Post on 26-May-2020
transcript
1
PREPARATION AND FIELD EVALUATION OF CELL CULTURE
ADAPTED LYOPHILIZED THERMOSTABLE NEWCASTLE DISEASE
VACCINE
By
FAISAL SIDDIQUE
DVM & M. Phil
Reg. No. 2004-ag-1674
A thesis submitted in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
In
MICROBIOLOGY
INSTITUTE OF MICROBIOLOGY
UNIVERSITY OF AGRICULTURE FAISALABAD,
PAKISTAN
2015
2
To
The Controller of Examinations, University of Agriculture,
Faisalabad
“We, the supervisory committee, certify that the contents and form of thesis submitted by Mr.
Faisal Siddique, Reg. No. 2004-ag-1674, have been found satisfactory and recommend that
it be processed for evaluation by the external examiner (s) for the award of degree”.
Supervisory Committee:
1. Chairman _____________________________
Dr. Muhammad Shahid Mahmood
2. Member _________________________
Prof. Dr. Iftikhar Hussain
3. Member _________________________
Dr. Farrah Deeba
3
DECLARATION
I, hereby, declare that the contents of thesis, “Preparation and field evaluation of cell
culture adapted lyophilized thermostable Newcastle Disease Vaccine” are product
of my own research and no part has been copied from any published source (except the
references, standard mathematical or generic models /equations /formulae /protocols…etc). I,
further, declare that this work has not been submitted for award of any other diploma/degree.
The university may take action if the information provided is found inaccurate at any stage (In
case of any default, the scholar will be proceeded against as per HEC Plagiarism Policy).
Faisal Siddique
4
To
WHO IS UNIVERSE FOR ME
WHO IS HEAVEN FOR ME
THEY ARE WORLD FOR ME
5
Acknowledgements
I feel actuated from within to offer my humblest and sincerest thanks to
ALMIGHTY ALLAH, the most Merciful, the most Beneficent, the Gracious and
Compassionate, Who created the Universe and bestowed the mankind with
knowledge and Wisdom to search for its secrets and bestowed the ability to perceive
and pursue higher ideals of life. I offer my praises and sentiments to HOLY PROPHET
HAZRAT MUHAMMAD (Peace and Blessings of Allah be upon him), who is an
eternal beacon of guidance and knowledge for humanity as a whole.
I deem it utmost pleasure to express my heartiest gratitude and deep sense of
obligation to my reverend Supervisor Dr. Muhammad Shahid Mahmood, Associate
Professor, Institute of Microbiology, University of Agriculture, Faisalabad, for his
skillful guidance, learned patronage, unfailing patience, untiring help throughout and
inspiring attitude to work with patience. His guidance helped me in all the time of
research and writing of this thesis. I could not have imagined having a better advisor
and mentor for my Ph.D. study.
My supervisory committee member, Professor Dr. Iftikhar Hussain, Director,
Institute of Microbiology, University of Agriculture, Faisalabad for his kind,
sympathetic, inspiring and scholastic guidance and ever encouraging attitude.
I take pride in expressing my immense gratitude to member of my supervisory
committee Dr. Farrah Deeba, Assistant Professor, Department of Clinical Medicine
and Surgery, University of Agriculture, Faisalabad, for her guidance and valuable
suggestions during the course of this project.
I fervently extend my zealous thanks and profound sense of admiration to
honorable Prof. Dr. Sayied I. Ahmad, HEC, Foreign Professor, Institute of
Microbiology, University of Agriculture, Faisalabad and Dr. Moaz-ur-Rahman,
Principle Scientist, NIBGE for their kind sympathetic and inspiring guidance and
valuable suggestions during the course of study.
Parents are truing dense of my humblest obligations and my words will fail to
give them credit especially to my Parents whose prayers, love, patience, sacrifice,
6
encouragement and spiritual inspiration was a great source of motivation for the quest
of knowledge at every stage of my education. I am earnestly obliged to my polite Father
and loving Mother for the strenuous efforts done by them in enabling me to join the
higher ideas of life. My success is really the fruit of her derailed prayers. I am greatly
indebted and submit my earnest thank to her as she has potentially tolerated agony
and all miseries and provided me the incentives and opportunity to complete my post-
graduate studies.
Last but not least, I must acknowledge my indebtedness to my loving family,
relatives and friends Dr. Asif Iqbal, Farrukh Siddique, Dr. Arslan Siddique, Sadam
Siddique, Ayesha Siddque, Maida Manzoor, Abdul Sattar, Usman Yaqoob, M.
Zahid, Raheem-ul-Allah, Dr. Azahar Aslam and Dr. Shahid Ali for their prayers,
love, patience, sacrifice, encouragement and spiritual inspiration was a great source of
motivation during my study period.
Faisal Siddique
7
CONTENTS
Chapter # Title Page #
1 INTRODUCTION 1
2 REVIEW OF LITERATURE 4
3 MATERIALS AND METHODS 18
4 RESULTS 40
5 DISCUSSION 76
6 SUMMARY 85
7 REFERENCES 87
8
List of Tables
Sr. No. Title Page No.
1 Complete description of Vero cell line 44
2 Effect of Temperature Treatment on the Infectivity and
Haemagglutination activity of the NDV I-2 Vaccine 58
3 Comparative Haemagglutination inhibition antibody titers mean of
Thermo-Vac and LaSota NDV vaccine in commercial broiler chickens 62
4 Comparative ELISA antibody titers mean of Thermo-Vac and LaSota
NDV vaccine in commercial broiler chickens 64
5 Effect of Challenge virus on the selected groups after 28 days of post
immunization 66
6
Haemagglutination Inhibition Mean antibody titers of cell culture
adapted Thermostable ND I-2 (Thermo-Vac) at various selected
poultry farms of district Faisalabad, Pakistan
71
7
Enzyme Linked Immunosorbant Assay Mean antibody titers of cell
culture adapted Thermostable ND I-2 vaccine (Thermo-Vac) at
various selected poultry farms of district Faisalabad, Pakistan
73
9
List of Figures
Sr. No. Title Page #
1 Vero cells 24 hours post revival at 100X 42
2 48 hours post revival Vero cells at 100X 42
3 90-100% confluent monolayer after 96 hours 43
4 24 hours post infected Vero cells with I-2 NDV 46
5 36 hours post infected plate of Vero cells 46
6 48 hours post infection of Vero cells in passage no.1 47
7 72 hours post infection of Vero cells in passage no.1 47
8 Appearance of cytopathic effect (CPE) started at 96 hours post
infection at P 10th 48
9 CPE (Syncytial formation) at 120 hours post infection of virus in
10th passage 48
10 CPE (Syncytial and Roundening of cells) at 72 hours post infection
in 11th passage 49
11 CPE (Syncytial formation and Roundening of cells) after 72 hours
in passage 12th 49
12 Consistent CPE appeared in passage 13th after 6 hours of Post
infection 50
13 Consistent CPE (Aggregation of cells) appeared in passage 13th after
12 hours of Post infection 50
14 Consistent CPE (Aggregation of cells) appeared in passage 13th after
18 hours of Post infection 51
15
Consistent CPE (Roundening or Detachment of cells from Tissue
culture flask) appeared in passage 13th after 24 hours of Post
infection
51
16 PCR products amplified from fusion protein gene of cleavage site of
NDV I-2 strain on 2% agarose gel stained with ethidium bromide 53
17 Newcastle disease virus strain I2 fusion protein mRNA, partial cds
Gen Bank: KM043779.1 54
10
18
Neighbor-Joining method was used for constructing phylogenetic
hierarchy on partial nucleotide sequences of fusion protein of I-2
Newcastle disease virus
55
19 Final preparation of cell culture adapted lyophilized thermostable
Newcastle disease vaccine (Thermo-Vac) 57
20
Experimental evaluation Thermo-Vac NDV and LaSota NDV
vaccine in commercial broiler chickens, Lab animal House, IOM,
UAF
61
21
Comparative Haemagglutination inhibition antibody titers mean of
Thermo-Vac (I-2 NDV) and LaSota NDV vaccine in commercial
broiler chickens
61
22 Comparative ELISA antibody titers mean of I-2 NDV (Thermo-
Vac) and LaSota NDV vaccine in commercial broiler chickens 65
23
Comparative analysis of cellular immune response of Thermo-Vac
and LaSota NDV vaccine through Splenic cell migration inhibition
assay
67
24 Field evaluation of Thermo-Vac NDV vaccine in commercial
broiler birds 70
25
Haemagglutination Inhibition Mean antibody titers of cell culture
adapted Thermostable ND I-2 (Thermo-Vac) at various selected
poultry farms of district Faisalabad, Pakistan
72
26
Enzyme Linked Immunosorbant Assay Mean antibody titers of cell
culture adapted Thermostable ND I-2 vaccine (Thermo-Vac) at
various selected poultry farms of district Faisalabad, Pakistan
74
27
Comparative HI and ELISA Mean antibody titers of cell culture
adapted Thermostable ND I-2 vaccine (Thermo-Vac) at various
selected poultry farms of district Faisalabad, Pakistan
75
11
ABSTRACT
Newcastle disease is one of the nastiest disease of chicken throughout the world, particularly
in developing countries like Pakistan. The present study was aimed to prepare a cell culture
adapted vaccine for propagation and adaptation of avirulent thermostable NDV I-2 strain on
Vero cell line, molecular confirmation and characterization of cell culture adapted
thermostable NDV I-2 strain and experimental and field evaluation of the cell culture adapted
NDV I-2 vaccine (Thermo-Vac) in broiler birds. A well characterized avirulent, Australian
origin thermostable I-2 ND Virus strain was used for vaccine production. In the current study,
Vero cell line was used for production of thermostable I-2 NDV vaccine. Vero cells were
grown at the rate of 3×107 cells per ml in MEM199 medium. The morphological alterations
such as roundening, aggregation of cells and detachment of cells were observed after the
growing of virus, called cytopathic effect (CPE). The first clear CPE was observed in passage
no. 10 following of 120 hours post infection. Haemagglutination test for each passage showed
that supernatant contained the virus. Consistent CPE was observed at passage no. 13th which
conferred the adaptation of NDV I-2 of Vero cells. Thermostablity was evaluated after each
passage of virus and results showed that thermostability of NDV I-2 strain was retained after
adaptation on Vero cell line. Biological titration of that adapted passage produced 106 pfu/ml
and log10 8 per ml tissue culture infective dose fifty (TCID50). Reverse transcription
polymerase chain reaction (RT-PCR) was used for molecular detection of Vero cell adapted
virus. Specific primer amplified fusion protein cleavage site and produced 204 bp DNA
fragment. The accession number i.e. KM043779 was obtained from Genbank. Phylogenetic
analysis revealed that 80-90% homology of in nucleotides amino acids was existed among the
other reported thermostable NDV isolates. The Vero cell adapted virus was used for
preparation of Thermo-Vac (cell culture adapted lyophilized NDV I-2) vaccine.
Thermostability of vaccine and sterility of prepared vaccine was checked by inoculating
culture media.
An experimental chicken NDV infection experiments in group 1, maximum HI and ELISA
mean antibody titers Log2 and standard deviation was achieved at days 14 e.g. 7.5±0.79a,
6812±0.654a as followed 2±0.41a,, 1633±0.341a, 6.0±0.13a, 4899±0.546a, 6.8±0.49a,
5899±0.879a, 6.75±0.64a, 5716±0.546a and 4.5±0.53a, 3480±0.347a at day 0, 7, 21, 28 and 35
following Thermo-Vac vaccination via drinking water method as compared to commercially
12
available NDV LaSota vaccine (Group 2) HI and ELISA mean antibody titer Log2 and standard
deviation i.e. 2±0.41b, 1633±0.632a, 2.95±0.29b, 2300±0.231b, 4.04± 0.62b, 4520±0.234b,
3.09±0.73b, 3400±0.543b, 2.20±0.11b, 2372±0.653b and 2 ± 0.65b, 1500±0.436b at day 0, 7, 14,
21, 28 and 35 respectively. The antibody titers of Thermo-Vac vs NDV LaSota were
vaccinated birds significantly different from one another except at day 0. In negative control
(group 3) no protective antibodies were produced. After NDV challenge infection, we observed
any morbidity and mortality in chicks in all groups. The results showed that administration of
Thermo-Vac vaccine in broiler birds was feasible and was found to induce more protective
antibody response i.e. 90% against challenge infection in group 1 as compared with group 2
NDV LaSota 60% protection after challenge viral infection. In group 3, all birds died after
challenge infection within 2-3 days. Cellular immune response was examined through spleenic
cell migration inhibition assay. The results showed that in group 1, Thermo-Vac vaccine start
producing % inhibition migration at day 3 (40%) and reached optimized level at day 6 (50%)
as gradually decreased at day 9, 12, 15 and 18 i.e. 38%, 26%, 14%, 13% respectively. In group
2, LaSota ND vaccine shown % migration inhibition at day 3, 6, 9, 12, 15, 18 i.e. 32%, 43%,
34%, 19%, 10%, 12% respectively. The % migration inhibition was less than 15% in control
group throughout the experiment. The % migration inhibition with ND I-2 antigen in group 1
was significantly higher as compared with Group 2 LaSota ND vaccine. In field conditions,
maximum geometric mean anti-NDV-HI (Log27.83) and anti-NDV-ELISA (6017) antibodies
titers were observed, respectively on 14th day post vaccination. In conclusion, Thermo-Vac
vaccine produced protective cellular and humoral immunity against NDV, So, Thermostable
NDV I-2 strain can be a preferred choice against NDV in developing countries like Pakistan.
13
1
Chapter # 1
INTRODUCTION
The poultry sector is one of the most important components of the farmer’s economy in the
Pakistan. Poultry is the principal meat in Pakistan now-a-days due to higher beef and mutton
prices and limited availability of fish meat. Poultry meat share in total meat production in
Pakistan is 28%. Poultry sector comprises of domestic birds (cocks, hens and chicken etc.)
commercial layers and broilers and their products (egg and meat). There are a number of viral
and bacterial diseases which cause huge economic loss in the poultry industry globally in terms
of morbidity and mortality. Among these diseases, Newcastle disease is the primary cause of
economic losses in the form of weakness, decreased egg production and quality of meat and
high death rate (Czeglédi et al., 2006). In Pakistan, forty four million birds died during 2012
which may reflect the significance of this nightmare (Anonymous, 2012).
With exception of some islands and Oceania, Newcastle disease is present worldwide.
This infection was first time found in Newcastle-upon-Tyne, England for which it was termed
as Newcastle disease (Doyle, 1927). In 1927, its outbreak also occurred in Ranikhet, India
(Saif, 2008). Newcastle disease causes upto 90-100% morbidity and mortality in chicken
(Czeglédi et al., 2006). High economic losses of the poultry industry is due to the epidemics
of ND and very costly vaccination programs (Czegledi et al., 2006).
Avian Paramyxovirus type 1 is the causative agent of this nightmare, which belongs to
Avulavirus genus of the Paramyxovirinae sub-family (Xiao et al., 2012). NDV is polymorphic
in shape, negative sense, enveloped RNA, single stranded virus (Saif, 2008). Thermostable
NDV I-2 strain is an Australian origin, avirulent, live (Spradbrow, 1992), safe and potent
(Anon, 1991). Pathogenesis and virulence of Newcastle disease virus strains depends upon
organ tropism. There are many associated determinants which affect the occurrence of the
disease in birds include dose of the virus, immune status, age of the birds, route of exposure,
stress and concurrent bacterial infection (Lewis, 2005). The virus enters the body through
nasopharyngeal and oral rout. The ciliary movements play an important role in its spread from
cell to cell. During initial replication and multiplication, the virus enters into the blood stream
14
and can be found in all major tissues include liver, kidney, spleen etc. within 20-40 hours of
infection. The virus enters the brain after sixty hours post infection after which birds start dying
(Kouwenhoven, 1993). The cellular activities of the host cells destroyed through
intracytoplasmic inclusion bodies. During infection, aggregation of cells or syncytial formation
observed, which could be due to the attachment and fusion of infected cells with
uninfected/normal host cells. Cloudy swelling of the host cells occurs during replication of
NDV which results in the destruction of the cells through budding. Newcastle disease virus
infection causes decreased ciliary movement, i.e. ciliostasis and lowering the resistance of
mucosal surfaces to secondary bacterial infection (Sharma and Adlakha, 1995a).
Vaccination is the only way to ingrain viral disease such as Newcastle disease round
the globe. Different factors such as levels of maternal antibodies, efficacy and quality of
vaccine, methods of immunization and health status of the birds have significant effects of
immunization program. Cell mediated and humoral immune response plays an eminent role in
the safeguard against ND (Li et al., 2009). There are many types of Newcastle disease vaccines
available in commercial market such as oil emulsified killed vaccines, mesogenic, lentogenic,
avirulent thermostable and recombinant vaccines (Spradbrow et al., 1995; Musa et al., 2010;
Palya et al., 2012). These vaccines provide sufficient immunity against ND. LaSota and
Hitchner B1 (lentogenic Newcastle disease virus strains) have been used for vaccine
production as compared to Mukhtaswar and Komarov (mesogenic NDV strains) because it
contains severe pathogenic effects (Musa et al., 2010).
Specific Pathogen Free (SPF) embryonated chicken eggs and cell culture method are
the two well-known techniques which have been used for the production of Newcastle disease
vaccines. SPF eggs have some drawbacks such as these it is expensive in terms of high
production cost and time consumption. Cell culture systems is more comfortable and less
laborious as compared to SPF eggs (Illango et al., 2008). Cell lines commonly used are
chicken, Vero cells, rabbit, MKC, pig, CEF, BHK-21, calf and BGM-70 (Ahmed et al., 2004;
Mohan et al., 2007). These are easy to handle in the laboratory.
Different techniques for the administration of vaccines to the birds include drinking
water, eye drop, spraying, mixing with feeds and injection (Echonwu et al., 2008b; Wambura
et al., 2011). Among them, the eye drop method provides strong protection against challenge
infection (Zubeedy, 2009).
15
Temperature is directly proportional to the efficacy of vaccines and deterioration of
thermolabile vaccines rapidly started after sixty minutes storage at room temperature. In
countries like Pakistan, where load shedding is an immense problem as cold chain cannot work
properly due to failure of constant equipment’s electric supply which could lead the wastage
of vaccine. To overcome these issues, we developed cell culture adapted thermostable NDV
vaccine (Thermo-Vac) by using thermostable Australian origin an avirulent NDV I-2 strains
in the cell culture laboratory from the Institute of Microbiology, University of Agriculture
Faisalabad. There are a number of benefits of thermostable vaccines i.e. less dependent to cold
chain, higher efficacy of vaccine, decrease in vaccine depletion, and easy storage. These
vaccines can maintain their activity at 28oC for 4-8 weeks and 4-8oC for 1 year. Keeping in
perspective the above expressed dangers, the present study was aimed to prepare a cell culture
adapted vaccine for the propagation and adaptation of avirulent thermostable NDV I-2 strain
on the Vero cell line, molecular confirmation and characterization of cell culture adapted
thermostable NDV I-2 strain and experimental and field evaluation of the cell culture adapted
NDV I-2 vaccine (Thermo-Vac) in broiler birds.
16
Chapter # 2
REVIEW OF LITERATURE
Based on OIE (2000), following are the criteria for the proper definition of Newcastle
disease (i) in day old Gallus Gallus, the Newcastle disease virus has 0.7 or greater ICPI (intra
cerebral pathogenicity index). (ii) The amino acid phenylalanine at position 117 is present in
the C-terminus of the F2 protein and N-terminus of the F1 protein. In 113 to 116 amino acid
position, three lysine or arginine are present. It may term as 'multiple basic amino acids.
Background Description
Avian Paramyxovirus type-1 is primary cause of this disease and it is distributed round
the globe, with the possible exception of certain islands and Oceania. This virus has the ability
to cause huge economic losses in poultry industry and infect more than two hundred and forty
species of birds. In 1926, this disease has been reported first time in Java, (Indonesia) and
Newcastle-upon-Tyne (England for which it was named (Kraneveld, 1926). However some
scientist, including Levine (1964), Hashimoto and Ochi well-thought that ND may had been
existing in Korea 2 years earlier than its outbreaks in Indonesia and United Kingdom. In 1991
the Office International des Epizooties (OIE) put ND into list A diseases (OIE, 1996).
The epidemics of Newcastle disease had been reported in many countries including
Western Isles of Scotland (1896), Central Europe (1926, 1960, 1973, 1981), Victoria state
(1976, 1985 and 1992), North America (1990), Saskatchewan (1990), Manitoba (1990),
Alberta Canada (1990) (Wobeser et al., 1993), Hong Kong (1950); cormorants in western
Canada, North USA, (1992) (Mixson and Pearson, 1992; Heckert 1993, Meteyer et al.,1997);
California, Arizona (1995 and 1997, 2002), Texas (1995 and 1997, 2002), New Mexico (1995
and 1997, 2002) and Nevada (1995 and 1997, 2002) (Docherty and Friend,1999; Kuiken et
al.,1998), Morocco (1988) and Mauritania (1988) (Bell and Mouloudi, 1988), Cameroon
(1991), Uganda (1991), Sudan (1991), Ethopia (1991) and Nigeria (1991) (Agbede et a1.,
1991; Bawke et al.,1991; Fadol, 1991; George, 1991; Olabode et al.,1991), Myanmar (1992),
Nepal (1992), Veitnam (1992), Srilanka (1992) and Bangladesh (1992) (Asadullah, 1992;
Levin, 1992; Mishra, 1992; Nguyen, 1992; Guanaratne, 1992); during 2012-2013, in Pakistan
fifty million broilers have been died due to this disease. Most of the economic losses in poultry
17
industry is caused by ND which mean it is a bigger drain on the world’s economy than any
other animal virus. There are countless benefits of protecting the birds against ND such as its
control measures will reduce morbidity and mortality rate of commercial and village chicken
which as a result will increase the eggs and meat production. Hence, demands for household
consumption and market supply will be fulfilled and lifestyle and health of human being will
be improved.
Importance of Newcastle Disease
It is grave transferable and extremely transmissible disease (Saidu et al., 2006). Among
contagious syndromes, ND is one of the supreme atrocious disease that distress avian species,
predominantly chicken where it may cause upto hundred percent morbidity and 90-100 %
mortality. In advanced countries, the epidemics of ND cause enduring damage in the poultry
industry and their vaccination program are very costly (Czegledi et al., 2006). However, in
emerging countries like Pakistan (Khan et al., 2011), Bangladesh (Asadullah, 1992) and
Uganda (Illango et al., 2008) where domestic as well as commercial poultry sector provides a
dietary protein in the form of eggs and meat, the prevalent of ND causes huge economic losses
as well as influence of human health (Iroegbu and Amadi, 2004). Mortality of 80-85% of
unvaccinated village poultry birds have also been reported due to ND outbreak (Ananth et al.,
2008).
Etiology
This disease is caused by Avian Paramyxovirus type 1 virus (Alexander, 1997;
Alexander et al., 1997; Lamb and Kolakofsky, 2001; Mayo, 2002; Aldous et al., 2003; Kim et
al., 2007a) which belong to genus Avulavirus (Lamb and Parks, 2007; Czegledi et al., 2006)
of the family Paramyxoviridae (Dortmans, 2009; Paldurai, 2009). ND viruses have been
classified in two classes. The class I ND virus genome comprises 15-198 nucleotides and the
genome of second class contains 15-192 nucleotides (Romer-Oberdorfer, 1999; Ballagi-
Pordany et al., 1996; Czegledi et al., 2006; Kim et al., 2007b). It is a single stranded RNA
virus, which is 100-200 nm in diameter, negative sense, non-segmented, enveloped,
pleomorphic with total size of genome is 15.2 kb (Seal et al., 2000; Knipe and Hetsley, 2001;
Bian et al., 2005; Saif, 2008; Alexander and Senne, 2008).
18
Genomic assembly of Newcastle Disease Virus
Six types of proteins including Haemagglutinin–neuraminidase (HN), Fusion (F),
Matrix (M), Phosphoprotein (P), RNA-dependent RNA polymerase (L) and Nucleocapsid
(NP) are present in ND virus. Among them, first three are most significant in the pathogenic
point of view (Lomniczi et al., 1998). The nucleocapsid protein is more stable than any other
genomic proteins of ND virus (Knipe and Hetsley, 2001; Zhao and Peeters, 2003; Seal et al.,
2005; Flint et al., 2007). The major function of fusion protein is merging of virus into the host
cell. When the virus enters into host, host proteases hydrolyze its virulence protein (fusion
protein) into two parts F2/F1. This cleavage is a prerequisite for the spread of viral infection
(Rott, 1985; Chambers et al., 1986b; Chambers and Samson, 1982; Toyoda et al., 1989; Collins
et al., 1993; Salih et al., 2000). The cellular proteases break down this precursor at F1/F2. The
molecular weight of F1 and F2 are 54 kDa and 16 kDa, respectively (Gotoh et al., 1992;
Ogasawara et al., 1992). Trypsin is also capable for this post-translation cleavage (Nagai et al.,
1976b; Peeters et al., 1999). When phosphoprotein and RNA-dependent RNA polymerase
combine then they synthesize ribonucleic-protein complex. This complex is the initial point of
transcription and start-stop process are started by using six protein genes. This mechanism is
called as “the rule of six” (Zhao and Peeters, 2003; Seal et al., 2005). Additional non-structural
protein V and W are formed by editing of phosphor protein gene transcription (Steward et al.,
1993; Locke et al., 2000; Mebatsion et al., 2001).
The RNA-dependent RNA polymerase (L) protein is the major structural protein which
contains 2204 amino acids and 249 kDa (Yusoff et al., 1987). The exact mechanism of L
protein is not clear. The significant role of this protein has been observed during assembly
formation (Chambers et al., 1986; Seal et al., 2000). The entire gene of HN protein contains
two thousand nucleotides that carry 571, 577 and 581 amino acid open frame reading sequence
(Sakaguchi et al., 1989; Tan et al., 1995). Haemagglutinin protein starts the hemolysis of red
blood cells by forming a lattice through absorption of the virus to specific receptors NANA
(N-acetyl neuramic acid) on the surface of the red blood cells (Kimball, 1990).
Neuraminidase protein cleaves the ketosidic bond between NANA receptor on host
cells and Haemagglutinin proteins of virus (Lamb and Kolakofsky, 1996). The phosphor
protein encloses three hundred and ninety five amino acid containing 42 kDa molecular weight
(McGinnes et al., 1988; Steward et al., 1993). The particular character of P protein is not
19
recognized, yet in combination with NP and L proteins it produces an active complex involved
in genome replication and transcription (Hamaguchi et al., 1985). The nucleocapsid (NP)
composed of four hundred and eighty nine residues of amino acid with 53 kDa molecular
weight. These protected the virus into nuclease activity of host cells (Kho et al., 2001b).
Molecular basis of pathogenic strains of ND
The virulence of Newcastle disease virus predominantly depends upon the fusion
protein amino acids sequence of cleavage site (Nagai et al., 1976; Glickman et al., 1988; Long
et al., 1988; de Leeuw et al., 2003). The difference between cleavage site of valogenic and
mesogenic strains consist of two amino acid residue separated by phenylalanine and glutamine
amino acids at 117 position, while the amino acid residues of lentogenic strains found at
position 112 and 115 and lucine at 117 (Collins et al.,1994). Some scientists reported that the
phenylalanine amino acid sequence of high pathogenic viruses were 112R/K-R-Q-K/R-R116
at the C-terminus and N-terminus of the F2 and F1 respectively. On the other side, low
virulence viruses (lentogenic viruses) have leucine amino acid sequences in the same region
(Rott, 1979; Jestin et al., 1989; Collins et al., 1993; Alexander and Senne, 2008). Avirulent
NDV strains (1-2 and V4) comprise six genes in the sequence 3'-N-P-M-F-HN-L-5' which
contain 15,192 bases of nucleotides (Mohamed et al., 2009).
Biological Functions of Surface Polypeptides
Surface polypeptides of Newcastle disease virus, for example fusion, Haemagglutinin
and Neuraminidase proteins performs several biological functions. Fusion protein speed up the
attachment of the virus to host cell via NANA receptors, which may lead to the breakdown of
erythrocytes. Host proteases cleave the fusion protein into two active subunits F1 and F2
(Chang and Dutch, 2012). Several researchers reported that arrangement of amino acid
sequence of the fusion protein cleavage site is the key element for NDV tissue tropism and
virulence (Panda et al., 2004; deLeeuw et al., 2005; Chang and Dutch, 2012). Velogenic or
very virulent Newcastle disease virus contains multi-basic amino acid fusion protein cleavage
site. Multi-basic amino acids present in the fusion protein cleavage site are moderate to high
virulent NDV strains. In comparison, mono-basic amino acids are present at the cleavage site
of the fusion protein of lentogenic and asymptomatic NDV strains (Dortmans et al., 2011).
Several studies have demonstrated the pathogenic effects of haemagglutinin proteins (Khattar
et al., 2009). The host red blood cells contain N-acetyl neuramic acid (NANA) receptors and
20
the viral haemagglutinin proteins have the capability to attach these receptors which could be
responsible for the agglutination of these cells (Ingrid et al., 2013). This agglutination
mechanism is the basis of serological diagnosis of Newcastle disease virus antibodies by
Haemagglutination inhibition test. Some eluted proteins such as mucopolysaccharide N-acetyl
neuraminyl hydrolase neuraminidase are also present on the surface of a virus. It has been
supposed that neuraminidase might assistance or facilitate the attachment of the fusion protein
to the cell membrane of the host cell.
Host Range
It is a transmissible bird’s infection distressing various wild and domestic avian species (Kaleta
and Baldauf, 1988). There are a huge number of poultry species infected with various NDV
strains of the virus round the globe which includes; broiler and layers (Nguyen, 1992; Sadiq,
2004; Numan et al., 2005; Ullah et al., 2005), pigeon (Arshad, 1984; Ballouh et al., 1985; Saif,
2003; Liu et al., 2003) ducks (Kaleta and Beldauf, 1988; Nishizawa et al., 2007; Liu et al.,
2009), turkeys (Coria et al., 1975; Ibrahim and Abdu,1992; Jamil and Sharma, 1993; Ananth
et al.,2008), ostrich (Sa’idu et al., 1999), guinea fowl, peacocks, pheasants (Higgins and
Shortridge, 1988; Warner, 1989; Martin, 1992), double yellow headed parrots (Walker et al.,
1973), water fowls (Spalatin and Hanson, 1975; Higgins and Shortridge, 1988) and Psittacines
(Kalthoff et al.,2008).
Pathotypes of Newcastle disease virus
Newcastle disease virus has been classified into four pathotypes on the basis of clinical
signs and symptoms. Various risk factors which have a dominant role in establishing the
cruelty of the disease are, exposure route, secondary bacterial infection, stress, dose of virus,
immune status, species and age of the host (Saif, 2003).
21
a) Velogenic Newcastle disease virus
It is the cruelest form of ND which causes upto 100% mortality. Neurological signs and
haemorrhagic lesions are more prominent signs.
b) Mesogenic Newcastle disease virus
It produces low mortality (40-50%) and reduction in egg production, e.g. Mukhtasvar,
Beaudette etc. It may or may not produce nervous signs. Mortality may be increased in very
young chicks if secondary infections are present.
c) Lentogenic Newcastle disease virus
Very low percentage of mortality (< 5%) observed due to this strain. In adults, it does
not cause any mortality but in young birds, it may cause respiratory signs.
d) A virulent Newcastle disease virus
It produces no mortality in chicks.
Transmission
Inhalation and Ingestion are the two routes that could be responsible for the transmission of
Newcastle disease virus among birds. Virus replicates in the respiratory and gastrointestinal
tracts. Therefore, the large amount of viruses are secreted in the droplets forms from the birds.
Host gets infection by inhaling these droplets or by ingesting infected faeces. A number of
other factors which facilitate the spread and epidemics of disease including wind, movement
of equipment, people and poultry products, mycotoxins, improper or expired vaccines, polluted
drinking water, immune status of the birds, managemental issues and geographical location
(Alexander, 1991b; Cattoli et al., 2011; OIE, 2012).
Clinical Signs and pathological findings
The average incubation period of Newcastle disease virus is 5-6 days. Numerous
factors such as environmental stress, secondary bacterial infection, health status, quantity of
virus, strain of virus, age, species and immune status of the birds play a significant role in
disease severity.
Head, wattle and conjunctival swelling, muscular tremors, ruffled feathers, twisting of
head and neck, prostration, anorexia, greenish diarrhea, thin-shelled eggs, difficult breathing
and mortality almost 100% are the signs of highly virulent vNDV (Brown et al., 1999;
Kommers et al., 2003; Susta et al., 2010). Other signs and symptoms may be multifocal
22
hemorrhages, necrosis and ulceration in the epidermal surface of intestine, GALT (gut
associated lymphoid tissue), cecal tonsils, proventriculus and gizzard (Brown et al., 1999;
Alexander and Senne, 2008).
In severe cases, multiple foci of yellow to white staining in spleen have also been
reported (Wakamatsu et al., 2006). In some cases, atrophy of bursa and thymus are also
reported (Nakamur et al., 2008). In the respiratory system, loss of cilia, edema, congestion,
erythro-phagocytosis and cell infiltration may also occur in birds. Numerous changes have also
been observed in the female reproductive system including destruction of shell forming portion
of the uterus; inflammation and atresia of follicles and hemorrhages and congestion in the
oviduct (Nakamura et al., 2004).
Diagnosis of Newcastle disease
The key of diagnosis success primarily depends upon history, sign and symptoms, gross and
microscopic examination of the lesions, isolation of the virus and serological tests.
Haemagglutination inhibition test is the gold standard for the detection of virus (Allan and
Gough, 1974; Forogh and Mayahi, 2013; Mohammed et al., 2013). Some other serological
test, e.g. Enzyme linked immunosorbent assay (ELISA) and virus neutralization test can be
applied for the detection of virus (Abdelrhman et al., 2013; Phan et al., 2013). Now-a-days,
molecular techniques including Reverse transcriptase-polymerase chain reaction (RT-PCR),
Real-time PCR (qPCR) and multiplex RT-PCR have also been used for the detection and
characterization of Newcastle disease virus (Chen et al., 2008; Cattoli et al., 2009; Al-Habeeb
et al., 2013). There are a number of suitable in vivo techniques used for the assessments of
pathogenesis; for example MDT in SPF embryonated chicken eggs (mean death time), ICPI in
one-day-old chickens (intracerebral pathogenicity index) and IVPI in six-week-old chickens
(the intravenous pathogenicity index). MDT and IVPI are useful indicators of virulence as
compared to ICPI (Cattoli et al., 2009).
Control of Newcastle Disease
It is inspiring to determine any aspect of the disease without assuming how to prevent or control
it. Two approaches, i.e. biosecurity and vaccination have been used for the successful control
of ND epidemics (Alexander, 2003). Newcastle disease control programs should be started, at
least thirty days earlier to its onset period reported from those countries where its epidemics
are more common. Immunization program contained many features includes immunization of
23
the healthy chickens only, priming farmers to revaccinate their birds, standard vaccine quality
and adaptation of quarantine measures for new birds. Thermostable Newcastle disease
vaccines have been found the only choice of controlling the Newcastle disease virus in under
developing countries like Pakistan and Uganda etc. (Alexander, 2003; Kapczynski and King,
2005; Wambura et al., 2009; Nega, et al., 2012).
Vaccination
The outbreaks of Newcastle disease have been controlled by the use of different
vaccines since last five decades (OIE, 2012). Immunizations are the best tool for ingrained of
viral diseases like ND (Msoffe et al., 2010). A number of experiments have been accompanied
on thermostable ND virus vaccines in the poultry birds round the globe (Bwala et al., 2011).
Vaccines protect the birds by provoking the immune response without causing any disease in
the birds. The vaccine virus produces different types of antibodies in the host which neutralize
the immunogen (Zoth et al., 2008). Immunization strategy principally depends upon different
elements which are levels of maternal antibodies, efficacy and quality of vaccine, methods of
immunization and health status of the birds (Allan and Gough, 1974).
Classification of Newcastle diseases vaccines
In the easiest method for preparation of a killed or inactivated vaccines first of all virus
is taken, then killed and finally inoculated in the birds. SPF embryonated chicken eggs were
used for the production of inactivated or killed NDV vaccines. The deactivating agents are
added e.g. formalin and beta propiolactone after growing of virus. Oil or montanide adjuvant
added to increase its immunogenic property. These vaccines produce very high antibody titers
and protect the birds against virulent ND virus. It is normally administrated 0.3 to 0.5 ml per
bird S/C (Bell et al., 1990). These vaccines provide a long lasting immunity against ND virus
but with some limitations e.g. expensive, slight risk to injury, time consuming, sensitive to heat
and require expertise and stress and brings a minor hazard to the handler of accidental self-
injection (Bosseray and Plommet, 1983; Van, 1987; Bell et al., 1990).
Another type of vaccine is a live vaccines in which, low pathogenic or asymptomatic
enteric virus strains are carefully chosen, passages or adapted and administering to the birds.
Different types of Newcastle disease vaccines are available in commercial market such as
LaSota, Hitchner B1, Mukhtaswar and recombinant vaccines ((Folitse, 1998; Gilad and
Nathan, 1999). These vaccines usually produce sufficient immunity against ND outbreaks. In
24
2002, Food and Agriculture Organization recommended different NDV strains used as a live
vaccines including F, BI, LaSota, V4, I-2, Mukhtasvar, V4-HR and Komarov. The live
vaccines have many advantages as compared to killed vaccines includes no need to vaccinate
in each bird, simple way of administration, provision of natural immunity and less expensive.
Re-occurrence of the disease is the main disadvantages of live vaccines (Westbury et al., 1984;
Spradbrow and Samuel, 2004).
Lentogenic vaccines
The low pathogenic strains of Newcastle disease virus such as LaSota and Hitchner B1
have been used for the vaccine production (Abbas et al., 2006; Ikegami et al., 2009; Bouloy et
al., 2009). The main objective is to select a virus that contains less vaccinal reaction but retain
higher immunogenic properties. NDV LaSota strain has some limitations over NDV HB1
strain, i.e. moderate vaccinal reaction, not suitable for multiage population and enhanced risk
of bacterial infections. The HB1 NDV strain has mild reactions, endorsed for the primary
vaccination and effective for all age groups (Bell et al., 1990; Bell, 2001; Saif et al., 2003).
Some other drawbacks of NDV LaSota vaccine have been observed such like production of
low to moderate vaccine reactions in multi-age chickens, increased chances of concurrent
infection, cold storage system requirement from production unit till inoculation and expensive
in the village situation. Lentogenic vaccines efficacy could be enhanced by using some cloning
techniques and Clone 30 is an example of this type of vaccine. The EID50 (embryo infective
dose fifty) of LaSota NDV vaccine dose are 106/bird (Hofacre, 1986).
Mesogenic vaccines
Low to moderate virulent NDV strains (Komarov (Saifuddin et al., 1990) and R2B
Mukhtaswar strain (Alaxander, 2001) are lesser used for vaccination in chicken because they
have the ability of reversion. Mainly, these are given to the birds as a booster dose after LaSota
NDV vaccine (Reddy and Srinivasan, 1991; Alders, 2004).
Recombinant vaccines
The biotechnology tools provides a novel method for the production of recombinant
viral vaccines. Different vectors, for example adenovirus, herpes virus and pox virus have been
used for this purpose (Morgan et al., 1993; Dodds, 1999; Jackwood, 1999; Yokoyama et al.,
1997). Haemagglutinin-neuraminidase and fusion protein genes can be added into these
25
expression vectors for the production of these vaccines. These vaccines have the ability to
produce protective antibody titers in the birds (Morgan et al., 1993; Palya et al., 2012).
Thermostable Vaccines against Newcastle Disease
The central theme of this literatures is to elaborate the significance of thermostable
Newcastle disease vaccines against NDV which is a big hurdle particularly for the
improvement of village as well as commercial poultry sector (Burleson et al., 1992). The main
principle of immunization is to provoke an immune response i.e. humoral and cellular against
the challenge viral infection in such a fashion that it does not cause the disease. The history for
the development of NDV thermostable vaccines have been started from Australia since 1984.
Two thermostable NDV strains, i.e. V4 and I-2 have been isolated in the Australian
Centre for International Agriculture Research and later on these thermostable strains used for
vaccine production (Simmons, 1976; Spradbrow et al., 1992a). Both of strains are avirulently
produced superior biological safety vaccines (Anon, 1991; Spradbrow, 1992a), and they
maintained their activity in lyophilized form at 28°C for one year and at 4-8°C for 10-12 week
(Nssien and Adene, 2002; Wambura, 2003), and have an ease of administration (intranasal,
intraocular, injection, food based and drinking water administration methods). The protection
level of these thermostable NDV vaccines have successfully been examined in different Asian
and African countries (Spradbrow, 1992; Spradbrow, 1995; Alders and Spradbrow, 2001).
These vaccines have shown satisfactory results in many countries round the globe,
including Cameroon, Tanzania (Foster et al., 1999; Bell et al., 1995), Zambia (Aldres et al.,
1994), Ghana (Amakye et al., 2000), Veitnam (Alders, 2004) and different other Asian
countries (Alders and Spradbrow, 2001a). Food and Agriculture Organization certified these
thermostable NDV vaccines for the village as well as commercial poultry birds in the
developing countries (FAO, 1997). There are a number of advantages for using thermostable
vaccines as compared to thermolabile NDV vaccines, like decreased vaccine wastage during
transportation, increase effectiveness of vaccine efficacy, no need of cold chain storage system,
minimum cost for equipment repairing, ease of application and storage (Alders and Spradbrow,
2001). These vaccines have the ability to provide upto 80-100% protection of birds against
Newcastle disease (Illango et al., 2008).
26
Different biotechnology or molecular techniques like polymerase chain reaction, RT-
PCR, nested PCR, etc. have been used to detect correct genomic sequence of thermostable
NDV strains. The amino acids arrangements of I-2 and V4 thermostable NDV strains are
112RKQGR↓LIG119 and 112GKQGR↓LIG119, respectively. Arginine and glycine amino
acids position play a significant role in the pathogenesis of thermostable NDV avirulent strains.
The arginine amino acid present at 112 positions, glycine and leucine at 115 position may be
responsible for the avirulent genetic structure of I-2 strain whereas V4 NDV strains comprised
amino acid glycine at 112 position. Haemagglutinin-neuraminidase protein of I-2 NDV strain
contains five hundred and seventy eight amino acids (Gould et al., 2003). The carboxyl
terminal position of HN protein of V4 NDV strain comprises forty five amino acid length while
I-2 NDV strain contains seven amino acids (Aldous et al., 2003). Avirulent I-2 NDV strain
categorized into avirulent avian paramyxovirus on the basis of fusion protein gene sequence
(OIE, 2000; Wambura et al., 2007). Thermostability of Newcastle disease virus I-2 strain,
particularly depends upon Polymerase, Haemagglutinin-neuraminidase and nucleoprotein
proteins (Horikami et al., 1992; Yusoff et al., 1996; Kattenbelt et al., 2006).
Trachea is used for the study of thermostable NDV tropism because there is no systemic
responses interference of infection are present. Ciliary movement in trachea helped in the
spread of virus into other body parts. Thermostable NDV I-2 strain produces less damage as
compared to V4 NDV strain, when grown in epithelium cells of the trachea. Therefore, it has
been claimed that I-2 NDV strain has a more tropism in epithelial cells of the digestive tract as
compared to V4 strain. V4 NDV strains replicate or grow in the epithelial cells of the
respiratory tract (Rehmani and Spradbrow, 1995). In previous studies, many investigators have
illustrated that neither I-2 NDV nor V4 NDV strain were existing in conjunctivae and brain
tissue (Gohman and Colleagues, 2000; Wambura, et al., 2006). Organ tropism of thermostable
NDV strains depend upon the arrangement of amino acid sequence of HN protein, fusion
protein cleavage site and C-terminal amino acid extensions. Thermostable I-2 NDV strain HN
protein gene contains seven amino acid extension at the C-terminal position while V4 NDV
strain has forty five amino acid extension of same regions (Wambura, 2003). Earlier
information proved that NDV I-2 strain has the ability to produce good superior quality live
vaccine as accompanying to V4 NDV strain (Wambura, 2006).
27
Thermostable Newcastle disease vaccines can be produced using two techniques,
includes Specific Pathogen Free (SPF) embryonated chicken eggs and cell culture system.
Most commercially available NDV vaccines are prepared from SPF embryonated chicken
eggs. The egg based vaccines have certain advantages over cell culture systems such as
minimum chance of contamination, easy manufacturing steps and no trypsin requirement
(Alders and Spradbrow 2001a). SPF eggs have some drawbacks like their expensiveness in
terms of high production cost and time consuming. Cell culture systems are more comfortable
and less costly technique as compared to SPF chicken eggs (Illango et al., 2008). A virus is an
intracellular parasite which could not grow without a host cell. In cell culture systems, avian
origin and mammalian origin cell lines have been used for the production of vaccines against
NDV. Cell lines commonly used are chicken, Vero cells, rabbit, MKC, pig, CEF, BHK-21,
calf and BGM-70 (Ahmed et al., 2004; Mohan et al., 2007). These are easy to handle in the
laboratory. There is no need of trypsin for the growth of virulent Newcastle disease virus in
cell lines. Newcastle disease virus pathogenesis correlates the plaque formation.
Vero cells and CEF (Chick embryo fibroblast) are used for harvesting the ND virus
(Ahamed et al., 2004). The literature has shown that Mukhtaswar strain produces CPE
(Cytopathic effect) on CEK (Mohammed et al., 2012) and an African green monkey kidney
cells (Vero cell) (Wambura, 2007). V4 NDV strain produces a less cytopathic effect when
growing in Vero cells as compared to I-2 NDV strain (Madhan et al., 2005). It has been
reported that trypsin is compulsory for the growth of avirulent or lantogenic strains of NDV in
Vero cell lines (Ragavan et al., 1998) however Wambura et al., (2006) have ascertained that
thermostable avirulent NDV I-2 strain has the capacity to produce a cytopathic effect in CEK
cells without adding trypsin in the growth medium. Stabilizers e.g. skimmed milk and gelatin
have the ability to increase and maintain the shelf life of vaccines (Young et al., 2002).
There are many ways for administering of thermostable Newcastle disease
vaccines such as eye drop, nasal spraying, drinking water, Injection and through feeding
(Komba et al., 2012). Eye drop method is the best technique for administering the vaccines
into birds (Musa et al., 2010) because it produced more protective antibodies and protects the
birds against challenge viral infections (Mgomezulu et al., 2009). For mass scale vaccination
program, administrating vaccines through fresh drinking water method is a suitable choice but
this technique produces lesser protection (Rehmani, 2004).
28
Thermostable NDV vaccines have been effectively given through mixing feeds, e.g.
parboiled sorghum, maize and lactose pellet (Echonwu et al., 2008b; Wambura et al., 2011).
Rice e.g. cooked white rice has been used as a stabilizer of thermostable NDV vaccines (Tu et
al., 1998; Spradbrow, 1993/94) because it is stable, minimum antiviral activity, cheap and
striking to chickens. Oil particularly, vegetable oil has been used for coating of rice, which
may increase vaccine efficacy and stability (Wambura, 2009).
Olabode et al. (2010) have executed a test to govern the efficiency of thermostable V4
NDV vaccine by administration through maize grains. Their research experiment is evidence
that optimum antibody titers can be obtained through the soaked maize as compared to un-
soaked. Comparable outcomes also detected several other researcher (Agbo, 1999; Echeonwu
et al., 2008). The thermostable I-2 NDV vaccine should be avirulent, high potency, easy
administrative. These factors have significant effect to the success of vaccination program
(Spradbrow, 1995).
Efficacy is the ability of any vaccine to protect or overcome the birds against challenge
viral infection and disease causing agent (Allan et al., 1974a). Successful field trials of
thermostable NDV vaccines have been reported in many countries of the world such as Nigeria
(Musa et al., 2010), Tanzania, Uganda (Illango et al., 2005) Malaysia (Fostera et al., 199;
Nwanta et al., 2008) Australia (Wambura et al., 2000). The protective antibody titers of NDV
vaccine suggested, i.e. HI > Log24.
Immunoglobulin A secretions in the plasma cells are increased during drinking water
administrations of thermostable ND vaccine which ultimately act as antibody on the epithelial
surfaces of mucosa in the different body organs such as the bronchi, trachea, oviduct and
intestine (Jayawardane and Spradbrow, 1995a, b; Iroegbu and Nchinda, 1999). This stimulate
the cellular immune response which ultimately plays a significant role for protection of the
vaccinated birds (Komba et al., 2012). Cytokines and interleukins particularly cytotoxic T
lymphocyte, Tumor necrosis factor alpha and interferon γ play an important part in cellular
immune response. The protection level of thermostable NDV vaccines can be assessed over
challenge infections (Al-Garib et al., 2003; Bwala et al., 2011).
Thermostable NDV vaccine provided eighty percent protection against challenge
infection during field conditions (Alder, 2005). Ambient temperatures and administration
methods predominantly effects the efficacy of thermostable NDV vaccines (Musa et al., 2010).
29
Eye drop method provided 80-90% protection (Alders, 2005) as compared to mixing with feed
(30%) and administration by drinking water method (60-70%) (Wambura et al., 2001; Musa
et al., 2010). It has been reported that eye drop immunization of thermostable avirulent I-2 and
V4 NDV strain can withstand haemagglutinin antibody titers after nine months in the domestic
birds (Samuel and Spradbrow, 1991).
30
Chapter # 3
MATERIALS AND METHODS
1. Procurement of thermostable strain of NDV
A well characterized an avirulent thermostable NDV I-2 strain was procured from
Centers of Advanced Studies in Vaccinology and Biotechnology, University of Baluchistan,
Pakistan.
2. Vero Cell Line
African green monkey kidney cells (Vero cell line) was procured from Institute of
Microbiology, University of Agriculture, Faisalabad as it was imported from Center for
Applied Microbiology and Research having catalogue # ATCC CCL81.
3. Apparatus, Media and Preparation
3.1. Glassware
Test tubes
Glass Pipettes
Petri-dishes
Cylinders
Petri-dishes
Beakers
Slides
Glass bottles (10ml, 25ml, 50ml, 500ml and 1000ml)
Cylinders
Roux flasks
Cover slips
Filtration assembly
Cryo vials
Tissue culture flask
3.2. List of Plastic-ware
96 wells flat bottom culture plates
24 wells flat bottom culture plates
6 wells flat bottom culture plates
31
Micro tips
Petri dishes
To remove grease and oil, all the new glassware was dipped in Dichromate
solution for 24 hours.
3.3. Dichromate solution (stock solution)
Potassium dichromate 65 grams
Concentrated Sulphuric acid (H2So4) 900 ml
Distilled water 100 ml
Sixty five grams of orange red color potassium dichromate was weighed and mixed in
100 ml distilled water. Heat was applied for 10 minutes with continuous stirring. The
dichromate salt was swell up, was not dissolved in the water and sediment at the base. 900 ml
conc. H2So4 was taken in a sterilized beaker (Pyrex) of 2 liters capacity and the dichromate
slurry was added in the conc. H2So4 along the wall of a beaker and mixed gently to dissolve
the dichromate slurry. Then distilled water (9 liters) was taken in a plastic tub (20 litter
capacities) and stock solution of acidic dichromate was poured in the distilled water along the
wall of the tub.
The glassware was dipped in working the Decon’s solution for 24 hours. The Decon’s
solution is poured off from each of the glass ware. The glass ware was then washed in tape
water and rinsed 10 times with distilled water.
3.4. Sterilization of glassware
All the glassware used in the cell culture laboratory was washed thoroughly and finally
rinsed with De-ionized double distilled water. After proper washing glassware was wrapped in
aluminum foil and sterilized in dry heat (hot air oven) at 171oC for 30-45 minute. All the corks
and caps of test tubes were moist heat (autoclaved) at 121oC for 30 minutes.
3.5. Chemicals, Culture Media and Reagents
All the chemicals, reagents and culture media used for cell culture are of high purity
and cell culture grade. All the culture media have balanced salt solution, a protein or serum
supplement and a combination of antibiotics and antifungal to control the accidental microbial
and fungal contamination. Methods of different reagents, chemicals and culture media
prepared are given below.
32
3.5.1 Trypsin-EDTA Solution
Na2 HPO4 1.15 gram
NaCl 8.0 gram
Trypsin 2.5 gram
KCl 0.2 gram
KHPO4 0.2 gram
Penicillin 100,000 IU
Streptomycin 0.1 mg
DDW 1000 ml
Above stated chemical constituents were weighing and mixed in the DDW (double
distilled water) in the order given and stirred on magnetic stirrer until trypsin completely
dissolved. Filtration assembly was used to sterilize the above solution.
3.5.2. Dulbecco’s Phosphate Buffered Saline
Distilled water 800 ml
NaCl 8.0 gram
KCl 0.2 gram
KH2PO4 0.2 gram
Na2 HPO4 2H2O 0.14 gram
MgCl2 6H2O 1.0 gram
All the ingredients weighed and added in to the distilled water. After mixing all the
ingredients in the water, solution was autoclaved at 121oC at 10 lbs for 10 minutes.
3.5.3. Growth Medium (M199, DMEM, EMEM)
MEM199 900 ml
Fetal bovine serum (FBS) 100 ml
Growth media MEM 199 was used for the growing of cells in confluent monolayer.
Fetal bovine serum (10%) was used.
3.5.4. Maintenance Medium
MEM199 950 ml
Fetal bovine serum (FBS) 50 ml
In maintenance medium, 5% fetal bovine serum was used.
33
3.5.5. Storage Medium
MEM199 100 ml
FBS 20 ml
Dimethyl Sulfoxide (DMSO) 10 ml
Twenty ml of the fetal bovine serum (FBS) and 10ml DMSO was added in 100ml of
MEM199 medium.
3.5.6. Antibiotic and Antifungal Solution
Cell culture grade antibiotic (penicillin and streptomycin) were opened in biosafety
cabinet and mixed in sterile distilled water in 104 IU and 10 mg respectively/ml. the antifungal
e.g. amphotericin B was used as 0.2 mg/ml. The mixture of the antibiotic and antifungal had
been frozen in aliquots at -20oC. This stock solution added at the concentration of 1ml per 100
ml of media, which gave 100 IU of penicillin, 100 µg of streptomycin and 2 µg of amphotericin
B.
3.5.7. Trypan Blue Solution
Trypan blue 1 gram
Phosphate buffer saline 200 ml
One gram trypan blue was dissolved in 200 ml Phosphate buffer saline. This solution
was filtered when used.
3.5.8. Phenol Red (0.1%)
Phenol red 1 gram
N/10 NaOH 28 ml
Double distilled water (DDW) 971 ml
One gram of phenol red was triturated in 28 ml of N/10 sodium hydroxide and then
DDW was added in above mentioned quantity. The solution was autoclaved at 121oC at 15 lb
pressure and stored at 4oC for further used.
3.5.9. Serum
Fetal calf serum and fetal bovine serum both were used in the cell culture system
successfully. Serum must be sterilized. Commercially prepared sera were used in this study.
4. Examination of viable Vero cells
Cells were counted in a standard Neubauer counting chamber. Viability was
determined by adding trypan blue (0.5 percent solution) to cell suspension. Trypan blue was
34
selectively absorbed by the non-viable cells, which was stained blue color while the viable
cells remained colorless or unstained.
4.1.Procedure
The ancillary ridges of counting chamber were moistened and the cover slip was
applied by pressing firmly until and unless the newton ring appeared.
Proper mixing of cell suspension by pipetting them up and down
Transferred a single drop of above solution into Heamocytometer chamber
This fluid was entered into the chamber through capillary action
16 mm objective focus on large square (contains 16 smaller squares) was used for
counting of cells
Counted all the cells in the square omitted those on the lower and right hand line
but included those on the upper and left hand lines.
Four corner squares were counted; mean was calculated and multiplied by 10000.
This gave the number of cells per ml.
4.2. Resuscitation of Vero cells
Vero cell line was resuscitated in 25 cm2 tissue culture flask (Orange, UK)
4.2.1. Procedure
Cryovial which contained Vero cells was taken out from the liquid nitrogen
cylinder and immediately transferred to water bath at 37oC temperature
Cells were thawed quickly until and unless whole the vial was thawed
The ampoule was agitated regularly and immediately shifted in 25 cm2 tissue
culture flask contains growth medium
Flasks were incubated at 37oC in CO2 incubator
The Vero cells achieved their normal growth rate in 4th passage.
4.2.2. Preparation and Sub-culturing of Monolayer
After resuscitation of Vero cells, the tissue culture flasks were observed under inverted
microscope (Olympus CK40 Japan) daily. 95-100% confluent monolayer was achieved within
3-4 days. Growth medium (10% FBS) was used for preparation and sub-culturing of Vero
cells.
Monolayer cell culture flask was taken from CO2 incubator and examined under
inverted microscope
35
Cell culture flask which had 95% monolayer was selected for sub-culturing
All the chemical reagents and media were pre warmed in water bath at 37oC
Cell culture flask was opened in biosafety cabinet II (ESCO) and the exhaust
media was discarded in hazard basket
DPBS (without Ca++ and Mg++) was used for washing purpose. This was helped
to remove the contents of serum in the media because serum cause adverse effect
on the action of trypsin
Trypsin-EDTA solution (2-3 ml) was added in 25cm2 cell culture flask and placed
in an incubator at 37oC for 3-5 minutes
Single cell suspension was made after trypsinization of Vero cells
Cells were equally distributed in to 3 or 4 daughter cell culture flasks depending
upon the concentration of cells in mother cell culture flask
4.3. Cryopreservation of Vero cell line
It is very important to preserve the cell line because the risk of contamination may
happen at any stage throughout working with cell line. The cells were preserved or stored in
the storage medium and revived time to time when needed
4.3.1. Procedure
All the reagent and medium put in water bath at 37oC for pre warming
Prepared storage medium containing 20% serum and 10% DMSO
Confluent monolayer flask was taken out from incubator and examined under
inverted microscope
Add 3-5 ml Trypsin-EDTA solution into the flask
Made single cell suspension by numerous pipetting
Centrifugation was carried out at the rate of 500xg for 5 minutes and supernatant
was discarded
Re-suspend the cell pellet in storage medium
Add 1-2 ml cell suspension solution into cryo-vials and sealed tightly
Transferred these vials in -80oC refrigerator for 24 hours
After 24 hours these vial was put in liquid nitrogen cylinder at -196oC for further
use.
36
5. Adaptation of I-2 NDV on Vero Cell line
The following steps were undertaken to adapt I-2 NDV on Vero cell line.
5.1. Infection of Vero cells
I-2 NDV virus was used to infect healthy confluent monolayer of Vero cells
Prepared maintenance medium (5% FBS and 0.5% trypsin)
Discarded the growth medium of the cell culture flask
The monolayer was washed with pre warmed DPBS
Each 25 cm2 flask was infected with 0.25 ml I-2 NDV
Put flask into incubator at 37oC for 30 minutes for adsorption purpose
5-7 ml of pre warmed sterilized maintenance medium was added
Infected flask was incubated at 37oC, because at this temperature infectivity
and reproducibility of NDV to any host is optimal
Cell monolayer of infected flasks was examined twice per day under inverted
microscope for cytopathic effect (CPE)
5.2. Harvesting of virus
After five to six day of incubation, the cell culture flask was subjected to harvesting.
This virus was further used for next infection of cell monolayer. The culture fluid was
harvested by freeze-thaw cycles
The infected flasks were kept in -20oC for overnight
Then the flasks were thawed at room temperature and again put in -20oC for
overnight (cycle repeated three times)
Virus suspension was put in centrifuge tubes and centrifuged at 1000xg for 10
minutes
The clear supernatant was collected and marked as passage 1 (P1) and stored
at -85oC for further use
5.3. Adaptation of virus
Harvested P1 virus was infected again to Vero cells using same media and techniques.
Virus harvested through this second passage was designated as P2 virus. Similarly, subsequent
passages were done and CPE were observed carefully during all passages.
37
5.3.1. Confirmation of adapted virus
Consistent cytopathogenic effects (CPE) were strong indication for the adaptation of I-
2 NDV virus on Vero cells. Morphological changes in the infected cells were examined
regularly and data was recorded at each passage. The time of appearance of CPEs and also
intensity was noted in each passage. For more confirmation the supernatant after every passage
was subjected to Haemagglutination test.
5.3.2. Identification of I-2 NDV virus
The I-2 NDV virus was identified on Vero cells through its cytopathic effect. For the
confirmation of adapted I-2 NDV virus culture supernatant from each passage was subjected
to Micro titration plate Haemagglutination test.
5.3.3. Micro titration plate Haemagglutination test
a. Equipment and Materials Required
Biological Safety Cabinet II
Centrifuge machine
5-10 ml conical tubes
Disposable pipettes 1 ml, 5 ml, 10 ml
Micropipette and sterile disposable aerosol resistant tips
Phosphate Buffer Saline
1% Chicken red blood cells
Round-bottomed 96-well dish
b. Chicken RBC preparation
4 ml of chicken blood is pipetted into a 10 ml conical and topped off with PBS
Centrifugation was carried out at 800 rpm for 10 minutes
Aspirate the supernatant without disturbing the blood cells
Add 12 ml PBS and mix by inverting – do not vortex
Spin at 800 rpm for 5 minutes and repeat wash two more times
Aspirate supernatant after final wash and add enough PBS to make a 1%
solution of red blood cells. This solution is useable for one week
Procedure
A round-bottomed 96-well dish is preferred for this assay
Add 50 ul of PBS in each well of first row
38
In the first column, add 50 ul of virus sample and transfer 50 ul to the next well
on its right for made two fold serial dilution upto 11 well
Add 50 ul of 0.5% red blood cell working solution to each well.
Leave at room temperature for 30-60 minutes to develop
The virus’s HA titer was calculated
5.3.4. Titration of adapted I-2 NDV virus
Titration of adapted I-2 NDV virus was calculated by Tissue culture infective dose 50
(TCID50) and plaque assay respectively.
5.3.5. Tissue culture infective dose 50 (TCID50)
TCID50 was calculated of adapted I-2 NDV virus according to Reed and Munch, 1938
method. Briefly the procedure was described below
A 10 fold serial dilution was made in phosphate buffer saline (PBS) from 10 -1
to 10-10
Vero cells were grown in 96 well micro titration plate in confluence monolayer
A 100 µl of each virus dilution was added in each well of first row of micro
titration plate with help of micro dispenser
Leaved the last two wells un inoculated as negative control and plate was
incubated at 37oC in 5% CO2 for 4-5 days
The plates were observed thrice daily for CPE and after appearance of CPE,
wells were stained with neutral red
Monolayers were fixed with methanol for 10 min and stained with 0.13%
gentian violet solution for 10 min
Plates were examined under inverted microscope
The median tissue culture infectious doses (TCID50) were calculated as
described by Reed and Munch method
Formula: (% of wells infected at dilution above 50% 50%)
(% of wells infected at dilution above 50%) (% of wells infected at
dilution below 50%)
39
5.3.6. Plaque assay
For the calculation of plaque forming unit (PFU/ml), this assay was used. Briefly the
procedure was described below
A 1: 100 dilution was made by adding 10 µl viral stock to 990 µl medium
Ten-fold serial dilutions were made by transferring 100 µl of diluted virus to
900 µl medium
Vero cells were infected with each dilution of virus in 6 well plate
Incubated the cells for 45-60 minutes at 37oC for proper adsorption of virus
Agarose overlay medium was prepared by melting 5 ml 5% agarose and cooled
to 44oC
45 ml of growth medium was warmed and mixed with 5 ml Agarose (5%)
After incubation, the virus containing media with 0.25 trypsin was removed and
3 ml agarose solution was added in each well
The plates were placed in incubator at 37oC after the agarose was set
Plaques were visible after 7 days
The plaques were stained with 0.03% neutral red by adding neutral red for 2
hours
The number of plaques forming units were calculated from the dilution which
gave 30-50 plaques by following formula
No. of plaques/(d×v)= pfu/ml
6. Molecular detection through RT-PCR
After titration of cell culture adapted virus, samples were subjected to RT-PCR for their
molecular detection. We used GF-1, 2 step RT-PCR kit (Vivantis Technologies, Malaysia).
Following protocol was performed.
6.1. RNA extraction
Procedure
o Sample A: Add 15 ul of carrier RNA in 200 ul of VL buffer
o Sample B: Add 50 ul of carrier Proteinase K in 200 ul of sample i.e supernatant cell
culture fluid
o Mix sample A and sample B by vortexing
40
o Incubation was carried out at 65oC for 10 minutes
o Add absolute ethanol 280 ul, and mixed immediately
o Transfer sample into a column assembled in a collection tube
o Centrifuge at 5000xg for one minute
o Discard the follow-through
o Wash the column with 500 ul of wash buffer 1 and centrifuge at 5000xg for one
minute
o Discard the follow-through
o Wash the column with 500 ul of wash buffer 2 and centrifuge at 5000xg for one
minute
o Discard the follow-through
o Wash the column with 500 ul of wash buffer 2 and centrifuge at 5000xg for 3 minute
o Discard the follow-through
o Place the column in sterilized Eppendorf tube
o Add 30-50 ul of elusion buffer in center of column and stand for 2 minutes
o Centrifuge at 5000xg for one minute to elute RNA
6.2. Synthesis of cDNA (using Fermentas Revert aid strand cDNA Kit)
Procedure
o Take and mix component of kit and place on ice
o Add the following reagent in a sterilize nuclease free tube on ice as follows
Template RNA 5 ul
Primer (Random Hexamer) 1 ul
Nuclease free water 6 ul
o Mix gently and short spin
o Incubate at 65oC for 1 minute
o Add following reagents as
5x Reaction buffer 4 ul
Riboblock (Rnase inhibitor) 1 ul
10 mM dNTP mix 2 ul
Revert aid (RT) 1 ul
o Mix gently and centrifuge
41
o Incubate at
25oC for 5 minute
Then 42oC for 60 minute
Terminate reaction by 70oC
o Store at -80oC for further used
6.3. Primer designs
For amplification of Avian Paramyxovirus serotype 1, two primer sequences were
generated using Genefisher primer design software (Giegerich et al., 1996). These primers
amplified fusion protein cleavage site and produced a 204 base pair (bp) DNA fragment.
The primer sequence and location were as follows:
NDV F (sense), 4829 5-GGTGAGTCTATCCGGARGATACAAG-3’4893
NDV R (antisense), 5031 5-TCATTGGTTGCRGCAATGCTCT-3’5008
(Julie et al., 2002)
6.4. PCR reaction
o Set up PCR reaction using cDNA as a template
o Add following reagent for PCR reaction
cDNA 1ul
Forward primer 1 ul
Reverse primer 1 ul
10x Taq polymerase buffer 5 ul
MgCl2 5 ul
4x dNTP mix 1 ul
Taq plus DNA polymerase 0.2 ul
ddH2O 35 ul
o Following cycle conditions were set in thermal cycler (Programmable Thermal
Cycler, ICCC, PTC-06)
Initial denaturation 94oC for 3 minutes
Denaturation 94oC for 1 minute
Annealing 55oC for 1 minute
Polymerization 72oC for 1 minute
42
Repeat 30 times
Final polymerization 70oC for 10 minutes
Kept at 4oC
o Use 3-5 ul of sample from each reaction tube to analyze the specific PCR product
by 1.5% agarose gel electrophoresis and by staining the gel with ethedium bromide
to visualize the DNA.
6.5. Preparation of Agarose gel electrophoresis
o We used 10X TBE buffer, composition as follow
Tris base 10 gm
Boric acid 55 gm
EDTA 8.3 gm
Distill water 1000 ml
o Ethedium bromide preparation (10 mg/ml)
Add 1 gm of ethedium bromide to 100 ml distill water
Stirring was done on a magnetic stirrer for several hours to ensure
that the dye has dissolved.
The container is wrapped in aluminum foil and stored at 4oC.
Procedure
o Weigh 1.5 gm of agarose powder to prepare 1.5% concentration
o Add electrophoresis buffer (0.5 x TBE) to make volume of 100 ml
o When solution is cooled add ethedium bromide and gel is poured on sealed tray
o It is left undisturbed until it gets solidified
o Tray was placed in the electrophoresis tank after removing comb
o The gel is covered to a depth of about 1 mm by adding enough electrophoresis
buffer (0.5 x TBE)
o DNA sample was mixed with 6X loading buffer and loaded into the slots of
submerged gel
o DNA ladder also add in small slot
o The gel is run at 100-120 volt
o Gel image was recorded by gel documentation system
43
6.6. Phylogenetic analysis
After purification of sample, it was sending Marcogen DNA sequencing company
(Korea) through DSL courier service. DNA Star, Laser gene (Laser gene, V.8.0.2 DNA Star,
Madison WI) software was used for making consensus sequence of the nucleotide. This
sequence was submitted to Genbank and MEGA-5 software was used for phylogenetic
analysis.
7. Preparation of Vaccine
i. Preparation of Live cell culture adapted lyophilized I-2 NDV vaccine
(Thermo-Vac)
The Vero cell adapted NDV I-2 virus was serially passaged until adaptation was
achieved. Adapted virus gave clear and consistent CPE. The passage number which gave
consistent CPE was selected as a vaccine candidate i.e. 13th passage. This passage was
centrifuged @ 5000 rpm for five minutes. The supernatant was further passed through filter
having 0.2 um pore size. The tested live Vero cell adapted Thermostable Newcastle disease
vaccine was mixed with stabilizer i.e., 10% skim milk. Lyophilization was done in the
laboratory by using ALPHA 1-4 LSC CHRIST Freeze Dryers according to manufacture
method. This lyophilized vaccine (Thermo-Vac) was used as oral vaccine in drinking water
method against challenge in broiler birds.
ii. Sterility testing
Vaccine sterility was confirmed by culturing it on bacterial and fungal media for the
presence of any contamination. For this purpose, 3 ml of vaccine fluid was centrifuged at 500xg
for 10 minutes and the residue was streaked on to Nutrient agar, MacConkey’s agar, Blood
agar, and Sabouraud’s dextrose agar plates. Loop full sediment was also inoculated in Frey’s
modified medium for Mycoplasma. These plates were incubated at 37oC for 48 hours except
Sabouraud’s agar and Frey’s medium. The Sabroud’s agar plates were incubated at 25oC in a
humid chamber and Frey’s medium plates were incubated for 7-10 days. All the plates were
observed for microbial contamination.
44
iii. Safety testing
After the vaccine has been proven to be sterile, each batch of vaccine was inoculated
into 20 chickens at 4-5 day-old through drinking water. The inoculated chickens was monitored
for any pyrogenic effect, vaccine shock and/or vaccinal reaction.
iv. Vaccine stability
Thermostable ND vaccines will be stored at ambient temperature and after each
passage of virus, heat stability was tested by incubating at 56oC for 10, 20, 30 and 40 minutes.
7.1. Evaluation of Vaccines
a. Experimental testing
Thermostable vaccine was inoculated to a group of day-old one hundred and eighty
broiler chicken reared at experimental animal house Institute of Microbiology, University of
Agriculture, Faisalabad.
i. Experimental Design
One hundred and eighty day old broiler chicks were purchased from commercial
hatchery and reared in the animal house of Institute of Microbiology, University of Agriculture
Faisalabad, which were not immunized against NDV or any other agent and kept under
standard managemental conditions in an animal house. The experiment was carried out under
the regulations of the Institutional Animal Care and Use Committee of Animal Veterinary
Science UAF, Pakistan. They were fed standard chicken feed and given drinking water ad
libitum. No vaccination was carried out except the experimental vaccination. Prior to the
vaccine administration, water was withheld from the birds for approximately 8-10 hour
overnight. One hundred and eighty birds were divided into three groups (G1, G2 and G3) of
sixty birds each. Group 1 were vaccinated with lyophilized live cell culture adapted I-2 NDV
vaccine (Thermo-Vac) and. Group 2 were immunized with commercially available ND LaSota
vaccine as positive control. The group 3 (G3) kept as negative control in the whole
experimental design. All these group housed separately. All the birds were given a single
vaccine application. Serum samples were collected and HI test and ELISA performed when
the birds were 0, 7, 14, 21, 28 and 35 days of age.
45
ii. Challenge protection assay
A challenge protection assay was performed to evaluate all birds on trial. The remaining
birds were injected with 103 TCID50 of local velogenic NDV strain at 28 days of post
vaccination in each group. Clinical signs, mortality and symptoms were observed twice daily
upto 5 day of post inoculation. Morbidity, mortality and protection rates were calculated
(Wambura, 2011).
b. Field trials
The present study was conducted in six poultry farms surrounding the district of Faisalabad
in the province of Punjab, Pakistan. Selected farms were Randhawa poultry farm (F1), Aslam
poultry farm (F2), Sohail poultry farm (F3), Basharat poultry farm (F4) and Nasir poultry farm
(F5). Humoral immune response was checked by using Haemagglutination inhibition (HI) and
ELISA assay.
i. Experimental design
The day old broiler chicks (n=60/farm) were vaccinated (dose: 106 EID50/bird) through
drinking water at six farms surrounding the district of Faisalabad. Tags were used for the
identification of the vaccinated birds. Blood samples were collected from each bird. The serum
from each sample was separated and stored in properly labelled vials at -80oC for further
processing. Haemagglutination inhibition (HI) and Enzyme-linked immunosorbent assay
(ELISA) were performed to detect anti-NDV-HI and anti-NDV-ELISA antibodies,
respectively on 0, 7, 14, 21, 28 and 35 days post-vaccination (DPV) (Olabode et al. 2010).
7.2.1. Hemagglutination-Inhibition test (HAI)
Chickens infected with ND virus through vaccination will develop antibodies to the virus.
Antibodies can usually be detected and measured in the serum six to ten days after infection
with ND virus using a number of serological tests. The haemagglutination inhibition (HI) test
is the test most commonly used for detecting antibodies to ND virus. HAI test was done
according to the procedures of OIE (2004). The test was conducted at the cell culture lab,
Institute of Microbiology, University of Agriculture, Faisalabad.
46
i. Preparation of antigen for the haemagglutination inhibition test
The antigen used in the HI test is allantoic fluid containing ND virus. This may be prepared
from a batch of I-2 ND vaccine produced in the vaccine production unit or a vial of vaccine
prepared from an avirulent strain of ND virus, such as V4 (Maas et al.,1998). Avirulent strains
of ND virus give more reliable results in the HI test. If a trial requiring a large number of HI
tests is planned, prepare a large batch of antigen and use the same batch throughout the trial.
Store the antigen in 1 mL aliquots at –20°C.
ii. Equipment and materials required
PBS
ND virus antigen suspension
1% red blood cell suspension
96-well V-bottomed microtitre plates
Glass pipettes (1 and 10 mL)
Pipettors (200–1000 mL and 10–200 mL) and tips
Negative control serum
Positive control serum
Test sera
iii. Preparation of 4 HA units of ND virus antigen suspension
Using the quantitative HA test, titrate the ND virus antigen suspension and
calculate the HA titer
Divide the HA titer by four to calculate the dilution factor.
Calculate the volume of diluted antigen suspension required. Allow 2.5 mL
for each microtitre plate
Measure the volume of antigen suspension required and dilute in PBS, using
the dilution factor calculated above
iv. Procedure
Add 50 ul of PBS in all wells of first row of U-shaped bottom micro titer
plates
Add 50 ul of test sera and made two fold serial dilution upto 10 well
47
Add 50 ul 4 Hemagglutination units of (HAU) the viral antigen of V4 strain
upto 11 well, 11 well was antigen control well
The plate was left at room temperature for a minimum of 30 minutes
Finally add 50 ul of 1% (v/v) chicken RBCs upto 12 well, 12 well is RBCs
control well
Again, the plate was left at room temperature for a minimum of 30-45
minutes
Calculate the antibody titer
7.2.1. ELISA for Antibodies titer
IDEXX Newcastle disease kit was used for the detection of antibodies directed against
Newcastle disease in individual serum samples. Briefly described the principles i.e. micro
plates are coated with ND LPS. Samples to be tested are diluted and incubated in the wells.
Upon incubation of the test samples in the coated wells, NDV specific antibodies form immune
complexes with ND LPS. After washing away unbound material, antibody enzyme conjugate
is added which binds to any immune-complex ND LPS-antibody. Unbound conjugate is
washed away and enzyme substrate (TMB) is added, in presence of the enzyme, the substrate
is oxidized and develops a blue compound becoming yellow after blocking. Subsequent color
development is directly related to the amount of antibody to Newcastle disease virus present
in the test sample. The result is obtained by comparing the sample optical density with the
positive control mean optical density.
Materials required but not provided
Centrifuge (capacity 2000*g)
Precision micropipettes and multi dispensing micropipettes
Disposable pipette tips
Microplate shaker
Distilled water or deionized water
Microplate washer
Microplate cover (lid, aluminum foil or adhesive)
96 well microplate reader equipped with 450 nm filter
48
Test procedure
All reagents must be allowed to come to 18-26°C before use.
Reagents must be mixed by gentle swirling or vortexing. Use a separate pipette tip for
each sample
Controls must be dispensed anywhere on the microplate.
Obtain coated microplates and record the position of each sample on a worksheet.
Dispense 190 µL of dilution buffer N.2 into each well
Dispense 10 µL of undiluted negative control into one appropriate well
Dispense 10 µL of undiluted positive control into two appropriate wells
Dispense 10 µL of undiluted samples into remaining wells
Homogenize contents of the wells using a miroplate shaker
Cover the microplate (with a lid, aluminum foil or adhesive plate cover) and incubate
for:
Individual sample: 1 hour (± 5 min) at 18-26°C (short protocol) or 16-24 hours at 18-
26°C (overnight protocol)
Pool samples: 1 hour ((± 5 min) at 18-26°C (short protocol)
Wash each well with approximately 300 ul of wash solution three times. Aspirate the
liquid contents of all well after each wash. Following the final aspiration, firmly tap
residual wash fluid from each microplate onto absorbent material. Avoid microplate
drying between washes and prior to the addition of next reagent.
Dispense 100 µL of diluted conjugate into each well
Cover the microplate (with a lid, aluminum foil or adhesive cover plate) and incubate
for 30 mins (±3 min) at 18-26 °C
Repeat step 7
Dispense 100 µL of TMB-substrate N.13 into each well
Incubate 20 mins ((±3 min) at 18-26 °C at a dark place
Dispense 100 µL of stop solution N.3 into each well. Shake the microplate by gentle
tapping. Wipe carefully the underside of the microplate
Blank the microplate reader on air
Measure and record optical densities values of samples and controls at 450 nm
49
7.2.2. Splenic cell Migration inhibition assay
Cell mediated immune response was evaluated in all the groups by using splenic cell
migration inhibition assay with slide modification method of Pawan et al.,1991.
Materials required
Percoll 35%
31.5 mL of percoll TM (Health care)
+ 58.5 mL RPMI culture medium
PBS-SVF 2%
300 mL PBS 1x
+ 6 mL of SVF
ACK
1.66 g NH4Cl
+ 0.2 g KHCO3
+ 40 µL EDTA (500 mM)
+ 200 mL H2O
Final pH 7.41 or 8.0
Cytospin 3 (Shandon), program 8, Accel: high, speed 500
rpm/ 5 mins.
a. Sample preparation
Took a spleen sample in PBS1X and crush the tissue by keeping in cell strainer
(BD Falcon, 100 µm, yellow color) within a 6 wells plate containing 3 to 4 ml of
PBS-SVF 2%.
Crush the tissue with the help of piston of syringe (10 ml) and pass on up to 3
wells for each sample.
Recollect the cells from wells in a falcon tube of 50 ml.
Leave the cells to settle down for 45 minutes at 28oC temperature.
Centrifuge at 1200 rpm for 5 minutes.
Discard the supernatant and take the pellet (sediment) in 13 to 14 ml of percoll
35% solution in 13 ml tubes.
Centrifuge at 2600 rpm for 25 minutes
Discard the supernatant.
50
Re-suspend the pellet (sediment) in 500 µL of pure bovine fetal serum in 13 ml
tubes.
Add 3 mL of ACK solution for 3 minutes at ambient temperature.
Stop lysis by adding 10 mL of PBS-SVF 2% and put in ice.
Centrifuge at 1200 rpm for 5 minutes.
Discard the supernatant, and take the pellet (sediment) in 300-800 µL of PBS-
SVF 2% (according to volume of sediment) and measure the total volume after
addition.
Counting of cells on graded slide.
Count the cells (20 µL) in 1/2th or 1/ 5th dilution in trypan blue stain.
b. Preparation of agarose plates for the LMI test
Agarose solution was prepared by adopting following protocol.
Solution A. 1.6 grams agarose (Sigma Chemical., USA) was dissolved in 160 ml of
sterile distilled water by heating for 15-20 minutes at 52oC in a water bath and
maintained it.
Solution B. it was prepared by mixing 20 ml of fetal bovine serum (PAA), 18 ml of
10x GMEM-199 medium with Hanks' salts (PAA Research Products), 2 ml of
penicillin-streptomycin solution (Sigma), and 1 ml of 7.5% sodium bicarbonate
solution. The final pH was adjusted to 7.2, and this solution was warmed to 52oC.
Both solutions (A and B) were mixed together. Three to five-ml agarose solution
was put into tissue-culture plates and allowed to solidify.
c. Thermostable I-2 NDV strain (Thermo-Vac) was used as test antigen.
d. Procedure
Took three sterile test tube
Add leukocyte sample into sterile tubes.
The ND I-2 antigen was added to the first tube, LaSota ND second tube and an
equal amount of GMEM-199 medium was added to the third tube i.e. control tube.
All the tubes containing leukocyte suspensions with or without antigen were
incubated at 37oC for 30 minutes.
Six wells were made in each of the agar plates using a punch
51
Two wells of the agar plate were filled with cell suspensions containing antigen ND
I-2 (10 ul/well), two LaSota ND (10 ul/well) and the remaining two wells were
filled with cell suspensions containing no antigen (10 ul/ well).
All plates were incubated at 37oC for 18 hours in a humidified atmosphere
containing 5% CO2.
After incubation, the plates were fixed with 8% glutaraldehyde solution for 60
minutes.
The hardened agar was removed, and the adhering cells were stained with trypan
blue stain. After washing with dis-tilled water, the plates were allowed to dry.
The diameter of the cellular migration was measured using an inverted microscope
(Nikon, Japan).
Mean migration distance was calculated using the formula
The average migration area in the presence or absence of antigen was compared,
and the percentage of migration was calculated as follows:
% Migration = Mean of Migration in the presence of Ag x 100
Mean of migration in the absence of Ag
The percentage of inhibition of migration was deter-mined as follows:
% Inhibition = 100 - % Migration
v. Statistical analysis
The data regarding anti-NDV antibodies titers (determinately either HI or ELISA tests)
was processed using one way analysis of variance (ANOVA) on 0, 7, 14, 21, 28 and 35 DPV.
The difference was further studied using Least Significant Difference test. All the analyses
were performed using SPSS version 13.0 for Windows (Coakes et al. 2006).
52
Chapter # 4
RESULTS
Newcastle disease has terrible and destructive effects in poultry industry throughout
the world in term of high morbidity and mortality. In Pakistan, during 2012, forty five million
mortalities had been recorded due to this disease resulting in economic loss of 6 billion
Pakistani Rupees. Thermostable vaccine have low storage cost, less chances for the wastage
of vaccine and higher shelf life of the product. Thermostable vaccine is the only way to combat
Newcastle disease virus in countries with high ambient temperature like subtropical countries
(Pakistan, India, Bangladesh etc). This vaccine has the ability to maintain its activity at 28oC
and 4-8oC for 9-10 weeks and 12 months, respectively.
Commercial vaccines such as LaSota, Hitchner B1 etc. used against Newcastle disease
are mostly heat unstable in nature; so they demand cold chain storage system from production
to inoculation. In emerging countries including Pakistan electrical load shedding is a big hurdle
for maintaining vaccine efficacy from production to inoculation. So in such countries, the
development and administration of thermostable poultry vaccine is expected to play an
important role in the development of health and economy of the country.
The present study was carried out to make lyophilized live cell culture based NDV I-2
vaccines (Thermo-Vac). The virus was obtained from the Centers of Advanced Studies in
Vaccinology and Biotechnology, University of Baluchistan, Pakistan. The NDV I-2 virus was
re-characterized and purified by using cell culture system. The Vero cell line was established
in the Cell culture laboratory, Institute of Microbiology, University of Agriculture, Faisalabad.
The thermostable NDV I-2 virus strain was grown on Vero cells and adaptation was carried
out through sequential passages and then experimental and field trial was performed.
Procurement of NDV virus
Well characterized thermostable NDV I-2 strain procured from Centers of Advanced
Studies in Vaccinology and Biotechnology, University of Baluchistan, Pakistan. The virus was
re-characterized by Haemagglutination test.
53
Procurement of Vero Cell Line
African green monkey kidney cell (Vero cell line) was procured from the Institute of
Microbiology, University of Agriculture, Faisalabad as it was imported from Center for
Applied Microbiology and Research which has catalogued no. ATCC CCL81 and its complete
description was mentioned in Table 1.
Sterilization of Glassware’s
The fresh glassware such as flasks, beaker etc. immersed in the Deacon’s solution for
18-24 hours and then washed three times in tap water and de-ionized distilled water. The
washed glassware’s were put in digital hot air oven at 171oC for 1 hour for sterilization. We
used disposable 25 cm2 and 75 cm2 cell culture flasks (Orange and SPL) for growing of cells.
Different cell culture media including M199, DMEM and GMEM were used for growing of
Vero cell line.
Preparation of Vero cell monolayer
Thawing of Vero cells have been carried out at 37oC temperature in a water bath
immediately after taking out the aliquot or cryo-vial from the liquid nitrogen cylinder. The
detailed description of the African green monkey kidney cells (Vero cell) was listed in Table
1. After thawing the aliquot of Vero cells were transferred in the cell culture flask containing
the growth medium. The complete revival procedure was carried out in Bio safety cabinet II
(ESCO, BSL II, Korea). Then flask was put in a CO2 incubator at 37oC temperature. The
monolayer of cells was observed on daily basis. The complete monolayer was formed within
four days after revival as indicated in Figure 1, 2 and 3.
54
Figure 1: 24 hours post revival of Vero cells at 100x
Figure 2: 48 hours post revival Vero cells at 100X
55
Figure 3: 90-100% confluent monolayer after 96 hours
Viability of the Vero cells
Viability of Vero cells was observed by using trypan blue staining. Haemocytometer
was used for counting the cells. Dead cells turned blue due to the entrance of dye in their
cytoplasm while live cells remained unstained or colorless. Out of the 130 cells, 108 were live
cells. These live cells were further used for sub-culturing in cell culture flasks.
No. of live cells: 108
Total No. of cells: 130
%age of live cells: 83.07%
56
Table 1: Complete description of Vero cell line
ECACC No. 84113001
Name Vero
Morphology Fibroblast like
Established from Normal adult African green monkey kidney
Ploidy Aneuploid
Mode of growth Monolayer
Growth medium M199, DMEM
Sub-culturing With 0.25% Trypsin EDTA
Growth requirements 37oC
Yield High
Source Center for Applied Microbiology and Research (CAMR)
(ECACC, Salisbury, UK)
Catalogue No. ATCC CCL81
Applications Virus studies, vaccine production
57
Cryopreservation of Vero cells
Storage medium (20% fetal bovine serum, 10% DMSO) was used for cryopreservation
of the Vero cells. Cells were calculated before cryopreservation which were 3×107 cells per
ml. These vials were stored in -80oC refrigerated for over-night and then transferred in -196oC
liquid nitrogen cylinder for further use.
Infection of Vero cell line with I-2 NDV strain
The thermostable I-2 NDV strain has been used to infect confluent healthy mono layer
of African green monkey kidney cells (Vero cell). The inoculum of I-2 NDV contained 106
fifty percent egg infective dose (EID50). The virus was primarily filtered through 0.22 µm
syringe filters (Filter-Tek) and then inoculated on Vero cells at the rate of 0.25ml per 25 cm2
cell culture flasks. For adsorption purpose, the flask was incubated at 37oC for 60 minutes. 5-
10 ml growth medium was added in flask. The flask was examined on daily basis (morning
and evening) using inverted microscope up to seven days.
No any cytopathic effect was observed in the blind passage or passage 1 (Figure 4-8).
After three freeze thaw cycles, the culture supernatant was centrifuged, harvested and injected
again on confluent monolayer of Vero cells. After that process, the harvested virus was
designated as P2 (passage no. 2). This P2 was again injected into healthy Vero cell monolayer
and consequent passages were done upto passage no. 13. The first clear cytopathic effects was
observed in passage no. 10 at 120 hours post inoculation. The consistent cytopathic effects
were observed at 13th passage so it was considered as adapted I-2 NDV passage on Vero cells.
The cytopathic effects were recorded including syncytial formation, rounding and detachment
of cells as shown in Figure 9 to 15. The infectivity titers of the virus were recorded which
increased gradually from the passage 1 to the 13th passage as presented in Table 2.
58
Figure 4: 24 hours post infected Vero cells with I-2 NDV
Figure 5: 36 hours post infected plate of Vero cells
59
Figure 6: 48 hours post infection of Vero cells in passage no. 1
Figure 7: 72 hours post infection of Vero cells in passage no. 1
60
Figure 8: Appearance of cytopathogenic effects started at 96 hours post
infection at P 10th
Figure 9: CPE (Syncytial formation) at 120 hours post infection of virus in
10th passage
61
Figure 10: CPE (Syncytial and Roundening of cells) at 72 hours post
infection in 11th passage
Figure 11: CPE (Syncytial formation and Roundening of cells) after 72
hours in passage 12th
62
Figure 12: Consistent CPE appeared in passage no. 13 after 6 hours of Post
infection
Figure 13: Consistent CPE (Aggregation of cells) appeared in passage no.
13 after 12 hours of Post infection
63
Figure 14: Consistent CPE (Aggregation of cells) appeared in passage no.
13 after 18 hours of Post infection
Figure 15: Consistent CPE (Roundening or Detachment of cells from
Tissue culture flask) appeared in passage 13 after 24 hours of Post
infection
64
Identification and titration of NDV 1-2 viral strain
The distinguishing proof of I-2 ND viral strain on the Vero cell line was done by its
specific appearance of CPE, specifically syncytial development, rounding of cells and
separation of cells. After centrifugation of each passage, the supernatant fluid was utilized for
Haem-agglutination test. The passage no. 13 showed a titer of 512 matching to the original
one. The Vero cell adapted NDV I-2 virus had 106 pfu/ml and at TCID50 it was found as log108
per ml.
Molecular detection through RT-PCR
Specific primers were used to determine the fusion protein gene sequence. After
running in polyacrylamide gel, produced a 204 bp product on amplification band as shown in
Figure 16. The accession number i.e. KM043779 was obtained from Genbank presented in
Figure 17. Phylogenetic analysis revealed that 80-90% homology of in nucleotides amino acids
was existed among the other reported thermostable NDV isolates presented in Figure 18.
Fusion protein gene sequence
Sequence Forward
GGTGAGTCTATCCGGAGGATACAAGAGTCTGTGACTACATCCGGAGGAAGGAGA
CAGAGACGCTTTATAGGTGCCATTATTGGCAGTGTAGCTCTAGGGGTTGCAACAG
CTGCACAAATAACGGCAGCCTCGGCTCTGATACAAGCCAACCAGAATGCTGCTA
ACATCCTCCGGCTTAAGGAGAGCATTGCCGCAACCAA
Sequence Reverse
TTGGTTGCGGCAATGCTCTCCTTAAGCCGGAGGATGTTAGCAGCATTCTGGTTGG
CTTGTATCAGAGCCGAGGCTGCCGTTATTTGTGCAGCTGTTGCAACCCCTAGAGC
TACACTGCCAATAATGGCACCTATAAAGCGTCTCTGTCTCCTTCCTCCGGATGTA
GTCACAGACTCTTGTATCCTCCGGATAGACTCACC
65
Figure 16: PCR products amplified from fusion protein gene of cleavage site
of NDV I-2 strain on 2% agarose gel stained with ethidium bromide. Lane
1, Gene RulerTM 1kbp DNA Ladder (Fermentas # SM0373); Lane 2, Positive
control (Egg adapted live NDV I-2 vaccine); Lane 3, NDV I-2 vaccine strain
(Vero cell adapted live) produced 204 base pair product.
800
600
1000
200
400
250
100
50
500
300
150
900
700
1 2 3
204 bp
66
Figure 17: Newcastle disease virus strain I-2 fusion protein mRNA, partial
cds Gen Bank: KM043779.1
67
Figure 18: Neighbor-Joining method was used for constructing phylogenetic
hierarchy on partial nucleotide sequences of fusion protein of I-2 Newcastle
disease virus [Gen-Bank Accession No: KM043779] with previously
published sequences of ND viruses.
68
Preparation of Vaccines
Freeze dried cell culture adapted ND I-2 (Thermo-Vac) vaccines was prepared by
following standard protocols indicated in Figure 19. 13th cell culture adapted passage was used
as vaccine candidates. 10% skimmed milk was used as a stabilizer.
Sterility test
Cell culture adapted ND I-2 vaccine was proved to be sterile when it streaked on the
various general purpose as well as different selective media. No bacterial as well as fungal
growth was identified on Nutrient agar, MacConkey agar, Thioglycolate agar, Blood agar,
Frey’s modified medium and Sabouraud’s agar, even after 72 hours post inoculation. These
results indicated that Thermo-Vac NDV vaccine prepared in the cell culture laboratory of
Institute of Microbiology, University of Agriculture Faisalabad (used in the present research)
was free from any contaminants.
Safety testing
No sign of any pyrogenic effect, vaccine shock and/or vaccinal reaction was observed
when inoculated in day old chicks. This was clearly revealed that vaccine was safe.
Vaccine stability
Cell culture adapted I-2 NDV vaccine strain had retained thermostable ability of both
infectivity and HA after 13 passages on Vero cell line at 56°C for up to 40 minutes indicated
in Table 2.
69
Figure 19: Final preparation of cell culture adapted lyophilized
thermostable Newcastle disease vaccine (Thermo-Vac)
70
Table 2: Effect of Temperature Treatment on the Infectivity and
Haemagglutination activity of the NDV I-2 Vaccine
Passage No. Temperature 56oC
Time Period (Minutes)
10 20 30 40
HA EID50 HA EID50 HA EID50 HA EID50
1 6 6 6 6 6 5.80 4 2.75
2 6 5.8 6 5.62 5 5.60 4 2.85
3 7 5.6 7 5.6 6 5.58 4 3.10
4 6 5.8 6 5.8 6 5.55 4 3.25
5 6 5.9 6 5.65 6 5.54 5 3.80
6 7 6.2 7 5.83 6 5.78 5 4.20
7 8 6.35 7 5.86 6 5.74 5 4.45
8 7 6.52 8 6.20 7 5.95 5 4.80
9 8 7.30 8 6.85 7 6.56 6 5.42
10 9 7.45 9 6.92 8 6.70 6 5.55
11 9 7.86 9 7.65 8 7.35 7 5.80
12 10 8.45 10 7.86 9 7.54 7 6.15
13 10 8.52 10 8.35 9 7.86 8 6.45
Legend: HA: Geometric mean haemagglutinin titers (log2); EID50: Geometric mean titers of
embryo infectious dose 50% (log10/ml)
71
Experimental evaluation of vaccine
1. Humoral immune response and challenge studies
Twenty birds from each group were randomly selected for blood sampling. Blood
collection was performed at 0, 7th, 14th, 21st, 28th and 35th days post vaccination by using wing
web method in sterile conditions as shown in Figure 20. Serum was separated through
centrifugation which was inactivated at 56oC for 30 minutes and exposed to Haemagglutination
Inhibition test (HI) and Enzyme linked immunosorbant assay (ELISA) for detection of
antibody titers as shown in Table 3 (Figure 21) and Table 4 (Figure 22), respectively.
An experimental evaluation of group 1, maximum HI and ELISA mean antibody titer
Log2 and standard deviation was achieved at days 14 e.g. 7.5 ± 0.79a, 6812 ± 0.654a followed
by 2 ± 0.41a,, 1633±0.341a, 6.0 ± 0.13a, 4899 ± 0.546a, 6.8 ± 0.49a, 5899 ± 0.879a, 6.75 ± 0.64a,
5716 ± 0.546a and 4.5 ± 0.53a, 3480 ± 0.347a at day 0, 7, 21, 28 and 35, respectively when
Thermo-Vac was given through drinking water method.
In group 2 (NDV LaSota) vaccine produced HI and ELISA mean antibody titer Log2
and standard deviation, i.e. 2 ± 0.41b, 1633 ± 0.632a, 2.95 ± 0.29b, 2300±0.231b, 4.04 ± 0.62b,
4520±0.234b, 3.09 ± 0.73b, 3400 ± 0.543b, 2.20 ± 0.11b, 2372 ± 0.653b and 2 ± 0.65b,
1500±0.436b at day 0, 7, 14, 21, 28 and 35 respectively when administered through drinking
water method. All 2 means (Thermo-Vac and NDV LaSota) are significantly different from
one another except at day 0. Means with the different letters are significantly different at 0.05
confidence level as shown in Table 3 and 4. In negative controlled group 3, no protection was
observed against challenge infection. We observed no morbidity and mortality in chicks during
challenge infection. The result showed that Thermo-Vac protect 85% birds in group 1 i.e. 85%
protection rate as compared to NDV LaSota given which had given 60% protection after
challenge viral infection (both of them were given through drinking water method). In group
3, all birds died after challenge infection within 2-3 days as presented in Table 5.
2. Cellular Immune Response
Splenic cell migration inhibition assay was used for evaluation of cellular immune
response. Each sample comprised of 5 x 107 leukocyte cells per ml. The percentage migration
inhibition of Thermo-Vac ND vaccine in group A was significantly higher as compared to
Group B LaSota ND vaccine. The outcomes of the present study represent that in group A,
Thermo-Vac vaccine started producing inhibition migration at day 3 (40%) and reached
72
optimum level at day 6 (50%) and then gradually declined at day 9, 12, 15 and 18 i.e. 38%,
26%, 14% and 13%, respectively. In group B, commercially available thermolabile LaSota ND
vaccine had shown migration inhibition at day 3, 6, 9, 12, 15, 18 i.e. 32%, 43%, 34%, 19%,
10% and 12%, respectively. The mean migration inhibition was non-significant (< 15%) in the
control group throughout the experiment illustrated in Figure 23.
73
Figure 20: Experimental evaluation of Thermo-Vac NDV and LaSota NDV
vaccine in commercial broiler chickens, Lab Animal House, Institute of
Microbiology, University of Agriculture Faisalabad
74
Table 3: Comparative Haemagglutination inhibition antibody titers mean of
Thermo-Vac (I-2 NDV) and LaSota NDV vaccine in commercial broiler
chickens
Legend: G= Group, NDV= Newcastle disease vaccine, D/W= Drinking water, HI=
Haemagglutination inhibition, NC; Negative, PBS= Phosphate Buffer Saline, control All 2
means are significantly different from one another except at day 0. Means with the different
letters are significantly different at 0.05 confidence level
Group Vaccination Route HI Mean Antibody titer Log2 (Days)
0 7 14 21 28 35 Overall
G1 Thermo-Vac D/W 2 ±
0.41a
6.0 ±
0.13a
7.5 ±
0.79a
6.8 ±
0.49a
6.75 ±
0.64a
4.5 ±
0.53a
5.5917±
0.89 a
G2 LaSota NDV D/W 2 ±
0.41b
2.95 ±
0.29b
4.04 ±
0.62b
3.09 ±
0.73b
2.20 ±
0.11b
2 ±
0.65b
2.7133±
1.99 b
G3 NC (PBS) D/W - - - - - -
75
Figure 21: Comparative Haemagglutination inhibition antibody titers mean
of Thermo-Vac (I-2 NDV) and LaSota NDV vaccine in commercial broiler
chickens
76
Table 4: Comparative ELISA antibody titers mean of I-2 NDV (Thermo-
Vac) and LaSota NDV vaccine in commercial broiler chickens
Legend: G= Group, NDV= Newcastle disease vaccine, D/W= Drinking water, ELISA=
Enzyme linked immunosorbant assay, PBS= Phosphate Buffer Saline, All 2 means are
significantly different from one another except at day 0. Means with the different letters are
significantly different at 0.05 confidence level.
Group No. Vaccination Route ELISA Antibody titer mean (Days)
0 7 14 21 28 35 Overall
G1 Thermo-Vac D/W 1633 ±
0.341a
4899±
0.546a
6812±
0.654a
5899±
0.879a
5716±
0.546a
3480±
0.347a
4739.8
±0.783a
G2 LaSota NDV D/W 1633 ±
0.632a
2300±
0.231b
4520±
0.234b
3400±
0.543b
2372±
0.653 b
1500±
0.436b
2620.8
±0.743b
G3 Negative
Control (PBS) D/W
1633 ±
0.632a
1230±
0.112b - - - -
77
Figure 22: Comparative ELISA antibody titers mean of I-2 NDV (Thermo-
Vac) and LaSota NDV vaccine in commercial broiler chickens
0
1000
2000
3000
4000
5000
6000
7000
8000
0 7 14 21 28 35
EL
ISA
An
tib
od
y T
iters
Days
G1 G2 G3
78
Table 5: Effect of Challenge virus on the selected groups after 28 days of
post immunization
Legend: G= Group, NDV= Newcastle disease vaccine, D/W= Drinking water, TCID50; Tissue
culture infective dose fifty, PBS= Phosphate buffer saline
Group
No. Vaccination Route
Dose rate
(TCID50)
Morbidity
%
Mortality
%
Lesion
score
Protection
rate %
G1 Thermo-Vac D/W 106 5-10 0 Minute 90
G2 LaSota NDV D/W 106 80 40 Moderate 60
G3 PBS D/W ------- --- 100 ----- 0
79
Figure 23: Comparative analysis of cellular immune response of Thermo-
Vac and LaSota NDV vaccine through Splenic cell migration inhibition
assay
0
10
20
30
40
50
60
% M
igrati
on
In
hib
itio
n
Thermo-Vac ND Vaccine LaSota ND Vaccine Control0 3 6 9 12 15
80
Field trials of cell culture adapted Thermostable NDV I-2 vaccines
The present study was conducted in six poultry farms in the district of Faisalabad,
Punjab, Pakistan as indicated in Figure 6. Selected farms were Randhawa poultry farm (F1),
Aslam poultry farm (F2), Sohail poultry farm (F3), Basharat poultry farm (F4), Nasir poultry
farm (F5) and Ahmad poultry farm (F6). Out of total 360 screened samples, 274 (76%) were
found positive for anti-NDV-HI and anti-NDV-ELISA antibodies while 86 (24%) were
negative. Anti NDV-HI titers of log23 or above is mainly accepted all over the world as it
indicates a protective level of antibodies against NDV. The serum level of antibodies was
detected by using HI test (Uddin et al., 2014). In the field conditions, maximum geometric
mean anti-NDV-HI (Log27.83) and anti-NDV-ELISA (6017) antibody titers were observed on
14th day post vaccination as presented in Figure 26.
Results of Randhawa poultry farm (F1) showed that maximum anti-NDV-HI and anti-
NDV-ELISA antibody titers in Log2 and standard deviation was achieved at days 14 e.g.
7±0.52a, 6357±0.638a as followed 2.5±0.15a, 1430±0.286a, 5.3±0.46a, 4344±0.546a, 6.3±0.42a,
5547±0.546a, 4.7±0.35a, 3580±0.382a and 3.25±0.24a, 3276±0.480a at day 0, 7, 21, 28 and 35
respectively presented in Table (6, 7) and Figure 24 and 25. The outcomes of Aslam poultry
farm (F2) depicted that that maximum anti-NDV-HI and anti-NDV-ELISA antibody titers in
Log2 and standard deviation was achieved at days 14 e.g. 7.62±0.53a, 6554±0.628a as followed
2±0.21a, 1360±0.245a, 7±0.48a, 6150±0.620a, 7.2±0.50a, 6200±0.622a, 6.7±0.46a, 5549±0.584a
and 3.25±0.26a, 2694±0.260a at day 0, 7, 21, 28 and 35 respectively.
Maximum anti-NDV-HI and anti-NDV-ELISA antibody titers of Sohail poultry farm
(F3) were observed at day 14 as 9±0.68a, 6554±0.628a followed by 2.75±0.19a, 1440±0.310a,
8.2±0.62a, 7120±0.640a, 6.7±0.52a, 5500±0.580a, 6.3±0.53a, 4480±0.512a and 4.0±0.28a,
3560±0.320a at day 0, 7, 21, 28 and 35, respectively. The results of Basharat poultry farm (F4)
indicated that that optimum anti-NDV-HI and anti-NDV-ELISA antibody titers in Log2 and
standard deviation were observed at day 14 as 7.5±0.0.52a, 6670±0.640a followed by
1.25±0.18a, 1530±0.240a, 5.5±0.44a, 4550±0.556a, 7.12±0.58a, 6120±0.620a, 4.31±0.34a,
3556±0.424a and 1.5±0.14a, 1218±0.235a at day 0, 7, 21, 28 and 35, respectively.
The outcomes of Nasir poultry farm (F5) indicated that that optimum anti-NDV-HI and
anti-NDV-ELISA antibody titers in Log2 and standard deviation were recorded at day 14 as
6.62±0.47a, 5500±0.592a followed by 1.56±0.22a, 1420±0.180a, 4.62±0.38a, 4730±0.572a,
81
5.8±0.46a, 4887±0.564a, 5.12±0.39a, 4120±0.524a and 2±0.16a, 1609±0.196a at day 0, 7, 21, 28
and 35, respectively. The outcomes of Ahmad poultry farm (F6) indicated that that optimum
anti-NDV-HI and anti-NDV-ELISA antibody titers in Log2 and standard deviation were
recorded at day 14 as 4.25±0.36b, 3850±0.462b followed by 1.5±0.19b, 1465±0.252b,
2.5±0.175b, 2640±0.320b, 3.80±0.25b, 3450±0.352b, 2.80±0.22b, 2180±0.325b and 1.8 ±0.15b,
1120±0.135b at day 0, 7, 21, 28 and 35, respectively.
82
Figure 24: Field evaluation of Thermo-Vac NDV vaccine in commercial
broiler birds
83
Table 6: Haemagglutination Inhibition Mean antibody titers of cell culture
adapted Thermostable ND I-2 (Thermo-Vac) at various selected poultry
farms of district Faisalabad, Pakistan
Legend: F= Farm, F1=Randhawa poultry farm, F2= Aslam poultry farm, F3=Sohail poultry
farm, F4= Basharat poultry farm, F5= Nasir poultry farm, F= Ahmad poultry farm, NDV=
Newcastle disease vaccine, D/W= Drinking water, HI= Haemagglutination inhibition; SD=
Standard deviation. All 2 means are significantly different from one another except at day 0.
Means with the different letters are significantly different at 0.05 confidence level.
Farm
No. Vaccination
Rout
e
HI Mean Antibody titer log2 and SD (Days)
0 7 14 21 28 35
F1 Thermo-Vac D/W 2.5±0.15a 5.3±0.46a 7±0.52a 6.3±0.42a 4.7±0.35a 3.25±0.24a
F2 Thermo-Vac D/W 2±0.21a 7±0.48a 7.62±0.53a 7.2±0.50a 6.7±0.46a 3.25±0.26a
F3 Thermo-Vac D/W 2.75±0.19a 8.2±0.62a 9±0.68a 6.7±0.52a 6.3±0.53a 4.0±0.28a
F4 Thermo-Vac D/W 1.25±0.18a 5.5±0.44a 7.5±0.0.52a 7.12±0.58a 4.31±0.34a 1.5±0.14a
F5 Thermo-Vac D/W 1.56±0.22a 4.62±0.38a 6.62±0.47a 5.8±0.46a 3.12±0.19a 2±0.16a
F6 Thermo-Vac D/W 1.5±0.19b 4.58±0.29b 6.25±0.38b 5.70±0.35b 4.80±0.27b 2±0.15b
84
Figure 25: Haemagglutination Inhibition Mean antibody titers of cell culture
adapted Thermostable ND I-2 (Thermo-Vac) at various selected poultry
farms of district Faisalabad, Pakistan
85
Table 7: Enzyme Linked Immunosorbant Assay Mean antibody titers of cell
culture adapted Thermostable ND I-2 vaccine (Thermo-Vac) at various
selected poultry farms of district Faisalabad, Pakistan
Legend: F= Farm, F1=Randhawa poultry farm, F2= Aslam poultry farm, F3=Sohail poultry
farm, F4= Basharat poultry farm, F5= Nasir poultry farm, F= Ahmad poultry farm, NDV=
Newcastle disease vaccine, D/W= Drinking water, ELISA=Enzyme linked immunosorbant
assay, SD= Standard deviation. All 2 means are significantly different from one another except
at day 0. Means with the different letters are significantly different at 0.05 confidence level.
Farm
No. Vaccination Route
ELISA Mean Antibody titer and SD (Days)
0 7 14 21 28 35
F1 Thermo-Vac D/W 2049±0.286a 4344±0.546a 6357±0.638a 5547±0.546a 3580±0.382a 3276±0.480a
F2 Thermo-Vac D/W 1757±0.245a 6150±0.620a 6554±0.628a 6200±0.622a 5549±0.584a 2694±0.260a
F3 Thermo-Vac D/W 2160±0.310a 7120±0.640a 8340±0.725a 5500±0.580a 4480±0.512a 3560±0.320a
F4 Thermo-Vac D/W 1015±0.240a 4550±0.556a 6670±0.640a 6120±0.620a 3556±0.424a 1218±0.235a
F5 Thermo-Vac D/W 1597±0.180a 4730±0.572a 5500±0.592a 4887±0.564a 4120±0.524a 1609±0.196a
F6 Thermo-Vac D/W 1450±0.252b 2640±0.320b 4850±0.462b 3450±0.352b 2180±0..325b 1120±0.135b
86
Figure 26: Enzyme Linked Immunosorbant Assay Mean antibody titers of
cell culture adapted Thermostable ND I-2 vaccine (Thermo-Vac) at various
selected poultry farms of district Faisalabad, Pakistan
87
Figure 27: Comparative HI and ELISA Mean antibody titers of cell culture
adapted Thermostable ND I-2 vaccine (Thermo-Vac) at various selected
poultry farms of district Faisalabad, Pakistan
88
Chapter # 4
DISCUSSION
Newcastle disease is one of the most awful infections throughout the world particularly in
developing countries like Pakistan. During 2011-2013, three hundred ND outbreaks had been
recorded which have resulted into massive economic losses i.e. USD 200 million
approximately per year. Younger flocks, especially lower than two weeks of age, had been hit
badly by this disease (Siddique et al., 2013). The disease is endemic in Pakistan and
intermittent incidences are recorded frequently in commercial and rural poultry as well as in
wild captive birds. Avian Paramyxovirus type 1 (APMV-1) is the causative agent of this
notorious disease which is a single stranded and negative sense RNA virus belonging to the
genus Avulavirus and Paramyxoviridae family. The genomic structure of NDV comprised of
seven proteins which includes matrix protein (M), fusion protein (F), nucleoprotein (NP),
hemagglutinin-neuraminidase (HN), RNA dependent RNA polymerase (L), phosphoprotein
(P) and V protein (Alexandar and Senne 2008; Makoui et al., 2013).
Newcastle disease virus hit badly 250 species of domestic as well as wild avian birds. The
severity of Newcastle disease fluctuates from peracute to acute infection with almost 100%
mortality. Five pathotypes were originated on the basis of severity of clinical disease named
as velogenic, mesogenic, lentogenic, asymptomatic enteric and avirulent forms (Alexander and
Senne, 2008). The clinical manifestation mainly depends upon pathotypes of Newcastle
disease virus which may also influenced by some host-related factors including immune status,
age, environmental stress, toxins and route of infection (Alexander and Senne, 2008). The
major quantifiable signs and symptoms are swelling of conjunctiva, reddening in the lower
eyelid, ruffled plumage, anorexia, tremors, weakness, prostration, weakness, labored
breathing, generalized febrile state, opisthotonus, paralysis, greenish diarrhea, misshapen eggs
and drop in egg production (Brown et al., 1999; Alexander, 2003; Kommers et al., 2003; Susta
et al., 2010). The postmortem lesions are multifocal hemorrhages of the intestines, spleen, gut
associated lymphoid tissue, cecal tonsils, proventriculus, trachea and gizzard (Wakamatsu et
al., 2006; Kong et al., 2007).
Vaccination is the only way to combat the ND viral disease. Live or killed vaccines are
available commercially and extensively used in both broiler and layer poultry farms in
Pakistan. In spite of these extensive immunization strategies, disease epidemics are regularly
89
reported from the worldwide. It may be due to failure of vaccine efficacy because all vaccines
are thermolabile in nature and require cold chain systems for their storage and transportation
which may not be maintained due to electric load shedding from production to inoculation. So
in the current scenario, the development of thermostable I-2 ND vaccine is necessary which
doesn’t require any cold chain system from production to inoculation.
Newcastle disease vaccine is produced by using 8-9 days old embryonated eggs since 1930.
This conventional technique has some problems including high cost in terms of labor and SPF
embryonated chicken eggs, time consuming and difficult to scale-up (Souza et al., 2009). A
substitute to this old fashioned technique is the development of ND vaccine in cell culture
system. The World Health Organization has endorsed the establishing of cell culture based
vaccines due to their significant advantages over egg based vaccines which include rapid
vaccine production, no change in the virus antigenicity, less time required for high yield
vaccine production and absence of any allergic compound (WHO, 1995; Ehrlich et al., 2009).
There are a number of cell lines (BHK 21, Vero, MDCK and Hela etc.) used for vaccine
productions. Among them WHO recommended Vero cell line (derived from African green
monkey kidney fibroblast cells) that has been used for vaccine productions commercially
(Barrett et al., 2009). Arifin et al. (2011) reported that NDV has the capability to propagate in
a variety of cells. Different substrate of cell has been used for production of NDV such as Vero
(Ravindra et al., 2008), chicken embryonic fibroblasts (DiNapoli et al., 2007) and DF-1 (Afrin
et al., 2010). These cells have the ability to attach to the surface of matrix to assist the growth
of cells (Afrin et al., 2011).
In the current study, the Vero cell line has been used for production of Thermo-Vac NDV
vaccines. Cells were yielded at the rate of 3×107 cells per ml when grown in MEM199 medium.
There are different types of culture media, including DMEM, MEM and RPMI 1640, used for
the culturing of Vero cells. Maximum concentration (1.93×106 cells/ml) of Vero cells was
achieved when grown in DMEM medium followed by MEM (1.5 × 106 cells/ml) and RPMI
(7.55 × 105 cells/ml) (Afrin et al., 2010). Afrin et al., 2010 reported that when a DF-1 cell
grown in DMEM medium then optimum cell concentration (1.29 x 106 cells/ml) was
maintained after 64 hours of incubation (Afrin et al., 2011).
The morphological alterations such as roundening, aggregation of cells and formation of
plaques has occurred after the growing of virus, called cytopathic effect (CPE). The first clear
90
cytopathic effect was observed in passage no. 10 at 120 hours post infection. The passage 10
was considered as the I-2 NDV adapted. The cytopathic effects were observed, including
syncytial formation, rounding and detachment of cells. Complete cell monolayer was obtained
in cell culture flasks after 72 h of seeding. Clear cytopathic effects were examined after 3-7
days of inoculation when propagated in chicken embryo kidney (CEK) cell line. These were
degenerating, vacuolization, rounding, granularity and cell fusion (Wambura Wambura et al.,
2006). Similar findings were reported by many researchers round the globe (Cann and Irving,
1999; Ahmad et al., 2004; Afrin et al., 2011).
Thermal stability is a property which allows the virus to bear interaction with high
temperatures without the total loss of their infectivity and while retaining immunogenicity.
Goldman and Hanson (1955) identified first heat resistant Newcastle disease virus strain.
Bensink and Spradbrow (1999) developed thermostable, avirulent I-2 NDV strain for vaccine
production, which does not required any cold chain storage system from production to
inoculation and can be used in village chickens against challenge infection in many developing
countries. Many techniques have been adopted to choose a heat tolerant NDV strain such as
stepwise exposure to gradually increased temperatures upto 56oC and short exposure at
different temperatures (Spradbrow, 1992; Varadarajan et al., 2000; King, 2001). NDV I-2
strain survives at 56oC. This temperature was used because it gave rapid results and it is
supposed that if NDV I-2 strain persist at 56oC then it will definitely survive at 25 to 28oC in
tropical and subtropical countries (Spradbrow, 1992). NDV I-2 strain proved as heat tolerant
strain for both infectivity and HA (Bensink and Spradbrow, 1999). The outcomes of current
study revealed that NDV I-2 strain has the ability to maintain infectivity and HA when treated
with different temperatures and time intervals. After each passage of virus in Vero cell line, no
death of embryos was recorded which proved that NDV I-2 strain had maintained avirulence
ability in the chick embryos. Time and temperature comparison depicted that the HA and
infectivity titers were reduced by two logarithmic orders. These findings proved that NDV I-2
strain used for vaccine productions which has induced more protective antibody response as
compared to commercially available thermolabile NDV LaSota vaccines in field condition of
Pakistan.
Biological assay for titration of Newcastle disease virus strain I-2 was performed which grown
in 9-10 days chicken in embryonated eggs based on the incubation period of virus. Maximum
91
HA titers was detected (109 EID50/ml) after 24 hours of incubation (Wambura et al., 2006). In
the present study, P13th passage produced 106 pfu/ml and log10 8 per ml TCID50. These results
indicates that, 10-8 times diluted Vero cell culture adapted P13 NDV I-2 passage which has the
ability to produce cytopathic effects. The passage 13 had shown a HI titer of 512 matching to
the original one. Approximately similar result had been reported in one recent study when
Newcastle disease virus propagated in DF-1 cell line where HA observed titer was 107
TCID50/ml (Afrin et al., 2011).
Fusion protein cleavage site and Haemagglutinin-neuraminidase carboxyl terminus have been
used for detection of a virulent I-2 strain. Number 13th passage was subjected to molecular
detection through two step RT-PCR reaction in which I-2 strain produced a 204 base pair
product on amplification by the use of degenerate fusion protein primers as shown in Figure 2.
The amplicons were directly sequenced by the dye-terminator cycle method. We obtained an
accession number KM043779 from Genbank as denoted in Figure 17. Then it was subjected
to homology comparison with other NDV strains related published sequences as presented in
Figure 4. The evolutionary history was inferred using the Neighbor-Joining method (Saitou
and Nei, 1987). The optimal tree with the sum of branch length = 0.32560662 is shown. The
percentage of replicating trees in which the associated taxa clustered together in the bootstrap
test (100 replicates) are shown next to the branches (Felsenstein, 1985). The tree is drawn to
scale with branch lengths in the same units as those of the evolutionary distances used to infer
the phylogenetic tree. The evolutionary distances were computed using the Kimura 2-
parameter method (Kimura, 1980) and are in the units of the number of base substitutions per
site. The analysis involved 17 nucleotide sequences. All positions containing gaps and missing
data were eliminated. A total of 170 positions were present in the final dataset. Evolutionary
analyses were conducted in MEGA5 (Tamura et al., 2011). In a previous study, heat tolerant
I-2 NDV strain genomes was sequenced and compare to sequence of parent/master seed of the
virus. Mutations were observed at a number of positions with haemagglutin-neuraminidase
gene of parent culture.
Their homology was compared with the published sequence data of I-2 and V4 strains. No
major changes were examined in HN gene which could be represented as heat resistance gene.
Heat tolerant present in the I-2 strains is due to the alterations in the L protein of the virus
(Kattenbelt et al., 2006). The BHK-21 cell line had been used for serial passage of V4 strain
92
and named as Strain TSO9-C which is a thermostable in nature as parental V4 strain. The
whole genomic analysis of strain TS09-C was analyzed, then matched with other thermostable
Newcastle disease virus strains. The genome of this strain which was comprised of 15,186
nucleotides contained genes in the following order of 3′-NP-P/V/W-M-F-HN-L-5′.
Phylogenetic analysis revealed that 80-90% homology of nucleotides and amino acid was
existed among the other NDV thermostable isolates. Thermostable strains belonged to
genotype I. The cleavage site of fusion protein nucleotide was different from that of its V4
strain (Wen et al., 2013).
Acidic pH did not require for activation and cleavage of fusion protein. In neutral pH, it fuses
with the cell and helps for virus spreading in the host. Mono or dibasic amino acids are the part
of low virulent strains of NDV fusion protein cleavage site. These amino acids have the ability
to cleavage the less sensitize intracellular as well as extracellular proteases (Glickman et al.,
1988). It has been identified that lysine and arginine amino acids are present at cleavage site
and cellular proteases recognized this site (Toyoda et al., 1987; Kattenbelt et al., 2006). The
presence of arginine in different positions (115, 116) would lead to alteration of cleavage site
of virulent ND virus (Samal et al., 2011).
Stabilizers play a significant role in the stability of vaccines which includes the protection
against high temperature inactivation and during lyophilization and these stablizers also
increase shelf life of vaccines when vaccines were stored at ambient temperatures (22-25°C).
A variety of diluents including skim milk (5-10%), lactalbumin (5%), polyvinyl pyrolidone
(1%) and gelatin (1%) were used for the protection of NDV vaccines (Bensink and Spradbrow,
1999). In the present investigation, 10% skimmed milk was used as a stabilizer for the
protection of cell culture adapted NDV I-2 vaccine. The result indicated that skimmed milk is
one of the best stabilizer for protection of NDV I-2 vaccine which could be due to the presence
of lactose in it. It is also useful when used via drinking water vaccination (Wambura et al.,
2006).
No bacterial as well as fungal growth was detected on Nutrient agar, MacConkey agar,
thioglycolate agar, blood agar, Frey’s modified medium and Sabouraud’s agar. These results
indicated that Thermo-Vac vaccine used in the present study was free from any contaminants.
Recently, the NDV I-2 vaccine was verified free from any bacterial as well as fungal
93
contamination when cultivated on different bacterial and fungal media (Adwar and Lukešová,
2008).
NDV I-2 strain is avirulent, live vaccine (Spradbrow, 1992) with superior biological safety
(Anon, 1991). It is inoffensive to both handler and bird. This vaccine produces no harmful
clinical signs and symptoms such as coughing, weight loss, mortality and drop egg production
after vaccination (Bensink and Spradbrow, 1999; Heath et al., 1992). On other hand, LaSota
and HBI vaccines showed clinical signs in birds after vaccination (Musa et al., 2010). In my
research, no sign of any pyrogenic effect, vaccine shock and/or vaccine reaction was observed
when inoculated in day old chicks. This clearly showed that the vaccine was safe for both birds
and workers.
An experimental evaluation of group 1, maximum HI and ELISA mean anti-NDV-HI
titer Log2 and standard deviation was achieved at days 14 e.g. 7.5 ± 0.79a, 6812 ± 0.654a
followed by 2 ± 0.41a,, 1633±0.341a, 6.0 ± 0.13a, 4899 ± 0.546a, 6.8 ± 0.49a, 5899 ± 0.879a,
6.75 ± 0.64a, 5716 ± 0.546a and 4.5 ± 0.53a, 3480 ± 0.347a at day 0, 7, 21, 28 and 35,
respectively when Thermo-Vac was given through drinking water method.
In group 2 (NDV LaSota) vaccine produced HI and ELISA mean anti-NDV-HI titer Log2 and
standard deviation, i.e. 2 ± 0.41b, 1633 ± 0.632a, 2.95 ± 0.29b, 2300±0.231b, 4.04 ± 0.62b,
4520±0.234b, 3.09 ± 0.73b, 3400 ± 0.543b, 2.20 ± 0.11b, 2372 ± 0.653b and 2 ± 0.65b,
1500±0.436b at day 0, 7, 14, 21, 28 and 35 respectively when administered through drinking
water method. All 2 means (Thermo-Vac and NDV LaSota) are significantly different from
one another except at day 0. Means with the different letters are significantly different at 0.05
confidence level as shown in Table 3 and 4. In negative controlled group 3, no protection was
observed against challenge infection. We observed no morbidity and mortality in chicks during
challenge infection. The result showed that Thermo-Vac protect 85% birds in group 1 i.e. 85%
protection rate as compared to NDV LaSota given which had given 60% protection after
challenge viral infection (both of them were given through drinking water method). In group
3, all birds died after challenge infection within 2-3 days as presented in Table 5.
The standard dose of ND vaccines is 106 EID50/bird (OIE, 2012). There are a variety of ways
for administration of NDV I-2 vaccines such as drinking water, eye drop, mixing with feeds
sprays and injection. Eye drop method is the best tool for administering of NDV vaccine into
birds and 80-90% protection was achieved through this method (Mgomezulu et al., 2009; Musa
94
et al., 2010) as compared to drinking water method (60%) (Rehmani, 2004). But in our study,
drinking water method provide 90% protection. Thermostable NDV vaccines have been
effectively administered through feed (Illango et al., 2005). Food-based heat tolerant vaccines
have many benefits. Yet not whole live passage poultry vaccines were suitable for
administration on food (Spradbrow, 1993/94). Similar studies were carried out in Ethiopia,
when chickens vaccinated with the thermostable NDV I-2 and HB1 and LaSota vaccines
through different routes including intra ocular and drinking water routes against challenge
infection of a pathogenic Ethiopian strain of NDV. They produced protective antibody titers
in the chickens (Nasser et al., 2000).
The vaccine should be safe, potent, effective, pure and easy to use, and these factors are
important consideration leading to the success or failure of vaccination (Spradbrow, 1995).
Cellular immune response as well as humoral immune response have a significant effect for
the protection against pathogens like NDV (Rahman et al., 2013). Intracellular pathogen such
as viruses and tumor cells were recognized and eliminate through cellular immune response.
Antigen specific cells (cytotoxic T lymphocytes and cytokine releasing T helper lymphocyte)
and nonspecific cells (NK) play an immune-modulatory effect on the controlling of Newcastle
disease virus (Lam et al., 2014). The cell mediated immune response is the first immunological
response which can be established after administration of Newcastle disease vaccines. It had
reported that detected at day 3rd, optimized at day 7-10 and slowly decreased during the third
and fourth week after vaccination. This response could represent the early protection of birds
in the absence of immunoglobulin (Andereason and Latimer, 1989; Al-Shahery et al., 2008).
In spleenic cell migration test, sensitized lymphocytes was collected and stimulated by
knowing antigen, released macrophage inhibition factors and leukocyte inhibitory factor,
which have the ability for preventing the movement of macrophages and leukocytes
respectively (Young et al., 1990; Reynolds and Maraqa, 2000). It had reported that % of
inhibition more than 20% considered as statistically significant (Timms, 1974; Pawan and
Reynolds, 1991; Al-Shahery et al., 2008). The outcomes of present study represent that in
group A, Thermo-Vac vaccine start producing % inhibition migration at day 3 (40%) and
reached an optimized level at day 6 (50%) as gradually decreased at day 9, 12, 15 and 18 i.e.
38%, 26%, 14%, 13% respectively. In group B, commercially thermolabile LaSota ND vaccine
shown % migration inhibition at day 3, 6, 9, 12, 15, 18 i.e. 32%, 43%, 34%, 19%, 10%, 12%
95
respectively. The % migration inhibition was less than 15% in the control group throughout
the experiment. The % migration inhibition with Thermo-Vac ND antigen in group A was
significantly higher as compared to Group B LaSota ND vaccine. The % migration of
sensitized lymphocytes particularly T cells more with Thermo-Vac antigen, it may be due to
these cells are resensitized with this antigen in in vitro. These cells secrete cytokines such as
IL-1, IL-2 and 4 and macrophage inhibition factors which inhibited the migration of splenic
cells. These findings is an agreement with that of previous published data (Pawan and
Reynolds, 1991; Reynolds and Maraqa, 2000; Al-Shahery et al., 2008).
Out of total 360 samples screened 274 (76%) were found positive for anti-NDV-HI and anti-
NDV-ELISA antibodies while 86 (24%) were negative presented in Figure 27. Anti NDV-HI
titers of log23 or above is mainly accepted all over the world and it indicate protective level of
antibodies against NDV. Serum level of antibodies was detected by using HI test (Uddin et al.
2014). In the current research, single oral cell culture adapted thermostable ND vaccination
was capable to produce defensive immunoglobulin response in day old broilers after seven
days post vaccination. Thermostable NDV vaccine induced Log27.83 and 6017 geometric
mean anti-NDV-HI and anti-NDV-ELISA antibodies titers, respectively on 14th DPV
presented in Figure 27. Similar results had been presented in different studies by Bell et al.
(1995), Amakye et al. (2000), Spradbrow (1992 and 1995), Aldres et al. (1994), Wambura et
al. (2000), Alders (2004), Musa et al. (2010) and Wambura and Kataga (2011). Thermostable
vaccine dose (106 EID50/bird) was sufficient to induce protective titers against challenge viral
infection (Bawala et al. 2011). Antibody response is directly proportional to immunogen
amount in live ND vaccines (Ozan et al. 2014).
The protective antibodies response depends upon the vaccination route such as eye drop
method, drinking water method etc. (Musa et al. 2010). Eye drop method initiates high
antibody titer (80%) as compared to in drinking water (60%) as has been investigate by Alders
(2005). Our results are also in reported range in the drinking water method (76%). Comparable
results were detected in V4 thermostable strain (Guoyuan et al. 2013). The antibody titers of
thermostable Newcastle disease I-2 vaccines are generally decreased after definite periods of
time (Nssien and Adene 2002). In our study, 50 percent antibody titer was reduced on one
month post-vaccination. Factors responsible for poor antibody response include season,
presence of maternal antibodies, malnutrition, poor breed quality and administration routes
96
(Alexander and Senne 2008). Among these factors, season plays substantial role as dry season
affects severely than wet season (Otim et al. 2005). This might be due to harsh environmental
conditions such as high ambient temperature (Kemboi et al. 2013). It had been reported that
100 per cent protection was achieved in wet season as compared to dry season which was 83
percent protection (Kemboi et al. 2013).
97
Chapter # 5
SUMMARY
Thermostable vaccines can help to ensure vaccine potency in remote areas of the world with
limited or no electricity available for cold chain refrigeration. In addition, thermostable
vaccines hold promise for improving the application of vaccines by extending product shelf
life, decreasing the cost of vaccine stockpiling, and easing the deployment of vaccines.
Previous studies on the thermostability of various strains of NDV indicated that most NDV
strains lost their infectivity on exposure to temperatures of 50-55°C for 30 min. Newcastle
disease is one of the most nasty disease throughout the world, particularly in developing
countries like Pakistan, during 2011-2013, three hundred ND outbreaks have been recorded
which have resulted into massive economic losses i.e. USD 200 million approximately per
year. Younger flocks, especially less than two weeks of age were hit badly. The disease is
endemic in Pakistan and intermittent incidences are being described frequently in commercial
and rural poultry as well as wild captive birds. In the current study, the Vero cell line has been
used for production of thermostable I-2 NDV vaccine (Thermo-Vac). Cells were yielded at the
rate of 3×107 cells per ml when grew in MEM199 medium. The morphological alterations such
as roundening, aggregation of cells and formation of plaques has occurred after the growing of
virus, called cytopathic effect (CPE). The first clear cytopahic effect was observed in passage
no. 10 at 120 hours post infection. The passage no. 13th was considered as the I-2 NDV adapted,
which produced 106 pfu/ml and log10 8 per ml TCID50. Based on fusion protein cleavage site,
13th passage was subjected to the phylogenetic analysis through two step RT-PCR reaction.
The obtained accession number from Genbank was KM043779. Ten percent skimmed milk
was used as stabilizer for the protection of cell culture adapted NDV I-2 vaccine. There was
no bacterial as well as fungal growth was detected on Nutrient agar, MacConkey agar,
thioglycolate agar, blood agar, Frey’s modified medium and Sabouraud’s agar respectively.
An experimental evaluation, group 1, maximum HI and ELISA mean antibody titer Log2 and
standard deviation was achieved at days 14 e.g. 7.5±0.79a, 6812±0.654a as follows 2±0.41a,,
1633±0.341a, 6.0±0.13a, 4899±0.546a, 6.8±0.49a, 5899±0.879a, 6.75±0.64a, 5716±0.546a and
4.5±0.53a, 3480±0.347a at day 0, 7, 21, 28 and 35 respectively when NDV I-2 was given
through drinking water method. In group 2 (NDV LaSota) vaccine produced HI and ELISA
mean antibody titer Log2 and standard deviation i.e. 2±0.41b, 1633±0.632a, 2.95±0.29b,
98
2300±0.231b, 4.04± 0.62b, 4520±0.234b, 3.09±0.73b, 3400±0.543b, 2.20±0.11b, 2372±0.653b
and 2 ± 0.65b, 1500±0.436b at day 0, 7, 14, 21, 28 and 35 respectively when NDV LaSota was
administered through drinking water method. All 2 means (Thermo-Vac and NDV LaSota) are
significantly different from one another except at day 0. Means with the different letters are
significantly different at 0.05 confidence level. In negative controlled group 3, no protective
antibodies were observed. After challenge infection, daily (morning and evening) we observed
any morbidity and mortality in chicks. The result showed that Thermo-Vac protect 90% birds
in group 1 i.e. 90% protection rate compared with NDV LaSota 60% protection after challenge
viral infection, both of them were given through drinking water method. In group 3, all birds
died after challenge infection within 2-3 days. In our study, drinking water method provide
85% protection against challenge infection. In field conditions, maximum geometric mean
anti-NDV-HI (Log27.83) and anti-NDV-ELISA (6017) antibodies titers were observed,
respectively on 14th day post vaccination.
The thermostable vaccine particularly Thermo-Vac induces protective immunity in poultry
when correctly applied. It is cheap and thus makes it affordable to all farmers to use. It is not
require any strict cold chain facility and easy to administer by farmers. It can make a vital
contribution to the improvement of household food security in many developing countries like
Pakistan. The control of ND will contribute to improved commercial poultry production by
preventing the virus in circulation and act as reservoirs and carriers to themselves and the more
susceptible exotic breeds in commercial farms. In some circumstances, it may provide the first
contact between small-scale farmers and national veterinary services.
99
Chapter # 6
REFRENCES
Abbas T, MA Muneer, MD Ahmed, MA Khan, M Younus and I Khan, 2006. Comparative
Efficacy of Five Different Brands of Commercial Newcastle Disease Lasota Virus
Vaccines in Broilers. Pakistan Vet J, 26: 55-58.
Abdelrhman SS, EA ELsabour, M Rihan, M Hany, H Ali, A Jassem and MH Al-Blowi,
2013. Sero-Virological studies on Newcastle Disease and Avian Influenza in Farmed
Ostriches (Struthio camelus) in Saudi Arabia. J World Poult Res, 3: 38-42.
Adwar T and D Lukešová, 2008. Evaluation of thermostable vaccines against Newcastle
disease in village chicken used in tropics and subtropics. Agricult tropica subtrop, 41:
15-21.
Afrin MA, M Maizirwan, SH Salim, MIA Karim and A Ideris, 2010. Production of
Newcastle Disease Virus by Vero Cells Grown on Cytodex Microcarriers in a 2-Litre
Stirred Tank Bioreactor. J Biomed Biotechnol, 10: 586-363.
Afrin MA, M Maizirwan, SH Salim, MIA Karim and SS Hassan, 2011. Optimization of
Newcastle disease virus production in T-flask. Afr J Biotech, 81: 18816-18823.
Agbede G, F Demey, A Verhulest and JG Bell, 1990. Prévalence de la maladie de
Newcastle dans les élevages traditionnels de poulets au Cameroun. Sci Agronom Dév,
2: 6-14.
Agbor NT, 1999. Viability of thermostable Newcastle vaccine (HRV4-UPM) in some
Nigerian grains. Thesis for the award of FILMT, Nigeria.
Ahamed T, KM Hossain, MM Billah, KMD Islam, MM Ahasan and ME Islam, 2004.
Adaptation of Newcastle disease virus (NDV) on Vero cell line. Int J Poult Sci, 3: 153-
156.
Ahasan MM, KM Hossain and MR Islam, 2002. Adaptation of infectious bursal disease
virus on Vero cell line. Online J Biol Sci, 9: 633-635.
Ahmed T, KM Hossain, MM Billah, KMD Islam, MM Ahsan and ME Islam, 2004.
Adaptation of Newcastle Diseases virus (NDV) on Vero cell lines. Int J Poul Sci 3:
153-156.
100
Alders GR, 2005. The Aus AID Southern Africa Newcastle Disease Control Project: its
history, approach and lessons Learnt. ACIAR: Village chickens, poverty alleviation
and the sustainable control of Newcastle, pp 62-66.
Alders R and PB Spradbrow 2001a. Controlling Newcastle Disease in Village Chickens.
A Field Manual. ACIAR, Canberra, Australia. pp. 1-70.
Alders R, 2004. Poultry for profit and pleasure. FAO Diversification Booklet 3. Food and
Agriculture Organization of the United Nations: Rome.
Alders RG and PB Spradbrow, 2001. SADC planning workshop on Newcastle disease
control in village chickens. ACIAR Proceedings No. 103: 170 pp.
Alders RG, S Inoue and JC Katongo, 1994. Prevalence and evaluation of Hitchner B1 and
V4 vaccines for the control of Newcastle disease in village chickens in Zambia. Prev
Vet Med, 21: 125-132.
Aldous EW, JK Mynn, J Banks and DJ Alexander, 2003. A molecular epidemiology study
of avian Paramyxovirus type 1 (Newcastle disease virus) isolates by phylogenetic
analysis of a partial nucleotide sequence of the fusion protein gene. Avian Path, 32:
237-255.
Alexander DJ and DA Senne, 2008. Newcastle disease and other avian Paramyxoviruses.
In: A laboratory manual for the isolation, identification and characterization of avian
pathogens. ZL Dufour, DA Senne and JR Glisson, (eds), 5 th Ed;Omni Press, Inc,
Madison, Wisconsin, USA, pp: 135-141.
Alexander DJ, 1991b. Newcastle disease and other paramyxovirus infections. In: BW
Calnek, HJ Barnes, CW Beard, WM Reid and HW Yoder (eds.). Diseases of Poultry
9"" Edition 1991, (Iowa state University Press, Ames, Iowa, USA), 496-519.
Alexander DJ, 1997. Newcastle disease and other avian Paramyxoviridae infection. In
Calnek BW, Diseases of Poultry 10th ed. Iowa: Iowa State University Press. Pp; 541-
569.
Alexander DJ, 2001. Gordon Memorial Lecture. Newcastle disease. Br Poult Sci, 42: 5-22.
Alexander DJ, 2003. Newcastle disease, other paramyxoviruses and pneumovirus
infections. In: YM Saif, HI Barnes, JR Glisson, AM Fadly, DJ Mcdougald and DE
Swayne, (Eds), Diseases of Poultry, 11th Ed. (Iowa State Press, Ames, IA), 63-100.
101
Alexander DJ, 2009. Newcastle, disease: OIE Terrestrial Manual. Manual of Diagnostic
Tests and Vaccines for Terrestrial Animals. Chapter 2: 3.
Alexander DJ, JG Bell and RG Alders, 2004. Technology review: Newcastle disease with
special emphasis on its effect on village chickens. FAO Animal Production and Health
Paper No. 161. Food and Agriculture Organization of the United Nations: Rome.
Alexander DJ, RJ Manvell, JP Lowings, KM Frost, MS Collins, PH Russell and JE Smith,
1997. Antigenic diversity and similarities detected in avian paramyxovirus type 1
(Newcastle disease virus) isolates using monoclonal antibodies. Avian Pathol, 26: 399-
418.
Al-Garib SO, ALJ Gielkens, E Gruys and G Kochi, 2003. Review of Newcastle disease
virus with particular references to immunity and vaccination. World Poult Sci J, 59:
185-200.
Al-Shahery MN, AZ Al-Zubeady and SY Al-Baroodi, 2008. Evaluation of cell-mediated
immune response in chickens vaccinated with Newcastle disease virus. Iraqi J Vet Sci,
22: 21-24.
Al-Habeeb MA, MHA Mohamed and S Sharawi, 2013. Detection and characterization of
Newcastle disease virus in clinical samples using real time RT-PCR and melting curve
analysis based on matrix and fusion genes amplification. Vet World, 6: 239-243.
Allan WH and RE Gough, 1974a. A standard haemagglutination inhibition test for
Newcastle disease. I.A. comparison of macro and micro methods. Vet Res, 95: 120-
123.
Amakye AJ, JA Awuni, T Coleman and V Sedor, 2000. Ghanian trials with a rurally
produced thermostable Newcastle disease vaccine (strain I-2) in chickens. 26th Animal
Science Symposium Ghana Animal Science Association, Kumasi, Univ Sci Tech.
Ananth AJ, K John, MLM Priyadarshini and A Albert, 2008. Isolation of Newcastle
Disease Viruses of High Virulence in Unvaccinated Healthy Village Chickens in South
India. Inte J Poul Sci, 7: 368-373.
Anon, 1991. Websters Newcastle Disease Vaccine for Village Chickens. Castle Hill,
Australia, Websters Pty Ltd, Information Dossier.
Andereason CB and KS Latimer, 1989. Separation of avian hetrophils from blood using
Ficoll- Hypaque discontinuous gradients. Avian dis, 33: 163-167.
102
Arshad M, 1984. Epizootology of Newcastle disease in free flying birds of Pakistan. MSc
Thesis Deptt Microbiol, College of Vet Sci Lahore, Pakistan.
Asadullah M, 1992. Village chickens and Newcastle disease in Bangladesh. In: PB
Spradbrow (ed.). Proceedings of International Workshop on Newcastle Disease in
Village Chickens Control with Thermostable Oral Vaccine, (ACIAR Canberra,
Australia), 39: 161-162.
Ballagi-Pordany A, E Wehmann, J Herczeg, S Belak and B Lomniczi, 1996. Identification
and grouping of Newcastle disease virus strains by restriction site analysis of a region
from the F gene. Arch Virol, 141: 243-261.
Ballouh A, EM Abu-Elzein and AK Elmubarak, 1985. Outbreak of the pigeon
paramyxovirus serotype 1 in the Sudan. Vet Rec, 116: 375-380.
Bawala DG, FO Fasina, A Van and NM Duncan, 2011. Effects of Vaccination with
Lentogenic Vaccine and Challenge with Virulent Newcastle Disease Virus (NDV) on
Egg Production in Commercial and SPF Chickens. Inte J Poul Sci, 10: 98-105.
Bell JC and S Mouloudi, 1988. A reservoir of virulent Newcastle disease virus in village
chicken flocks. Prev Vet Med, 6:37-42.
Bell JG, 2001. A comparison of the different vaccine available for the control of Newcastle
disease in village chickens. In: Alders RG, PB Spradbrow, (eds.): SADC Planning
Workshop on Newcastle disease control in village chickens. Proce Int Workshop,
Maputo, Mozambique, 6-9 March, 2000. ACIAR Proceedings, No. 103: 56-60.
Bell JG, M Kane and CL Jan, 1990a. An investigation of the disease status of village
poultry in Mauritania. Preve Vet Med, 8: 291-294.
Bell JG, TM Fotzo, A Amara and G Agbede, 1995. A field trial of the heat resistant V4
vaccine against Newcastle disease by eye-drop inoculation in village poultry in
Cameroon. Prev Vet Med, 25: 19-25.
Bensink Z and PB Spradbrow, 1999. Newcastle disease virus strain I-2; a prospective
thermostable vaccine for use in developing countries. Vet Microb, 68: 131-139.
Bian H, P Fournier, R Moormann, B Peeters and V Schirrmacher, 2005. Selective gene
transfer in vitro to tumor cells via recombinant Newcastle disease virus. Cancer Gene
Ther, 12: 295-303.
103
Bouloy M and R Flick, 2009. Reverse genetics technology for Rift Valley Fever virus:
current and future applications for the development of therapeutics and vaccines. Anti
Res, 84: 101-118.
Brown C, DJ King and BS Seal, 1999. Pathogenesis of Newcastle disease in chickens
experimentally infected with viruses of different virulence. Vet Pathol, 36: 125-132.
Burleson FG, TM Chambers and DL Wiedbrauk, 1992. Virology: A laboratory manual,
Academic press, London, Pp 68-130. ISBN: 0-12-144730-8.
Cann AJ and W Irving, 1999. Virus isolation. In A J Cann, Virus Culture: A Practical
Approach New York: Oxford University Press. pp. 33-60.
Cattoli G, D Battisti, C Marciano, S Ormelli, S Monne, I Terregino and I Capua, 2009.
False-negative results of a validated real-time PCR protocol for diagnosis of Newcastle
disease due to genetic variability of the matrix gene. J Clin Microbiol, 47: 3791-3792.
Cattoli G, L Susta, C Terregino and C Brown, 2011. Newcastle disease: a review of field
recognition and current methods of laboratory detection. J Vet Diagn Invest, 23: 637-
656.
Chambers P and ACR Samson, 1982. Non-structural proteins in Newcastle disease virus-
infected cells. J Gen Virol, 58: 1-12.
Chambers P, NS Millar and PT Emmerson, 1986. Nucleotide sequence of the gene
encoding the fusion glycoprotein of Newcastle disease vims. J Gen Virol, 67: 2685-
2694.
Chang A and RE Dutch, 2012. Paramyxovirus fusion and entry: multiple paths to a
common end. Viruses, 4: 613-636.
Chen H, J Zhang, D Sun, D Zhang, X Cai, XL Liu, Y Ding, ML Yang, L Jin and Y Liu,
2008. Rapid discrimination of H5 and H9 subtypes of avian influenza viruses and
Newcastle disease virus by multiplex RT-PCR. Vet Res Commun, 32: 491-498.
Collins MS, JB Bashiruddin and DJ Alexander, 1993. Deduced amino acid sequences at
the fusion protein cleavage site of Newcastle disease viruses showing variation in
antigenicity and pathogenicity. Arch Virol, 128: 363-370.
Collins MS, S Franklin, I Strong, G Meulemans and DJ Alexander, 1998. Antigenic and
phylogenetic studies on a variant Newcastle disease virus using anti-fusion protein
104
monoclonal antibodies and partial sequencing of the fusion protein gene. Avian Pathol,
27: 90-96.
Collins PL, GW Wertz, LA Ball and LE Hightower, 1982. Coding assignments of the five
smaller mRNAs of Newcastle disease virus. J Virol, 43: 1024-1031.
Czegledi A, D Ujvári, E Somogyi, E Wehmann, O Werner and B Lomniczi, 2006. Third
genome size category of avian paramyxovirus serotype 1 (Newcastle disease virus) and
evolutionary implications. Virus Res, 120: 36-48.
De Leeuw OS, G Koch, L Hartog, N, Ravenshorst and BP Peeters, 2005. Virulence of
Newcastle disease virus is determined by the cleavage site of the fusion protein and by
both the stem region and globular head of the haemagglutinin-neuraminidase protein.
J Gen Virol, 86: 1759-1769.
De Leeuw OS, L Hartog, G Koch and BP Peeters, 2003. Effect of fusion protein cleavage
site mutations on virulence of Newcastle disease virus: non-virulent cleavage site
mutants revert to virulence after one passage in chicken brain. J Gen Virol, 84: 475-
484.
DiNapoli JM, L Yang, A Suguitan, 2007. Immunization of primates with a Newcastle
disease virus-vectored vaccine via the respiratory tract induces a high titer of serum
neutralizing antibodies against highly pathogenic avian influenza virus. J Virol, 81:
11560-11568.
Docherty DE and M Friend, 1999. Newcastle Disease. In: M Friend, JC Franson, (Eds.),
Field Manual of Wildlife Diseases: General Field Procedures and Diseases of Birds.
USGS, Biological Researches Division Information and Technology Report 1999- 001,
pp. 175-179.
Dodds WJ, 1999. More bumps on the vaccine road. Adv Vet Med, 41:715-732.
Dortmans JC, G Koch, PJ Rottier and BP Peeters, 2009. Virulence of pigeon
paramyxovirus type 1 does not always correlate with the cleavability of its fusion
protein. J Gen Virol, 90: 2746-2750.
Dortmans JCFM, G Koch, JM Peter and BPH Peeters, 2011. Virulence of Newcastle
disease virus: what is known so far. Vet Res, 42: 122-128.
Doyle TM 1927. A hitherto unrecorded disease of fowls due to a filter-passing virus. J
Comp Path, 40: 144-169.
105
Echeonwu BC, MB Ngele, GON Echeonwu, TM Joannis, EM Onovoh and G Paul, 2008.
Response of chickens to oral vaccination with Newcastle disease virus vaccine strain
I-2 coated on maize offal. African J Biotech, 7: 1594-1599.
Echeonwu G, GC Iroegbu, A Ngene, SA Junaid, J Ndako, IE Echeonwu, and JOA Okoye,
JOA. 2008b. Survival of Newcastle disease virus (NDV) strain V4-UPM coated on
three grains offal and exposed to room temperature. Afri J Biotech, 15: 2688-2692.
Edwards JT, 1928. Annual Report Imp. Inst Vet Res, 12: 14-15.
F Talazade and M Mayahi, 2013. Aquatic Birds Surveillance for Newcastle Disease Virus
(NDV) in Khozestan Province. Int J Enterpathog, 01: 5-7.
Fadol MA, 1991. Newcastle disease in Sudan. Type of the virus and its control. In: MM
Rweyemamu, V Palya, T Win and D Sylla (eds.). Proceedings of a Conference on
Newcastle Disease in Rural Africa (Pan Afr Vet Vacc Cent, Debre Zeit, Ethiopia), 61-
64.
FAO, 1997. Guidelines for the inclusion of improved household poultry production.
Diversification component of the Special Programmed for Food Security.
FAO, 2002. Laboratory Manual for the Small-Scale Production and Testing of I-2
Newcastle Disease Vaccine RAP publication (2002/22); ISBN 974-7946-26-2.
Felsenstein J, 1985. Confidence limits on phylogenies: An approach using the bootstrap.
Evolution, 39: 783-791.
Flint SJ, LW Enquist, VR Racaniello and AM Skalka, 2007. Prevention and control of viral
diseases. Principles of Virology, Molecular Biology, Pathogenesis, and Control of
Animal Viruses, p. 717, ASM Press, Washington, DC, USA, 2nd edition.
Folitse R, DA Halvorson and V Sivanandan, 1998. Efficacy of combined killed-in-oil
emulsion and live Newcastle disease vaccines in chickens. Avian Dis, 42: 173-8.
Fostera HA, HR Chitukuroa, T Tuppaa, T Mwanjalab and C Kusila, 1999. Thermostable
newcastle disease vaccines in Tanzania. Vet Microb, 68: 127-130.
George MM, 1991. Epidemiology of Newcastle disease in rural Uganda a review. Avian
Path, 23: 405-423.
Glickman RL, RJ Syddall, RM Iorio, JP Sheehan and MA Bratt, 1988. Quantitative basic
residue requirements in the cleavage-activation site of the fusion glycoprotein as a
determinant of virulence for Newcastle disease virus. J Virol, 62: 354-356.
106
Gotoh B, Y Ohnishi, NM Inocencio, E Esaki, K Nakayama, PJ Barr, G Thomas, and Y
Nagai, 1992. Mammalian subtilisinrelated proteinases in cleavage activation of the
paramyxovirus fusion glycoprotein. J Virol, 66: 6391-6397.
Gould AR, E Hansson, K Selleck, JA Kattenbelt, M Mackenzie and AJD Ports, 2003.
Newcastle disease virus fusion and haemagglutinin–neuraminidase gene motifs as
markers for viral lineage. Avian Path, 32: 361-373
Hamaguchi M, K Nishikawa, T Toyoda, T Yoshida, G Hanaichi and Y Nagai, 1985.
Transcriptive complex of Newcastle disease virus: structural and functional assembly
associated with the cytoskeletal framework. Virology, 147: 295-308.
Heath BC, MJ Lindsay and MKP Websters, 1992. Newcastle disease virus for village
chickens. Information Dossier. Arthur Webster, Castle Hill, Australia.
Heckert RA, MS Collins, RJ Manvell, I Strong, JE Pearson and DJ Alexander, 1996.
Comparison of Newcastle disease viruses isolated from cormorants in Canada and the
USA in 1975, 1990 and 1992. Can J Vet Res, 60: 50-54.
Heng Z and BPH Peeters, 2004. Recombinant Newcastle disease virus as a viral vector:
effect of genomic location of foreign gene on gene expression and virus replication. J
Gen Virol, 84: 781-788.
Higgins DA and KF Shortridge, 1988. Newcastle disease in tropical and developing
countries. In: DJ Alexander, (Ed.) Newcastle Disease. Kluwer Academic Publishers,
Boston, pp. 273-302.
Hoffmann B, T Harder, E Starick, K Depner, O Werner and M Beer, 2007. Rapid and
highly sensitive pathotyping of avian influenza A H5N1 virus by using real-time
reverse transcription-PCR. J Clin Microbiol, 45: 600-603.
Horikami SM, J Curran, D Kolakofsky and SA Moyer, 1992. Complexes of Sendai virus
NP–P and P–L proteins are required for defective interfering particle genome
replication in vitro. J Virol, 66: 4901-4908.
Ibrahim AL, K Chulan and AA Mustaffa-babjee, 1981. An assessment of the Australian
V4 strain of Newcastle disease virus as a vaccine by spray, aerosol and drinking water
administration. Aust Vet J, 57: 277-280.
Ikegami T and S Makino, 2009. Rift Valley Fever vaccines. Vaccine, 4: 69-72.
107
Illango J, MG Mukiibi, PP Abila, G Musisi and A Etoori, 2008. The value of the Newcastle
disease I-2 thermostable vaccine use in the rural free-range poultry management system
in Uganda. Livest Res Rural Develop, 20: 9-13.
Illango J, WO Mukani, GM Muka, PP Abila and A Etoori, 2005. Immunogenicity of a
locally produced Newcastle Disease I-2 Thermostable vaccine in Chicken in Uganda.
Trop Anim Health Prod, 37: 25-31.
Ingrid C, G Diego, D Diel, A Cary, C Estevez, Y Qingzhong, J Patti, M Miller and CL
Afonso, 2013. Newcastle disease virus fusion and haemagglutinin-neuraminidase
proteins contribute to its macrophage host range. J Gene Virol, 94: 1189-1194.
Iroegbu CU and ES Amadi, 2004. Ecological and Serological evidence of enzootic
circulation of NDV strains among free-roaming avian species in Nsukka environment,
Nigeria. Bull Anim Prod African, 52: 13-20.
Iroegbu CU and GW Nchinda, 1999. Evaluation of cassava feed for oral delivery of ND
V4 vaccine. Bullet Anim Prod African, 47: 155-161.
Jackwood MW, 1999. Current and future recombinant viral vaccines for poultry. Adv Vet
Med, 41: 517-522.
Jayawardane GWL and PB Spradbrow, 1995b. Cell-mediated immunity in chickens
vaccinated with the V4 strain of Newcastle disease virus. Vet Microbiol, 46: 37-41.
Jayawardane GWL and PB Spradbrow, 1995b. Mucosal immunity in chickens vaccinated
with V4 strain of Newcastle disease virus. Vet Microbiol, 46: 69-77.
Kapczynski DR and DJ King, 2005. Protection of chickens against overt clinical disease
and determination of viral shedding foll. Vaccination with commercially available
Newcastle disease virus vaccines upon challenge with highly virulent virus from the
California 2002 exotic ND outbreak. Vaccine, 23: 3424-3433.
Kaleta EF and C Baldauf, 1988. Newcastle in free living and Pet birds. In Newcastle
Disease (Ed. Alexander DJ) Kluwas Academic Publishers. Boston M. A. pp. 197-246.
Jestin V and A Jestin, 1991. Detection of Newcastle disease vims RNA in infected allantoic
fluids by in vitro enzymatic amplification (PCR). Arch Virol, 118: 151-161.
Kalthoff D, A Breithaupt, JP Teifke, A Globig, T Harder, TC Mettenleiter and M Beer,
2008. Highly Pathogenic Avian Influenza virus (H5N1) in experimentally infected
adult Mute Swans. Emerg Infect Dis, 14: 1267-1270.
108
Khan MY, M Arshad, MS Mahmood and I Hussain, 2011. Epidemiology of Newcastle
Disease in Rural Poultry in Faisalabad, Pakistan. Inter J Agricult Biol, 20: 15-18.
Khattar SK, Kho CI, MLM Azmi, SS Arshad and K Yusoff, 2000. Performance of an RT-
nested PCR ELISA for detection of Newcastle disease virus. J Virolo Meth, 86: 71-83.
Khattar SK, Kho CI, MLM Azmi, SS Arshad and K Yusoff, 2000. Performance of an RT-
nested PCR ELISA for detection of Newcastle disease virus. J Virol Meth, 86: 71-83.
Kim LM, DJ King, DL Suarez, CW Wong and CL Afonso, 2007b. Characterization of
class I Newcastle disease virus isolates from Hong Kong live bird markets and
detection using real-time reverse transcription-PCR. J Clin Microbiol, 45: 1310-1314.
Kim LM, DJ King, PE Curry, DL Suarez, DE Swayne, DE Stallknecht, RD Slemons, JC
Pedersen, DA Senne and K Winker, 2007a. Phylogenetic diversity among low
virulence Newcastle disease viruses from waterfowl and shorebirds and comparison of
genotype distributions to poultry-origin isolates. J Virol, 81: 12641-12653.
Kim SH, S Nayak, A Paldurai, B Nayak, A Samuel, GL Aplogan, KA Awoume, RJ Webby,
MF Ducatez, PL Collins and SK Samal, 2012. Complete genome sequence of a novel
Newcastle disease virus strain isolated from a chicken in West Africa. J Virol, 86:
11394-5.
Kimball JW, 1990. Introduction to Immunology 3rd edition (pp. 42-46). New York:
Macmillan Publishing Company.
Kimura M, 1980. A simple method for estimating evolutionary rate of base substitutions
through comparative studies of nucleotide sequences. J Mol Evol, 16: 111-120.
Komba EVG, O Albano, M Byuzi, CT Rutashobya and M Mulangila, 2012. Adoption of
I2 Vaccine in Immunization of Village Chickens against Newcastle Disease Virus in
Southern Tanzania: Immune Status of Farmer Vaccinated Birds. J Agricult Sci, 4: 4 -
10.
Kommers GD, DJ King, BS Seal and CC Brown, 2003. Virulence of six heterogeneous-
origin Newcastle disease virus isolates before and after sequential passages in domestic
chickens. Avian Pathol, 32: 81-93.
Kong D, Z Wen, H Su, J Ge, W Chen, X Wang, C Wu, C Yang, H Chen and Z Bu, 2012.
Newcastle disease virus-vectored Nipah encephalitis vaccines induce B and T cell
109
responses in mice and long-lasting neutralizing antibodies in pigs. Virology, 432: 327-
335.
Kouwenhoven B, 1993. Newcastle disease. In: Horzinek, MC (Ed), Viral infection of
Vertebrates series, Volume 3, JB McFerran and MS McNutly (Eds). Viral infections of
birds. Elsevier Science. Publishers Company, Amsterdam, pp. 341-360.
Kraneveld FC, 1926. A poultry disease in the Duch East Indies. Ned-Ind Bl Diergeneesk,
38: 488-450.
Kuiken T, RA Heckert, J Riva, FA Leighton and G Wobeser, 1998. Excretion of pathogenic
Newcastle disease virus by double crested cormorants (Phalacrocorax auritus) in
absence of mortality or clinical signs of disease. Avian Pathology, 27: 541-546.
Lamb RA and D Kolakofsky, 1996. Paramyxoviridae: the viruses and their replication. In
BN Fields, DM Knipe and PM Howley (Eds.), Fields virology 3rd edn, Vol. 1 (pp.
1177-1203). Philadelphia, PA: Lippincott-Raven.
Lamb RA and GD Parks, 2007. Paramyxoviridae: the viruses and their replication, p. 1449-
1496. In DM Knipe, PM Howley, DE Griffin, RA Lamb, MA Martin, B Roizman and
SE Straus (ed.), Fields Virology, 5th ed. Lippincott Williams and Wilkins,
Philadelphia, PA.
Lamb RA D Kolakofsky, 2001. Paramyxoviridae: the viruses and their replication. In: DM
Knipe and PM Howley (editors) Field’s Virology, 4th edn. Lippincott & Wilkins,
Philadelphia, USA, pp: 1305-1340.
Lewis B, 2005. Newcastle disease virus. Version: 1.5 of May 9th, 2005. Available at:
http://www.pathport.vbi.vt.edu/pathinfo/pathogens/NCDV-2 html# Website 1.
Li X, Y Qiu, A Yu, T Chai, X Zhang, JLD Wangb, H Wang, Z Wang and C Song, 2009.
Degenerate primers based RT-PCR for rapid detection and differentiation of airborne
chicken Newcastle disease virus in chicken houses. J Virol Method, 158: 1-5.
Liu XF, HQ Wan, XX Ni, YT Wu and WB Liu, 2003. Pathotypical and genotypical
characterization of strains of Newcastle disease virus isolated from outbreaks in
chicken and goose flocks in some regions of China during 1985-2001. Arch Virol. 148:
1387-1403.
110
Locke DP, HS Sellers, JM Crawford, SS Cherry, DJ King, RJ Meinersmann and BS Seal,
2000. Newcastle disease virus phosphor-protein gene analysis and transcriptional
editing in avian cells. Virus Res, 69: 55-68.
Lomniczi B, E Wehmann, J Herczeg, A Ballagi-Pordany, EF Kaleta, O Werner, G
Meulemans, PH Jorgensen, AP Mante, AL Gielkens, I Capua, and J Damoser, 1998.
Newcastle disease outbreaks in recent years in Western Europe were caused by an old
(VI) and a novel genotype (VII). Arch Virol, 143: 49-64.
Long LE, R Brasseur, C Wemers, G Meulemans and A Burny, 1988. Fusion (F) protein
gene of Newcastle disease virus: sequence and hydrophobicity comparative analysis
between virulent and avirulent strains. Virus Genes, 1: 333-350.
Lwin KZ, 1992. Newcastle disease in Myanmar. In: PB Spradbrow (ed.). Proceedings of
International Workshop on Newcastle Disease in Village Chickens Control with
Thermostable Oral Vaccine, (ACIAR Canberra, Australia), 39: 167-168.
Madhan C, DS Mohan and K Kumanan, 2005. Molecular changes of the fusion protein
Gene of chicken embryo fibroblast adapted velogenic Newcastle disease virus: Effect
on its pathogenicity. Avian Dis, 49: 56-62.
Makoui MH, A Feizi and M Khakpour, 2013. Comparative Efficacy of Newcastle
Disease’s Live Vaccines (Biovac, Clone and Lasota) in Broilers Using
Hemagglutination Inhibition (HI) Test. Middle-East J Sci Res, 13: 472-476.
Martin PAJ, 1992. The epidemiology of Newcastle disease in village chickens. In: PB
Spradbrow (ed.), Proceedings of International Workshop on Newcastle Disease in
Village Chickens Control with Thermostable Oral Vaccine, (ACIAR Canberra,
Austraha), 39: 40-45.
Mayo MA, 2002. A summary of taxonomic changes recently approved by ICTV. Archiv
Virol, 147: 1655-1663.
McGinnes LW and TG Morrison, 1994. Modulation of the activities of HN protein of
Newcastle disease virus by nonconserved cysteine residues. Virus Res, 34:305-16.
Mebatsion T, S Verstegen, LT de Vaan, AR Oberdorfer and CC Schrier, 2001. A
recombinant Newcastle disease virus with low-level V protein expression is
immunogenic and lacks pathogenicity for chicken embryos. J Virol, 75: 420-428.
111
Meteyer CU, DE Docherty, LC Glaser, JC Franson, DA Senne and R Duncan 1997.
Diagnostic findings in the 1992 epornitic of neurotropic velogenic Newcastle disease
in double-crested cormorants from the upper Midwestern United States. Avian Dis, 41:
171-180.
Mgomezulu RA and RG Alders, 2005. Trials with a thermotolerant I-2 Newcastle disease
vaccine in confined Australorp chickens and scavenger village chickens in Malawi,
ACIAR, Aus AID Southern Africa Newcastle Disease control project, pp 84-95.
Mgomezulu RA, RG Alders, PB Chikungwa, MP Young, WG Lipital and GW Wandal,
2009. Trials with a thermotolerant 1-2 Newcastle disease vaccine in confined
Australorp chickens and scavenging village chickens in Malawi.
Miller PJ, EL Decanini and CL Afonso, 2010b. Newcastle disease: Evolution of genotypes
and the related diagnostic challenges. Infect Genet Evol, 10: 26-35.
Mishra U, 1992. Present status of poultry in Nepal. In PB Spradbrow (Ed.): Newcastle
disease in village chickens, control with thermostable oral vaccines. Proceeding No. 39
(pp: 163-166). Canberra: Australian Centre for International Agricultural Research
(ACIAR).
Mishra U, 1992. Present status of poultry in Nepal. In: PB Spradbrow (ed.), Proceedings
of International Workshop on Newcastle Disease in Village Chickens, Control with
Thermostable Oral Vaccine, (ACIAR Canberra, Australia), 39: 163-166.
Mixson MA and JE Pearson, 1992. Velogenic neurotropic Newcastle disease (VNND) in
cormorants and commercial turkeys, FY 1992. Proceedings of the 96th Annual Meeting
of the United States Animal Health Association (pp 357-360). Louisville, Kentucky.
Mohamed MH, S Kumar, A Paldurai, MM Megahed, IA Ghanem, MA Lebdah and SK
Samal, 2012. Complete genome sequence of a virulent Newcastle disease virus isolated
from an outbreak in chickens in Egypt. Virus Genet, 39: 234-237.
Mohamed MHA, S Kumar, A Paldurai and SK Samal, 2009. Sequence analysis of fusion
protein gene of Newcastle disease virus isolated from outbreaks in Egypt during 2006.
Virol J, 8: 237-240.
Mohan CM, S Dey, K Kumanan, BM Mahohar and AM Nainar, 2007. Adaptation of a
velogenic disease virus to Vero cells: assessing the molecular changes before and after
infection. Vet Res Communic, 31: 371-383.
112
Morgan RW, J Gelb, CR Pope and PJ Sondermeijer, 1993. Efficacy in chickens of a herpes
virus of turkey’s recombinant vaccine containing the fusion gene of Newcastle disease
virus: onset of protection and effect of maternal antibodies. Avian Dis, 37: 1032-1040.
Msoffe PLM, D Bunn, AP Muhairwa, MMA Mtambo, H Mwamhehe, A Msago, MRS
Mlozi, and CJ Cardona, 2010. Implementing poultry vaccination and biosecurity at the
village level in Tanzania: a social strategy to promote health in free-range poultry
populations. Trop Anim Health Prod, 42: 253-263.
Muhammad ZS, S Zohari, T Yaqub, J Nazir, MAB Shabbir, N Mukhtar, M Shafee, M
Sajid, M Anees, M Abbas, MT Khan, AA Ali, A Ghafoor, A Ahad, AA Channa, AA
Anjum, N Hussain, A Ahmad, MU Goraya, Z Iqbal, SA Khan, HB Aslam, K Zehra,
MU Sohail, W Yaqub, N Ahmad, M Berg and M Munir, 2013. Genetic diversity of
Newcastle disease virus in Pakistan: a countrywide perspective. Virol J, 26: 10:170.
Musa U, PA Abdu, UM Mera, PE Emmenna and MS Ahmed, 2010. Vaccination with
Newcastle Disease Vaccines Strain I-2 and LaSota in Commercial and Local Chickens
In Plateau State Nigeria. Nigerian Vet J, 31: 46-55.
Nagai Y, HD Klenk and R Rott, 1976. Proteolytic cleavage of the viral glycoproteins and
its significance for the virulence of Newcastle disease virus. Virology, 72: 494-508.
Nagai Y, HD Klenk and R Rott, 1976. Proteolytic cleavage of the viral glycoproteins and
its significance for the virulence of Newcastle disease virus. Virology 72: 494-508.
Nasser M, JE Lohr, GY Mebratu, KH Zessin, MP Baumann Z Ademe, 2000. Oral
Newcastle disease vaccination trials in Ethiopia. Avian Pathol, 29: 27-34.
Nawanta JA, PA Abdu and WS Ezema, 2008. Epidemiology, challenges and prospects for
control of Newcastle disease in village poultry in Nigeria. World Poult Sci J, 64: 119-
127.
Nega M, F Moges, H Mazengia, G Zeleke and T Tamir, 2011. Evaluation of I-2
Thermostable Newcastle Disease Vaccine on Local Chickens in Selected Districts Of
Western Amhara. J Anim Feed Res, 3: 244-248.
Nguyen TD, 1992. Poultry production and Newcastle disease in Vietnam. In: PB
Spradbrow (ed.), Proceedings of International Workshop on Newcastle Disease in
Village Chickens Control with Thermostable Oral Vaccine, (ACIAR Canberra,
AustraHa), 39: 169-170.
113
Nishizawa M, AC Paulillo, LSO Nakaghi, AD Nunes, JM Campioni and JL Doretto, 2007.
Newcastle disease in white Pekin ducks: response to experimental vaccination and
challenge. Rev Bras Cienc Avic, 9: 15-20.
Nssien MAS and DDF Adene, 2002. Thermostability of Reconstituted Newcastle Disease
Virus Strains At 36oC Temperature. Afric J Biomed Res, 5: 87-89.
Numan M, MA Zahoor, HA Khan and M Siddique, 2005. Serological status of Newcastle
disease in broilers and layers in Faisalabad and surrounding districts. Pak Vet J, 25: 55-
58.
Ogasawara T, B Gotoh, H Suzuki, J Asaka, K Shimokata, R Rott and Y Nagai, 1992.
Expression of factor X and its significance for the determination of paramyxovirus
tropism in the chick embryo. EMBO J, 11: 467-72.
OIE, 1996. Newcastle disease. In: OIE Manual of Standards for Diagnostic Tests and
Vaccines, Paris. pp. 161-169.
OIE, 2000. Newcastle Disease. In: Manual of Standard for Diagnostic Tests and
Vaccines.5th edition, Paris, Pp. 104-124.
OIE, 2000. Office International des Epizooties/World Organization for animal Health,
“Newcastle disease,” in Manual of Standards for Diagnostic Tests and Vaccines.
OIE, 2009. Manual of diagnostic tests and vaccines for terrestrial animals: mammals, birds
and bees. In: Biological Standards Commission, World Organization for Animal
Health, Paris, pp. 576-589.
OIE, 2012. Newcastle disease. Manual of standard for diagnostic tests and vaccines. Off
Int des Epiz, Paris. pp. 221 -232.
Olabode AO, A James, M Ndako, G Echeonwu1, OO Nwankiti and AA Chukwuedo, 2010.
Use of cracked maize as a carrier for NDV4 vaccine in experimental vaccination of
chickens. Virol J, 7: 67-70.
Olabode AO, AG Lamorde, NN Shidali and AA Chikwuedo, 1991. Village chickens and
Newcastle disease in Nigeria. Australian Centre for Inter Agricult Res Proce, no. 39.
pp. 159-160.
Olabode AO, NN Shidali and AG Larmorde, 1991. Epidemiology of Newcastle disease in
Nigeria. In: MM Rweyemamu, V Palya, T Win, D Sylia, Eds. Newcastle Disease
114
Vaccines for Rural Africa. Proceedings of a Workshop held at Pan African Veterinary
Vaccine Centre (PANVAC) Debre Zeit, Addis Ababa, Ethiopia, 22-26, pp. 53-59.
Palya V, I Kiss, KT Tatar, T, Mato, B, Felfoldi and Y Gardin, 2012. Advancement in
vaccination against Newcastle disease: recombinant HVT NDV provides high clinical
protection and reduces challenge virus shedding with the absence of vaccine reactions.
Avian Dis, 56: 282-7.
Panda A, Z Huang, S Elankumaran, DD Rockemann and SK Samal, 2004. Role of fusion
protein cleavage site in the virulence of Newcastle disease virus. Microb Pathog, 36:
1-10.
Peeters BP, OS de Leeuw, G Koch and AL Gielkens, 1999. Rescue of Newcastle disease
virus from cloned cDNA: evidence that cleavability of the fusion protein is a major
determinant for virulence. J Virol, 73: 5001-5009.
Phan TG, N Phung, A Boros, P Pankovics, G Reuter, T Olive, TW Li, C Wang, X Deng,
LLM Poon and E Delwart, 2013. The Viruses of Wild Pigeon Droppings. PLoS One 8:
87-93.
Ragavan VSK, K Kumaran and K Nachimuthu, 1998. Use of MDBK cells in characterizing
Newcastle disease virus isolates in desi chickens. Ind Vet J, 75: 1079-1082.
Rahmani MD, 2004. Efficiency of V4 HR Newcastle disease (V4HR-ND) vaccine in
Broiler Birds in Bangladesh. J Poult Sci, 5: 365-368.
Ravindra PV, AK Tiwari and B Ratta, 2008. Induction of apoptosis in Vero cells by
Newcastle disease virus requires viral replication, de-novo protein synthesis and
caspase activation. Virus Res, 133: 285-290.
Reddy GS and VA Srinivasan, 1997. Evaluation of BHK21 cell line adapted Newcastie
disease vaccine. Ind J Anim Sci, 67: 357-358.
Reed LJ, H Muench, 1932. A simple method for estimating 50% endpoints. Am J Hygiene,
27: 493-497.
Rehmani SF and PB Spradbrow, 1995. Receptors for the V4 strain of Newcastle disease
virus in the digestive tract of chickens. Vet Microb, 46: 43-46.
Romer-Oberdorfer A, J Veits, O Werner and TC Mettenleiter, 2006. Enhancement of
pathogenicity of Newcastle disease virus by alteration of specific amino acid residues
in the surface glycoproteins F and HN. Avian Dis, 50: 259-263.
115
Rott R and HD Klenk, 1988. Molecular basis of infectivity and pathogenicity of Newcastle
disease virus, p. 98-112. In DJ Alexander (ed.), Newcastle disease. Kluwer Academic
Publishers, Boston.
Rout SN and SK Samal, 2008. The Large Polymerase Protein Is Associated with the
Virulence of Newcastle Disease Virus. J Virol, 82: 7828-7836.
Sa’idu L, 2006. Factors affecting the effectiveness of the control programme against
Newcastle disease in Zaria, Nigeria. PhD Dissertation, Faculty Vet Medic, Ahmadu
Bello Uni, Zaria, pp. 1-151.
Sadiq M, 2004. Pakistan poultry sector still on an upward swing. World Poultry, 20: 10-
11.
Saidu L, PA Abdu, LB Tekdek, JU Umoh, M Usman and SB Oladele, 2006. Newcastle
disease in Nigeria. Nige Vet J, 2: 23-32.
Saif YM, AM Fadly, JR Glisson and LR McDougald, 2008. Newcastle disease, other avian
paramyxoviruses, and pneumovirus infections,” in Diseases of Poultry, pp. 75 -93,
Blackwell Publishing Professional, Ames, Iowa, USA.
Saifuddin M, AJS Sarker, MM Amin and MA Rahman, 1990. Studies on the efficacy of
Newcastle disease vaccines and their vaccination schedule. Bangl Vet J, 20: 67-75.
Saitou, N and M Nei. 1987. The neighbor-joining method: A new method for
reconstructing phylogenetic trees. Mol Biol Evol, 4: 406-425.
Sakaguchi T, T Toyoda, B Gotoh, NM Inocencio, K Kuma, T Miyata and Y Nagai, 1989.
Newcastle disease vims evolution. I. Multiple lineages defined by sequence variability
of the haemagglutinin-neuraminidase gene. Virology, 169: 260-272.
Salih O, AR Omar, AM Ali and K Yusoff, 2000. Nucleotide sequence analysis of the F
protein gene of a Malaysian velogenic NDV strain AF2240. J Mol Biol Biochem Bioph,
4: 51- 57.
Schloer G, J Spalatin and RP Hanson, 1975. Newcastle disease virus antigens and strain
variations. Am J Vet Res, 36: 505-508.
Seal BS, DJ King and HS Sellers, 200. The avian response to Newcastle disease virus.
Develop Comp Immunol, 24: 257-268.
Seal BS, MG Wise and JC Pedersen, 2005. Genomic sequences of low-virulence avian
paramyxovirus-1 (Newcastle disease virus) isolates obtained from live-bird markets in
116
North America not related to commonly utilized commercial vaccine strains. Vet
Microb, 106: 7-16.
Sharma SN and SC Adlakha, 1995a. Viral replication and infection cycle in: Textbook of
Veterinary virology. Vikas publishing house, PVT, Ltd, New Dehli. Part 1, chapter 3,
pp 34-45.
Simmons GC, 1967. Isolation of Newcastle disease virus in Queensland. Aust workshop
train, 43: 29-30.
Souza MC, MS Freirea, EA Schulze, LP Gaspar and LR Castilho, 2009. Production of
yellow fever virus in microcarrier-based Vero cell cultures. Vaccine, 27: 6420-6423.
Spradbrow PB, 1992. A review of the use of food carriers for the delivery of oral Newcastle
disease vaccine. In: PB Spradbrow, (ed.) Newcastle Disease in Village Chickens
Control with Thermostable Oral Vaccine. Aust Cent Int Agricul Res, No. 39. pp. 18-
20.
Spradbrow PB, 1992. A review of the use of food carriers for the delivery of oral Newcastle
disease vaccine. In: PB Spradbrow, (ed.): Newcastle Disease in village.
Spradbrow PB, 1993/94. Newcastle disease in rural chickens. Poul Sci Rev, 5: 57-96.
Spradbrow PB, 1996c. Production of thermostable Newcastle disease vaccine in
developing countries. Prev Vet Med, 29: 157-159.
Spradbrow PB, M Mackenzie and SE Grimes, 1995. Recent isolates of Newcastle disease
virus in Australia. Vet Microbiol, 46: 21-28.
Spradbrow PB, Z Bensink and S Grimes, 1998. Small Scale Production and Testing of
Newcastle Disease Vaccine. Laboratory Manual. Brisbane, Australia. University of
Queensland, pp. 31-37.
Spradbrow, PB, 1992a. Newcastle disease in village chickens. Control with thermostable
oral vaccine. Proce Inte Workshop Kuala-Lumpur, Malaysia.
Steward M, IB Vipond, NS Millar and PT Emmerson, 1993. RNA editing in Newcastle
disease vims. J Gen Virol, 74: 2539 - 2547.
Susta L, PJ Miller, CL Afonso and CC Brown, 2010. Clinicopathological Characterization
in Poultry of Three Strains of Newcastle Disease Virus Isolated From Recent
Outbreaks. J Vet Pathol, 48: 349-360.
117
Tan SW, A Ideris, AR Omar, K Yusoff and M Hair-Bejo, 2009. Detection and
differentiation of velogenic and lentogenic Newcastle disease viruses using SYBR
Green I real-time PCR with nucleocapsid gene-specific primers. J Virol Method, 160:
149-156.
Tan WS, CH Lau, BK Ng, AL Ibrahim, and K Yusoff, 1995. Nucleotide sequence of the
haemagglutinin-neuraminidase (HN) gene of a Malaysian heat resistant viscerotropic-
velogenic Newcastle disease virus. DNA Sequence, 6: 47-50.
Tamura K, D Peterson, N Peterson, G Stecher, M Nei and S Kumar. 2011. MEGA5:
Molecular evolutionary genetics analysis using maximum likelihood, evolutionary
distance, and maximum parsimony methods. Mol Biol Evol, 28: 2731-2739.
Toyoda T, T Sakaguchi, H Hirota, B Gotoh, K Kuma, T Miyata and Y Nagai, 1989.
Newcastle disease virus evolution. II. Lack of gene recombination in generating
virulent and avirulent viruses. Virology, 169: 273-282.
Tu TD, KV Phuc, NTK Dihn, DN Quoc and PB Spradbrow, 1998. Vietnamese trials with
a thermostable Newcastle disease vaccine (Strain I-2) in experimental and village
chickens. Prev Vet Medic, 34: 205-214.
Ullah S, M Ashfaque, SU Rahman, M Akhtar and A Rehman, 2004. Newcastle disease
virus in the intestinal contents of broilers and layers. Pak Vet J, 24: 28-30.
Van EJH, 1987. Immunity to Newcastle disease in fowl of different breeds, primarily
vaccinated with commercial inactivated oil-emulsion vaccines: a laboratory
experiment. Vet Q, 9: 296-303.
Wakamatsu N, DJ King, BS Seal and CC Brown, 2007. Detection of Newcastle disease
virus RNA by reverse transcription polymerase chain reaction using formalin fixed,
paraffin-embedded tissue and comparison with immunohistochemistry and in situ
hybridization. J Vet Diagn Investigation, 19: 396-400.
Walker JW, BR Heron and MA Mixson, 1973. Exotic Newcastle disease eradication
program in the United States. Avian Dis, 17: 486-503.
Wambura PN, 2003. Thermostable I-2 strain of Newcastle disease virus as a rural vaccine.
PhD thesis, University of Queensland, Australia.
Wambura PN, 2006. Comparative Propagation of Newcastle disease virus (Strains I-2 and
V4) on Chicken Embryo Tracheal Explants. Vet Res Commun, 30: 673-677.
118
Wambura PN, 2009. Oral vaccination of chickens against Newcastle disease with I-2
vaccine coated on oiled rice. Trop Anim Health Prod, 41:205-208.
Wambura PN, 2011. Formulation of novel nano-encapsulated Newcastle disease vaccine
tablets for vaccination of village chickens. Trop Anim Health Prod, 43: 165-169.
Wambura PN, AM Kapaga and JMK Hyera, 2000. Experimental trials with a thermostable
Newcastle disease virus (strain I2) in commercial and village chickens in Tanzania.
Prev Vet Medic, 43: 75-83.
Wambura PN, J Meers and PB Spradbrow, 2001. Deduced amino acid sequence
surrounding the fusion glycoprotein cleavage site of the avirulent thermostable vaccine
strain I-2 of Newcastle disease virus. Third Aust Vet Virol Conf Sydney Australia.
Wambura PN, J Meers and PB Spradbrow, 2006. Determination of Organ Tropism of
Newcastle Disease Virus (Strain I-2) by Virus Isolation and Reverse Transcription–
Polymerase Chain Reaction. Vet Res Communic, 30: 697-706.
Wambura PN, J Meers and PB Spradbrow, 2007. Survival of avirulent thermostable
Newcastle disease virus (strain I-2) in raw, baked, oiled, and cooked white rice at
ambient temperatures. J Vet Sci, 8:303-305.
Wambura PN, J Meers and PB Spradbrow, 2007. Survival of avirulent thermostable
Newcastle disease virus (strain I-2) in raw, baked, oiled, and cooked white rice at
ambient temperatures. J Vet Sci, 8: 303-305.
Warner O, 1989. Newcastle disease. In: T Blaha, (Ed.), Applied Veterinary Epidemiology.
Elseveir, Amsterdam, pp. 73-76.
Westbury HA, G Parsons and WH Allan, 1984. Comparison of the residual virulence of
Newcastle disease vaccine strains V4, Hitchner B1 and LaSota. Australian Vet J, 61:
47-49.
Wobeser GA, AA Leighton, R Norman, DJ Myers, D Onderka, MJ Pybus, JL Neufeld, GA
Fox and DJ Alexander, 1993. Newcastle disease in wild water birds in western Canada,
1990. Canad Vet J, 34: 353-359.
Xiao S, A Paldurai, B Nayak, A Asamuel, EE Bharoto, TY Prajitno, PL Collins and SK
Samal 2012. Complete genome sequences of Newcastle disease virus strains
circulating in chicken populations of Indonesia. J Virol, 86: 5969-5970.
119
Yan Y, A Panda, PL Collins and SK Samal, 2009. A Y526Q mutation in the Newcastle
disease virus HN protein reduces its functional activities and attenuates virus
replication and pathogenicity. J Virol, 83: 7779-7782.
Yokoyama N, K Maeda and T Mikami, 1997. Recombinant viral vector vaccines for the
veterinary use. J Vet Med Sci, 59: 311-322.
Young M and R Alders, 2002. Controlling Newcastle Disease in village chickens:
laboratory manual. ACIAR.
Yusoff K and WS Tan, 2001. Newcastle disease virus: Macromolecules and opportunities.
Avian Pathology, 30: 439-455.
Yusoff K, WS Tan, CH Lau and AL Ibrahim, 1996. Sequence of the haemagglutinin-
neuraminidase gene of the Newcastle disease virus oral vaccine strain V4 (UPM).
Avian Path, 25: 837-844.
Zoth SC, E Gomez, E Carrillo and A Bernstein, 2008. Locally produced mucosal IgG in
chickens immunized with conventional vaccines for Newcastle disease virus. Braz J
Medic Biol Res, 41: 318-323.
Reynolds DL and AD Maraqa, 2000. Protection immunity against Newcastle disease: The
role of cell mediated immunity avian Disease, 44: 145-159.
Young DF, RE Randell, JA Lawrenson and BE Souberbielle, 1990. Clearance of a
persistent paramyxo virus infection mediated by cellular immune response but not by
serum neutralization antibody. J Virol, 64: 5403-5411.
Pawan KA and LDA Reynolds, 1991. Evaluation of the Cell-Mediated Immune Response
of Chickens Vaccinated with Newcastle Disease Virus as Determined by the Under-
Agarose Leukocyte-Migration-Inhibition Technique. Avian Dis, 35: 360-364.
Rahman MM, E Uyangaa and SK Eo, 2013. Modulation of humoral and cell-mediated
immunity against avian influenza and Newcastle disease vaccines by oral
administration of Salmonella enterica serovar typhimurium expressing chicken
interleukin-18. Immune Netw. 13: 34-41.
Lam HY, K Yusoff, SK Yeap, T Subramani, S Abd-Aziz, AR Omar, NB Alitheen, 2014.
Immunomodulatory Effects of Newcastle Disease Virus AF2240 Strain on Human
Peripheral Blood Mononuclear Cells. Int J Med Sci, 12: 1240-1247.
120
Timms L, 1974. Leukocyte migration inhibition as an indicator of cell mediated immunity
in chickens. Avian Pathol. 3: 177-187.