Post on 07-Jan-2016
description
transcript
Chapter 13From DNA to Protein
From Genes to Proteins
Your traits are determined by proteins that are Your traits are determined by proteins that are built according to instructions in DNA.built according to instructions in DNA.
These sections of DNA are your genes.These sections of DNA are your genes.
The first step in decoding the DNA instructions The first step in decoding the DNA instructions is to copy part of the DNA into RNA. is to copy part of the DNA into RNA.
13.1 RNA
Like DNA, RNA consists of a long chain of Like DNA, RNA consists of a long chain of nucleotides.nucleotides.
3 main differences between DNA and RNA:3 main differences between DNA and RNA:
The sugar in RNA is ribose, not deoxyribose.The sugar in RNA is ribose, not deoxyribose.
RNA is single – stranded, while DNA is double – RNA is single – stranded, while DNA is double – stranded stranded
RNA contains uracil instead of thymine. RNA contains uracil instead of thymine.
3 Types of RNA:
1.1. Messenger RNA (mRNA) – Messenger RNA (mRNA) – serves as serves as ““messengersmessengers”” from DNA to the rest of the from DNA to the rest of the cell.cell.
2.2. Ribosomal RNA (rRNA) – Ribosomal RNA (rRNA) – make up ribosomesmake up ribosomes
3. Transfer RNA (tRNA) – transfers
each amino acid to the
ribosome.
tRNA
A GU
Met Amino Acid
Anticodon
RNA Synthesis: Transcription
Occurs in the nucleusOccurs in the nucleus
Copying part of DNA into a complementary Copying part of DNA into a complementary sequence in RNA.sequence in RNA.
Requires an enzyme known as RNA Requires an enzyme known as RNA polymerase.polymerase.
RNA polymerase binds to DNA and separates RNA polymerase binds to DNA and separates the DNA strands. the DNA strands.
It uses one strand of DNA as a template to It uses one strand of DNA as a template to make a strand of mRNA.make a strand of mRNA.
How does RNA polymerase know where to start?
Promoters – have specific base sequences Promoters – have specific base sequences where RNA polymerase will bind to begin where RNA polymerase will bind to begin transcription.transcription.
PracticeDNA Template strand:DNA Template strand:
TACGGATCCTAACTACGGATCCTAAC
Write the corresponding mRNA sequence:Write the corresponding mRNA sequence:
In eukaryotes, many genes are In eukaryotes, many genes are interrupted by introns, which have interrupted by introns, which have no coding information.no coding information.
Exons are the portions of a gene Exons are the portions of a gene that are translated.that are translated.
After transcription the introns in the After transcription the introns in the mRNA are cut out by spliceosomes.mRNA are cut out by spliceosomes.
13.2 Ribosomes and Protein SynthesisTranslationTranslation
The sequence of bases in mRNA serve as The sequence of bases in mRNA serve as instructions for the order of amino acids to instructions for the order of amino acids to produce proteins (polypeptides). produce proteins (polypeptides).
Steps of Translation:
1.1. mRNA transcribed mRNA transcribed from DNA moves to from DNA moves to the cytoplasm.the cytoplasm.
2.2. mRNA attaches to a mRNA attaches to a ribosome.ribosome.
3.3. As mRNA As mRNA moves across moves across the ribosome the ribosome the proper the proper amino acid is amino acid is attached to the attached to the growing amino growing amino acid chain.acid chain.
This is the job This is the job of tRNAof tRNA
4.4. A peptide bond A peptide bond forms between the forms between the amino acids.amino acids.
until the ribosome until the ribosome reaches a stop reaches a stop codon codon
releases the releases the amino acid chain. amino acid chain.
The Genetic Code
RNA contains 4 bases: adenine, uracil, RNA contains 4 bases: adenine, uracil, cytosine, guaninecytosine, guanine
These 4 letters code for 20 amino acids.These 4 letters code for 20 amino acids.
The code is read 3 letters at a time.The code is read 3 letters at a time.
Each group of 3 letters is known as a codon.Each group of 3 letters is known as a codon.
Separate the following mRNA Separate the following mRNA sequence into codons:sequence into codons:
UCGCACGGUUCGCACGGU
The codon AUG can serve as a The codon AUG can serve as a ““startstart”” codon codon for protein synthesis (Methionine).for protein synthesis (Methionine).
There are also 3 There are also 3 ““stopstop”” codons which act like a codons which act like a period at the end of a sentence.period at the end of a sentence.
Table can be found on p. 367.
Practice Problems
Transcribe and translate the following DNA Transcribe and translate the following DNA sequences:sequences:
1.1. TACGGATATAAGCCGTTAATTTACGGATATAAGCCGTTAATT
mRNA:mRNA:
Protein (polypeptide):Protein (polypeptide):
2.2. TACAAATGGTTCCTTACAACTTACAAATGGTTCCTTACAACT
mRNA:mRNA:
Protein (polypeptide):Protein (polypeptide):
Mutations
Mutations in gametes can be passed on to Mutations in gametes can be passed on to offspring, but mutations in body cells affect only offspring, but mutations in body cells affect only the individual in which they occur.the individual in which they occur.
Gene MutationsGene Mutations
Point mutation – a single nucleotide Point mutation – a single nucleotide changechange
InsertionInsertion
ATCGGA ATCGGA → → ATCATCCCGGAGGA
Frameshift MutationsFrameshift MutationsDeletionDeletion
ATCGGA ATCGGA → → ATGGAATGGA
SubstitutionSubstitution
ATCGGA ATCGGA → → AACCCGGACGGA
Transcribe and translate the following DNA Transcribe and translate the following DNA sequence:sequence:
TACTATACCTGGACTTACTATACCTGGACT
mRNA:mRNA:
Protein (polypeptide):Protein (polypeptide):
Now transcribe and translate that same gene with an Now transcribe and translate that same gene with an insertion mutation:insertion mutation:
TACTATACCTGGACTACTATACCTGGACCCTT
mRNA:mRNA:
Protein (polypeptide):Protein (polypeptide):
How does this protein differ from the original?How does this protein differ from the original?