Mike BoxemMihail Sarov

CRISPR/Cas9-based genome engineering…. an update

Workshop overview

• Design sgRNA and repair template

• Inject P0– Cas9– sgRNA– Repair template

• Select mutants or transgenics– Phenotype– Fluorescence– PCR

Bacterial immunity

Large space for improvement and additional applications

A single guide RNA can direct dsDNA cleavage by Cas9

Jinek et al. Science. 2012 Aug 17;337(6096):816-21

Gasiunas et al. Proc Natl Acad Sci U S A. 2012 Sep 25;109(39)

Experimental procedure

• Design sgRNA and repair template

• Inject P0– Cas9– sgRNA– Repair template

• Select mutants or transgenics– Phenotype– Fluorescence– PCR

Target site selection

• Only one requirement: PAM sequence (NGG) has to bepresent

• When using U6 promoter expression avoid UUUU stretches as they serve as Pol III terminators

• U6 transcription initiation requires a 5’G – can add an extra G to the guide G(N)20NGG

• In vitro transcription requires polymerase specific initiating nucleotides– For T7 GG is optimal <can be added to the guide GG(N)

ON-target efficiency

• Multiple methods to predict efficiency (of limited value) Doench et al. 2014; Wang et al. 2014; Farboud and Meyer 2015; Xu et al. 2015

• (N)18GGNGG works better than (N)20NGG <but is rare - use is practical for deletion experiments - very rarely useful for HDR (Farboud and Meyer 2015)

• ‣(N)19CNGG is disfavoured in a consensus derived from a large dataset (Doench et al.)

Alternative PAM sequences

Fire lab

Modified Cas9

Cpf1

An improved sgRNA design

Chen, B., Gilbert, L. A., Cimini, B. A., Schnitzbauer, J., Zhang, W., Li, G.-W., et al. (2013). Dynamic Imaging of Genomic Loci in LivingHuman Cells by an Optimized CRISPR/Cas System. Cell, 155(7)

OFF-target effects

• Appears to be a negligible problem in C. elegans• Additional GGs at the 5’ end reduce the off-target activity

(Cho, S.W. et al. 2014; Kim, D. et al. 2016)• Shorter guides (17) reduce off target activity at a minor on

target penalty (Fu, Sander, Reyon, Cascio, Joung, Nat. Biotech. 2014 Mar; 32(3):279-84)

• Recommended: Outcross and compare independent lines

Modified fidelity Cas variants

Cas9n

dCas9-FokI

Need 2 cuts to create DSB

Need to target 2 sites, and dimerize FokI

High fidelity variants that bind DNA less strong

! May not tolerate an extra 5’ G in the sgRNA

SpCas9-HF (Joung lab)eSpCas- (Zhang lab)

Experimental procedure

• Design sgRNA and repair template

• Inject P0– Cas9– sgRNA– Repair template

• Select mutants or transgenics– Phenotype– Fluorescence– PCR

Genome engineering strategies

Oligo-mediated repair SEC vectorsSAP/TRAP vectors

Random mutationsDeletions (use 2 sgRNAs)

Oligonucleotice mediated repair(Alexandre Paix/Seydoux lab)

• Use for– Point mutations and small insertions (up to ~ 140 bp based on longest

available oligo)– Precise gene deletions (use 2 sgRNAs)

• Design considerations– ~35 bp arms (longer arms are detrimental)– Try to have cut site close to intended mutations– Introduce mutations to prevent re-cutting (mutate PAM if possible, if

not use silent mutations)– Add additional changes for detection: use codon table– PAGE purification increases efficiency

Alaggc

agaagtatggatcctattcgcgaaggagaagtggcccacgagggaagctctttcacgaagctcgaatacggcggcgaaggaacatacgggtttacacactcaacgacgaaggagSer

Add mutations between cut-site and edit point!

atcctattcgcgaaggagaagtggcccacgagggaGGctctttcacCaaATtAgaGtaTggcggcgaaggaacatacgggtttacacactcaacS F T K L E Y

Genome sequence target site PAM

ssODN repair template35 bp35 bp

Desired change Conservative changes

Recombination consistently occured here

Strand preference

• The DNA strand not targeted by the sgRNA is more accessible

• ssODNs that anneal to the non-target DNA strand are more efficient

Richardson, C. D., Ray, G. J., DeWitt, M. A., Curie, G. L., & Corn, J. E. (2016). Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nature Biotechnology.

Genome engineering strategies

Oligo-mediated repair SEC vectorsSapTrap vectors

SEC vectors by Dickinson et al.

Gibson cloning of SEC vector repair template

SapTrap vectors by Matthew Schwarz and Eric Jorgensen

Modular assembly using SapI enzyme

5’-GCTCTTCNNNN---3’-CGAGAAGNNNN---

SEC/SapTrap cloning considerations

• First amplify a larger region containing both homology arms– Good template for PCR with Gibson tails on primers– Provides outside primers for identification of engineered

animals

• Introduce mutations that disrupt the recognition sequence!

• Midipreps of SEC vectors are hard! We use Macherey-Nagel low copy protocol with 200 ml culture, grown at 30°C.

Delivery of Cas9 and sgRNA

Plasmid-based (may be most suitable for long-arm HDR)

RNA

Ribonucleoprotein (may be most suitable for short-arm HDR)

Experimental procedure

• Design sgRNA and repair template

• Inject P0– Cas9– sgRNA– Repair template

• Select mutants or transgenics– Phenotype– Fluorescence– PCR

Identifying engineered animals

• Phenotype• PCR• Co-CRISPR/co-conversion• Selectable markers

Phenotype-based selection

• Most modification probably can’t be identified by phenotype, but….

• Mutations can cause visible phenotypes

• Fluorescent insertions can be identified on low power binoculars

PCR-based identification

Mismatch detecting nuclease (CelI, T7E1, surveyor)

Size difference

PCR-based identification

tcctattcgcgaattcgaagtggccc

tcctattcgcgaaGtcgaagtggccc

tctttcacgaagctcgaatacgg

tctttcacCaaATtAgaGtaTgg

Restriction fragment length polymorphism

Silent mutations

Selection markers

Co-CRISPR(Arribere et al. 2014, Kim et al. 2014, Ward 2015)

Site 1 (co-CRISPR) Site 2 (desired change)

dpy-10(cn64) gain of functionsqt-1(e1350) dominant Rollerpha-1(e2123) rescue

Screen second site by PCR

Co-CRISPR considerations

• Best for efficient desired modifications– ssODN repair– Active sgRNA– Close to cut site

• Screen worms with jackpot broods• pha-1 repair easy to select, but a non-N2

background

Positive selection markers

unc-119 rescueblasticidin resistancehygromycin resistanceneomicin resistance

Positive selection advantages

• Large homology arms are less sensitive to distancefrom cut site

• Recombination can take place in F1 germline as well as P0

• Even rare events are detected, as all animals are screened.

Positive selection marker considerations

• Counter selection against extrachromosomal array appears to be unneeded with hygR

Flowchart from Dickinson et al. Genetics 2016

Other uses of CRISPR/Cas9

Modifying gene expression

dCas9

dCas9

Interfere

Activate

Chromatin IP or visualization

Visualization

Purification

The next CRISPR?

Questions/discussion