Post on 25-Dec-2015
transcript
DNA REPLICATION(semi-conservative method)
MOLECULAR BIOLOGY – DNA replication, transcription
Figure 5-2 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
REPLICATION FORK
1000 nt / sec !
Meselson-Stahl experiment
The enzyme DNA polymerase uses the two parental strands as a template to faithfully synthesise new daughter strands according to the specific Watson & Crick
base-pairing system (A-T and G-C)
Figure 5-14 Molecular Biology of the Cell (© Garland Science 2008)
Unwinding and strand separation achieved by DNA helicase using
the enegy released from ATP hydrolysis
MOLECULAR BIOLOGY – DNA replication, transcription
Semi-conservative replication by DNA polymerase requires that the
two anti-parallel parental DNA strands are unwound to give a
single stranded templates
Figure 5-16 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Secondary structure in the single stranded template can hinder DNApol
Single-strand binding proteins facilitate
DNApol’s progress
Figure 5-3 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Incoming deoxyribonucleotide trisphosphates or dNTPs(i.e. dATP, dCTP, dTTP or dGTP depending on base pairing with
TEMPLATE STRAND)
Newly synthesised strand replicated in a 5’ - 3’
direction
New dNTPs are added to the free 3’OH group of preceding nucleotides in the
DNA strand by means of a condensation reaction thus forming a
new phosphodiester bond
Pyrophosphate and water are by-products
UDP deoxyUDP dTTPADP deoxyADP dATPGDP deoxyGDP dGTPCDP deoxyCDP dCTP
dTDP
ribonucleotidereductase
kinase
Methotrexateanti-cancer drug
MOLECULAR BIOLOGY – DNA replication, transcription
Folate cofactor only obtainable as a dietary supplement(extra supplements for children and pregnant women)
Synthesis of dNTP substrates required for DNA replication
Figure 5-18c Molecular Biology of the Cell (© Garland Science 2008)
DNApol III
MOLECULAR BIOLOGY – DNA replication, transcription
Chromosomal DNA synthesis catalysed by DNA polymerase
III (DNApol III)
DNApol III requires the help of ‘sliding clamp’ in order to bind
DNA and start replication
The sliding clamp however requires a complex of proteins (i.e. the
‘clamp loading complex’) plus the energy released from ATP hydrolysis
to be loaded onto the DNA
DNA synthesis can now occur in 5’ - 3’ direction although any base-
pairing mistakes can be corrected by removing the incorrect base via the ‘3’-exonuclease activity’ of the
DNApol III complex
replication direction
3’
3’
5’
5’
3’leading strand
3’5’
5’ 5’3’
lagging strand
DNA polymerase synthesizes in 5’ 3’ direction therefore the two newly synthesized daughter strands are made
differently
MOLECULAR BIOLOGY – DNA replication, transcription
Okazaki fragmentsare eventually joined (ligated) together to form a complete strand
Figure 5-11 Molecular Biology of the Cell (© Garland Science 2008)
DNA polymerase III can not simplystart synthesizing a new strand
It can only elongate from existing one (i.e. a free 3’OH group is
required)
MOLECULAR BIOLOGY – DNA replication, transcription
How does DNA synthesis get started?
A specialized RNA polymerase called ‘DNA primase’ can simply start the synthesis of a new strand using the
template DNA strand as a guide
These 11-12 nucleotide RNA primers then provide the free 3’OH required by DNApol III to replicate the rest of
the DNA
MOLECULAR BIOLOGY – DNA replication, transcription
DNApol I
What happens to the RNA primers and Okazaki fragments
on the lagging strand?
The ‘gap’ between the Okazaki DNA fragment and the RNA primer is
recognised by ‘DNA polymerase I’ that then removes the RNA primer and fills in the space with template
directed DNA
Lastly the two adjacent DNA Okazaki fragments are joined by the enzyme
‘DNA ligase’
DNApol III completes the synthesis of the DNA Okazaki fragment up until
the previous RNA primer without joining the two molecules together
Figure 5-12 Molecular Biology of the Cell (© Garland Science 2008)
Figure 5-19a Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
DNA Replication Summary
N.B. the lagging strand template is bent round so both DNApol’s proceed in the same direction!
Figure 5-19b,c Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Detailed electronmicrograph of a bacterial DNA replication fork
Figure 5-6 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Electronmicrograph of two replication forks progressing around a circular bacterial DNA genome
Figure 5-25 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Summary of bidirectional
replication forks with leading and lagging strand
synthesis
Figure 5-21 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
The action of helicase at the replication fork places great strain on the DNA double helix ahead of
it because the two ends of the helix cannot freely rotate with
respect to each other
Figure 5-22 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
An enzyme called ‘DNA topisomerase I’ relieves this strain by catalysing a break in the phosphodiester backbone of one DNA strand
allowing the two ends of the helix to rotate relative to each other
MOLECULAR BIOLOGY – DNA replication, transcription
http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter11/animation_quiz_2.html
DNA replication summary
Figure 5-26 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Relatively small bacterial genomes
are circular and are usually
replicated from a single ‘replication
origin’ that consists of
tandem repeat rich DNA
sequences N.B. bi-directional replication from a single replication
origin.
Known as OriC in E-coli.
Figure 5-34 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Large eukaryotic genomes (multiple linear chromosomes) are replicated from many different ‘origins of replication’
• Multiple origins of replication comprising many different sequence variations (approx 100 000 in human genome)
• Not all activated at the same time
• Mechanism involves the assembly of the ‘pre-replication complex (pre-RC)’ of proteins prior to their activation and initiation of DNA synthesis
During DNA replication there is aProblem with the end of the lagging strand:
... progressive shortening of chromosomal ends and genetic instability
MOLECULAR BIOLOGY – DNA replication, transcription
TTAGGGTTAGGGTTAGGGTTAGGG
(TTAGGG)20-HUNDREDS
Telomeres made of many repeatsSpecies Repeat Sequence
Arabidopsis TTTAGGG
Human TTAGGG
Oxytricha TTTTGGGG
Slime Mold TAGGG
Tetrahymena TTGGGG
Trypanosome TAGGG
Yeast (TG)1-3TG2-3
MOLECULAR BIOLOGY – DNA replication, transcription
Chromosome ends comprised of TELOMERES
Telomeres provide a kind of ‘buffer’ for the chromosomal ends that protect genes located in the ‘sub telomeric’ regions
Therefore only telomeric sequence is lost during DNA replication
HOW ARE TELOMERES MAINTAINED?
Figure 5-41 Molecular Biology of the Cell (© Garland Science 2008)
TELOMERES ARE ELONGATED BY ACTION OF TELOMERASE
MOLECULAR BIOLOGY – DNA replication, transcription
Conventional DNA synthesis is achieved by RNA priming of the elongated parental strand thus maintaining
telomere length and chromosome integrity
• ~ 150 genes control telomere length in yeast and shortening telomeres is associated with cell senescence and death
• telomerase highly active in >90% of tumors i.e. cell immortalization and uncontrolled proliferation (drug target)
• many adult cell types have detectable telomerase activity, but it is a highly regulated, fine tuned activity
MOLECULAR BIOLOGY – DNA replication, transcription
Correlation between levels of perceived stress and telomere length and action of telomerase
MOLECULAR BIOLOGY – DNA replication, transcription
RELAX AND KEEP YOUR TELOMERES LONG!
MOLECULAR BIOLOGY – DNA replication, transcription
Telomere and Telomerase video/ tutorial
http://www.youtube.com/watch?v=AJNoTmWsE0s
AUG UAA
double stranded DNA
TRANSLATIONprotein coding sequence
or open reading frame
Functional Protein
MAPSSRGG…..
MOLECULAR BIOLOGY – DNA structure, genetic code
TRANSCRIPTION
ATG GCT CCT TCT TCC AGA GGT GGC . . . . . . TAATAC CGA GGA AGA AGG TCT CCA CCG . . . . . . ATT
5’5’3’
3’
single stranded mRNA AUG GCU CCU UCU UCC AGA GGU GGC . . . . . . UAA
TRANSCRIPTION
Focus on how the genetic information contained within DNA is copied into
RNA and it’s consequences
Figure 6-21 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Eukaryotic mRNAs are not synthesised in a form that can be immediately
translated to protein
i.e. there are processing and translocation steps
RNA processing
translocation
Figure 6-22a Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Polycistronic mRNA(e.g related gene operons)
Monocistronic mRNA
Table 6-1 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
TRANSCRIPTION INITIATION
MOLECULAR BIOLOGY – DNA replication, transcription
How does the RNA polymerase recognise the the correct place within DNA to start transcribing mRNA for a gene?
Doubel stranded DNA
RNA polymerse complexSingle stranded mRNA
Figure 6-11 (part 1 of 7) Molecular Biology of the Cell (© Garland Science 2008)
TRANSCRIPTION START IN PROKARYOTES
MOLECULAR BIOLOGY – DNA replication, transcription
Molecular interaction with the ‘sigma () factor’ permits RNA polymerase (designated ‘holoenzyme’) to bind DNA at specific regions called
‘promoters’
The core ‘RNA polymerase complex’ (consisting of & ’catalytic and 2x regulatory subunits) alone is unable to recognise and bind
DNA
Figure 6-12a Molecular Biology of the Cell (© Garland Science 2008)
GENEPROMOTER
MOLECULAR BIOLOGY – DNA replication, transcription
+1
1st ribonucleotide to be incorporated into
mRNA
The sigma factor recognises ‘consensus’ sequences in the promoter DNA
There are x2 consensus sequences at the -35 and -10
positions of the DNA
-35 -10
Variations in the -35 & -10 DNA sequences of different gene promoters affect how often mRNA synthesis can be initiated. Additionally bacteria have multiple sigma factors each with subtle
differences in binding affinity for -35 & -10 sequence variants.
The sigma factor recognises -35 & -10 and positions the
RNA polymerase in the correct position to start
synthesis of mRNA starting from the +1 position
-35
-10 +1
MOLECULAR BIOLOGY – DNA replication, transcription
After initiation, sigma factor disassociates and synthesis of the new mRNA molecule occurs in a 5’ - 3’ direction i.e.
‘elongation phase’
The mRNA sequence is specified by base-pair complementarities with the ‘template/ non-coding/ antisense’ DNA strand and therefore is a copy/
‘transcript’ of the ‘non-template/ coding/ sense’ strand wit U replacing T
5’
3’
5’
The repeats are copied into the transcribed mRNA and form a ‘hairpin
loop’ that is sensed by the RNA polymerase causing it to pause/ stutter.
Weak hydrogen bonding between the run of A nucleotides in the DNA template strand and the U ribonucleotides of the mRNA cause the disassociation of the whole RNA polymerase complex i.e.
‘intrinsic termination’
In other cases the binding of special helicases called ‘Rho ()proteins’
facilitate the disassociation i.e. ‘rho-dependent termination’
Just as promoter sequences in DNA instruct where transcription should begin, other DNA sequences called ‘terminators’ specify where it should stop.
MOLECULAR BIOLOGY – DNA replication, transcription
How does RNA polymerase know when to stop?
‘terminators’ sequences are inverted DNA repeats followed
by a run of A nucleotides
MOLECULAR BIOLOGY – DNA replication, transcription
Prokaryotic transcription cycle video/ tutorial
http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter12/animation_quiz_1.html
Table 6-2 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
TRANSCRIPTION IN EUKARYOTES
Additionally transcription occurs in the nucleus and not in the cytoplasm
i.e. PROTEIN CODING GENE TRANSCRIPTION
Table 6-3 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Recognition of the promoter and the initiation of transcription in eukaryotes is more complex
In addition to RNA polymerase a host of other proteins known as the ‘General Transcription Factors (GTFs)’ are required
GTF’s help RNA polymerase recognise a T/A rich DNA sequence motif in the promoter called the ‘TATA box’, correctly position it on the ‘chromatin template’ with respect to
the +1 position and convert it to form capable of RNA synthesis
i.e. help form a ‘pre-initiation complex’
MOLECULAR BIOLOGY – DNA replication, transcription
Binding of ‘specific transcription factors’ positively or negatively affect frequency of transcription initiation
• specific transcription factors bind particular DNA sequences only found in the locality of certain genes
• therefore can help regulate which genes mRNAs are synthesised within a cell (e.g. confine the production of antibodies in white blood cells but not in neurones!)
e.g. ‘short-range upstream regulator elements’
e.g. ‘long range enhancer sequences’
Pre-initiation complex of RNA polymerase II and GTFs at TATA box
Specific transcription factor binding
Figure 6-19 Molecular Biology of the Cell (© Garland Science 2008)
CORE PROMOTER
MOLECULAR BIOLOGY – DNA replication, transcription
MOLECULAR BIOLOGY – DNA replication, transcription
Initiation of eukaryotic transcription video/ tutorial
http://bcs.whfreeman.com/thelifewire/content/chp14/1402002.html
RNA PROCESSING in EukaryotesMOLECULAR BIOLOGY – DNA replication, transcription
Eukaryotic genes typically consist of segments of protein coding DNA sequence called ‘exons’ that are interspersed with non-protein coding sequences called ‘introns’ (that are often very long).
Unlike prokaryotes, the DNA sequence encoding eukaryotic protein is not often organised in one continuous length that
when transcribed is a fully functional mRNA that can be translated into protein. The mRNA first needs to be
‘processed’
• both the exons and introns are transcribed by RNA polymerase II to yield long RNA molecules called ‘Pre-mRNAs’
Pre-mRNA• Pre-mRNAs are modified (co-transcriptionally) by addition of a 5’-cap and 3’ polyadenylation motifs (important for stability and translation).
CAP AAA(n)
• the sequence corresponding to the introns is removed from the pre-mRNA in a process called ‘SPLICING’ to yield a ‘mature mRNA’
SPLICING
Mature mRNA CAP AAA(n)
• the ‘spliced’ together protein coding mRNA sequence corresponding to the exons in the DNA can now be translated into function protein (except for ‘untranslated regions/ UTRs’ at the 5’ & 3’ ends
Figure 6-22b Molecular Biology of the Cell (© Garland Science 2008)
Capping Eukaryotic Pre-mRNA
MOLECULAR BIOLOGY – DNA replication, transcription
RNA terminal
phosphatse
‘Enzyme capping complex (CEC)’
Bound to RNApolII complex and caps the pre-mRNA co-
transcriptionally
Leads to the covalent attachment of a ‘7-methylguanosine cap (m7G cap)’ at the 5’ end of the
pre-mRNA via an unusual 5’ - 5’ triphosphate bond
The m7G cap ensures:
• the (pre)mRNA is protected from degradation
• mRNA export from nucleus
• mRNA is translated to give functional protein
Figure 6-38 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Polyadenylation of Eukaryotic Pre-mRNA
Cleavage and polyadenylation specificity factor (CPSF) & cleavage stimulation factor
(CstF)
CPSF & CstF recognise the cleavage and polyadeylation signals once they have been
transcribed into the pre-mRNA
CPSF & CstF binding recuits other factors that cleave the pre-mRNA chain free of the RNA polymerase II complex
Additionally polymerase (PAP) and poly-A-binding proteins
(PABPs) are also recruited to this polyadenylation complex
Polyadenylation importance:
• participates in transcriptional termination
• protects mRNA from degradation
• mRNA export from nucleus
• mRNA translation to give functional protein
PAP extends the 3’ end of the RNA by untemplated addition of up to 200 adenosine (A) nucleotides that are
then bound by PABPs
MOLECULAR BIOLOGY – DNA replication, transcription
mRNA capping and polyadenylation video/ tutorial
http://www.youtube.com/watch?v=YjWuVrzvZYA
MOLECULAR BIOLOGY – DNA replication, transcription
SPLICING of Eukaryotic Pre-mRNA
The very precise removal of non protein coding intron derived sequences from pre-mRNAs (N.B. genetic code) is catalysed by the multiple subunit containing complex called the ‘SPLICEOSOME’
Pre-mRNASpliceosome
The subunit composition of the spliceosome changes as the splicing of introns progresses
The main class of subunit are the ‘small nuclear ribonucleoproteins/ snRNPs (“snurps”) ’
snRNPs are complexes of proteins and ‘small nuclear
RNA (snRNA)’
There are 5 different snRNPs designated U1,
U2, U4, U5 & U6
snRNA
Protein
The snRNAs in snRNPs permit spliceosome
assembly
&
Recoginse ‘specific splice signals’ within the pre-
mRNA by complementary base-paring
Figure 6-28 Molecular Biology of the Cell (© Garland Science 2008)
snRNAs of snurps recognize 3 types of splice signal in the pre-mRNA
5’ splice site ‘branch site’ 3’ splice site
MOLECULAR BIOLOGY – DNA replication, transcription
This adenosine is critical to successful
splicing
The recognition of these 3 splice signal sequences
directs the correct assembly of the spliceosome and the correct joining of the exons
Figure 6-26a Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Spliceosome reaction mechanism
Cowboy’s lariat
2’ - 5’ phosphodiester
bond
Figure 6-29 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Where do the snRNPs fit in?
N.B. the dynamics in the composition of the spliceosome between catalysing the first and
second phosphoryl-transfer reactions
Figure 6-30c Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
snRNP & snRNA interactions in the two forms of spliceosome active site
Formation of the lariat with the conserved adenosine (A) in the
branch site (i.e catalysis of the 2’ -5’ phosphodiester bond)
Excision of the lariat and joining of the two exons (i.e. a conventional 3’ -
5’ phosphodiester bond)
MOLECULAR BIOLOGY – DNA replication, transcription
General splicing video/ tutorial
http://bcs.whfreeman.com/thelifewire/content/chp14/1402001.html
Figure 6-36 Molecular Biology of the Cell (© Garland Science 2008)
MOLECULAR BIOLOGY – DNA replication, transcription
Self splicing introns
Some lower eukaryotic species e.g. tetrahymena
Some fungi and plants species
Secondary structure formation within the intron caused by complementary base-pairing between its nucleotides forms inherent enzymatic activities (i.e. ‘ribozymes’) that catalyse the removal of the
intron and the joining of exons
Unicorporated guanine (G)
particpates as a cofactor and intron excised as a linear
moleclue
As with spliceosome assisted splicing a conserved adenine (A) nucleotide in the intron participates in the reaction and the intron is excised as a
lariat
Figure 6-31 Molecular Biology of the Cell (© Garland Science 2008)
ALTERNATIVE SPLICING
MOLECULAR BIOLOGY – DNA replication, transcription
Alternative splicing is a mechanism by which one gene can code for more than one version of a protein depending upon which exons make it into the mature mRNA and are translated.
Therefore provides an evolutionary mechanism for extra diversity!