification techniques for material used in
TCM.
Morphology Chemistry Immunology DNA
Basis of
identification
Comparison of
morphology
Determination of the
chemical composition
Detection of antigens
within material by
antibody binding
Comparison of DNA
polymorphisms
between materials
Advantage of
method
Simple Can distinguish
cultivators
Can be used on all
sample types
Can be developed as a
field test
Uses small amounts
Can be used on any
form of TCM
Can distinguish
species and
cultivator
Can be developed
for a field test
Disadvantage of
method
Cannot be used on all
TCM forms
Samples may not be
distinguishable from
others based on
morphology
Requires a large
sample size
Difficult to use on
mixtures
Cannot determine
cultivator
Difficult to use on
mixtures
Expensive to
establish some of
the techniques
15
4 DNA Profiling
4.1 Background to DNA
Profiling of DNA samples is routinely used in forensic laboratories for the identification of
people involved in or related to crimes (Tamaki and Jeffreys, 2005). It is also used for
uncovering fraud in the livestock trade, especially in the multi-billion dollar thoroughbred
industry (Lee & Cho, 2006). DNA profiling also has civil applications, for example in
assigning paternity to children (Schneider, 2007; Sobrino et al., 2005; Coney, 1999). DNA
was first applied in a forensic context in 1985 when Alec Jeffreys applied RFLP to a
criminal case (Gill et al., 1985; Tamaki & Jeffreys, 2005). Since, then the reliance on DNA
analysis to provide evidence in criminal cases has increased dramatically.
DNA profiling is a commonly used technique for the identification and authentication of
biological material. For example, it has been used for the authentication of meat products
where the material being sold is mixed with a different species or sold under a different
label (Calvo et al., 2002; Saez et al., 2004). DNA techniques have also been used to
differentiate genetically modified plants from un-modified food (Leimanis et al., 2006; Lee
et al., 2006)
4.1.1 The Structure of DNA
DNA is made up of subunits called nucleotides; each is the combination of a base and a
sugar molecule (Sherwood, 1997). There are four different bases in DNA molecules,
adenosine, thymine, cytosine and guanine. Each nucleotide is connected to the phosphate
backbone that joins all nucleotides in the DNA molecule together. In this way a long
strand of nucleotides is created. Bases are complementary to each other and bind together
through hydrogen bonds in pairs; guanine with cytosine and adenosine with thymine and
the DNA molecule is double helix shaped, shown in Figure 2.
16
Figure 2. The Structure of DNA (reproduce from Sherwood, 1997). The DNA
molecule is made up of nucleotide bases attached to a Sugar-Phosphate
backbone and forms a double helix structure. There are four nucleotide
bases, which bind together in pairs, cytosine with guanine and adenine with
thymine.
Phosphate- Sugar
Backbone
Adenine
Guanine
Cytosine
Thymine
17
Plant DNA has the same structure as all other types of DNA, therefore methods used to
analyse other DNA samples can be applied to the DNA of plants. The difference between
human and plant DNA, besides the sequence of bases, is that plant cells may contain more
than 48 chromosomes normally found in each human cell (Blair, 1975; Yi et al., 2004). In
plants there can be up to double or triple that many chromosomes in each cell, for example
Symplocarpus foetidus contains 60 chromosomes (Blair, 1975). This does not affect the
protocols involved in DNA profiling or any results obtained from DNA analysis.
DNA can be used to distinguish different plant species because all plants within a plant
species have the same DNA sequence and each different species has a different DNA
sequence. DNA analysis has previously been used to profile many plant spceies including,
celery (Dovicovicova et al., 2004), cannabis (Hsieh et al., 2005; Linacre & Thorpe, 1998),
Echinacea species (Kapteyn et al., 2002), grasses (Ward et al., 2005) and plants used in
TCM, for example Radix astragali (Ma et al., 2000), Fritillaria cirrhosa (Li et al., 2003)
and Crocus sativus (Ma et al., 2001).
4.2 Polymerase Chain Reaction
DNA based techniques used to identify material, whether it be human, plant or animal, use
a technique called Polymerase Chain Reaction (PCR). PCR, is molecular photocopying,
where the number of copies of a fragment of DNA is increased as new copies of DNA are
produced. The steps involved in PCR is shown schematically in Figure 3.
18
Figure 3. The Polymerase Chain Reaction occurs in three steps. First, the DNA in
denatured by heating. Then the temperature is lowered and the primers
anneal. Finally, nucleotides are added to the primer to create a new
complementary strand of DNA.
3’ 5’
5’ 5’
TACGACCCATCCGTATGG
ATGCTGGGTAGGCATACC
3’
ATGCTGGGTAGGCATACC
TACGACCCATCCGTATGG 3’ 5’
5’
Denature
Bases are
added
during
extension
ATGCTGGGTAGGCATACC
TACGACCCATCCGTATGG
3’
3’ 5’
5’ ATGCTGGGTAGGCATACC
TACGACCCATCCGTATGG
3’
3’ 5’
5’
ATGCTGGGTAGGCATACC
TACGACCCATCCGTATGG
3’
3’
5’
5’
Primers
Anneal
Complementary
strands completed
cycle begins again
3’
3’
3’ TACG
TACC 5’
19
PCR involves three steps, denaturing, annealing and extension (see Figure 3). First the
DNA is denatured, which involves raising the temperature of the sample to near boiling
point. At these temperatures the bonds holding the two strands of DNA together are broken
and the DNA separates into two singles strands. During the annealing step the temperature
is decreased and primers, short strands of nucleotides, bind to the DNA strands where
complementary sequences of nucleotides occur. Finally, during extension a Taq
Polymerase molecule attaches nucleotides, to build a complementary strand of DNA to the
original sample. After this step two sets of double stranded DNA are present for every
DNA double helix started with. Usually PCR protocols require approximately 30 cycles to
be performed after which there are millions of copies of DNA that can be analysed.
4.2.1 Types of DNA Polymorphisms
Different DNA profiling techniques measure different DNA polymorphisms within the
DNA sequence. There are a wide range of polymorphisms that can be measured by various
techniques. Polymorphisms are insertions and deletions of nucleotides within the sequence
or changes in to bases in the sequence. Primers are designed for use in the different DNA
profiling techniques so that fragments containing the polymorphism are amplified.
There are a wide variety of DNA profiling techniques that detection different
polymorphisms. Single Nucleotide Polymorphisms (SNPs) measures differences between
DNA sequences caused by single deletions or insertions, that is changes to single
nucleotides (Rafalski, 2002). Restriction Fragment Length Polymorphism (RFLP) detects
insertions between the sites where a restriction enzyme acts.
Randomly Amplified Polymorphic DNA (RAPD) uses a small arbitrary primer of between
10 to 20 base pairs in length as both the forward and reverse primer (Roberts & Crawford,
2000; Yu & Pauls, 1992). These primers are not designed to be specific to the sample.
This results in the production of a number of different fragments of varying sizes and
number depending on the sample sequence, illustrated in Figure 4. The RAPD analysis
measures a variety of insertions and deletions to create different profiles for different
20
samples. For example, a deletion at the primer binding site will result in no band being
produced. In contrast an insertion between two primer binding sites will result in a larger
sized fragment.
Short Tandem Repeats (STR) analysis uses primers that have been designed to bind to areas
around where a tandemly repeating segment occurs. The result of using this type of primer
is a single fragment of DNA for each primer set. The length of the fragment indicates the
number of tandem repeats. The number of repeats is the variable indicator used to identify
the material with each individual having a different number of repeats.
21
Figure 4. A schematic representation of Randomly Amplified Polymorphic DNA
(RAPD) analysis. A. The short arbitrary primers used for RAPD analysis
binds to multiple places on the DNA sequence of the sample during PCR
resulting in the production of a number of different sized bands. B. A
representation of the electrophoresis gel produced with the fragments
generated from the two samples in A. The fragments are separated based on
the size of the resulting bands. In this example, Samples 1 and 2 have two
bands in common and Sample 2 has an extra smaller band.
B
1 2
A
5’
Sample 1 Extension
DNA
Primer
5’
3’
3’
Sample 2
5’
5’
3’
3’
22
4.3 Use of DNA profiling to authenticate TCM
To analyse TCM using DNA based techniques, primers need to be designed and protocols
optimised for use with materials used in TCM. A range of DNA profiling techniques have
been used to authenticate material used in TCM. Outlined below are different techniques
that have been used. Table 2 shows a summary of the different techniques and the material
they analysed.
4.3.1 Low C0t DNA profiling
Low C0t DNA fingerprinting was applied to TCM by Leung (1999). Low C0t DNA
fragments are highly repetitive; this property allows these DNA fragments to be separated
from other DNA fragments under certain conditions. Low C0t DNA is analysed by
denaturing DNA then re-annealing it, highly repetitive areas will reassociate faster then
single copies of a DNA sequence. These rapidly associating fragments are the low C0t
DNA. These fragments are separated from the other fragments and probed for host-specific
DNA to identify the material. This technique has been used to successfully differentiate
between P. ginseng and P. quinquefolium (Ho & Leung, 2001; Leung, 1999).
The use of low C0t DNA fingerprinting has been surpassed by newer technology and
techniques. It lacks the sensitivity of other techniques and is not practical for large scale
and high throughput testing. Reproducibility of the method is also low as it is highly
dependant on the quality of DNA and other technical factors, such as blotting and
hybridisation conditions. The demand for large amounts of high quality non-degraded
DNA from TCM samples is unrealistic. Since most genomic DNA sourced from TCM
samples is exposed to processing which degrades the DNA.
23
Table 2. DNA profiling techniques previously used to authenticate material used
in TCM.
Species Method DNA marker Reference
Panax species STR analysis Microsatellite (Hon et al., 2003)
Fritillaria cirrhosa DNA sequencing 5S-rRNA spacer
region (Li et al., 2003)
Panax species RAPD Analysis 5S-rRNA spacer
domains (Cui et al., 2003)
Dendrobium
species DNA sequencing rDNA ITS region (Ding et al., 2002)
Panax ginseng AFLP & DAMD minisatellite Pg2 (Ha et al., 2002)
Pinellia ternata RAPD & PCR-
RFLP
20-mer random
primers
(Chung et al.,
2002)
Atractylodes plants RAPD 20-mer random
primers (Chen et al., 2001)
Panax species RAPD & PCR-
RFLP 18S rRNA gene
(Fushimi et al.,
1997)
Ginseng and
Amaranthus
Low C0t DNA
fingerprinting C0t-1 DNA (Leung, 1999)
Panax species RAPD Unspecified (Shaw & But,
1995)
24
4.3.2 Restriction Fragment Length Polymorphism
Restriction Fragment Length Polymorphism (RFLP) uses restriction enzymes to cut the
DNA sequence at certain locations along the DNA sequence. Samples can be distinguished
because the DNA fragments created vary in size, as the distance between the restriction
sites varies from one sample to another. This enables samples to be distinguished based on
the sizes of the fragments produced.
RFLP analysis has been used on a number of plant and animal species used in TCM
(Fushimi et al., 1997; Um et al., 2001; Watanabe et al., 1998; Yue et al., 2002). Chung et
al (2002) found that by using RFLP they could distinguish Pinellia ternata roots grown in
China from those grown in Korea. Also, Um et al. (2001) investigated the profiles of P.
ginseng grown at different locations using RFLP. They found that where some of the
samples were grown could be could be differentiated from the others.
This assay is more reproducible than Low C0t DNA fingerprinting and RAPD techniques.
However, RFLP analysis is also limited because it requires large amounts of high quality
DNA which may not be present in samples of TCM. Materials used in TCM are dried and
processed before they are sold, this processing and drying degrades the DNA found in the
sample. Also, the degree of polymorphism detectable by this type of technology limits the
techniques ability to distinguish closely related cultivators. In addition, this technique is
not applicable for a high-throughput laboratory environment.
4.3.3 DNA Sequencing
DNA sequencing is the gold standard of DNA profiling techniques. It involves the
determination of every base in the DNA sequence of a certain segment of the DNA. To do
this after PCR amplification a sequencing reaction is performed, which works on the same
principles as PCR, only modified nucleotides (ddNTPs), referred to as stop nucleotides, are
added to the reaction mixture along with nucleotides (dNTPs). When a stop nucleotide is
incorporated into the sequence extension is terminated. This creates DNA fragments of
varying lengths. The fragments are separated by electrophoresis and as each stop
25
nucleotide is tagged a different colour, the colour present at each location indicates which
of the stop nucleotides was incorporated into the fragment and hence the sequence of the
sample is determined.
Minimal DNA sequencing has been done on material used in TCM (Dong et al,. 2003; Kim
& Lee, 2004; Kim et al., 1991; Lee & Wen, 2004; Mihalov et al., 2000; Sun et al., 2004).
Kim et al (1991) DNA sequenced a region of the mitochondrial DNA of the P. ginseng
herb. This analysis provided only information on one species Korean ginseng (P. ginseng).
Also, the segment of DNA was only small compared to the total genome available for
analysis. Dong et al. (2003) sequenced three regions of the genome (5S rRNA spacer,
Internal Transcribed Spacer (ITS) and 18S regions) of Astragalus genus plant species to
determine their phylogeny. Much of the DNA sequencing of plant material is done on the
ITS, 18S and 5S rRNA regions because they are highly variable regions of DNA from one
plant species to the next (Chen et al., 2002; Komatsu et al., 2001; Linder et al., 2000;
Mizukami, 1995; Wen et al., 1998; Wen & Zimmer, 1996; Zhao et al., 2002; Zhao et al.,
2001).
Miholav et al. (2000) performed DNA sequencing on American and Korean ginseng dried
root material along with commercial products. Miholav et al. (2000) sequenced an area of
the ribosomal ITS region and were able to distinguish the American and Korean ginseng
based on differences in four bases.
Ding et al. (2002) DNA sequenced the ITS region (an area of ribosomal DNA (rDNA)) in a
number of Dendrobium species. They found they could distinguish these species by
comparing differences in single nucleotides of the sequences. Detection of Single
Nucleotide Polymorphisms (SNPs) could potentially be used to distinguish cultivators of
plant material.
However, DNA sequencing techniques are fairly labour intensive and are relatively
expensive. The availability of DNA sequences provides opportunities to produce
simplified assays by designing primers based on the sequence information acquired. These
26
primers can be developed to detect Single Nucleotide Polymorphisms (SNPs) and other
forms of polymorphisms recognised from the sequence information (Wen & Zimmer,
1996). The determination of SNPs will also allow DNA “lab-on-a-chip” to be developed
for use in the field (Carles et al., 2001; Lee & Rasmussen, 2000). An example, is the
Silicon based microarrays developed by Carles et al. (2001) for the detection of DNA
polymorphism to identify toxic plant material used in TCM.
3.3.4 Microsatellites
Microsatellite analysis is regularly used in the forensic community for the identification of
people using Short Tandem Repeats (STR) markers (Tamaki & Jeffreys 2005).
Microsatellite analysis involves the amplification of areas where STRs occur. STRs are
areas where a sequence of approximately 4 to 6 base pairs (eg, GATAGATAGATA) is
repeated a number of times in a row. The number of repeats of the short sequence varies
from one individual to another. The different number of repeats can be measured because
the length of the fragment varies with the number of repeats, that is fragments increase in
size with more repeats.
Hon et al. (2003) tested 150 American ginseng samples and 40 Oriental ginseng samples
with 16 microsatellites and found that nine of the microsatellites could unambiguously
distinguish the two samples. However, their paper provides no details of the primers or
methods that they used, to allow for the reproduction of their work. Hong et al. (2004)
identified 103 microsatellite markers during their DNA sequencing of the Korean ginseng
genome which have yet to be tested. Xu et al. (2006) used microsatellites to identify
different populations of the plant Gastrodia elata.
This method is relatively robust and assays can be fully automated for high throughput
analysis. When coupled with the multi-colour instruments available from manufactures
such as Applied Biosystems, automation and high volume data handling is possible.
27
Also, Qin et al. (2005) were able to authenticate P. ginseng using microarray
electrophoresis after they performed PCR analysis using two STR markers. They did this
by first performing a PCR on the sample then running the electrophoresis on a chip and
found that they could distinguish American and Oriental ginseng but were unable to
determine whether the samples were wild versus cultivated.
The major disadvantage of using microsatellite markers is designing primers specific to
areas where STR occur. This requires DNA sequence information which is time
consuming and costly to gather. Information on the variability of the repeats found in the
population also needs to be collected, which is once again costly and time consuming.
3.3.5 Randomly Amplified Polymorphic DNA (RAPD)
Randomly Amplified Polymorphic DNA (RAPD) has been used repeatedly for the
authentication of material used in TCM (Boehm et al., 1999; Lee & Rasmussen, 2000;
Mihalov et al., 2000; Nebauer et al., 1999; Nebauer et al., 2000; Schluter & Punja, 2002;
Shaw & But, 1995; Tanaka et al., 2006; Xu et al., 2002). RAPD involves the use of a
single arbitrary primer of between 10 and 20 base pairs in length, which acts in both the
forward and reverse directions. The primer binds to different sites along the DNA
sequence for different material, resulting in the production of a number of different sized
DNA fragments. The number and size of the fragments produce a distinctive profile for
different species/individuals. Therefore, without any prior knowledge of a sample’s DNA
sequence, it is possible to distinguish one species from another. This is essential when
working with material used in TCM because little DNA sequence information is available.
This technique has been used successfully to differentiate P. ginseng and P. quinquefolium
(Boehm et al., 1999; Cui et al., 2003; Mathur et al., 2003; Mihalov et al., 2000; Shaw &
But, 1995). However, the two species share similar profiles as it was determined they share
97% of the analysed DNA in common (Cui et al., 2003). This indicates the limit of
resolution of this technique; that is closely related cultivars cannot be distinguished. RAPD
is also limited by a lack of reproducibility and relatively low resolution.
28
Minimal analysis has been performed on material purchased commercially; most analysis
has been performed on material from known cultivators where the species can be verified.
Miholav et al. (2000) used commercial samples and RAPD to identify the components of
different forms of TCM, they found whether a profile was produced using RAPD analysis
when testing pills or powders was variable. Little research has been done on the use of
RAPD primers to distinguish the components of a mixture.
3.3.6 Sequence Characterised Amplified Region (SCAR)
Sequence Characterised Amplified Region (SCAR) DNA profiling is an extension of the
RAPD profiling technique (Wang et al., 2001; Yau et al., 2002; Zhang et al., 2003). SCAR
involves taking polymorphic bands identified during RAPD analysis and sequencing these
fragments. The RAPD primers are then extended by 10 bases according to the sequence of
the polymorphic band. These new longer primers when used to test the samples produce a
single band for the specific species where the polymorphism was present. SCAR primers
developed in this manner are more specific and reliable then the RAPD primers they are
based on.
SCAR analysis has been used to identify material used in TCM, including Panax species
(Wang et al., 2001). Along with their use on plant material SCAR primers have also been
used on animal material such as seahorses (Zhang et al., 2003) and snakes (Yau et al.,
2002).
29
Table 3. Advantages and disadvantages of DNA profiling techniques. The specific attributes of each method are
described in the text proper.
Technique Low C0t RFLP DNA
sequencing
Microsatellite RAPD SCAR
Description Isolate highly
repetitive DNA
sequences.
Restriction
Enzyme cuts
DNA to produce
fragments of
differing sizes.
Every base in
the DNA
sequence is
determined.
Measures the
number of short
tandem repeats
at a location.
Use small
arbitrary primers
to produce
multiple DNA
fragments.
Extend RAPD
primers based
on polymorphic
fragment
sequences.
Advantage None. Higher
reproducibility
than RAPDs.
Gold Standard
technique.
Can design
primers from
results.
Number of
tandem repeats
is highly
polymorphic.
No prior
knowledge of
DNA sequence
information
required.
Higher
reproducibility
than RAPDs.
Disadvantage Surpassed by
newer
techniques.
High quality
DNA needed.
Cannot
determine
closely related
cultivators.
Expensive and
time consuming
to establish.
Expensive and
time consuming
to establish.
Low
reproducibility.
Cannot
determine
closely related
cultivators.
Limited work
using them.
30
4 Aims and Rationale of Experimental Design
The trade in TCM remains largely unregulated; this leaves consumers vulnerable to the
unscrupulous practices of vendors. DNA profile technology provides the best technique for
the authentication of material used in Traditional Chinese Medicine (TCM). However, the
currently available techniques require further development to meet the increasing need to
be able to identify the material used in TCM.
Little research has been done using commercially retailed plant material. This material is
involved in a range of processing before it is sold and used by the consumer which is likely
to cause DNA degradation and make the extraction of DNA from these samples difficult.
Therefore, whether DNA can be extracted from dried root material sold as TCM needs to
be determined.
With the degradation of DNA in these samples whether the DNA can be amplified using
PCR needs to be determined. As there is little DNA sequence information available for
Panax genus plant material Randomly Amplified Polymorphic DNA (RAPD) analysis
provides a technique that does not require previous knowledge of the samples DNA
sequence in order to profile it.
Panax genus plant species retail for different prices and are used for the treatment of
different ailments. Practices among some TCM vendors include substituting or
adulterating the materials used in TCM. This means it is important to authenticate the
different species independently.
TCM are available in a wide variety of forms for example pills, potions, powders and
liquids. These different forms are difficult to analyse using traditional analytical techniques
but they can be analysed with DNA. Therefore, DNA profiling needs to be performed on
these TCM forms which are likely to have very low levels of DNA.
31
A large amount of the TCMs sold are mixtures, whether they are sold labelled as mixtures
or whether they are substitutions and adulterations of materials. Therefore, DNA primers
need to be developed so different components of a mixture can be determined.
Taking these things into consideration the aims of this research were to:
i. Extract DNA from commercially sold dried plant root material. The
commercially sold as TCM are available in many forms that include whole root
material through to slices, powders, pills, potions, liquids and extractions. The
different forms of TCM are likely to have DNA that is more degraded than that
of the dried whole root material because they have gone through further
processing. Therefore, it is important to ensure that intact DNA can be readily
recovered from these sources so as to be a viable authentication method.
ii. Determine whether DNA extracted from the plant root material can be amplified
using RAPD profiling. The DNA that is extracted from materials used in TCM
is likely to be highly degraded due to the processing that occurs prior to its sale.
The degradation will most likely mean that only small fragments of DNA are
extracted which will be difficult to amplify using PCR.
iii. Further develop the RAPD technology for the authentication of TCM by
applying RAPD primers for the differentiation of Panax species. The value and
use of species within the Panax genus varies from one to another making it
important to be able to distinguish one species from another. Here
commercially sold Panax plant species were DNA profiled yo determine
whether RAPD primers would detect enough polymorphism to distinguish
different plant species.
iv. Apply the primers developed to other forms of TCM. The materials that are
commercially sold as TCM are available in a number of forms that are sold at
varying prices depending on what they claim to contain. TCMs sold as different
32
forms are therefore easier to substitute and adulterate material in. Therefore, the
components within different forms of TCM need to be authenticated.
v. Attempt to distinguish Panax plant species from mixtures. Many TCMs are
sold as mixtures whether this is because the mixture is required for treatment of
an ailment or a vendor maybe adulterating the materials within a sample for
cheaper varieties. Therefore, the ability to distinguish the different components
of a mixture needs to be developed.
33
SECTION 2.1
Differentiation of Ginseng species using Randomly Amplified Polymorphic
DNA (RAPD).
Catherine A. Rinaldi, Guan K. Tay and Ian R. Dadour
This section was submitted to Forensic Science, Medicine and Pathology and is presented
in the form required by the journal. Part of this work was presented orally at the 18th
International Symposium on the Forensic Sciences held by the Australian and New Zealand
Forensic Science Society (Fremantle, Australia, 2007).
34
Abstract
Although the traditional medicine trade is a billion dollar industry, the trade is largely
unregulated with unscrupulous practices among vendors which include adulterating or
omitting ingredients and the use of parts from endangered animals. These practices can be
harmful to the consumers and are illegal. Traditional Chinese Medicines (TCM) have been
used for thousands of years and continue to be widely used, without procedures to monitor
the quality of the materials used. The practices of TCM vendors mean it is important to be
able to authenticate the material used. Traditional methods used to authenticate these
materials include morphological, histological and chemical analysis. However these
techniques are limited by various factors. Research is moving towards the use of DNA
profiling and antibody detection for the authentication of TCM ingredients. One of the
most commonly used herb species are the ginseng varieties which range in quality and price
making them targets of adulteration and omission. Consequently reliable methods must be
developed to distinguish different ginseng varieties. Randomly Amplified Polymorphic
DNA (RAPD) uses small random primers which bind to multiple places on the sample’s
DNA sequence and produce different patterns of DNA fragments for different individuals.
RAPD was selected for use because it requires no knowledge of the samples DNA
sequence. Using a set of RAPD primers, we were able to reproducibly distinguish between
the dried, preserved roots of three different ginseng plant species; Panax ginseng, P.
quinquefolium, P. notoginseng.
35
Introduction
Natural and Traditional medicines are used throughout the world, in China Traditional
Chinese Medicine (TCM) was first recorded in the Chinese Materia Medica 2000 years
ago. Today, the traditional medicine trade is estimated to be worth sixty billion dollars
annually (1). However, the traditional medicine industry is largely unregulated, so
authentication and quality control of herbal materials being traded is lacking. Without
regulation, consumers are vulnerable to unscrupulous practices by vendors; these practices
include the adulteration and substitution of cheap ingredients for more expensive varieties,
the sale of poisonous material and trading in parts from endangered animals. Therefore,
reliable methods need to be developed for the authentication of materials used in TCM.
A variety of techniques have been used to authenticate the ingredients used in TCMs, the
most common techniques are morphological, histological and chemical analysis. However,
each technique has its own limitations and ideally results would be gathered using multiple
techniques and compiled to strengthen the authentication. A limitation of morphological
and histological analysis is that some plant species look similar making differentiation
difficult. TCM materials are not always sold as whole roots; they may be sold in a variety
of forms including slices, pieces, mixtures, powders, potions and pills or tablets these forms
of TCM can not be verified using morphological and histological analysis. Chemical
analysis is limited because the abundance of chemicals in plant roots varies within a species
depending on where it is grown and it is difficult to differentiate between mixtures (2).
DNA profiling has been used to authenticate a variety of herbs used in TCM (3-6). DNA
profiling has become the preferred technique because it requires less sample amount, all
forms of TCM can be tested and DNA profiles are independent of where the herbs are
grown (5).
A variety of DNA profiling techniques have been used to authenticate material used in
TCM; include restriction fragment length polymorphism (RFLP) (7, 8), randomly amplified
36
polymorphic DNA (RAPD) (5, 6, 9, 10), sequence characterized amplified region (SCAR)
(11), DNA sequencing (10, 12) and microsatellites profiling (3). The research literature
needs to be expanded to include different species and forms of TCM. Currently, limited
DNA sequence information is available for TCM ingredients. Therefore, a method of DNA
analysis that does not require DNA sequence information is required.
Randomly Amplified Polymorphic DNA (DNA) has the potential to provide differentiation
of plant species without prior knowledge of the samples DNA sequence (3). RAPD uses a
single small arbitrary primer, which acts as both the forward and reserve primer. The
primer binds at different places along the DNA sequence of different species, creating
profiles that are unique to a particular species. RAPD has been used previously on material
used in TCM (5, 6, 9, 13).
Little research has applied the protocols of RAPD analysis to commercial samples.
Mihalov et al. (2000) (10) tested commercial pill and powder samples with DNA
sequencing and RAPDs. They found that DNA could be profiled from the pills and
powder. However, RAPD analysis produced variable results and more consistent results
were obtained using DNA sequencing for analysis of these forms of TCM.
The species of the Panax plant genus are important ingredients used in TCM. The common
species within the genius are Panax ginseng, P. quinquefolium, and P. notoginseng. Each
species varies in its price and its use. As the roots of P. ginseng and P. quinquefolium have
similar morphology it is easy to substitute and adulterate one species for another. There are
also a number of different herb species, which are substituted for the Panax roots including
Eleutherococcus senticosus, commonly known as Siberian ginseng.
37
Materials and Methods
Acquisition of ginseng root
Labeled dried herb roots were purchased from a number of different stores around Australia
and Singapore, shown in Figure 1. Along with dried root material two liquid samples that
were labeled as containing ginseng were purchased for stores in Perth Western Australia,
see Table 1 for descriptions of the samples.
Figure 1. A sample of the variety of ginseng products that are commercially available.
Preparation of Samples
Before DNA extraction was preformed some sample preparation was required. All dried
samples were washed with sterile water to remove contaminates, and then they were dried
before the peel of the sample was removed and ground into a fine powder. The peel was
used because in plants the inner cortex is low in DNA containing cells and full of
polysaccharides, which are PCR inhibitors (14). Extractions were preformed on 1mL
aliquots of the liquid samples.
38
DNA Extraction
Phenol Chloroform extraction of the material was performed as follows, 25mg of material
was placed into 500µl of cell lysis buffer (500mM NaCl, 100mM Tris-HCl and 50mM
EDTA) with 50µl 20% SDS and 10µl of Proteinase K and then incubated at 65oC for an
hour. The sample was then extracted twice with an equal volume of
Phenol:Chloroform:Isoamyl alcohol. The supernatant was collected and 500µl of
Chloroform was added and centrifuged at 13,200rpm for 3 minutes. The supernatant was
collected and double volume of 100% ethanol was added and incubated at -20 o
C for 30
minutes. Samples were centrifuged at 13,200rpm for 10 minutes and the supernatant was
removed and the pellet was washed with 70% ethanol. Then the pellet was resuspended in
100µl of TE.
After extraction the concentration of DNA and purity of the samples was determined using
a Nanodrop® ND-1000 spectrophotometer measuring the light absorbance at 230nm.
Primers
The primers that were used had previously been used to differentiate different herb species.
Primer3, 5’-GTGTGCGATCAGTTGCTGGG-3’ (Geneworks, Australia), had been used to
distinguish Pinallia ternate species (15). DALP1.7F3, 5’-
GCGTCCCACTGACCCTTTTGTACA-3’ (Geneworks, Australia), was used to
differentiate P. ginseng and P. quinquefolium (16).
PCR
The PCR was set up to a total volume of 20µl, with 100ng of sample DNA, 1 Unit of Taq
(Fisher Biotec, Australia), 2µl of 10XPCR buffer (Fisher Biotec, Australia), 1µl of 5%
BSA, 2µl of 200 picomole primer and 200µM dNTP. For each primer the MgCl2
concentration was different; 3.2µl for Primer3 and 3.6µl for DALP1.7F3.
39
Table 1. Descriptions of the commercial samples from different sources tested by RAPD-
PCR
Sample Number Description Species
1 Dried root purchased in Perth Panax ginseng (Chinese)
2 Dried root purchased in Singapore Panax ginsneg (Chinese)
3 Dried root purchased in Singapore Panax quinquefolium
(American)
4 Dried root purchased in Perth Panax notoginseng
5 Dried root purchased in Perth Panax ginseng (Korean)
6 Dried root purchased in Brisbane Eleutherococcus
senticosus (Siberian)
7 Liquid extractum purchased in Perth Panax ginseng
8 Liquid drink, containing a whole
ginseng root purchased in Perth
Panax ginseng (Korean)
40
The PCR protocol was 15 minutes at 95 o
C, 35 cycles of 30s at 95 o
C, 60s at 45 o
C and 90s
at 72 o
C with a final extension at 72 o
C for an hour. The results of the PCR were run on 2%
agarose gel containing Ethidium Bromide at 120 volts for an hour. Then the gels were
visualized on an Ultraviolet light box.
41
Results
Extraction of DNA
Plant material used in TCM is dried then stored for extended periods of time after
harvesting and before use by the consumer. These conditions are not ideal for the
preservation of DNA. DNA was extracted from all samples, including liquid samples,
using the Phenol:Chloroform extraction protocol. However, the DNA was degraded as
shown in Figure 2, which shows extracted DNA run on an agarose gel and is highly
smeared.
Figure 2. An agarose gel of the DNA extracted from samples. Lane 1) Marker: 100bp
DNA ladder (Geneworks, Australia), 2) Panax ginseng,
3) P. quinquefolium , 5) P. notoginseng, 6) Eleutherococcus senticosus.
1 2 3 4 5 6
100bp
200bp
400bp
500bp
1000bp
42
PCR of Samples
Obtaining DNA during extraction does not ensure PCR amplification as there maybe co-
extraction of inhibitors or the sample DNA may be too degraded. The DNA extracted from
the sample while degraded was still amplifiable. Figure 3 shows the profiles of three
different Panax species using two different RAPD primers.
1000bp
1 2 3 4 5 6 7
1 2 3 4 5 6 7
A
100bp
200bp
300bp
400bp
500bp
1000bp
610bp
300bp
210bp
400bp
230bp
43
Figure 3. Representative gels of the profiles obtained using the different primers.
A) Primer3 and B) Primer DALP1.7F3. Lane 1) Marker: 100bp DNA ladder
(Geneworks, Australia), 2) Positive control, 3) P. ginseng,
4) P. ginseng, 5) P. quinquefolium, 6) P. Notoginseng and 7) Negative Control.
Black arrows indicate fragments shared between the different samples and
white arrows indicate polymorphic bands.
1 2 3 4 5 6 7
B
100bp
200bp
300bp
400bp 500bp
1000bp
600bp
370bp
290bp
190bp
150bp
44
Two P. ginseng samples were acquired from different countries produced the same DNA
profile demonstrating that the primers are consistent for each species. The gels show that
the three different Panax species can be distinguished based on a number of different
polymorphic bands present in one species but not the others.
Profiles of the liquid samples are shown in Figure 4. The gel shows that DNA could be
extracted and amplified using the RAPD primer from liquid samples containing ginseng.
However, the profiles were different to the control profile and whether the DNA was
amplified was variable.
Profiles of P. ginseng (Korean) and Eleutherococcus senticosus are included in Figure 4.
This RAPD primer cannot distinguish where the samples were grown, as the Chinese P.
ginseng and Korean P. ginseng produced the same profiles. The Eleutherococcus
senticosus had a different profile to the plants from the Panax genus.
45
Figure 4. Profiles obtained from aliquots of liquid and dried root samples after
amplification using primer DALP1.7F3. Lane 1) Marker: 100bp DNA ladder
(Geneworks, Australia), 2) Negative control, 3) P. ginseng (Chinese),
4) P. ginseng (Korean), 5) Eleutherococcus senticosus, 6) Liquid ginseng drink,
7) P. ginseng extractum. Black arrows indicate fragments shared between the
different samples and white arrows indicate polymorphic bands.
1 2 3 4 5 6 7
100bp
200bp
300bp
400bp
500bp
1000bp
600bp
290bp
190bp
240bp
46
Discussion
DNA can be extracted from samples of dried plant root material used in TCM, even though
the samples have undergone drying and have been stored for an unknown length of time
before analysis. DNA was also extracted from liquid samples advertised as containing
ginseng.
RAPD profiling provides a valuable tool for the differentiation of different plant species
used in TCM (17). Specifically, RAPD can be used to distinguish Panax species from each
other and to distinguish their adulterates. However, the resolution of RAPD analysis is
limited and cannot distinguish where plants are grown. Demonstrated by Chinese P.
ginseng and Korean P. ginseng, which are both of the P. ginseng species, but grown in
different countries having the same profiles. The ability to distinguish the cultivator or
where a sample is grown is an important step in the authentication of material used in TCM
because Korean P. ginseng retails for significantly more than Chinese P. ginseng. So, it is
important to be able to distinguish where the plant is grown, which is not possible using
these primers.
DNA profiling can be applied to any form of TCM including commercial liquid samples.
Mahlov et al (2000) (11) profiled commercial pill and powder TCMs and showed that DNA
can be successfully obtained from these materials. However, they found that the RAPD
proved unreliable with the production of profiles for the pills and powders. The same was
found here where the profiles of the liquid samples were different to the samples of ginseng
and whether amplification of the liquid occurred was variable.
While this research is important in showing that RAPD profiling can be applied to
commercial samples of TCM, the primers need to be applied to vouchered species samples.
This would allow for the production of a library of profiles of Panax plant species to aid in
the authentication of these materials that are used in TCM.
Randomly Amplified Polymorhpic DNA (RAPD) analysis provides a starting point for the
authentication of materials used in TCM. Although other methods with greater resolution
47
of plant origin need to be developed and tested with more herb species and applied to other
materials that are used in TCM.
Acknowledgements
We thank Angelina Lim for the supply of samples from Singapore and comments on the
manuscript. Also thanks to Dr. Michelle Harvey for PCR technical troubleshooting.
Funding for the research was provided by the Centre for Forensic Science, University of
Western Australia.
References
1. World Health Organisation http://www.who.int/mediacentre/factsheets/fs134/en/.
2. Chan, T.W.D., et al. (2000), Anal Chem 72(6), 1281-1287.
3. Hon, C.C., et al. (2003), Acta. Pharmacol. Sin. 24(9), 841-846.
4. Mathur, A., et al. (2003), Genetic Resources & Crop Evolution 50(3), 245-252.
5. Shaw, P.C. and But, P.P. (1995), Planta Med 61(5), 466-469.
6. Tanaka, H., Fukuda, N. and Shoyama, Y. (2006), Phytochem. Anal. 17(1), 46-55.
7. Fushimi, H., et al. (1997), Biol. Pharm. Bull. 20(7), 765-769.
8. Ngan, F., et al. (1999), Phytochemistry 50(5), 787-791.
9. Boehm, C.L., et al. (1999), J. Amer. Soc. Hort. Sci. 124(3), 252-256.
10. Mihalov, J.J., Marderosian, A.D. and Pierce, J.C. (2000), J Agric Food Chem 48(8),
3744-3752.
11. Wang, J., et al. (2001), Planta Med 67(8), 781-783.
12. Kim, K.S., et al. (1991), Plant Physiol. 97(4), 1602-1603.
13. Cui, X.M., et al. (2003), Planta Med. 69(6), 584-586.
14. Chiou, F.S., et al. (2001), J. For. Sci. 46(5), 1174-1179.
15. Chung, H.S., et al. (2002), Hereditas 136(2), 126-129.
16. Ha, W.Y., et al. (2001), Planta Med. 67(6), 587-589.
17. Nebauer, S.G., del Castillo-Agudo, L. and Segura, J. (2000), Theor. & Appl. Gene.
100(8), 1209-1216.
48
SECTION 2.2
Identification of Panax plant species within mixtures using a Randomly
Amplified Polymorphic DNA (RAPD) method.
Catherine Rinaldi, Ian Dadour and Guan Tay
This section was submitted to Planta Medica and is presented in the form required by the
journal.
49
Abstract
The Traditional Chinese Medicine (TCM) trade is a global industry that remains largely
unregulated in part due to the lack of available methods for the identification of material
used in TCM. Much of the material commercially available as TCM is sold as mixtures
whether the treatment of an ailment requires a cocktail of material or the vendor is
substituting or adulterating material they are selling with cheaper varieties. Randomly
Amplified Polymorphic DNA (RAPD) analysis is a DNA-based method that requires no
previous knowledge of the DNA sequence of the material being analysed. Here results are
presented for the use of RAPD primers to identify whether DNA profiles created could be
used to identify the components of a mixture. The RAPD primers used could not
distinguish closely related Panax genus plant material within a mixture.
50
Introduction
Traditional Chinese Medicines (TCMs) are widely used throughout the world. A large
range of the products sold as TCMs are mixtures of multiple components including parts of
plants and animals. Mixtures are used because combinations of materials are more
effective for treatment and provide better results for the consumer (1). Mixtures are also
used in TCMs because when ingredients are mixed together some property of one
component can be negated by the other. For example, poisonous material maybe required
to treat an ailment, but consuming poisonous material on its own is toxic. So it maybe
mixed with other material, which neutralises the poison.
The ability to identify the components of mixtures is required because practices among
TCM vendors include substituting or adulterating expensive TCM materials for cheaper
varieties. This means that material claimed to be composed of a single species may in fact
be a mixture of multiple different species. Therefore, it is essential that techniques are
developed to dissect out the components of a mixture.
DNA profiling has been used to authenticate a variety of herbs used in TCM (2-5). DNA
profiling has become the preferred technique for authenticating material because it requires
less sample amount. Further unlike chemical based methods, all forms of TCM can be
tested and DNA profiles are independent of where the herbs are grown (4). Unlike
chemical profiling, which is dependant on the location a particular crop is grown (6, 7).
Since DNA methods are species specific, it is the ideal technique to develop for
distinguishing materials found in mixtures.
A variety of DNA profiling techniques have been used to authenticate material used in
TCM; including restriction fragment length polymorphism (RFLP) (8, 9), randomly
amplified polymorphic DNA (RAPD) (4, 5, 10, 11), sequence characterised amplified
region (SCAR) (12), DNA sequencing (11, 13) and microsatellite profiling (2). Continued
research needs to expand to include different species and forms of TCM including testing
methods to distinguish material in mixtures. With the thousands of different materials used
51
in TCM the sheer number mean there is limited DNA sequence information available for
TCM ingredients, which makes it difficult to design primers for a number of the DNA
profiling techniques named above. Therefore, methods of DNA analysis not requiring
DNA sequence information need to be investigated.
Randomly Amplified Polymorphic DNA (DNA) has the potential to provide differentiation
of plant species without prior knowledge of the samples DNA sequence (2). RAPD
analysis uses a single small arbitrary primer, which acts as both the forward and reserve
primer. The primer binds at different places along the DNA sequence of different species,
creating profiles unique to a particular species. RAPD has been used previously to
distinguish a range of other plants used in TCM including Panax species (4, 5, 10, 14),
Radix Astragali (Milk-vetch) (15), Radix Angelica (Dang-gui) (16) and Crocus sativus
(Saffron Crocus) (17).
Limited studies have been performed using DNA profiling to authenticate materials found
in mixtures of more than one Panax plant species or mixtures of any kind used in TCM.
Wetton et al. (2002) (18) successfully used DNA profiling to determine whether tiger DNA
could be identified from samples of TCMs spiked with tiger bone, however this is the
extent of studies found to date.
In this study, we set out to determine whether Randomly Amplified Polymorphic DNA
(RAPD) techniques could be used to distinguish the components of mixtures. Our studies
concentrated on the differentiation of more than one Panax species plant material from
each other and unrelated plant species.
52
Materials and Methods
Acquisition of Panax roots
Labeled dried herb roots were purchased from a number of different retailers around
Australia and Singapore. The samples that were purchased were dried root material of
Panax ginseng, Panax quinquefolium and Panax nototginseng.
The mixtures analysed here were produced artificially, that is they were produced by
mixing the extracted DNA of the two samples during PCR set up. Mixtures were made of
diifferent Panax species and P. ginseng mixed with a positive control. When the mixing of
the samples occurred prior to DNA extraction, 25mg of each ground sample was mixed
together before adding the cell lysis buffer.
Preparation of Samples
Prior to DNA extraction, some sample preparation was required. All dried samples were
washed with sterile water to remove contaminants then dried on a heat block before being
peeled. The peel was then ground into a fine powder. The peel was used because in plants
the inner cortex is low in DNA containing cells and full of polysaccharides, which are PCR
inhibitors (19).
DNA Extraction
Phenol Chloroform extraction of the material was performed as follows. Ground material
was placed into 500µl of cell lysis buffer (500mM NaCl, 100mM Tris-HCl and 50mM
EDTA) with 50µl 20% SDS and 10µl of Proteinase K and then incubated at 65oC for an
hour. The sample was then extracted twice with an equal volume of
Phenol:Chloroform:Isoamyl (25:24:1) alcohol. The supernatant was collected and 500µl of
Chloroform was added and centrifuged at 13,200rpm for 3 minutes. The supernatant was
collected and a double volume of 100% ethanol was added and incubated at -20oC for 30
minutes. Samples were centrifuged at 13,200rpm for 10 minutes and the supernatant was
53
removed and the pellet washed with 70% ethanol. The pellet was then resuspended in
100µl of TE, pH .
After extraction the concentration of DNA and purity of the samples was determined using
a Nanodrop® ND-1000 spectrophotometer measuring (Biolab, Australia) the light
absorbance at 230nm.
Primers
The primers used here were selected from the research literature because they had
previously been used to authenticate different plant materials used in TCM. When using
RAPD analysis the selection of the primers is not an issue as the short nature of the primers
mean that they should amplify any sample. CHUN3, 5’-GTGTGCGATCAGTTGCTGGG-
3’ (Geneworks, Australia), had been used to distinguish Pinellia ternate species (20).
DALP1.7F3, 5’-GCGTCCCACTGACCCTTTTGTACA-3’ (Geneworks, Australia), was
used to differentiate P. ginseng and P. quinquefolium (21).
PCR Analysis
The PCR was set up to a total volume of 20µl with 1 unit of Taq (Fisher Biotec, Australia),
2µl of 10XPCR buffer (Fisher Biotec, Australia), 1µl of 5% BSA, 2µl of 200 picomole
primer and 200µM dNTP. For each primer, the MgCl2 concentration was different; 4mM
for CHUN3 and 4.5mM for DALP1.7F3. When mixing the samples after extraction, equal
amounts of extracted DNA (100ng) were added to a single PCR tube.
The PCR protocol was 15 minutes at 95 o
C followed by 35 cycles of 30s at 95 o
C, 60s at 45
oC and 90s at 72
oC with a final extension at 72
oC for an hour. PCR was performed in a
GeneAmp® PCR System 2700 (Applied Biosystems, Australia). The results of the PCR
were run on 2% agarose gel containing Ethidium Bromide at 120 volts for an hour. Gels
were visualized on an Ultraviolet light box and photographed.
54
Results
Mixtures of Panax ginseng and Potato
Panax ginseng was mixed with the positive control potato samples to determine whether
RAPD analysis using these primers could differentiate P. ginseng and an unrelated DNA
sample. Figure 1 shows the results of mixing potato and P. ginseng.
Figure 1 shows that when the DNA extracts of potato and Panax ginseng were mixed the
resulting profile created by the RAPD primers was a combination of the profiles of potato
and P. ginseng. The profiles provide enough polymorphic bands so that the P. ginseng
could be distinguished. When the amount of DNA of one of the components of the mixture
was greater than that of the other the profile of the mixture was the material present in the
greatest amount only.
55
Figure 1. A representative profile of mixtures of potato and Panax ginseng
using the primer CHUN3. Lane 1) 100 base pair DNA ladder.
2) Potato. 3) Potato and P. ginseng. 4) P. ginseng. 5) Negative Control.
The black arrows indicate bands that are present in the P. ginseng and
mixture sample and the white arrows indicate bands that are in the
potato and mixture samples.
100bp
200bp
300bp
400bp
500bp
1000bp
1 2 3 4 5
600bp
450bp
2400bp
260bp
670bp
490bp
56
Mixtures of Panax species
Mixtures of Panax genus plant species were made by mixing extracted DNA prior to PCR.
Mixtures were made of the P. ginseng with P. quinquefolium, P. ginseng with P.
notoginseng and P. quinquefolium with P. notoginseng. The results of the mixing of the
extracted DNA together at the time of PCR are shown in Figure 2.
Figure 2 shows that the primers are not able to distinguish the different Panax species in
each of the mixtures. For example, while using primer DALP1.7P3 P. notoginseng and P.
quinquefolium can be distinguished from each other individually however, when mixed the
profile that results is that of the P. quinquefolium (Figure 2B, lane 7).
A
1 2 3 4 5 6 7 8
100bp
200bp
300bp
400bp
500bp
1000bp
610bp
400bp
110bp
290bp
210bp
300bp
57
Figure 2. RAPD profiles produced when mixing different Panax plant species
together after DNA had been extracted individually. A. CHUN3.
B. Primer DALP1.7F3. Lane 1) 100 base pair ladder. 2) P. ginseng.
3) P. quinquefolium. 4) P. notoginseng. 5) P. ginseng and
P. quinquefolium. 6) P. ginseng and P. notoginseng. 7) P. notoginseng
and P. quinquefolium. 8) Negative Control. The arrows on the right side
of the gel indicate the sizes of the fragments.
B
100bp
200bp
300bp
400bp
500bp
1000bp
1 2 3 4 5 6 7 8
600bp
380bp
250bp
220bp
170bp
150bp
100bp
58
Discussion
The ability to identify the components that make up mixtures is critical when analyzing
material used in TCM for a number of reasons. Firstly, many of the products sold as TCM
are mixtures. Secondly, a practice among TCM vendors is to substitute or adulterate the
material they are selling with cheaper materials.
The RAPD primers used here could be used to distinguish Panax ginseng when mixed with
a genetically unrelated potato sample. This ability to distinguish the P. ginseng from the
potato is based on the polymorphic bands which can be used to distinguish the two samples
all being present in the profile of the mixture of the two samples. However, using these
primers the P. ginseng could not be identified in a mixture of potato and P. ginseng when
the potato was present in a greater than one to one ratio, then only the potato profile was
present.
The RAPD primers used here also do not provide enough discriminatory ability to identify
the individual Panax species in a mixture of multiple Panax species. That means that while
the different Panax species can be distinguished from each other individually the profiles
produced when the samples were mixed resulted in the amplification of only one of the
samples. This is because the primers do not produce many discriminating bands, which
while they discriminate species from each other when in a mixture one of the profiles
dominates.
RAPD primers provide a starting point for DNA analysis of material that is used in TCM
because the small arbitrary primers require no previous information of the DNA sequence
be known before DNA profiling begins. The results found here show that the
discriminatory power of the primers tested was not high enough to be able to distinguish
components of a mixture of closely related plant species used in TCM. There needs to be
the development of other techniques that measure smaller DNA polymorphisms such as
59
DNA sequencing to identify Single Nucleotide Polymorphisms (SNPs) which maybe able
to distinguish the components of a mixture based on differences in only a few nucleotides.
Acknowledgements
Funding for this project was supplied by the Centre for Forensic Science at the University
of Western Australia. We would also like to thank Rebecca Ford and Yvette Hitchens for
their review and comments on this paper.
References
1. Guili, Z. and Chengbo, Z., Concise Chinese Materia Medica, Shandong Science and
Technology Press, Jinan, China, 1997.
2. Hon CC, Chow YC, Zeng FY, Leung FC. Genetic authentication of ginseng and
other traditional Chinese medicine. Acta. Pharmacol. Sin. 2003;24(9):841-846.
3. Mathur A, Mathur AK, Sangwan RS, Gangwar A, Uniyal GC. Differential
morphogenetic responses, ginsenoside metabolism and RAPD patterns of three
Panax species. Genetic Resources & Crop Evolution 2003;50(3):245-252.
4. Shaw PC, But PP. Authentication of Panax species and their adulterants by random-
primed polymerase chain reaction. Planta Med 1995;61(5):466-469.
5. Tanaka H, Fukuda N, Shoyama Y. Identification and differentiation of panox
species using ELISA, RAPD and eastern blotting. Phytochem. Anal. 2006;17(1):46-
55.
6. Dong TTX, Ma XQ, Clarke C, Song ZH, Ji ZN, Lo CK, et al. Phylogeny of
Astragalus in China: Molecular evidence from the DNA sequences of 5S rRNA
spacer, ITS, and 18S rRNA. Journal of Agricultural & Food Chemistry
2003;51(23):6709-6714.
7. Lao SC, Li SP, Kan KKW, Li P, Wan JB, Wang YT, et al. Identification and
quantification of 13 components in Angelica sinensis (Danggui) by gas
chromatography–mass spectrometry coupled with
pressurized liquid extraction. Analytica Chimica Acta 2004;526:131-137.
60
8. Fushimi H, Komatsu K, Isobe M, Namba T. Application of PCR-RFLP and MASA
analyses on 18S ribosomal RNA gene sequence for the identification of three
Ginseng drugs. Biol. Pharm. Bull. 1997;20(7):765-769.
9. Ngan F, Shaw P, But P, Wang J. Molecular authentication of Panax species.
Phytochemistry 1999;50(5):787-791.
10. Boehm CL, Harrison HC, Jung G, Nienhuis J. Organization of American and Asian
ginseng germplasm using randomly amplified polymorphic DNA (RAPD) markers.
J. Amer. Soc. Hort. Sci. 1999;124(3):252-256.
11. Mihalov JJ, Marderosian AD, Pierce JC. DNA identification of commercial ginseng
samples. J Agric Food Chem 2000;48(8):3744-3752.
12. Wang J, Ha WY, Ngan FN, But PP, Shaw PC. Application of sequence
characterized amplified region (SCAR) analysis to authenticate Panax species and
their adulterants. Planta Med 2001;67(8):781-783.
13. Kim KS, Schuster W, Brennicke A, Choi KT. Korean ginseng mitochondrial DNA
encodes an intact rps12 gene downstream of the nad3 gene. Plant Physiol.
1991;97(4):1602-1603.
14. Cui XM, Lo CK, Yip KL, Dong TTX, Tsim KWK. Authentication of Panax
notoginseng by 5S-rRNA spacer domain and random amplified polymorphic DNA
(RAPD) analysis. Planta Med. 2003;69(6):584-586.
15. Ma XQ, Duan JA, Zhu DY, Dong TT, Tsim KW. Species identification of Radix
Astragali (Huangqi) by DNA sequence of its 5S-rRNA spacer domain.
Phytochemistry 2000;54(4):363-8.
16. Zhao KJ, Dong TT, Tu PF, Song ZH, Lo CK, Tsim KW. Molecular genetic and
chemical assessment of radix Angelica (Danggui) in China. J Agric Food Chem
2003;51(9):2576-83.
17. Ma XQ, Zhu DY, Li SP, Dong TTX, Tsim KWK. Authentic identification of
Stigma Croci (stigma of Crocus sativus) from its adulterants by molecular genetic
analysis. Planta Medica 2001;67(2):183-186.
18. Wetton JH, Tsang CSF, Roney CA, Spriggs AC. An extremely sensitive species-
specific ARMS PCR test for the presence of tiger bone DNA. Forensic Science
International 2002;126(2):137-144.
61
19. Chiou FS, Pai CY, Hsu YPP, Tsai CW, Yang CH. Extraction of human DNA for
PCR from chewed residues of betel quid using a novel "PVP/CTAB" method. J.
For. Sci. 2001;46(5):1174-1179.
20. Chung HS, Um JY, Kim MS, Hong SH, Kim SM, Kim HK, et al. Determination of
the site of origin of Pinellia ternata roots based on RAPD analysis and PCR-RFLP.
Hereditas 2002;136(2):126-129.
21. Ha WY, Yau FC, But PP, Wang J, Shaw PC. Direct amplification of length
polymorphism analysis differentiates Panax ginseng from P. quinquefolius. Planta
Med. 2001;67(6):587-589.
62
SECTION 3
GENERAL DISCUSSION AND CONCLUSIONS
A
63
Traditional and natural medicines have been used by many cultures throughout the world
for thousands of years. Plant and animal materials are widely used as stand alone remedies
or as mixtures of agents with synergistic properties. In China Traditional Chinese Medicine
(TCM) was first recorded 2,000 years ago (Hon et al., 2003).
The trade in traditional medicines is estimates by the World Health Organisation to be
worth over US$60 billion dollars annually (World Health Organisation, 2003). Although
this trade attracts billions of dollars annually, it is not well regulated, leaving consumers
open to unscrupulous practices of some vendors. These practices include substitution and
adulterant of expensive material with cheaper varieties, sale of poisonous material and
trading in endangered animal parts. Therefore, techniques need to be developed to identify
the materials used in traditional and natural medicines.
Currently available techniques used to identify materials used in TCMs have several
disadvantages (for a review of the advantages and disadvantages of each method see Table
1 of the Introduction section to this thesis). Traditionally, plant material has been identified
by morphological, histological, chemical and immunological methods. More recently, with
the development of the Polymerase Chain Reaction (PCR), DNA profiling has become a
valuable tool for the identification of biological material. Applying DNA profiling
techniques to differentiating plant and animal material is a common practice. PCR-based
DNA profiling has been used to differentiate genetically modified crops from un-modified
material (Leimanis et al., 2006; Lee et al., 2006). Plant varieties have also been
differentiated by these technologies. DNA technology has been used to profile meats,
small-goods as well as canned meat to validate the labels and source of meats (Calvo et al.,
2002; Saez et al., 2004).
Hence, DNA-based techniques can be readily used on TCM. DNA profiling is
advantageous over traditional techniques because it requires a small sample amount, it can
be used on all forms of TCM and could potentially distinguish the components of mixtures.
Even with the development of new techniques it is still best practice to apply multiple
techniques to the sample for a thorough authentication of the material.
64
There are a range of DNA based techniques, many of which require some knowledge of the
DNA sequence of the sample material. Due to the variety of plant species used in the TCM
trade and the fact that sequences are not readily available for much of the plant material
used, techniques not requiring sequence information need to be used. The DNA profiling
technique Randomly Amplified Polymorphic DNA (RAPD) analysis requires no previous
knowledge of a samples DNA sequence. Therefore, it provides a fast and inexpensive
DNA based technique that can easily be applied to material used in TCM where limited
DNA sequence information is available. With that in mind, whether using RAPD primers
to distinguish Panax genus plant species is reliable was investigated.
Commercially sold TCM samples undergo processing before being sold; processing
techniques include drying, grinding, boiling and extracting into liquid form. Therefore,
DNA in these samples is likely to be highly degraded and very fragmented, which may
make it difficult to amplify extracted DNA. Here DNA was extracted from dried root
samples using an organic Phenol:Chlororform protocol, which extracted high levels of high
quality DNA. This DNA was of high enough quality that it could be amplified using
RAPD analysis.
The first manuscript presented in this thesis showed that the RAPD primers used here could
amplify the DNA extracted from dried root material. The primers were selected from the
research literature for their previous use on plant material. The profiles produced by these
primers were different for three Panax species and one sample commonly referred to as a
ginseng, Eleutherococcus senticosus. The profiles showed a number of polymorphic bands
which could be used to distinguish each different species.
These primers could distinguish the samples labeled as P. ginseng (Chinese ginseng), P.
quiquefolium (American ginseng), P. notoginseng and Eleutherococcus senticosus
(Siberian ginseng). This is consistent with other research where RAPD analysis was used
to distinguish different plant species (Shaw & But, 1995; Tanaka et al., 2006; Boehm, et al.,
1999; Mihalov et al., 2000). It is also consistent with RAPD primers having been used
65
specifically to distinguish Panax genus plants (Shaw & But, 1995; Cui et al, 2003; Boehm,
et al., 1999).
Three samples of P. ginseng purchased from two different countries were analysed. Two
samples were sold as Chinese ginseng, the other was sold as Korean ginseng. Each of the
P. ginseng samples was found to produce the same DNA profile. While this demonstrates
that the RAPD primers produce reliable profiles for a species it means that either the
primers did not produce enough polymorphism to distinguish the origin of the sample or
the sample was being sold as Korean ginseng but was in fact Chinese ginseng. It is most
likely that the RAPD primers being used here do not provide enough polymorphism to
distinguish cultivators so they are not an option for use when the cultivator of the samples
needs to be determined.
Korean ginseng (P. ginseng) is grown in Korea and retails at a higher market value than
both American (P. quiquefolium) and Chinese ginseng (P. ginseng); therefore it is
important to be able to distinguish the location where a plant is grown. The same is true of
trying to distinguish wild and cultivated plants. As the profiles of the Korean and Chinese
ginseng were the same with these primers, these primers do not produce enough
polymorphism for the determination of cultivators.
It maybe possible to use different primers that are more sensitive to small differences in the
DNA sequences of the samples. This may mean the use of Short Tandem Repeats (STRs)
where the number of tandem repeats varies depending on where the sample is grown. Hon
et al. (2003) found allelic differences between American ginsengs grown on different farms
using STRs. A likely technique to determine closely related cultivators is using Single
Nucleotide Polymorphisms (SNPs), where differences in single nucleotides are examined.
Materials sold as TCMs are available in a variety of forms, from whole roots through to
slices, powders, pills, tablets, extracts and liquids. These materials are likely to contain
little, if any, DNA of high enough quality that can be amplified by PCR. Analysis of two
different liquid samples, one a ginseng drink and the other an extractum, showed variable
66
amplification of the extracted DNA. That is, there was no reproducible and reliable
amplification of DNA extracted from these liquid samples.
The reason for the lack of reproducibility is likely to be the degraded nature of the DNA in
the sample. Degradation most probably occurred due to processing of the samples into a
liquid form and results in low amounts of DNA present in the sample. It is also possible
that more PCR inhibitors were co-extracted from the liquid samples than the dried root
material; this is indicated because the extractions were brown coloured. Dark coloured
extractions indicate the co-extraction of contaminants (Fu et al., 1998). The lack of
reproducibility when analysing liquids is a similar result to that found by Mihalov et al.
(2000). Mihalov et al. (2000) found that DNA sequencing provide better results for
analysing samples of liquids than RAPD analysis, which was unreliable.
The second manuscript presents results of mixing samples together and amplifying them
with the RAPD primers. First, DNA from P. ginseng was mixed with potato positive
control DNA to determine whether there was enough polymorphism between the profiles to
distinguish both samples in the mixture and whether there was any preferential
amplification of one sample over another. The results of this analysis were that both
profiles could be distinguished in the mixture profile. The unique bands that differentiated
each of the two samples were all present in the profile of the mixture when the samples
were mixed in equal concentrations. When the samples were not mixed in equal
concentrations there was only the profile of the sample present in higher amounts.
The profiles of mixtures of more than one Panax species plant were also generated. The
profiles resulting from mixtures were the same as one of the samples. This is because the
RAPD primers used did not provide enough polymorphic bands to distinguish the different
species. For example, in a mixture of P. notoginseng and P. quinquefolium when using
these primers only the profile of P. quiquefolium was visible. This means that these RAPD
primers cannot be used to differentiate the different Panax species when mixed together.
67
As with profiling of liquids it would probably be best if DNA profiling of the mixture
samples was done with other techniques. For example, Wetton et al. (2003) DNA
sequenced bone, hair and TCM samples spiked with tiger bone and found that they could
detect the tiger DNA profile in the mixtures. So, the development of techniques that
identify smaller polymorphisms is important.
A limitation of the research performed here is that the samples used were not verified
specimens but commercial products. While limited research has been done using
commercial samples, using exemplar specimens, which are known to be a certain species,
enables libraries to be created of the profiles of different material used in traditional
medicines. These libraries can then be used as databases for the comparison of profiles of
unknown samples. This would be a similar idea to currently available forensic DNA
database such as CODIS in the United States of American or CrimTrac in Australia.
Further research is also needed to extend the range of samples investigated that can be
included in libraries of DNA profiles.
Another limitation is that an untested plant or other material may give the same profile as
the plant species tested here using these primers. That is, P. ginseng may have the same
profile as a species not examined here. For example, P. ginseng may have the same profile
as tiger because the fragments are only measured based on size not internal sequence. So, a
sample with a different sequence could conceivably produce the same sized bands when
analysed using RAPD primers. While it is most likely that it will be a related species that
produces the same profile and the three tested here did not it is possible that one of the
other Panax species may. The reason for this is that the RAPD analytical technique is
designed so that, any sample could work with any primer so continued testing of different
samples using these primers needs to be carried out.
There is a large amount of future research that evolves from the results of this research.
Further research needs to be performed that will increase the discriminatory power for the
DNA analysis performed on materials used in TCMs. One possible method is to extend the
RAPD primers used here to create new Sequence Characterised Amplified Region (SCAR)
68
primers. To produce SCAR primers polymorphic bands created by the RAPD analysis are
sequenced and the RAPD primers are extended by a number of bases based on the
sequencing analysis results (Wang et al., 2001; Zhang et al., 2003; Yau et al., 2002).
SCAR primers are more reliable and discriminatory than RAPD primers because the
primers only amplify the single polymorphic band in the sample it was present in.
A possibility for further research is to investigate the use of antibodies to authenticate
materials used in TCMs. Antibodies could target antigens on the plant cell surface and not
chemical compounds produced by the cells. Targeting the plant cells will make the
procedure more reliable when trying to distinguish closely related plant species. Using
chemical composition of plants is problematic because the chemical composition varies
depending on several environmental factors (Dong et al., 2003; Lao et al., 2004).
Antibodies provide the possibility of creating field tests, such as a test based on the
principle of a pregnancy test where the combination of the antibody and antigen produce a
visible band on the testing medium.
DNA profiling could as be used to create “lab-on-a-chip” microarrays so that samples can
be analysed in the field. As per the “lab-on-a-chip” DNA microarrays used to differentiate
Panax genus plants (Carles et al., 2001). These microarrays it could be used by the police
as a presumptive field test. Any field test could also potentially be marketed to consumers
so that when they are about to buy some material they can test it and to ensure they are
getting what they paid for.
In conclusion, RAPD analysis provides a quick and inexpensive DNA based technique that
can be used to differentiate different plant species. The primers tested here were able to
distinguish Panax genus plants and two unrelated components in a mixture. It is therefore
important that further DNA techniques be developed either by extending on RAPD primers
such as those used here or by DNA sequencing to identify different polymorphisms.
69
Summary of Conclusions
The results of this research show that Randomly Amplified Polymorphic DNA (RAPD)
analysis provides a quick, cost effective and easy to use method for differentiating material
used in TCM without prior knowledge of the samples DNA sequence. The specific
conclusions that can be drawn from the results are:
i. DNA can be extracted from a variety of different commercially sold TCM,
including dried root material, drink and liquid extractums.
ii. The DNA extracted from this material can be amplified using RAPD primers.
iii. The RAPD primers used here can distinguish a number of different Panax genus
plant species from each other and genetically unrelated plant material.
iv. Amplifying DNA extracted from liquid samples using these RAPD primers is
unreliable and results are variable.
v. The RAPD primers used here do not provide enough polymorphic bands to be able
to distinguish the make up of mixtures containing two Panax species plants.
70
BIBILOGRAPHY
Assinewe, V. A., Baum, B. R., Gagnon, D. & Arnason, J. T. (2003), 'Phytochemistry of
Wild Populations of Panax quinquefolius L. (North American Ginseng)', Journal of
Agricultural & Food Chemistry, 51, pp. 4549-4553.
Barnes, S. & Prasain, J. (2005), 'Current progress in the use of traditional medicines and
nutraceuticals', Current Opinion in Plant Biology, 8, pp. 1-5.
Benecke, M. (1998), 'Random amplified polymorphic DNA (RAPD) typing of
necrophageous insects (diptera, coleoptera) in criminal forensic studies: validation
and use in practice', Forensic Science International, 98, pp. 157-168.
Binladen, J., Wiuf, C., Gilbert, M. T. P., Bunce, M., Barnett, R., Larson, G., Greenwood, A.
D., Haile, J., Ho, S. Y. W., Hansen, A. J. & Willerslev, E. (2006), 'Assessing the
Fidelity of Ancient DNA Sequences Amplified From Nuclear Genes', Genetics,
172, pp. 733-741.
Blair, A. (19750, 'Karyotypes of Five Plant Species with Disjunct Distributions in Virginia
and the Carolinas', American Journal of Botany, 62 (8), pp. 833-837.
Boehm, C. L., Harrison, H. C., Jung, G. & Nienhuis, J. (1999), 'Organization of American
and Asian ginseng germplasm using randomly amplified polymorphic DNA
(RAPD) markers', Journal of the American Society for Horticultural Science, 124
(3), pp. 252-256.
But, P. (1994), 'Herbal poisoning caused by adulterants or erroneous substitutes.' Journal of
Tropical Medicine and Hygenie, 97 (3), pp. 371-374.
Calvo, J. H., Rodellar, C., Zaragoza, P. & Osta, R. (2002), 'Beef- and bovine-derived
material identification in processed and unprocessed food and feed by PCR
amplification', Journal of Agricultural & Food Chemistry, 50 (19), pp. 5262-5264.
Carles, M., Lee, T., Moganti, S., Lenigk, R., Tsim, K., Ip, N., Hsing, I. & Sucher, N.
(2001), 'Chips and Qi: microcomponent-based analysis in traditional Chinese
medicine', Fresenius Journal of Analytical Chemistry, 371 (2), pp. 190-194.
71
Chan, T. W. D., But, P. P. H., Cheng, S. W., Kwok, I. M. Y., Lau, F. W. & Xu, H. X.
(2000), 'Differentiation and Authentication of Panax ginseng, Panax quinquefolius,
and Ginseng Products by Using HPLC/MS', Analytical Chemistry, 72, pp. 1281-
1287.
Chan, T. Y. K., Chan, J. C. N., Tomlinson, B. & Critchley, J. A. J. H. (1993), 'Chinese
herbal medicines revisited: a Hong Kong perspective', The Lancet, 342 (8886-
8887), pp. 1532-1534.
Chan, T. Y. K., Tam, H. P., Lai, C. K. & Chan, A. Y. W. 2005, 'A multidisciplinary
approach to the toxicologic problems associated with the use of herbal medicines',
Therapeutic Drug Monitoring, 27 (1), pp. 53-57.
Chen, K. T., Su, Y. C., Lin, J. G., Hsin, L. H., Su, Y. P., Su, C. H., Li, S. Y., Cheng, J. H. &
Mao, S. J. (2001), 'Identification of Atractylodes plants in Chinese herbs and
formulations by random amplified polymorphic DNA', Acta Pharmacol Sin, 22 (6),
pp. 493-497.
Chen, Y.-Q., Wang, N., Zhou, H. & Qu, L.-H. 2002, 'Differentiation of medicinal
Cordyceps species by rDNA ITS sequence analysis', Planta Medica, 68 (7), pp.
635-639.
Chiou, F. S., Pai, C. Y., Hsu, Y. P. P., Tsai, C. W. & Yang, C. H. (2001), 'Extraction of
human DNA for PCR from chewed residues of betel quid using a novel
"PVP/CTAB" method', Journal Forensic Science, 46 (5), pp. 1174-1179.
Chung, H. S., Um, J. Y., Kim, M. S., Hong, S. H., Kim, S. M., Kim, H. K., Park, S. J., Kim,
S. C., Hwang, W. J. & Kim, H. M. (2002), 'Determination of the site of origin of
Pinellia ternata roots based on RAPD analysis and PCR-RFLP', Hereditas, 136 (2),
pp. 126-129.
Coleman, C. I., Hebert, J. H. & Reddy, P. (2003), 'The effects of Panax ginseng on quality
of life', Journal of Clinical Pharmacy & Therapeutics, 28 (1), pp. 5-15.
Comstock, K. E., Ostrander, E. A. & Wasser, S. K. (2005), 'Amplifying Nuclear and
Mitochondrial DNA from African Elephant Ivory: A Tool for Monitoring the Ivory
Trad', Conservation Biology, 17 (6), pp. 1840-1843.
Coney, S. (1999), 'New Zealand court allows national blood samples to be used in civil
trial', Lancet, 354 (9180), pp. 753.
72
Cui, J., Garle, M., Eneroth, P. & Bjorkhelm, I. (1994), 'What do commercial ginseng
preparations contain?', Lancet, 344 (8915), pp. 134.
Cui, X. M., Lo, C. K., Yip, K. L., Dong, T. T. X. & Tsim, K. W. K. (2003), 'Authentication
of Panax notoginseng by 5S-rRNA spacer domain and random amplified
polymorphic DNA (RAPD) analysis', Planta Medica, 69 (6), pp. 584-586.
Dickens, P., Tai, Y. T., But, P. P. H., Tomlinson, B., Ng, H. K. & Yan, K. W. (1994), 'Fatal
accidental aconitine poisoning following ingestion of Chinese herbal medicine: A
report of two cases', Forensic Science International, 67, pp. 55-58.
Ding, X., Xu, L., Wang, Z., Zhou, K., Xu, H. & Wang, Y. (2002), 'Authentication of stems
of Dendrobium officinale by rDNA ITS region sequences', Planta Medica, 68 (2),
pp. 191-192.
Dong, T. T. X., Ma, X. Q., Clarke, C., Song, Z. H., Ji, Z. N., Lo, C. K. & Tsim, K. W. K.
(2003), 'Phylogeny of Astragalus in China: Molecular evidence from the DNA
sequences of 5S rRNA spacer, ITS, and 18S rRNA', Journal of Agricultural & Food
Chemistry, 51 (23), pp. 6709-6714.
Dou, D., Wen, Y., Pei, Y., Yao, X., Chen, Y., Kawai, H. & Fukushima, H. (1996),
'Ginsenoside-I(a): a novel minor saponin from the leaves of Panax ginseng', Planta
Medica, 62 (2), pp. 179-181.
Dovicovicova, L., Olexova, L., Pangallo, D., Siekel, P. & Kuchta, T. (2004), 'Polymerase
chain reaction (PCR) for the detection of celery (Apium graveolens) in food',
European Food Research Technology, 218, pp. 493-495.
Du, Q., Jerz, G., Waibel, R. & Winterhalter, P. (2003), 'Isolation of dammarane saponins
from Panax notoginseng by high-speed counter-current chromatography', Journal of
Chromatography. A, 1008, (2), pp. 173-180.
Espinoza, E. O., Mann, M.-J., Bleasdell, B., DeKorte, S. & Cox, M. (1996), 'Toxic Metals
in Selected Traditional Chinese Medicinals', Journal of Forensic Science, 41 (3),
pp. 453-456.
Espinoza, E. O., Shafer, J. A. & Hagey, L. R. (1993), 'International Trade in Bear Gall
Bladders: Forensic Source Inference', Journal of Forensic Sciences, 38 (6), pp.
1363-1371.
73
Espley, M. H. (2006), 'Bears need not suffer for our health', The Pharmaceutical Journal,
276, p. 107.
Feng, H.-T. & Li, S. F. Y. (2002), 'Determination of five toxic alkaloids in two common
herbal medicines with capillary electrophoresis', Journal of Chromatography A, 973
(1-2), pp. 243-247.
Fennell, C. W., Lindsey, K. L., McGawb, L. J., Sparg, S. G., Stafford, G. I., Elgorashi, E.
E., Grace, O. M. & van Staden, J. (2004), 'Assessing African medicinal plants for
efficacy and safety: pharmacological screening and toxicology', Journal of
Ethnopharmacology, 94, pp. 205-217.
Fu, R.-Z., Wang, J., Sun, Y.-R. & Shaw, P.-C. (1998), 'Extraction of genomic DNA
suitable for PCR analysis from dried plant rhizomes/roots', Biotechniques, 25 (5),
pp. 796-801.
Fukuda, N., Tanaka, H. & Shoyama, Y. (1999), 'Western blotting for ginseng saponins,
ginsenosides using anti-ginsenoside Rb1 monoclonal antibody', Biological &
Pharmaceutical Bulletin, 22 (2), pp. 219-220.
Fukuda, N., Tanaka, H. & Shoyama, Y. (2000a), 'Formation of monoclonal antibody
against a major ginseng component, ginsenoside Rg1 and its characterization:
Monoclonal antibody for a ginseng saponin', Cytotechnology, 34 (3), pp. 197-204.
Fukuda, N., Tanaka, H. & Shoyama, Y. (2000b), 'Isolation of the pharmacologically active
saponin ginsenoside Rb1 from ginseng by immunoaffinity column chromatography',
Journal of Natural Products, 63 (2), pp. 283-285.
Fukuda, N., Tanaka, H. & Shoyama, Y. (2001), 'Double staining of ginsenosides by
Western blotting using anti-ginsenoside Rb1 and Rg1 monoclonal antibodies',
Biological & Pharmaceutical Bulletin, 24 (10), pp. 1157-1160.
Fushimi, H., Komatsu, K., Isobe, M. & Namba, T. (1997), 'Application of PCR-RFLP and
MASA analyses on 18S ribosomal RNA gene sequence for the identification of
three Ginseng drugs', Biological & Pharmaceutical Bulletin, 20 (7), pp. 765-769.
Fuzzati, N. (2004), 'Analysis methods of ginsenosides', Journal of Chromatography B,
812, pp. 119-133.
Gill, P., Jeffreys, A. J. & Werrett, D. J. (1985), 'Forensic application of DNA 'fingerprints'',
Nature, 318 (6046), pp. 577-579.
74
Guili, Z. & Chengbo, Z. (1997), Concise Chinese Materia Medica, Shandong Science and
Technology Press, Jiana, China.
Ha, W. Y., Shaw, P. C., Liu, J., Yau, F. C. & Wang, J. (2002), 'Authentication of Panax
ginseng and Panax quinquefolius using amplified fragment length polymorphism
(AFLP) and directed amplification of minisatellite region DNA (DAMD)', Journal
of agricultural and food chemistry, 50 (7), pp. 1871-1875.
Ha, W. Y., Yau, F. C., But, P. P., Wang, J. & Shaw, P. C. (2001), 'Direct amplification of
length polymorphism analysis differentiates Panax ginseng from P. quinquefolius',
Planta Medica, 67 (6), pp. 587-589.
Ho, I. S. H. & Leung, F. C. (2001), 'Isolation and characterization of repetitive DNA
sequences from Panax ginseng', Molecular Genetics & Genomics: MGG, 266 (6),
pp. 951-961.
Hon, C. C., Chow, Y. C., Zeng, F. Y. & Leung, F. C. (2003), 'Genetic authentication of
ginseng and other traditional Chinese medicine', Acta Pharmacol Sin, 24 (9),
pp. 841-846.
Hong, C. P., Lee, S. J., Park, J. Y., Plaha, P., Park, Y. S., Lee, Y. K., Choi, J. E., Kim, K.
Y., Lee, J. H. & Lee, J. (2004), 'Construction of a BAC library of Korean ginseng
and initial analysis of BAC-end sequences', Molecular Genetics & Genomics, 271
(6), pp. 709-716.
Hsieh, H.-M., Liu, C.-L., Tsai, L.-C., Hou, R.-J., Liu, K.-L., Linacre, A. & Lee, J. C.-L.
(2005), 'Characterization of the polymorphic repeat sequence within the rDNA IGS
of Cannabis sativa', Forensic Science International, 152, pp. 23-28.
Jung, D.-W., Lee, J. M. & Sung, C. K. (2002), 'Enzyme-linked immunosorbent assay for
the determination of 20(S)-protopanaxatriol', Analytica Chimica Acta, 462 (2),
pp. 157-163.
Kapteyn, J., Goldsbrough, P. B. & Simon, J. E. (2002), 'Genetic relationships and diversity
of commercially relevant Echinacea species', Theoretical Applied Genetics, 105, pp.
365-376.
Kew, J., Morris, C., Aihie, A., Fysh, R., Jones, S. & Brooks, D. (1993), 'Arsenic and
mercury intoxication due to Indian ethnic remedies.' British Medical Journal, 306,
pp. 506-507.
75
Kim, K. & Lee, H. (2004), 'Complete chloroplast genome sequences from Korean ginseng
(Panax schinseng Nees) and comparative analysis of sequence evolution among 17
vascular plants', DNA Research, 11 (4), pp. 247-261.
Kim, K. S., Schuster, W., Brennicke, A. & Choi, K. T. (1991), 'Korean ginseng
mitochondrial DNA encodes an intact rps12 gene downstream of the nad3 gene',
Plant Physiology, 97 (4), pp. 1602-1603.
Kitagawa, T., Yang, Z., Bai, G., Fujiwara, K., Akahori, A., Sonoi, S. & Kondo, S. (1997),
'A general Enzyme Immunoassay for the Licorice Root Component contained in
Traditional Chinese Medicine', Biological & Pharmaceutical Bulletin, 20 (3),
pp. 211-216.
Komatsu, K., Zhu, S., Fushimi, H., Qui, T. K., Cai, S. & Kadota, S. (2001), 'Phylogenetic
analysis based on 18S rRNA gene and matK gene sequences of Panax vietnamensis
and five related species', Planta Medica., 67 (5), pp. 461-465.
Lao, S. C., Li, S. P., Kan, K. K. W., Li, P., Wan, J. B., Wang, Y. T., Dong, T. T. X. &
Tsim, K. W. K. (2004), 'Identification and quantification of 13 components in
Angelica sinensis (Danggui) by gas chromatography–mass spectrometry coupled
with pressurized liquid extraction', Analytica Chimica Acta, 526, pp. 131-137.
Lee, C. & Wen, J. (2004), 'Phylogeny of Panax using chloroplast trnC-trnD intergenic
region and the utility of trnC-trnD in interspecific studies of plants', Molecular
Phylogenetics & Evolution, 31 (3), pp. 894-903.
Lee, S.-B. & Rasmussen, S. K. (2000), 'Molecular markers in some medicinal plants of the
Apiaceace family', Euphytica, 114, pp 87-91.
Lee, S.-Y. & Cho, G.-J. (2006), 'Parentage testing of Thoroughbred horse in Korea using
microsatellite DNA typing', Journal of Vetinary Science, 7 (1), pp. 63-67.
Lee, S. H., Min, D. M. & Kim, J. K. (2006), 'Qualitative and quantitative polymerase chain
reaction analysis for genetically modified maize MON863', Journal of agricultural
and food chemistry, 54 (4), pp. 1124-1129.
Leimanis, S., Hernandez, M., Fernandez, S., Boyer, F., Burns, M., Bruderer, S., Glouden,
T., Harris, N., Kaeppeli, O. & Philipp, P. (2006), 'A Microarray-based Detection
System for Genetically Modified (GM) Food Ingredients', Plant molecular biology,
61 (1-2), pp. 123-139.
76
Leung, F. C. (1999), 'New applications of low-C0t DNA as a DNA fingerprint probe',
Electrophoresis, 20 (8), pp. 1762-1767.
Li, Y. F., Li, Y. X., Lin, J., Xu, Y., Yan, F., Tang, L. & Chen, F. (2003), 'Identification of
bulb from Fritillaria cirrhosa by PCR with specific primers', Planta Medica, 69 (2),
pp. 186-188.
Linacre, A. & Thorpe, J. (1998), 'Detection and identifcation of cannabis by DNA',
Forensic Science International, 91, pp. 71-76.
Linder, C. R., Moore, L. A. & Jackson, R. B. (2000), 'A universal molecular method for
identifying underground plant parts to species', Molecular Ecology, 9, pp. 1549-
1559.
Liu, S.-Y., Woo, S.-O. & Koh, H.-L. (2001), 'HPLC and GC–MS screening of Chinese
proprietary medicine for undeclared therapeutic substances', Journal of
Pharmaceutical and Biomedical Analysis, 24, pp. 983-992.
Lo, C.-F., Lin, Y.-R., Chang, H.-C. & Lin, J.-H. (2006), 'Identification of Turtle Shell and
Its Preparations by PCR-DNA Sequencing Method', Journal of Food and Drug
Analysis, 14 (2), pp. 153-158.
Lorenzini, R. (2005), 'DNA forensics and the poaching of wildlife in Italy: A case study',
Forensic Science International, 153, pp. 218-221.
Ma, X. Q., Duan, J. A., Zhu, D. Y., Dong, T. T. & Tsim, K. W. (2000), 'Species
identification of Radix Astragali (Huangqi) by DNA sequence of its 5S-rRNA
spacer domain', Phytochemistry, 54 (4), pp. 363-8.
Ma, X. Q., Zhu, D. Y., Li, S. P., Dong, T. T. X. & Tsim, K. W. K. (2001), 'Authentic
identification of Stigma Croci (stigma of Crocus sativus) from its adulterants by
molecular genetic analysis', Planta Medica, 67 (2), pp. 183-186.
Mallol, A., Cusido, R. M., Palazon, J., Bonfill, M., Morales, C. & Pinol, M. T. (2001),
'Ginsenoside production in different phenotypes of Panax ginseng transformed
roots', Phytochemistry, 57 (3), pp. 365-371.
Manel, S., Berthier, P. & Luikart, G. (2002), 'Detecting Wildlife Poaching: Identifying the
Origin of Individuals with Bayesian Assignment Tests and Multilocus Genotypes',
Conservation Biology, 16 (3), pp. 650-659.
77
Mathur, A., Sangwan, R. S., Gangwar, A. & Uniyal, G. C. (2003), 'Differential
morphogenetic responses, ginsenoside metabolism and RAPD patterns of three
Panax species', Genetic Resources & Crop Evolution, 50 (3), pp. 245-252.
Mihalov, J. J., Marderosian, A. D. & Pierce, J. C. (2000), 'DNA identification of
commercial ginseng samples', Journal of Agricultural & Food Chemistry, 48 (8),
pp. 3744-3752.
Mizukami, H. (1995), 'Amplification and sequence of a 5S-rRNA gene spacer region from
the crude drug "Angelica root"', Biological & Pharmaceutical Bulletin, 18 (9), pp.
1299-1301.
Nah, J., Song, J., Choi, S., Kim, S., Rhim, H., Oh, T., Lee, S. & Nah, S. (2000),
'Preparation of monoclonal antibody against ginsenoside Rf and its enzyme
immunoassay', Biological & Pharmaceutical Bulletin, 23 (5), pp. 523-526.
Nebauer, S. G., Castillo-Agudo, L. d. & Segura, J. (1999), 'RAPD variation within and
among natural populations of outcrossing willow-leaved foxglove (Digitalis obscura
L.)', Theoretical & Applied Genetics, 98 (6/7), pp. 985-994.
Nebauer, S. G., Castillo-Agudo, L. d. & Segura, J. (2000), 'An assessment of genetic
relationships within the genus Digitalis based on PCR-generated RAPD markers',
Theoretical & Applied Genetics, 100 (8), pp. 1209-1216.
Ngan, F., Shaw, P., But, P. & Wang, J. 1999, 'Molecular authentication of Panax species',
Phytochemistry, vol. 50, no. 5, pp. 787-791.
Palsboll, P. J., Berube, M., Skaug, H. J. & Raymakers, C. (2005), 'DNA Registers of
Legally Obtained Wildlife and Derived Products as Means to Identify Illegal Takes',
Conservation Biology, 20 (4), pp. 1284-1293.
Popovich, D. G. & Kitts, D. D. (2004), 'Generation of ginsenosides Rg3 and Rh2 from
North American ginseng', Phytochemistry, 65 (3), pp. 337-344.
Putalun, W., Fukuda, N., Tanaka, H. & Shoyama, Y. (2002), 'Immunoaffinity column for
isolation of bioactive compounds using monoclonal antibodies', Journal of Liquid
Chromatography & Related Technologies, 25 (13-15), pp. 2387-2398.
Putalun, W., Fukuda , N., Tanaka, H. & Shoyama, Y. (2004), 'A one-step
immunochromatographic assay for detecting ginsenosides Rb1 and Rg1', Analytical
& Bioanalytical Chemistry, 378 (5), pp. 1338-1341.
78
Qin, J., Leung, F. C., Fung, Y., Zhu, D. & Lin, B. (2005), 'Rapid authentication of ginseng
species using microchip electrophoresis with laser-induced fluorescence detection',
Analytical & Bioanalytical Chemistry, 381 (4), pp. 812-819.
Rafalski, J. A. (2002), 'Novel genetic mapping tools in plants: SNPs and LD-based
approaches', Plant Science, 162, pp. 329-333.
Roberts, M. A. & Crawford, D. L. (2000), 'Use of Randomly Amplified Polymorphic DNA
as a Means of Developing Genus- and Strain-Specific Streptomyces DNA Probes',
Apllied and Environmental Microbiology, 66 (6), pp. 2555-2564.
Roitt, I. M. 1991, Essential Immunology, 7th edn, Blackwell Scientific, Oxford.
Saez, R., Sanz, Y. & Toldra, F. (2004), 'PCR-based fingerprinting techniques for rapid
detection of animal species in meat products', Meat Science, 66, pp. 659-665.
Saita, T., Katano, M., Matsunaga, H., Yamamoto, H., Fujito, H. & Mori, M. (1993), 'The
first specific antibody against cytotoxic polyacetylenic alcohol, panaxynol',
Chemical & Pharmaceutical Bulletin, 41 (3), pp. 549-552.
Schaneberg, B. T. & Khan, I. A. (2004), 'Analysis of products suspected of containing
Aristolochia or Asarum species', Journal of Ethnopharmacology, 94, pp. 245-249.
Schluter, C. & Punja, Z. K. (2002), 'Genetic diversity among natural and cultivated field
populations and seed lots of American ginseng (Panax quinquefolius L.) in Canada',
International Journal of Plant Sciences, 163 (3), pp. 427-439.
Schneider, P. M. (2007), 'Scientific standards for studies in forensic genetics', Forensic
Science International, 165 (2-3), pp. 234-243.
Semple, S. J., Nobbs, S. F., Pyke, S. M., Reynolds, G. D. & Flower, R. L. P. (1999),
'Antiviral flavonoid from Pterocaulon sphacelatum, an Australian Aboriginal
medicine', Journal of Ethnopharmacology, 68, pp. 283-288.
Shaw, P. C. & But, P. P. (1995), 'Authentication of Panax species and their adulterants by
random-primed polymerase chain reaction', Planta Medica, 61 (5), pp. 466-9.
Sherwood, M. L. (1997), Human Physioloy: From cells to Systems, 3rd edn, Wadsworth
Publishing Company, Belmont, California. Figure from , pg B-3.
Shoyama, Y., Tanaka, H. & Fukuda, N. (1999), 'Monoclonal antibodies against naturally
occurring bioactive compounds', Cytotechnology, 31 (1-2), pp. 9-27.
79
Singh, A., Gaur, A., Shailaja, K., Bala, B. S. & Singh, L. (2004), 'A novel microsatellite
(STR) marker for forensic identification of big cats in India', Forensic Science
International, 141, pp. 143-147.
Sobrino, B., Brion, M. & Carracedo, A. (2005), 'SNPs in forensic genetics: a review on
SNP typing methodologies.' Forensic Science International, 154 (2-3), pp. 181-194.
Still, J. (2003), 'Use of animal products in traditional Chinese medicine: environmental
impact and health hazards', Complementary Therapies in Medicine, 11, pp. 118-
122.
Sun, F.-J., Downie, S. R. & Hartman, R. L. (2004), 'An ITS-Based phylogenetic analysis of
the perennial, endemic Apiaceae subfamily apioideae of western North America',
Systematic Botany, 29 (2), pp. 419-431.
Tamaki, K. & Jeffreys, A. J. (2005), 'Human tandem repeat sequences in forensic DNA
typing', Legal Medicine, 7 (4), pp. 244-250.
Tanaka, H., Fukuda, N. & Shoyama, Y. (1999), 'Formation of monoclonal antibody against
a major ginseng component, ginsenoside Rb1 and its characterization',
Cytotechnology, 29 (2), pp. 115-120.
Tanaka, H., Fukuda, N. & Shoyama, Y. (2006), 'Identification and Differentiation of Panax
species using ELISA, RAPD and Eastern Blotting', Phytochemical Analysis, 17, pp.
46-55.
Tanaka, H., Fukuda, N., Yahara, S., Isoda, S., Yuan, C. & Shoyama, Y. (2005), 'Isolation of
Ginsenoside Rb1 from Kalopanax pictus by Eastern Blotting Using Antiginsenoside
Rb1 Monoclonal Antibody', Phytotherapy Research, 19, pp. 255-258.
Tanaka, H. & Shoyama, Y. (1999), 'Monoclonal antibody against tetrahydrocannabinolic
acid distinguishes Cannabis sativa samples from different plant species', Forensic
Science International, 106, pp. 135-146.
Tawab, M. A., Bahr, U., Karas, M., Wurglics, M. & Schubert-Zsilavecz, M. (2003),
'Dedragation of Ginsenosidesin Humans after Oral Administration', Drug
Metabolism and Disposition, 31 (8), pp. 1065-1071.
Tay, C. & Seah, C. (1975), 'Arsenic poisoning from anti-asthmatic herbal preparations',
Medical Journal of Australia, 2, pp. 424-428.
80
Um, J.-Y., Chung, H.-S., Kim, M.-S., Na, H.-J., Kwon, H.-J., Kim, J.-J., Lee, K.-M., Lee,
S. J., Lim, J. P., Do, K.-R., Hwang, W.-J., Lyu, Y.-S., An, N.-H. & Kim, H.-M.
(2001), 'Molecular authentication of Panax ginseng species by RAPD analysis and
PCR-RFLP', Biological & Pharmaceutical Bulletin, 24 (8), pp. 872-875.
van Breemen, R. B., Huang, C.-R., Lu, Z.-Z., Rimando, A., Fong, H. H. S. & Fitzioff, J. F.
(1995), 'Electrospray Liquid Chromatography/Mas Spectrometry of Ginsenosides',
Analytical Chemistry, 67, pp. 3985-3989.
Wang, J., Ha, W. Y., Ngan, F. N., But, P. P. & Shaw, P. C. (2001), 'Application of
sequence characterized amplified region (SCAR) analysis to authenticate Panax
species and their adulterants', Planta Medica, 67 (8), pp. 781-783.
Wang, N., Kiyohara, H., Sakurai, M. & Yamada, H. (1999), 'Antigenic epitope for
polyclonal antibody against a complement activating pectin from the roots of
Angelica acutiloba Kitagawa', Carbohydrate Polymers, 39 (3), pp. 257-264.
Ward, J., Peakall, R., Gilmore, S. R. & Robertson, J. (2005), 'A molecular identification
system for grasses:a novel technology for forensic botany', Forensic Science
International, 152, pp. 121-131.
Watanabe, A., Araki, S., Kobari, S., Sudo, H., Tsuchida, T., Uno, T., Kosaka, N.,
Shimomura, K., Yamazaki, M. & Saito, K. (1998), 'In vitro propagation, restriction
fragment length polymorphism, and random amplified polymorphic DNA analysis
of Angelica plants', Plant Cell Reports, 18 (3-4), pp. 187-192.
Wen, J., Shi, S., Jansen, R. K. & Zimmer, E. A. (1998), 'Phylogeny and Biogeorgraophy of
Aralia sect. Aralia (Araliaceae)', American Journal of Botany, 85 (6), pp. 866-875.
Wen, J. & Zimmer, E. A. (1996), 'Phylogeny and biogeography of Panax L. (the ginseng
genus, araliaceae): inferences from ITS sequences of nuclear ribosomal DNA',
Molecular Phylogenetic Evolution, 6 (2), pp. 167-77.
Wetton, J. H., Tsang, C. S. F., Roney, C. A. & Spriggs, A. C. (2002), 'An extremely
sensitive species-specific ARMS PCR test for the presence of tiger bone DNA',
Forensic Science International, 126 (2), pp. 137-144.
Wilbert, J. (1991), 'Does pharmacology corroborate the nicotine therapy and practices of
South American shamanism?' Journal of Ethnopharmacology, 32, pp. 179-182.
81
Wilson, I. G. (1997), 'Inhibition and Facilitation of Nucleic Acid Amplification', Applied
and Environmental Microbiology, 63 (10), pp. 3741–3751.
World Health Organisation, (2003). Traditional medicine Fact sheet N°134
www.who.int/mediacentre/factsheets/fs134/en/.
Xu, H., Fabricant, D. S., Piersen, C. E., Bolton, J. L., Pezzuto, J. M., Fong, H., Totura, S.,
Farnsworth, N. R. & Constantinou, A. I. (2002), 'A preliminary RAPD-PCR
analysis of Cimicifuga species and other botanicals used for women's health',
Phytomedicine, 9 (8), pp. 757-762.
Xu, Y. C., Li, B., Li, W. S., Bai, S. Y., Jin, Y., Li, X. P., Gu, M. B., Jing, S. Y. & Zhang,
W. (2005), 'Individualization of tiger by using microsatellites', Forensic Science
International, 151, pp. 45-51.
Xu, Y., Wang, Y., Li, Z., Bao, Z., Zhou, J. & Huang, H. (2006), 'Characterization of
polymorphic microsatellite loci in a traditional Chinese medicinal plant, Gastrodia
elata', Molecular Ecology Notes, 6 (2), pp. 316-318.
Yanagihara, H., Sakata, R., Minamia, H., Tanaka, H., Shoyama, Y. & Murakamib, H.
(1996), 'Immunoaffinity column chromatography against forskolin using an anti-
forskolin monoclonal antibody and its application', Analytica Chimica Acta, 335,
pp. 63-70.
Yau, F. C. F., Wong, K. L., Shaw, P. C., But, P. P. H. & Wang, J. (2002), 'Authentication
of snakes used in Chinese medicine by sequence characterized amplified region
(SCAR)', Biodiversity and Conservation, 11, pp. 1653-1662.
Yee, S.-K., Chu, S.-S., Xu, Y.-M. & Choo, P.-L. (2005), 'Regulatory control of Chinese
Proprietary Medicines in Singapore', Health Policy, 71, pp. 133-149.
Yi, T., Lowry, P. P., II, Plunkett, G. M. & Wen, J. (2004), 'Chromosomal evolution in
Araliaceae and close relatives', Taxon, 53 (4), 987-1005.
Yoon, S.-R., Nah, J.-J., Kim, S.-K., Kim, S.-C., Nam, K.-Y., Jung, D.-W. & Nah, S.-Y.
(1998), 'Determination of ginsenoside Rf and Rg2 from Panax ginseng using
enzyme immunoassay', Chemical & Pharmaceutical Bulletin, 46 (7), pp. 1144-
1147.
Yu, K. & Pauls, K. P. (1992), 'Optimization of the PCR program for RAPD analysis',
Nucleic Acids Research, 20 (10), p. 2606.
82
Yue, G., Li, Y., Chen, F., Cho, S., Lim, L. C. & Orban, L. (2002), 'Comparison of three
DNA marker systems for assessing genetic diversity in Asian arowana (Scleropages
formosus)', Electrophoresis, 23 (7-8), pp. 1025-32.
Zhang, H., Lu, Z., Tan, G. T., Qiu, S., Farnsworth, N. R., Pezzuto, J. M. & Fong, H. H. S.
(2002), 'Polyacetyleneginsenoside-Ro, a novel triterpene saponin from Panax
ginseng', Tetrahedron Letters, 43, pp. 973-977.
Zhang, N., Xu, B., Mou, C., Yang, W., Wei, J., Lu, L., Zhu, J., Du, J., Wu, X., Ye, L., Fu,
Z., Lu, Y., Lin, J., Sun, Z., Su, J., Dong, M. & Xu, A. (2003), 'Molecular profile of
the unique species of traditional Chinese medicine, Chinese seahorse (Hippocampus
kuda Bleeker)', FEBS Letters, 550 (1-3), pp. 124-34.
Zhao, K. J., Dong, T. T., Tu, P. F., Song, Z. H., Lo, C. K. & Tsim, K. W. (2003),
'Molecular genetic and chemical assessment of radix Angelica (Danggui) in China',
Journal of agricultural and food chemistry, 51 (9), pp. 2576-2583.
Zhao, Z. L., Wang, Z. T., Xu, L. S. & Zhou, K. Y. (2002), 'Studies on the molecular
markers of rhizomes of some Alpinia species', Planta Medica, 68 (6), pp. 574-6.
Zhao, Z. L., Zhou, K. Y., Dong, H. & Xu, L. S. (2001), 'Characters of nrDNA ITS region
sequences of fruits of Alpinia galanga and their adulterants', Planta Medica, 67 (4),
pp. 381-383.
83
APPENDIX A
84
Detailed in this appendix are the methods used during this research.
Solutions
Cell Lysis Buffer - 500mM Sodium Chloride
100mM Tris-HCl
50mM EDTA
TE buffer pH 8.0 - 100mM Tris-HCl
10mM Ethylenediaminetetraacetic Acid (EDTA)
2% Agarose Gel - 4g Agarose powder
200ml of 0.5 X TBE
10µl Ethidium Bromide
0.5 X TBE - 108g of Tris-HCl
8g of EDTA
56g of Boric Acid
20 litres of distilled water
Sample Acquisition
Dried plant root samples were purchased from a number of different retailers in Western
Australia, Singapore and Brisbane. Each of the purchased samples where labelled as Panax
ginseng, Panax quinquefolium or Panax notoginseng. Along with dried root material two
liquid samples labelled as containing ginseng were purchased from stores in Perth Western
Australia, see Table 1 below for descriptions of the samples.
Extraction Protocol
Before DNA extraction was preformed some sample preparation was required. All dried
samples were washed with sterile water to remove contaminants then dried on a heat block
before they were peeled and the peel ground into a fine powder. The peel was used because
85
the inner cortex of plants is low in DNA containing cells and full of polysaccharides, which
are PCR inhibitors (Chiou et al. 2001; Wilson 1997). Liquid samples were extracted using
1mL aliquots of the samples.
Phenol:Chloroform extraction of the material was performed as follows, 25mg of material
was placed into 500µl of cell lysis buffer with 50µl of 20% SDS and 10µl of Proteinase K
then incubated at 65oC for an hour. The sample was then extracted twice with an equal
volume of Phenol:Chloroform:Isoamyl alcohol (25:24:1). The supernatant was collected
and 500µl of Chloroform was added and centrifuged at 13,200rpm for 3 minutes. The
supernatant was collected again and double volume of 100% ethanol was added and
incubated at -20 o
C for 30 minutes. Samples were centrifuged at 13,200rpm for 10 minutes
and the supernatant was removed and the pellet was washed with 70% ethanol. The pellet
was air dried and re-suspended in 100µl of TE.
After extraction the concentration and purity of the DNA was determined using a
Nanodrop® ND-1000 (NanoDrop Technologies) spectrophotometer measuring light
absorbance at 230nm.
86
Table 1. The samples that were DNA profiled to evaluate the use of these RAPD primers to differentiate TCM material.
Sample
Number
Sample Description Label Common Name Purchased From
CR003 Dried root material in thin pieces Panax ginseng Chinese ginseng Perth, Western Australia
CR010 Dried whole roots Panax quinquefolium American ginseng Singapore, Singapore
CR009 Dried root material in thick pieces Panax ginseng Chinese ginseng Singapore, Singapore
CR013 Slices of Black root material Panax notoginseng
Sanchi ginseng Perth, Western Australia
CR025 Whole Red dried root material Panax ginseng Korean ginseng Perth, Western Australia
CR026 Black liquid extractum Panax ginseng Chinese ginseng Perth, Western Australia
CR027 Liquid drink containing a whole root Panax ginseng Korean ginseng Perth, Western Australia
CR030 Dried root material Eleutherococcus
senticosus
Siberian ginseng Brisbane, Queensland
87
PCR Protocol
PCR Solution
The PCR solution contained the following material to a total volume of 20µl,
100ng of DNA
1 Unit of Taq
2µl of 10X PCR buffer
2µl of 200 picomole primer
200µM dNTP
1µl of 5% BSA
MgCl2 concentrations were optimized for each primer
Sterile double-distilled water
Taq Polymerase
A range of Taqs were tested during a short trial, these included AmpliTaq (Applied
Biosystems), AmpliTaq Gold (Applied Biosystems), iTaq DNA polymerase (Bio-Rad),
HotStarTaq Plus (Qiagen), GoTaq Green (Promega) and Fisher Biotec Taq. The Taq found
to amplify the samples the most consistently was used for all further profiling. While each
Taq produced results to varying degrees the Fisher Biotech (Australia) Taq produced the
most consistent amplification of multiple bands and was used for all subsequent work
presented here.
Additives
Initially, there were problems getting reproducible production of PCR products. To try and
determine what was causing the lack of reproducibility positive control DNA was mixed
with the extracted DNA and a PCR as performed. It was found that the positive control and
sample DNA mix where inhibited. To reduce the action of the PCR inhibitor a variety of
additives were tested and BSA was found to product more reliable PCR amplification when
88
added to the PCR solution. BSA is used regularly in many other DNA profiling situations
such as with ancient DNA to reduce inhibitors affects (Binladen et al., 2006).
Magnesium Chloride concentration
As with all PCR protocols the MgCl2 needed to be optimised for each of the primers used.
Here the MgCl2 were 4mM for Primer3 and 4.5mM for primer DALP1.7F3.
Primers
Randomly Amplified Polymorphic DNA (RAPD) techniques use a single small arbitrary
primer of between 10 and 20 base pairs in length in each PCR. The single primer acts as
what in different DNA profiling techniques would be separately designed forward and
reverse primers. When testing material using RAPD techniques different primers are tested
until a set is found which produce reliable and reproducible results that can distinguish
multiple species from each other.
Primers were selected from previous research articles where they had been used on a
number of different samples types, including TCMs (Chung et al., 2002; Cui et al., 2003;
Ha et al., 2001), cannabis (Linacre & Thorpe, 1998) and flies (Benecke, 1998). Table 2
describes the primers that were tested, detailing their sequence and the sample they had
previously been used with. Each primer produced results to varying degrees; the most
reliable primers that differentiated the different Panax species were used to further
authenticate the material used in TCM.
Primers REP1R and primer 808, which had previously been used on flies, produced only
single bands when amplifying the materials of interest here. This meant they were of no
use for distinguishing Panax plant species and hence, were not used again.
The three primers (Z8, Z10 and primer C) were found to produce very variable results and
would not consistently amplify even after considerable attempts to optimize the PCR.
89
When they did amplify multiple bands were produced, their unreliability and lack of
reproducibility meant they are of little research value.
The primers primer 3 (referred to as CHUN3 in Section 2.2) and DALP1.7F3 produced
reliable results that could be reproduced repeatedly. These primers also produced profiles
that distinguished the plant species of interest. The profiles produced by the primers are
presented in detail in the manuscript titled “Differentiation of Ginseng species using
Randomly Amplified Polymorphic DNA (RAPD)” in Section 2.1.
90
Table 2. Primers tested to determine whether they could distinguish Panax plant species.
Name Sequence 5’-3’ Reference Previous use
Primer 3 (referred
to as CHUN3 in
Section 2.2)
GTGTGCGATCAGTTCTGGG Chung et al. (2002) Pinellia ternata root
DALP1.7F3 GCGTCCCACTGACCCTTTTGTACA Ha et al. (2001) P. ginseng and P. quinquefolium
Z8 GGGTGGGTA Cui et al. (2003) P. notoginseng
Z10 CCGACAAACC Cui et al. (2003) P. notoginseng
Primer C CGAAATCGGTAGACGCTACG Linacre and Thorpe
(1998) Cannabis sativa
REP1R ACGTCGICATCAGGC
Benecke (1998) Calliphora erythrocephala
Primer 808 AGA GAG AGA GAG AGA GC
In House Calliphora erythrocephala
91
PCR Cycle
The PCR protocol used was selected as it provided conditions that would amplify any DNA
present in the PCR. The cycle was as follows:
Initial Denature 15 minutes at 95 oC
35 cycles Denature 30s at 95 o
C
Anneal 60s at 45 o
C
Extension 90s at 72 o
C
Final Extension 72 oC for an hour.
Visualisation
The PCR products were run on 2% agarose gel containing Ethidium Bromide at 120 volts
for an hour. Then the gels were visualized on an Ultraviolet light box.