Post on 02-Aug-2020
transcript
Draft
Role of the LuxR family transcriptional regulator Lpg2524 in
the survival of Legionella pneumophila in water
Journal: Canadian Journal of Microbiology
Manuscript ID cjm-2016-0780.R1
Manuscript Type: Article
Date Submitted by the Author: 02-Mar-2017
Complete List of Authors: Li, Laam; McGill University, Department of Natural Resource Sciences Faucher, Sébastien; McGill University, Natural Resource Sciences
Keyword: <i>Legionella pneumophila</i>, freshwater, survival, LuxR family protein, cell density
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
1
Role of the LuxR family transcriptional regulator Lpg2524 in the survival of Legionella
pneumophila in water
Laam Li1 and Sébastien P. Faucher
1*
1) Department of Natural Resource Sciences, Faculty of Agricultural and Environmental
Sciences, McGill University, Montreal, QC, Canada.
* Corresponding author
Address: 21,111 Lakeshore Road, Ste-Anne-de-Bellevue, Montreal, QC, Canada, H9X 3V9.
Email: sebastien.faucher2@mcgill.ca
Tel: 514-398-7886
Fax: 514-398-7990
Page 1 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
2
Abstract
The water-borne Gram-negative bacterium Legionella pneumophila (Lp) is the causative agent of
Legionnaires’ disease. Lp is typically transmitted to human from water systems, where it grows
inside amoebae. Survival of Lp in water is central to its transmission to humans. A transcriptomic
study previously identified many genes induced by Lp in water. One of such gene, lpg2524,
encodes a putative LuxR family transcriptional regulator. It was hypothesized that this gene
could be involved in the survival of Lp in water. Deletion of lpg2524 does not affect the growth
of Lp in rich medium, in the amoeba Acanthamoeba castellanii or in human macrophage-like
THP-1 cells, showing that Lpg2524 is not required for growth in vitro and in vivo. Nevertheless,
deletion of lpg2524 results in a faster CFU reduction in an artificial freshwater medium, Fraquil,
indicating that Lpg2524 is important for Lp to survive in water. Over-expression of Lpg2524 also
results in a survival defect, suggesting that a precise level of this transcriptional regulator is
essential for its function. However, our result shows that Lpg2524 is dispensable for survival in
water when Lp is at a high cell density (109 CFU ml
-1), suggesting that its regulon is regulated by
another regulator activated at high cell density.
Key words: Legionella pneumophila, freshwater, survival, LuxR family protein, cell density
Page 2 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
3
Résumé
La bactérie Gram-négative Legionella pneumophila (Lp) est l’agent étiologique de la maladie du
Légionnaire. Lp est transmis à l’humain à partir de systèmes hydriques dans lesquels il se
multiplie à l’intérieur d’amibes. La survie de Lp dans l’eau est essentielle à sa transmission à
l’humain. Une étude transcriptionnelle a permis d’identifier plusieurs gènes induits par Lp dans
l’eau, comme lpg2524 qui code pour un présumé régulateur transcriptionel de la famille de LuxR.
L’hypothèse a été émise que ce gène pourrait être impliqué dans la survie de Lp dan l’eau. La
délétion de lpg2524 n’affecte pas la croissance de Lp dans un milieu riche, dans l’amibe
Acanthamoeba castellanii ou dans les macrophages humains en culture THP-1, démontrant que
Lpg2524 est dispensable pour la croissance in vitro et in vivo. Cependant, la délétion de ce gène
engendre un défaut de survie dans l’eau, révélant son rôle dans la survie de Lp dans l’eau. La
surexpression de ce gène engendre aussi un défaut de survie, probablement parce qu’un niveau
d’expression précis est requis. De plus, la délétion de Lpg2524 n’a pas d’effet sur la survie de Lp
lorsque la densité bactérienne est élevée (109 CFU ml
-1), ce qui suggère que son régulon est
régulé par un autre régulateur activé lorsque la densité bactérienne est élevé.
Mots-clés: Legionella pneumophila, eau, survie, protéine de la famille de LuxR, densité
cellulaire
Page 3 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
4
Introduction
Legionella pneumophila (Lp) is an opportunistic human pathogen that can infect the
alveolar macrophages of susceptible individuals, resulting in a severe pneumonia called
Legionnaires’ disease (Fields et al. 2002). As a bacterium inhabiting freshwater environments, Lp
is frequently exposed to fluctuating conditions and experienced various stresses such as nutrient
limitation, temperature and pH. Bacteria tend to reorganize their transcriptomic profile to better
adapt to environmental changes (Leaphart et al. 2006; Stintzi 2003). Such changes in overall
gene expression are usually achieved by the modulation of transcriptional and post-
transcriptional regulators, which control a pool of genes.
Several transcriptional regulators in Lp have been well studied due to their significant
contribution to the regulation of virulence genes, such as the two-component systems CpxRA,
PmrAB, LetAS as well as LqsRS (Gal-Mor and Segal 2003; Hammer et al. 2002; Spirig et al.
2008; Tanner et al. 2016; Zusman et al. 2007). Together, they regulate the expression of over 70
genes encoding Type IVB secretion system and effector proteins, which are essential for
intracellular growth (reviewed by Segal 2013). Moreover, the alternative sigma factor RpoS
modulates the expression of 739 genes, which is approximately one-fourth of the total annotated
genes in Lp. (Hovel-Miner et al. 2009). Apart from controlling multiple pathways associated with
intracellular growth, RpoS is also important for the survival of Lp in water (Trigui et al. 2014).
Our previous transcriptomic studies have showed that RpoS positively regulates two genes
significantly induced in water, bdhA and lpg1659 (lasM), that contribute to the long-term
survival of Lp in water (Li and Faucher 2016; Li et al. 2015).
Our previous microarray analysis showed that another gene, lpg2524, was also
significantly induced in Lp after 6 hours (Log2 ratio =1.52) and 24 hours (Log2 ratio =1.73) in
Page 4 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
5
water when compared to the control grown in rich medium (Li and Faucher 2016). The
expression of this gene is positively regulated by RpoS in the post-exponential phase of growth
(Hovel-Miner et al. 2009). The protein encoded by lpg2524 is composed of 287 aa and is
annotated as a LuxR family transcriptional regulator in the NCBI database due to the presence of
a DNA-binding domain similar to LuxR-like protein at the C-terminal. LuxR is a transcriptional
regulator in the LuxIR quorum sensing (QS) system that regulates bioluminescence in Vibrio
fischeri (Engebrecht and Silverman 1984). Briefly, LuxI is the autoinducer synthase that
synthesizes acylated homoserine lactone (AHL), while LuxR is activated by AHL and then binds
to the regulatory region of target genes to alter gene expression (Nasser and Reverchon 2007). In
Proteobacteria, incomplete QS systems were also found, with a LuxR family sensor/regulator but
no cognate LuxI family synthase (Case et al. 2008). These unpaired LuxR family proteins, also
called LuxR solos, may respond to endogenous or exogenous AHLs with a lower specificity
(Subramoni and Venturi 2009). For instance, the LuxR solo QscR of Pseudomonas aeruginosa
interacts with two different AHLs produced by LasI, namely 3-oxo-decanoyl-homoserine lactone
(3OC10-HSL) and 3-oxododecanoyl-homoserine lactone (3OC12-HSL), and regulates genes
involved in metabolism, transport and virulence (Lee et al. 2006; Lequette et al. 2006). LuxR
solos may also respond to non-AHL molecules (Subramoni and Venturi 2009). For example,
Xanthomonas campestris possesses a LuxR solo named XccR, which responds to a plant factor
(Zhang et al. 2007).
In Lp, there are another four proteins that show sequence similarity to LuxR family
transcriptional regulators, including LpnR1 (Lpg2557), LpnR2 (Lpg1946), LpnR3 (Lpg1448)
and LetA (Lpg2646) (Hammer et al. 2002; Lebeau et al. 2004). Their importance on host
invasion and intracellular multiplication has been characterized, but the function of Lpg2524 has
Page 5 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
6
not been studied yet. Since lpg2524 is induced in water and positively regulated by RpoS, we
hypothesize that this gene is important for Lp to survive in water. In this study, we investigate the
function of Lpg2524 on the growth of Lp in vitro and in vivo as well as its survival in water.
Materials and methods
Bacterial strains and culture conditions
The wild-type (WT) strain we used for constructing the mutant and over-expression
strains was KS79, which is a constitutively competent strain derived from Lp Philadelphia-1
strain JR32 (de Felipe et al. 2008; Sadosky et al. 1993). Lp was grown on charcoal yeast extract
(CYE) agar with 0.25 mg ml-1
ferric pyrophosphate, 0.4 mg ml-1
L-cysteine and 0.1% α-
ketoglutarate at 37°C for three days (Edelstein 1981; Feeley et al. 1979). Liquid cultures were
grown in ACES-buffered yeast extract (AYE) broth (Horwitz and Silverstein 1983). If needed,
this medium was further supplemented with 5 µg ml-1
chloramphenicol or 25 µg ml-1
kanamycin.
The strains of Escherichia coli were derived from DH5α. They were grown overnight on Luria-
Bertani agar at 37°C and the medium was supplemented with 25 µg ml-1
chloramphenicol if
needed. Bacterial strains used in this study are described in Table 1.
Construction of mutant, complemented and over-expression strains
For the construction of deletion mutant SPF258 (∆lpg2524), 1 kb of the sequence
upstream of lpg2524 was amplified from KS79 by PCR using Taq polymerase (Invitrogen) and
the primer set 2524_UpF/2524_UpR, and 1 kb of the sequence downstream of lpg2524 was
amplified using the primer set 2524_DownF/2524_DownR. A kanamycin cassette was then
amplified using pSF6 as template and Kn-F/Kn-R as primers. Using the purified kanamycin
Page 6 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
7
cassette as template, a 1 kb kanamycin fragment with 5’ end complementary to the 3’ end of
upstream fragment and 3’ end complementary to the 5’ end of downstream fragment was
amplified using the primer set 2524_KnF/2524_KnR. Subsequently, a 3 kb mutant allele was
amplified from a mixture of the three 1 kb fragments using the primer set
2524_UpF/2524_DownR and Phusion DNA polymerase (NEB). The amplicon was purified and
introduced into KS79 through natural transformation (de Felipe et al. 2008). Successful
recombinants in which lpg2524 is replaced by the kanamycin cassette were confirmed by
kanamycin resistance and PCR.
For the construction of plasmid pSF84 (plpg2524) for complementation, the lpg2524
gene and a 500 bp upstream sequence was amplified using KS79 as template and
Com2524F_SacI/Com2524R_XbaI as primers. Both the plasmid pXDC39 and purified amplicon
were digested with SacI and XbaI (NEB), following by ligation using T4 DNA ligase (NEB).
Ligation mixture was then transformed into E. coli DH5α and transformants were selected based
on resistance against chloramphenicol. The plasmid was extracted from the transformant and
correct insertion was confirmed by PCR using pXDC39-F/Com2524R_XbaI as primers.
Subsequently, the plasmid was introduced into the deletion mutant ∆lpg2524 by electroporation,
as described previously (Chen et al. 2006), to construct the complemented strain SPF295
(∆lpg2524+plpg2524). Successful recombinants were confirmed by kanamycin and
chloramphenicol resistance as well as PCR.
For the construction of plasmid pSF93 (plpg2524i) for over-expression of lpg2524, the
gene was amplified using KS79 as template and Com2524F2_SacI/Com2524R_XbaI as primers.
Both the plasmid pMMB207c and purified amplicon were digested with SacI and XbaI (NEB),
following by ligation using T4 DNA ligase (NEB). Ligation mixture was then transformed into E.
Page 7 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
8
coli DH5α and the transformants were selected based on resistance against chloramphenicol. The
plasmid was extracted from the transformant and correct insertion (lpg2524) was confirmed by
PCR using PromF/Com2524R_XbaI as primers. Subsequently, the plasmid was introduced into
KS79 by electroporation to construct the over-expression strain SPF311 (WT+plpg2524i).
Successful recombinants were confirmed by kanamycin and chloramphenicol resistance as well
as PCR validation. The sequence of all primers is listed in Table 2.
Extracellular growth assay
The WT strain KS79 and the deletion mutant ∆lpg2524 were suspended at an OD600 of
0.1 in AYE broth. Twenty-five ml of each culture, with three replicates per culture, was grown in
125 ml Erlenmeyer flask at 37°C shaking (250 rpm). The optical density at 600 nm (OD600) of
each culture was monitored for 32 hours at intervals of 4 hours.
Cell lines and infection assays
The amoeba Acanthamoeba castellanii was first grown in 20 ml of peptone yeast glucose
(PYG) broth at 30°C in a 75 cm2 tissue culture flask (Sarstedt). PYG broth is composed of 2%
proteose peptone, 0.1% yeast extract, 0.1% sodium citrate dihydrate, 0.4 M CaCl2, 0.1 M glucose,
4 mM MgSO4, 2.5 mM NaH2PO3, 2.5 mM K2HPO3 and 0.05 mM Fe(NH4)2(SO4)2 (Moffat and
Tompkins 1992). When the culture became confluent, the spent medium with any non-adherent
amoebae was discarded. Ten ml of fresh PYG broth was added into the flask, which was then
shaken sharply to allow detachment of the adherent amoebae from the inner surface of the flask.
Subsequently, the suspension of amoebae was diluted to 5×105 cells ml
-1 and 1 ml was added to
the wells of a 24-well plate (Sarstedt). The plate was settled for two hours to allow adhesion of
Page 8 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
9
amoebae. Then, the medium was replaced with Ac buffer that does not support the growth of Lp
(Moffat and Tompkins 1992) and the plate was settled for another two hours.
To prepare the human monocyte-like cell line THP-1 for infection, cells were first grown
in 30 ml of RPMI 1640 (Life Technologies) with 2 mM glutamine and 10% fetal bovine serum at
37°C under 5% CO2 (Kim et al. 2009). The culture was diluted to 5×105 cells ml
-1 and 1×10
-7 M
phorbol 12-myristate 13-acetate (PMA) (Fisher Scientific) was added. One ml of this culture was
added to the wells of a 24-well plate (Sarstedt) and the plate was incubated for three days to
allow differentiation of monocytes into adherent macrophage-like cells. Fresh medium was used
to replace the spent medium two hours before infection.
To start the infection, the strains KS79, ∆lpg2524 and the dotA mutant were first
suspended in AYE broth at an OD600 of 0.1 and diluted 10 times (to approximately 2.5×106 cells
ml-1
). The dotA mutant is a negative control known to be defective in intracellular growth (Roy
and Isberg 1997). Two µl of each bacterial culture was added to three replicate wells in the 24-
well plate containing either A. castellanii or THP-1 cells (i.e. MOI of 0.1). The plate with A.
castellanii was incubated at 30°C and the plate with THP-1 cells was incubated at 37°C under
5% CO2. The growth of each bacterial strain was monitored every 24 hours by CFU counts and
their intracellular growth was determined by comparing the CFU on individual day with the
initial CFU.
Survival assays in water
In the survival assays, an artificial freshwater medium Fraquil, which does not support
the growth but allows long-term survival of Lp (Mendis et al. 2015), was used. Fraquil contains
0.25 µM CaCl2, 0.15 µM MgSO4, 0.15 µM NaHCO3, 0.1 µM NaNO3, 23 nM MnCl2, 10 nM
Page 9 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
10
K2HPO4, 10 nM FeCl3, 4 nM ZnSO4, 2.5 nM CoCl2, 1 nM CuSO4 and 0.22 nM (NH4)6Mo7O24
dissolved in ultra-pure Milli-Q water (Morel et al. 1975). Strains grown on CYE agar were first
washed with Fraquil for three times before suspending in fresh Fraquil at an OD600 of 0.1. One
ml of suspension was mixed with 4 ml of fresh Fraquil (to obtain an OD600 of approximately 0.02)
and then incubated in a 25 cm2 plastic flask (Sarstedt). Three biological replicates were prepared
for each strain and they were incubated at 25°C, 37°C and 42°C. CFU of each sample was
monitored once per three weeks, once per two weeks and once per week, respectively. For the
samples incubated at 42°C, Live/Dead staining and flow cytometry were used to determine the
membrane integrity of Lp after 7 weeks as described previously (Li et al. 2015). Freshly grown
KS79 was used as the control for viable cells and KS79 boiled in a water bath for 10 minutes
was used as the control for dead cells. Both the samples and controls were diluted to an OD600 of
0.01 in Fraquil. One ml of the dilution was then stained with 1.5 µl of SYTO 9 at 3.34 mM and
1.5 µl of propidium iodide at 20 mM. The Guava easyCyte flow cytometer (EMD Millipore) was
used for fluorescence signal measurement (green fluorescence from SYTO 9 and red
fluorescence from propidium iodide). Unstained cells and stained Fraquil were used as a
reference for instrument setting to eliminate background signals. For data analysis, the guavaSoft
2.7 software was used. The sample cells that followed the fluorescence profile of viable control
and dead control were considered as viable cells and dead cells, respectively. Noteworthy, the
cells that fell in the small overlap region between the profiles of the two controls were
considered as undefined. To study the effects of high cell density on the survival of Lp in water,
the strains were suspended in Fraquil at an OD600 of 1.0 instead of 0.02 before incubating at
42°C.
Page 10 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
11
Results
Deletion of lpg2524 does not affect the growth of Lp in vitro
Since transcriptional regulator controls the expression of other genes, Lpg2524 could be a
critical protein involved in various functions such as growth, infection and survival in water. To
study the importance of lpg2524 in those functions, we constructed a mutant by allelic exchange
(∆lpg2524). No significant differences were observed between the growth of WT strain and the
mutant ∆lpg2524 in rich medium (Fig. 1). Both strains showed exponential growth between 8 to
20 hours and their growth curve remained similar for 32 hours. This result indicates that lpg2524
is dispensable for optimal growth of Lp in complex medium in vitro at 37°C.
Deletion of lpg2524 does not affect the growth of Lp in vivo
Next, we tested if the deletion of lpg2524 would alter the ability of Lp to infect host cells
and to grow intracellularly. Since Lp infects amoebae in the natural environment and infects
human macrophages on occasion (Fields et al. 2002), the amoeba A. castellanii and human
macrophage-like THP-1 cells were used as host cells. In both infection assays, the WT strain and
∆lpg2524 showed a similar increase in CFU ratio, while the negative control (dotA mutant)
showed a decreasing ratio as expected (Fig. 2a and 2b). There were no significant differences
between the WT and ∆lpg2524 in both assays, suggesting that Lp does not require lpg2524 for
host infection and intracellular growth.
lpg2524 is important for Lp to survive in water at warm temperatures
Since Lp induces expression of lpg2524 in water (Li et al. 2015), we hypothesized that
this gene could be important for survival in water and thus that the deletion of lpg2524 could
Page 11 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
12
result in a survival defect. Therefore, we exposed the WT strain, mutant strain ∆lpg2524 and
complemented strain ∆lpg2524+plpg2524 to water at different temperatures and monitored their
survival by CFU count.
At 25°C, no significant reductions in CFU were detected within 24 weeks (Fig. 3a). At
37°C, the CFU of all strains decreased faster than at 25°C and eventually became undetectable
after 22 weeks of exposure in water (Fig. 3b). The mutant ∆lpg2524 showed a faster CFU
reduction than the WT and significant differences in CFU between the two strains were observed
since the 14th
week. In contrast, the complemented strain maintained similar CFU as the WT,
indicating that lpg2524 is important for the survival of Lp in water. At 42°C, the trend was
similar to that at 37°C, though the survival defect of ∆lpg2524 was only partially recovered in
the complemented strain (Fig. 3c). Also, the CFU of all strains dropped quicker than at 37°C and
became undetectable after 5 weeks of exposure to water. Taken together, the results suggest that
lpg2524 is important for Lp to survive in water at temperatures of 37°C and above.
The viability of the WT, mutant and complemented strains was then analyzed using
Live/Dead staining and flow cytometry. For all three strains, over 90% of the cells were viable
and less than 8% were dead (Fig. 3d). Since the CFU of all strains already dropped below
detection limit at this time point (the 7th
week in water at 42°C), the result suggests that most
cells became viable but non-culturable (VBNC).
Over-expression of Lpg2524 affects the survival of Lp in water
Recently, we have shown that LasM (Lpg1659) is important for Lp to survive in water
and that over-expression of this gene further promotes the survival (Li and Faucher 2016).
Therefore, we tested if the over-expression of lpg2524 would have a beneficial effect on the
Page 12 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
13
survival of Lp in water. To test this, a plasmid containing an inducible Ptac promoter upstream of
the lpg2524 ORF was introduced into the WT strain (WT+plpg2524i). The WT strain and
WT+plpg2524i ON/OFF were then exposed to water at 42°C. In contrast to our initial hypothesis,
the CFU became undetectable two weeks earlier than the WT when the over-expression of
Lpg2524 was induced with IPTG (WT+plpg2524i ON) (Fig. 4). When Lpg2524 was not over-
expressed (WT+plasMi OFF), the CFU dropped faster than the WT and became undetectable one
week earlier, probably due to the leaky expression of Ptac. These results indicate that a higher
level of Lpg2524 interferes with the survival of Lp in water.
Lp does not require lpg2524 for survival in water at high cell density
Since LuxR family proteins are sometimes involved in QS-mediated regulation (Nasser
and Reverchon 2007), we hypothesized that Lpg2524 could have such a role in Lp. As QS
involves the regulation of gene expression as a function of cell density (Nasser and Reverchon
2007), bacteria at different densities may show distinct phenotypes. Lpg2524 may be needed to
regulate the genes for survival in water only when Lp is at a particular cell density. Therefore, we
suspended the WT strain, mutant strain ∆lpg2524 and complemented strain ∆lpg2524+plpg2524
in water at a cell density 100 times superior to what was tested in Fig. 3 (i.e. 109
cells ml-1
, an
OD600 of 1.0) and monitored their survival at 42°C. This temperature was used because the
survival defect previously observed in ∆lpg2524 was the greatest.
At a higher cell density, the CFU of all strains dropped below detection limit after 7
weeks of water exposure at 42°C (Fig. 5). This is 2 weeks longer than the suspensions at a lower
cell density (107 cells ml
-1, an OD600 of 0.02) (Fig. 3c), which was expected for a larger
population. All strains showed a similar survival curve and the mutant ∆lpg2524 did not show a
Page 13 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
14
survival defect even at this temperature (Fig. 5), demonstrating that lpg2524 is no longer
important for Lp to survive in water at 42°C when at high cell density.
Discussion
LuxR family proteins are usually composed of around 250 aa with two functional
domains, a N-terminal domain for AHL-binding and a C-terminal helix-turn-helix DNA-binding
domain for transcriptional regulation (Nasser and Reverchon 2007). These LuxR family
transcriptional regulators can manipulate the expression of downstream genes in order to regulate
certain functions, such as LuxR regulating bioluminescence in V. fischeri (Engebrecht and
Silverman 1984). In Lp, the LuxR solo LetA regulates virulence in Lp and the shift between the
replicative and transmissive phases (Hammer et al. 2002). Here, we revealed the functions of a
previously unknown LuxR family transcriptional regulator, Lpg2524, on the survival of Lp in
water.
First, we found that the deletion of lpg2524 does not affect the growth of Lp in vitro. This
is consistent with a previous study showing that the insertion of transposon in this gene did not
result in growth advantages or disadvantages in rich medium (O’Connor et al. 2011). Also,
lpg2524 is dispensable for invasion and intracellular growth in amoeba A. castellanii and human
macrophage-like THP-1 cells. Noteworthy, the other four LuxR family proteins in Lp (LpnR1,
LpnR2, LpnR3 and LetA) were found to be involved in virulence to some extent. It is known that
LpnR2, LpnR3 and LetA promote the expression of flagellin, which is needed for efficient host
cell infection (Hammer et al. 2002; Lebeau et al. 2004; Pruckler et al. 1995). All three LpnR
proteins are dispensable for intracellular multiplication in human macrophage-like U937 cells,
but LpnR2 is needed for invasion and LpnR3 is needed for intracellular multiplication in A.
Page 14 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
15
castellanii (Lebeau et al. 2004). Furthermore, LetA is needed for Lp to evade phagosome-
lysosome fusion, but not important for intracellular multiplication in bone marrow derived
macrophages from A/J mouse (Hammer et al. 2002). Considering our result, it is possible that: 1)
Lpg2524 is not involved in the regulation of virulence at all; 2) due to functional redundancy,
deletion of lpg2524 would not result in any observable effects; and 3) the importance of Lpg2524
is host-specific, so the mutant ∆lpg2524 may have a defect in other host cells, such as primary
macrophages.
Survival defect was observed in ∆lpg2524 exposed to water at 37°C and 42°C, but not at
25°C, suggesting that lpg2524 is important for Lp to survive in warm water. Similar results were
found for bdhA and lasM, which are required for survival in water only when the temperature is
above 25°C (Li and Faucher 2016; Li et al. 2015). Since ∆lpg2524 did not show a defect in water
during short-term exposure at 55°C when compared to the WT (data not shown), it is unlikely
that the defects we observed at 37°C and 42°C were due to a lower tolerance to high temperature.
Therefore, it is possible that ∆lpg2524 could have a survival defect at 25°C over longer period of
time.
In addition, the result of Live/Dead staining showed that the major population of
∆lpg2524 did not die after exposure to water at 42°C for 7 weeks. Instead, it entered a VBNC
state earlier than the WT. VBNC cells are known to be cells in a quiescent status, waiting for
revival or transitioning to death (Li et al. 2014). For example, VBNC cells of Lp induced by
starvation could be resuscitated by co-inoculation with A. castellanii (Steinert et al. 1997).
However, those induced by monochloramine treatment could not be resuscitated using the same
method (Alleron et al. 2013). Since we were unable to resuscitate the VBNC cells in our samples
and they remained non-infectious (data not shown), we consider the cells to be dying, indicating
Page 15 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
16
that ∆lpg2524 started dying in water at an earlier time point than the WT.
Although Lpg2524 is important for Lp to survive in water, the precise level of this
transcriptional regulator seems to be critical for optimal survival. Over-expression of Lpg2524
induced by IPTG greatly hindered the survival of Lp in water at 42°C, whereas slight increase in
the level of Lpg2524 caused by the leaky expression of Ptac also resulted in a mild but
significant survival defect. It is known that over-expression of transcriptional regulators may
disrupt normal pathways and activities in bacteria (reviewed by MacRitchie et al. 2008). For
example, RpoS is important for the virulence of Lp (Hovel-Miner et al. 2009), but its over-
expression was found to repress LetAS-dependent virulence traits, including motility,
cytotoxicity and infectivity (Bachman and Swanson 2004). In fact, most of the LuxR family
transcriptional regulators act as activators by recruiting RNA polymerase to the promoter of their
target genes (Nasser and Reverchon 2007). It is likely that Lpg2524 could activate genes
required for Lp to survive in water. Therefore, the deletion mutant had a survival defect, probably
due to its inability to activate critical genes, whereas the over-expression strain also had a
survival defect, perhaps due to excessive quantity of Lpg2524 that bind non-specifically to genes
that should not be activated when Lp is under nutrient limitation in water (e.g. genes involved in
replication and translation).
Noteworthy, the importance of Lpg2524 to the survival of Lp in water appears to be
dependent on cell density. Lpg2524 is needed for the survival of Lp when at a cell density of 107
CFU ml-1
(OD600 of 0.02) but is dispensable when at a cell density of 109 CFU ml
-1 (OD600 of
1.0). In the natural environment, it is more likely to find Lp at a lower cell density than at cell
density as high as 109 CFU ml
-1. Previous studies found 10
6 CFU ml
-1 of Lp in water basin of
cooling towers and 104 CFU ml
-1 of Lp in hot-water tank (Stout et al. 1985; Türetgen et al. 2005).
Page 16 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
17
However, it is possible that the cell density reaches a higher level in biofilm or during
intracellular multiplication. In both cases, Lp may not require Lpg2524 to maintain survival
because it is not in direct contact with water.
The fact that Lpg2524 belongs to the LuxR family and is important for the survival of Lp
at low cell density suggests a link with a QS system. Such systems have been observed in both
Gram-positive and Gram-negative bacteria to allow interspecies and intraspecies communication
to synchronize group behavior through controlling gene expression (Nasser and Reverchon
2007). Most QS systems involve an autoinducer synthase and a cognate response regulator, while
there are exceptions that involve an extra component, a sensor kinase, which helps signal
detection and transmission (Tiaden et al. 2007). For example, based on the gene cluster
homology to cqsAS QS system in Vibrio cholerae, the first QS system identified in Lp includes
an autoinducer synthase LqsA, a response regulator LqsR and a sensor kinase LqsS (Tiaden et al.
2007). In this system, LqsA produces the α-hydroxyketone autoinducer LAI-1 that does not bind
to the regulator directly but to the sensor, whereas the sensor transfers the phosphoryl group to
the regulator to activate the regulation of target genes (reviewed by Schell et al. 2016).
Nevertheless, Lpg2524 is required at low cell density, which would suggest a model
where Lpg2524 binds to and activates transcription of target genes when the autoinducer is
absent or at a low concentration. At high cell density, the binding of the autoinducer to Lpg2524
may render it inactive. This would result in a similar phenotype between the WT and the mutant
strains at high cell density. Since there are no LuxI homologues in Lp, it is not clear what signal
Lpg2524 senses. None of the five LuxR family proteins (LpnR1, LpnR2, LpnR3, LetA and
Lpg2524) have been shown to interact with autoinducers and it is not clear if they are genuine
QS regulators. One possibility is that Lpg2524 senses an as yet unknown metabolic product that
Page 17 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
18
accumulates extracellularly as the cell density increases. This signaling molecule could be an as
yet unknown molecule or LAI-1 produced by the Lqs system, since LuxR solos are known to
bind to autoinducer produced by other systems (Subramoni and Venturi 2009). Since Lp is not
growing in water, but merely surviving, it is not clear if an autoinducer could be produced and
accumulated extracellularly in sufficient quantity to bind to the response regulators. It is known
that Lp is metabolically active in water since deletion of bdhA, a gene involved in the utilization
of energy reserves, result in a survival defect in water starting at 6th
week (Li et al. 2015).
However, transcription is drastically reduced after 24 hours in water, which would require that
Lpg2524 inhibition by autoinducers occurs within a few days to have an impact on induction of
genetic program required for survival in water, which is likely improbable. Therefore, it is
unlikely that Lpg2524 is involved in typical QS-mediated regulation of genes involved in
survival of water, thus we do not favor this model.
Alternatively, it is possible that another regulator is activated at high cell density, which
bypasses the function of Lpg2524. In this case, Lpg2524 would not be, directly, involved in QS.
This other regulator might not be necessarily a typical QS regulator since other molecules that
accumulate extracellularly can also play a role in sensing the density of the population. In P.
aeruginosa, the siderophore pyoverdine regulates the production of exotoxin A and the PrpL
protease in a dose-dependent manner (Lamont et al. 2002). Such mechanism would be more
consistent with the situation presented here. In water, Lp could produce a siderophore, a secreted
proteins or another type of molecule that accumulates extracellularly. At high density, this
molecule could accumulate to a concentration level sufficient to initiate a response and bypass
the requirement for Lpg2524. It is unlikely that this molecule is a siderophore since the genes
involved in the production of legiobactin and HGA-melanin (Cianciotto 2015) are repressed in
Page 18 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
19
water at high cell density (Li et al. 2015). More likely, it is possible that a micronutrient is
exhausted faster at high cell density, which leads to activation of the alternative regulator that
bypasses the requirement for Lpg2524. Previously, we have shown that the putative transporter
LasM is required for Lp to survive in water and that supplementation with 10 times the normal
amount of trace metal rescues this requirement (Li and Faucher 2016). Hence, it is possible that
exhaustion of trace metals at high cell density serves as a signal during survival of Lp in water.
In conclusion, this study shows that the novel LuxR family transcriptional regulator,
Lpg2524, is important for Lp to survive in water at warm temperature. Absence of Lpg2524 does
not affect the growth of Lp, both in vitro and in vivo. However, both the deletion and over-
expression of lpg2524 result in a survival defect in water, showing that precise level of Lpg2524
is required for maintaining the survival of Lp. Such requirement of Lpg2524 for Lp to survive in
water seems to depend on cell density, as the absence of this protein only cause a survival defect
at low cell density but not at high cell density. Further investigations of the target genes of
Lpg2524 could provide some insight on the underlying regulatory mechanisms.
Acknowledgments
This work was supported by NSERC Discovery grant 418289-2012 and John R. Evans
Leaders Fund – Funding for research infrastructure from the Canadian Foundation for Innovation
to S. P. F.
Page 19 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
20
References
Alleron, L., Khemiri, A., Koubar, M., Lacombe, C., Coquet, L., Cosette, P., et al. 2013. VBNC
Legionella pneumophila cells are still able to produce virulence proteins. Water Res.
47(17): 6606-6617. doi: 10.1016/j.watres.2013.08.032.
Bachman, M.A., and Swanson, M.S. 2004. Genetic evidence that Legionella pneumophila RpoS
modulates expression of the transmission phenotype in both the exponential phase and
the stationary phase. Infect. Immun. 72(5): 2468-2476. doi: 10.1128/iai.72.5.2468-
2476.2004.
Case, R.J., Labbate, M., and Kjelleberg, S. 2008. AHL-driven quorum-sensing circuits: their
frequency and function among the Proteobacteria. ISME J. 2(4): 345-349. doi:
10.1038/ismej.2008.13.
Charpentier, X., Faucher, S.P., Kalachikov, S., and Shuman, H.A. 2008. Loss of RNase R
induces competence development in Legionella pneumophila. J. Bacteriol. 190(24):
8126-8136. doi: 10.1128/jb.01035-08.
Chen, D.-Q., Huang, S.-S., and Lu, Y.-J. 2006. Efficient transformation of Legionella
pneumophila by high-voltage electroporation. Microbiol. Res. 161(3): 246-251. doi:
10.1016/j.micres.2005.09.001.
Cianciotto, N.P. 2015. An update on iron acquisition by Legionella pneumophila: new pathways
for siderophore uptake and ferric iron reduction. Future Microbiol 10(5): 841-851.
de Felipe, K.S., Glover, R.T., Charpentier, X., Anderson, O.R., Reyes, M., Pericone, C.D., et al.
2008. Legionella eukaryotic-like type IV substrates interfere with organelle trafficking.
PLoS Pathog. 4(8): e1000117. doi: 10.1371/journal.ppat.1000117.
Edelstein, P.H. 1981. Improved semiselective medium for isolation of Legionella pneumophila
Page 20 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
21
from contaminated clinical and environmental specimens. J. Clin. Microbiol. 14(3): 298-
303.
Engebrecht, J., and Silverman, M. 1984. Identification of genes and gene products necessary for
bacterial bioluminescence. Proc. Natl. Acad. Sci. 81(13): 4154-4158.
Faucher, S.P., Mueller, C.A., and Shuman, H.A. 2011. Legionella pneumophila transcriptome
during intracellular multiplication in human macrophages. Front. Microbiol. 2: 60. doi:
10.3389/fmicb.2011.00060.
Feeley, J.C., Gibson, R.J., Gorman, G.W., Langford, N.C., Rasheed, J.K., Mackel, D.C., et al.
1979. Charcoal-yeast extract agar: primary isolation medium for Legionella pneumophila.
J. Clin. Microbiol. 10(4): 437-441.
Fields, B.S., Benson, R.F., and Besser, R.E. 2002. Legionella and Legionnaires' disease: 25 years
of investigation. Clin. Microbiol. Rev. 15(3): 506-526. doi: 10.1128/cmr.15.3.506-
526.2002.
Gal-Mor, O., and Segal, G. 2003. Identification of CpxR as a positive regulator of icm and dot
virulence genes of Legionella pneumophila. J. Bacteriol. 185(16): 4908-4919. doi:
10.1128/jb.185.16.4908-4919.2003.
Hales, L.M., and Shuman, H.A. 1999. The Legionella pneumophila rpoS gene is required for
growth within Acanthamoeba castellanii. J. Bacteriol. 181(16): 4879-4889.
Hammer, B.K., Tateda, E.S., and Swanson, M.S. 2002. A two-component regulator induces the
transmission phenotype of stationary-phase Legionella pneumophila. Mol. Microbiol.
44(1): 107-118. doi: 10.1046/j.1365-2958.2002.02884.x.
Horwitz, M.A., and Silverstein, S.C. 1983. Intracellular multiplication of Legionnaires' disease
bacteria (Legionella pneumophila) in human monocytes is reversibly inhibited by
Page 21 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
22
erythromycin and rifampin. J. Clin. Invest. 71(1): 15-26.
Hovel-Miner, G., Pampou, S., Faucher, S.P., Clarke, M., Morozova, I., Morozov, P., et al. 2009.
σS controls multiple pathways associated with intracellular multiplication of Legionella
pneumophila. J. Bacteriol. 191(8): 2461-2473. doi: 10.1128/jb.01578-08.
Kim, E.-H., Charpentier, X., Torres-Urquidy, O., McEvoy, M.M., and Rensing, C. 2009. The
metal efflux island of Legionella pneumophila is not required for survival in
macrophages and amoebas. FEMS Microbiol. Lett. 301(2): 164-170. doi: 10.1111/j.1574-
6968.2009.01813.x.
Lamont, I.L., Beare, P.A., Ochsner, U., Vasil, A.I., and Vasil, M.L. 2002. Siderophore-mediated
signaling regulates virulence factor production in Pseudomonas aeruginosa. Proc Natl
Acad Sci 99(10): 7072-7077. doi: 10.1073/pnas.092016999.
Leaphart, A.B., Thompson, D.K., Huang, K., Alm, E., Wan, X.-F., Arkin, A., et al. 2006.
Transcriptome profiling of Shewanella oneidensis gene expression following exposure to
acidic and alkaline pH. J. Bacteriol. 188(4): 1633-1642. doi: 10.1128/jb.188.4.1633-
1642.2006.
Lebeau, I., Lammertyn, E., De Buck, E., Maes, L., Geukens, N., Van Mellaert, L., et al. 2004.
Novel transcriptional regulators of Legionella pneumophila that affect replication in
Acanthamoeba castellanii. Arch. Microbiol. 181(5): 362-370. doi: 10.1007/s00203-004-
0664-6.
Lee, J.-H., Lequette, Y., and Greenberg, E.P. 2006. Activity of purified QscR, a Pseudomonas
aeruginosa orphan quorum-sensing transcription factor. Mol Microbiol 59(2): 602-609.
doi: 10.1111/j.1365-2958.2005.04960.x.
Lequette, Y., Lee, J.-H., Ledgham, F., Lazdunski, A., and Greenberg, E.P. 2006. A distinct QscR
Page 22 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
23
regulon in the Pseudomonas aeruginosa quorum-sensing circuit. J. Bacteriol. 188(9):
3365-3370. doi: 10.1128/JB.188.9.3365–3370.2006.
Li, L., and Faucher, S.P. 2016. The membrane protein LasM promotes the culturability of
Legionella pneumophila in water. Front. Cell. Infect. Microbiol. 6: 113. doi:
10.3389/fcimb.2016.00113.
Li, L., Mendis, N., Trigui, H., and Faucher, S.P. 2015. Transcriptomic changes of Legionella
pneumophila in water. BMC Genomics 16(1): 1-21. doi: 10.1186/s12864-015-1869-6.
Li, L., Mendis, N., Trigui, H., Oliver, J.D., and Faucher, S.P. 2014. The importance of the viable
but non-culturable state in human bacterial pathogens. Front. Microbiol. 5: 258. doi:
10.3389/fmicb.2014.00258.
MacRitchie, D.M., Buelow, D.R., Price, N.L., and Raivio, T.L. 2008. Two-component signaling
and Gram negative envelope stress response systems. In Bacterial Signal Transduction:
Networks and Drug Targets. Edited by R. Utsumi. Springer New York, New York, NY.
pp. 80-110.
Mendis, N., McBride, P., and Faucher, S.P. 2015. Short-term and long-term survival and
virulence of Legionella pneumophila in the defined freshwater medium Fraquil. PLoS
One 10(9): e0139277. doi: 10.1371/journal.pone.0139277.
Moffat, J.F., and Tompkins, L.S. 1992. A quantitative model of intracellular growth of
Legionella pneumophila in Acanthamoeba castellanii. Infect. Immun. 60(1): 296-301.
Morel, F.M.M., Westall, J.C., Rueter, J.G., and Chaplick, J.P. 1975. Description of the algal
growth media “Aquil” and “Fraquil”. In Technical Note 16. Massachusetts Institute of
Technology, Cambridge.
Nasser, W., and Reverchon, S. 2007. New insights into the regulatory mechanisms of the LuxR
Page 23 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
24
family of quorum sensing regulators. Anal. Bioanal. Chem. 387(2): 381-390. doi:
10.1007/s00216-006-0702-0.
O’Connor, T.J., Adepoju, Y., Boyd, D., and Isberg, R.R. 2011. Minimization of the Legionella
pneumophila genome reveals chromosomal regions involved in host range expansion.
Proc. Natl. Acad. Sci. 108(36): 14733-14740. doi: 10.1073/pnas.1111678108.
Pruckler, J.M., Benson, R.F., Moyenuddin, M., Martin, W.T., and Fields, B.S. 1995. Association
of flagellum expression and intracellular growth of Legionella pneumophila. Infect.
Immun. 63(12): 4928-4932.
Roy, C.R., and Isberg, R.R. 1997. Topology of Legionella pneumophila DotA: an inner
membrane protein required for replication in macrophages. Infect. Immun. 65(2): 571-
578.
Sadosky, A.B., Wiater, L.A., and Shuman, H.A. 1993. Identification of Legionella pneumophila
genes required for growth within and killing of human macrophages. Infect. Immun.
61(12): 5361-5373.
Schell, U., Simon, S., Sahr, T., Hager, D., Albers, M.F., Kessler, A., et al. 2016. The α-
hydroxyketone LAI-1 regulates motility, Lqs-dependent phosphorylation signalling and
gene expression of Legionella pneumophila. Mol. Microbiol. 99(4): 778-793. doi:
10.1111/mmi.13265.
Segal, G. 2013. The Legionella pneumophila two-component regulatory systems that participate
in the regulation of Icm/Dot effectors. In Molecular Mechanisms in Legionella
Pathogenesis. Edited by H. Hilbi. Springer-Verlag Berlin Heidelberg. pp. 35-52.
Spirig, T., Tiaden, A., Kiefer, P., Buchrieser, C., Vorholt, J.A., and Hilbi, H. 2008. The
Legionella autoinducer synthase LqsA produces an α-hydroxyketone signaling molecule.
Page 24 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
25
J. Biol. Chem. 283(26): 18113-18123. doi: 10.1074/jbc.M801929200.
Steinert, M., Emödy, L., Amann, R., and Hacker, J. 1997. Resuscitation of viable but
nonculturable Legionella pneumophila Philadelphia JR32 by Acanthamoeba castellanii.
Appl. Environ. Microbiol. 63(5): 2047-2053.
Stintzi, A. 2003. Gene expression profile of Campylobacter jejuni in response to growth
temperature variation. J. Bacteriol. 185(6): 2009-2016. doi: 10.1128/jb.185.6.2009-
2016.2003.
Stout, J.E., Yu, V.L., and Best, M.G. 1985. Ecology of Legionella pneumophila within water
distribution systems. Appl. Environ. Microbiol. 49(1): 221-228.
Subramoni, S., and Venturi, V. 2009. LuxR-family ‘solos’: bachelor sensors/regulators of
signalling molecules. Microbiology 155(5): 1377-1385. doi: 10.1099/mic.0.026849-0.
Tanner, J.R., Li, L., Faucher, S.P., and Brassinga, A.K.C. 2016. The CpxRA two-component
system contributes to Legionella pneumophila virulence. Mol. Microbiol. 100(6): 1017-
1038. doi: 10.1111/mmi.13365.
Tiaden, A., Spirig, T., Weber, S.S., Brüggemann, H., Bosshard, R., Buchrieser, C., et al. 2007.
The Legionella pneumophila response regulator LqsR promotes host cell interactions as
an element of the virulence regulatory network controlled by RpoS and LetA. Cell.
Microbiol. 9(12): 2903-2920. doi: 10.1111/j.1462-5822.2007.01005.x.
Trigui, H., Dudyk, P., Oh, J., Hong, J.-I., and Faucher, S.P. 2014. A regulatory feedback loop
between RpoS and SpoT supports the survival of Legionella pneumophila in water. Appl.
Environ. Microbiol. 81(3): 918-928. doi: 10.1128/AEM.03132-14.
Türetgen, I., Sungur, E.I., and Cotuk, A. 2005. Enumeration of Legionella pneumophila in
cooling tower water systems. Environ. Monit. Assess. 100(1): 53-58. doi:
Page 25 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
26
10.1007/s10661-005-7058-3.
Zhang, L., Jia, Y., Wang, L., and Fang, R. 2007. A proline iminopeptidase gene upregulated in
planta by a LuxR homologue is essential for pathogenicity of Xanthomonas campestris
pv. campestris. Mol Microbiol 65(1): 121-136. doi: 10.1111/j.1365-2958.2007.05775.x.
Zusman, T., Aloni, G., Halperin, E., Kotzer, H., Degtyar, E., Feldman, M., et al. 2007. The
response regulator PmrA is a major regulator of the icm/dot type IV secretion system in
Legionella pneumophila and Coxiella burnetii. Mol. Microbiol. 63(5): 1508-1523. doi:
10.1111/j.1365-2958.2007.05604.x.
Page 26 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
27
Figure captions
Fig.1. Optical density at 600 nm of the WT strain and deletion mutant ∆lpg2524 grown in rich
medium for 32 hours. Data shown are the mean and SD of three biological replicates.
Fig. 2. Growth of the WT strain, mutant ∆lpg2524 and negative control dotA mutant inside (a) A.
castellanii or (b) THP-1 macrophages. CFU was monitored daily and the log ratio between the
CFU on individual day (CFUT) and the initial CFU (CFU0) was calculated. Data shown are the
mean and SD of three biological replicates.
Fig. 3. Survival of the WT strain, mutant strain ∆lpg2524 and complemented strain
∆lpg2524+plpg2524 suspended in water at (a) 25°C, (b) 37°C and (c) 42°C. The initial OD600 of
all samples was approximately 0.02. Significant differences between WT and other strains were
determined by one-tailed unpaired Student’s t test (* p<0.05; ** p<0.005; *** p<0.0005). DL
indicates detection limit. (d) Percentage of viable and dead cells in different strains exposed to
water at 42°C for 7 weeks. Live/Dead staining together with flow cytometry was used to analyze
5000 cells in each replicate. Data shown are the mean (and SD) of three biological replicates.
Fig. 4. Survival of the WT strain and the over-expression strain WT+plpg2524i in water at 42°C.
WT+plpg2524i OFF means the over-expression of lpg2524 was not induced, whereas
WT+plpg2524i ON means the over-expression of lpg2524 was induced with 1 mM IPTG. Data
shown are the mean and SD of three biological replicates. One-tailed unpaired Student’s t test
was used to assess significant differences against WT (* p<0.05; ** p<0.005; *** p<0.0005). DL
indicates detection limit.
Page 27 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
28
Fig. 5. Survival of the WT strain, mutant strain ∆lpg2524 and complemented strain
∆lpg2524+plpg2524 in water at 42°C at an OD600 of 1.0. Data shown are the mean and SD of
three biological replicates. Significant differences between WT and other strains were
determined by one-tailed unpaired Student’s t test (* p<0.05). DL indicates detection limit.
Page 28 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
29
Tables
Table 1. Bacterial strains used in this study
Name Relevant genotype Reference
Legionella pneumophila strain Philadelphia-1
JR32 r-m
+, Sm
R (Sadosky et al. 1993)
KS79 (WT) JR32 ∆comR (de Felipe et al. 2008)
LELA3118 (dotA mutant) JR32 dotA::Tn903dIIlacZ (Sadosky et al. 1993)
LM1376 (rpoS mutant) JR32 rpoS::Tn903dGent, GmR (Hales and Shuman
1999)
SPF176 (prpoS) LM1376 pSF49 (Trigui et al. 2014)
SPF248 (∆lasM) KS79 ∆lpg1659, KnR This work
SPF294 (∆lasM+plasM) SPF248 pSF83, KnRCm
R This work
SPF298 (WT+plasMi) KS79 pSF73, CmR This work
Escherichia coli
DH5α supE44 ∆lacU169 (Φ80 lacZ∆M15)
hsdR17 recA1 endA1 gyrA96 thi-1 relA1
Invitrogen
pMMB207C DH5α, ∆mobA, CmR (Charpentier et al.
2008)
pSF6 DH5α, pGEMT-easy-rrnb (Faucher et al. 2011)
pSF49 DH5α, pMMB207C-ptac-rpoS, CmR (Trigui et al. 2014)
pSF73 DH5α, pMMB207C-ptac-lpg1659, CmR This work
pSF83 DH5α, pXDC39-plpg1659-lpg1659, CmR This work
pXDC39 DH5α, pMMB207c, ∆Ptac,∆lacI, CmR Xavier Charpentier
Page 29 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
30
Table 2. Primer sequences used in this study
Name Sequence (5’�3’)*
2524_UpF GGCAAGACAGTTCTGGAGTCC
2524_UpR CAGTCTAGCTATCGCCATGTAGTTAGAGAACTTCTGATCCCG
2524_DownF GATGCTGAAGATCAGTTGGGTCCCTACTGACTCAAAAACAGC
2524_DownR GAATGATCTTCACTCAACAATGC
2524_KnF CGGGATCAGAAGTTCTCTAACTACATGGCGATAGCTAGACTG
2524_KnR GCTGTTTTTGAGTCAGTAGGGACCCAACTGATCTTCAGCATC
Com2524F_SacI CCGGAGCTCTGAGACAATGCCATTGTCTGG
Com2524F2_SacI CCGGAGCTCATGAATGCCCAATCCAGAATG
Com2524R_XbaI CGCTCTAGATGAGTCAGTAGGGGTTATGTC
Kn-F TACATGGCGATAGCTAGACTG
Kn-R ACCCAACTGATCTTCAGCATC
pXDC39-F GCTTCCACAGCAATGGCATCC
PromF CGTATAATGTGTGGAATTGTGAG
* The underlined bases indicate restriction sites.
Page 30 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Optical density at 600 nm of the WT strain and deletion mutant ∆lpg2524 grown in rich medium for 32 hours. Data shown are the mean and SD of three biological replicates.
Fig. 1
73x42mm (300 x 300 DPI)
Page 31 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Growth of the WT strain, mutant ∆lpg2524 and negative control dotA mutant inside (a) A. castellanii or (b) THP-1 macrophages. CFU was monitored daily and the log ratio between the CFU on individual day (CFUT) and the initial CFU (CFU0) was calculated. Data shown are the mean and SD of three biological replicates.
Fig. 2 152x169mm (300 x 300 DPI)
Page 32 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Survival of the WT strain, mutant strain ∆lpg2524 and complemented strain ∆lpg2524+plpg2524 suspended in water at (a) 25°C, (b) 37°C and (c) 42°C. The initial OD600 of all samples was approximately 0.02.
Significant differences between WT and other strains were determined by one-tailed unpaired Student’s t test (* p<0.05; ** p<0.005; *** p<0.0005). DL indicates detection limit. (d) Percentage of viable and dead
cells in different strains exposed to water at 42°C for 7 weeks. Live/Dead staining together with flow cytometry was used to analyze 5000 cells in each replicate. Data shown are the mean (and SD) of three
biological replicates. Fig. 3
143x76mm (300 x 300 DPI)
Page 33 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Survival of the WT strain and the over-expression strain WT+plpg2524i in water at 42°C. WT+plpg2524i OFF means the over-expression of lpg2524 was not induced, whereas WT+plpg2524i ON means the over-expression of lpg2524 was induced with 1 mM IPTG. Data shown are the mean and SD of three biological
replicates. One-tailed unpaired Student’s t test was used to assess significant differences against WT (* p<0.05; ** p<0.005; *** p<0.0005). DL indicates detection limit.
Fig. 4 72x36mm (300 x 300 DPI)
Page 34 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Survival of the WT strain, mutant strain ∆lpg2524 and complemented strain ∆lpg2524+plpg2524 in water at 42°C at an OD600 of 1.0. Data shown are the mean and SD of three biological replicates. Significant
differences between WT and other strains were determined by one-tailed unpaired Student’s t test (* p<0.05). DL indicates detection limit.
Fig. 5 72x36mm (300 x 300 DPI)
Page 35 of 35
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology