DNA & Genetics

Biology

Remember chromosomes?

• What are genes?• Made up of DNA and are units of

heredity; unique to everyone• What are traits?• Are physical and unseen characteristics.• Examples: • physical: color of skin or eyes• unseen: blood type or intelligence level

Remember chromosomes?• What are chromosomes?• Carrier of genetic

materials, thread-like fibers found in the nucleus

• They are composed of genes

• What is an allele?• Gene form for each

variation of a trait of an organism. Example: gene for height can express tall or short

DNA structure

• DNA = deoxyribonucleic acid• A nucleic acid, genetic material• Carries the code for all proteins that

make up the human body• Composed of paired nucleotides• Nucleotides contain a phosphate

group, 5-carbon sugar (deoxyribose), and a nitrogen base

DNA structure

• The 4 nitrogen bases of DNA:– Thymine (T)– Cytosine (C)– Adenine (A)– Guanine (G)

DNA structureNucleotide

structures:1 phosphate

group1 5-carbon

sugar1 nitrogen

base

DNA structure

• Structurally pyrimidines pair with purines

• Thymine (T) and Cytosine (C) are pyrimidines

• Adenine (A) and Guanine (G) are purines

• Nitrogen bases are held together by hydrogen bonds

• Guanine (G) pairs with Cytosine (C)• Adenine (A) pairs with Thymine (T)

DNA structure

• Composed of 2 complementary strands

• Complete the following DNA strand:

•TACGTACCGCAGGTAATC•ATGCATGGCGTCCATTAG

DNA

What does DNA look like?

• Double helix• 1st published in

1951• Credited to

Watson and Crick• 1st seen by

Rosalind Franklin, whose pictures were stolen from her lab

DNA Replication

• Process where DNA copies itself• DNA replicates before mitosis• DNA replicates before meiosis I• The 2 strands of a DNA molecule

separate when the hydrogen bonds break. Two complimentary strands form, each using one of the single DNA as a template

DNA Replication

http://video.google.com/videoplay?docid=5595842121339099106&q=DNA+replication&hl=en

http://video.yahoo.com/video/play?p=DNA+replication&toggle=1&cop=mss&ei=UTF-8&b=2&oid=b4115effae59a11e&rurl=www.bioteach.ubc.ca&vdone=http%3A%2F%2Fvideo.yahoo.com%2Fsearch%2Fvideo%3Fp%3DDNA%2Breplication%26toggle%3D1%26cop%3Dmss%26ei%3DUTF-8

Steps of DNA Replication

• Enzyme breaks hydrogen bonds between paired nucleotides

• DNA strand unzips• Free nucleotides move in and bond with

complementary pairs on unzipped strands of DNA

• Enzyme bonds the newly paired nucleotides together

• 2 exact copies of the original DNA strand are produced

Steps of DNA Replication

• Replicate the following DNA strand:

•TACGTACCGCAGGTAATCATGCATGGCGTCCATTAG

DNA Replication

RNA structure

• RNA is produced from a DNA strand• What is RNA?• Ribonucleic acid• Consists of 1 strand of nucleotides• RNA nucleotides have 1 phosphate

group, 1 5-carbon sugar (ribose), and 1 nitrogen base

RNA structure• The 4 nitrogen bases of RNA:

– Uracil (U)– Cytosine (C)– Adenine (A)– Guanine (G)

RNA structure

• Nitrogen bases are held together by hydrogen bonds

• Guanine (G) pairs with Cytosine (C)• Adenine (A) pairs with Uracil (U)

Compare DNA and RNA

DNA:• 2 strands• Deoxyribose sugar• Phosphate group• 4 nitrogen bases:

adeninethymineguaninecytosine

RNA:• 1 strand• Ribose sugar• Phosphate group• 4 nitrogen bases

adenineuracilguaninecytosine

Types of RNA

• Messenger RNA – mRNA: carries sequence of nucleotides that code for protein from nucleus to ribosomes

• Transfer RNA – tRNA: picks up individual amino acids in the cytoplasm & carries them to the ribosomes

• Ribosomal RNA – rRNA: found in ribosomes, helps bind mRNA and tRNA together during translation (protein synthesis)

Transcription: DNA into RNA

• Enzymes break hydrogen bonds in DNA strands

• Unzipped strand of DNA gets paired with free RNA nucleotides

• RNA nucleotides bond together• Enzymes break hydrogen bonds

between DNA and RNA strands.• RNA strand becomes mRNA and

leaves the nucleus

Transcription: DNA into RNA

mRNA• Composed of a codons• A codon is a series of “3” letters or bases

that make up the code of mRNA• Codons are the “recipe” for making all

amino acids in the body• Every strand of mRNA starts with the

codon AUG or the start codon – starts protein synthesis. There is only 1 start codon

• Every strand of mRNA ends with a terminator or “stop” codon – stops protein synthesis. There are 3 stop codons.

Translation of mRNA

• Translate the following mRNA into amino acids using the Universal codon chart

• AUGAGGGCUCGAUGA• MET-ARG-GLY-ARG-STOP

Universal codon chart

What does mRNA do?

• Brings the code for protein production and assembly to the ribosome

• At the ribosome the code in the mRNA is translated into amino acids

• mRNA codons enter the ribosome• transfer RNA or tRNA brings the

complementary base pairs or the anti-codon - to the ribosome from the cytoplasm

• A protein is produced when the mRNA codon and the tRNA anti-codon bond

Translation