Post on 08-Aug-2020
transcript
DROSOPHILA COUCH POTATO MUTANTS EXHIBIT COMPLEX NEUROLOGICAL
ABNORMALITIES INCLUDING EPILEPSY PHENOTYPES
Edward Glasscock* and Mark A. Tanouye*,†
*Department of Molecular and Cell Biology
Division of Neurobiology
†Department of Environmental Science, Policy and Management
Division of Insect Biology
University of California
Berkeley, CA 94720
Genetics: Published Articles Ahead of Print, published on January 31, 2005 as 10.1534/genetics.104.028357
TANOUYE--2
RUNNING HEAD:
Couch potato Epilepsy Phenotypes
KEY WORDS:
Epilepsy, seizure, RNA-binding protein, bang-sensitive, couch potato
Corresponding Author:
Mark A. Tanouye
Department of Environmental Science, Policy, and Management
Life Sciences Addition, Rm. 131A
University of California
Berkeley, CA 94720
(510) 642-9404
(510) 643-6791 (FAX)
tanouye@uclink4.berkeley.edu
TANOUYE--3
ABSTRACT
RNA-binding proteins play critical roles in regulation of gene expression and impairment can
have severe phenotypic consequences on nervous system function. We report here the discovery
of several complex neurological phenotypes associated with mutants of couch potato (cpo), that
encodes a Drosophila RNA-binding protein. We show that mutation of cpo leads to bang-
sensitive paralysis, seizure susceptibility, and synaptic transmission defects. A new cpo allele
called cpoEG1 was identified based on a bang-sensitive paralytic mutant phenotype in a sensitized
genetic background (sda/+). In heteroallelic combinations with other cpo alleles, cpoEG1 shows
an incompletely penetrant bang-sensitive phenotype with ~30% of flies paralyzing. In response
to electroconvulsive shock, heteroallelic combinations with cpoEG1 exhibit seizure thresholds less
than half that of wild-type flies. Finally, cpo flies display several neurocircuit abnormalities in
the giant fiber (GF) system. The TTM muscles of cpo mutants exhibit long latency responses
coupled with decreased following frequency. DLM muscles in cpo mutants show drastic
reductions in following frequency despite exhibiting normal latency relationships. The labile
sites appear to be the electro-chemical GF-TTMn synapse and the chemical PSI-DLMn
synapses. These complex neurological phenotypes of cpo mutants support an important role for
cpo in regulating proper nervous system function, including seizure susceptibility.
TANOUYE--4
INTRODUCTION
RNA-binding proteins perform myriad crucial roles throughout the life of an RNA
molecule in eukaryotes. Subsequent to their genesis in the nucleus during transcription, pre-
messenger RNAs (pre-mRNAs) are bound by RNA-binding proteins, which mediate their
maturation into mRNAs via processing reactions, such as splicing, editing, capping, and
polyadenylation. RNA-binding proteins then assist in transporting mRNAs to the cytoplasm
where they are instrumental in regulating the translation, stability, and localization of the
transcripts. In addition to translated RNAs, the discovery of regulatory non-translated RNA
genes, termed microRNAs because of their minuscule size (<100 nucleotides) suggests
additional functions for RNA-binding proteins (Ambros 2001). Thus, RNA-binding proteins
serve a most critical role in the control of gene expression, especially in the nervous system
where extensive alternative splicing occurs and aberrations frequently result in neurological
disease.
Many neurological disorders result when the performance of RNA-binding proteins goes
awry, highlighting their importance in the maintenance of fundamental neuronal processes. For
example, in the human neurological condition paraneoplastic opsoclonus myoclonus ataxia
(POMA), patients lose inhibitory control of motor neurons in spinal cord and brainstem. POMA
is associated with the ectopic expression of the NOVA family of RNA-binding proteins, which
regulate neuron-specific alternative splicing (Jensen et al. 2000). In humans with Fragile X
syndrome, impaired expression of the cytoplasmic RNA-binding protein, FMRP, leads to mental
retardation, likely resulting from misregulation of mRNA transport or translation (Perrone-
Bizzozero and Bolognani 2002).
TANOUYE--5
Several neurological disorders that have been characterized in animal models with
defective RNA-binding proteins include jerky and quaking in mice and pumilio in Drosophila.
The jerky mice exhibit temporal lobe epilepsy analogous to the most common seizure disorder in
human adults. The jerky gene encodes an RNA-binding protein postulated to regulate mRNA
usage in neurons, which is inactivated in the mutant (Liu et al. 2002). The quaking mice exhibit
tonic-clonic seizures and hypomyelination. An RNA-binding protein involved with mRNA
nuclear export appears responsible for the “quaking” defects (Larocque et al. 2002). In
Drosophila, pumilio mutants show defects in embryonic development and maintainence of
neuronal excitability. The pumilio mutant exhibits increased rates of long-term facilitation at the
larval neuromuscular junction (Schweers et al. 2002). The pumilio gene has been shown to
encode an RNA-binding protein that acts as a translational repressor (Wreden et al. 1997).
The work presented here examines a Drosophila RNA-binding protein gene called couch
potato (cpo) that causes several neurological abnormalities including epilepsy phenotypes when
impaired. The cpo gene was originally identified in a screen for genes expressed in sensory organ
precursor cells during peripheral nervous system (PNS) development (Bellen et al. 1992a). Cpo
protein is localized to the nucleus and is expressed in the PNS and central nervous system (CNS)
of embryos, larvae, and adults, as well as other tissues such as midgut, glia, and salivary glands
(Bellen et al. 1992b). The protein contains an RNA recognition motif (RRM) and a nuclear
localization sequence (Bellen et al. 1992b). The RRM domain of cpo shows homology to the
hermes gene of M. musculus, G. gallus and Xenopus laevis; the C. elegans gene mec-8 and the
human gene RBP-MS (Gerber et al. 1999; Lundquist et al. 1996; Shimamoto et al. 1996). The
cpo gene has also been linked to the human neurodegenerative disorder spinocerebellar ataxia
type 1 (SCA1). The defective human SCA-1 gene causes neurodegeneration when expressed in
TANOUYE--6
Drosophila; this phenotype is enhanced by overexpressing cpo (Fernandez-Funez et al. 2000).
Partial loss of function mutations of Drosophila cpo cause a variety of behavioral phenotypes
including overall sluggishness and abnormal phototaxis, geotaxis, flight ability, ether recovery,
and mating vigor (Bellen et al. 1992a; Hall 1994).
In this paper, we identify a new cpo allele, cpoEG1. Electrophysiological analysis shows
that the cpoEG1 mutation contributes to numerous defects in the giant fiber (GF) neural circuit.
Additionally, the cpoEG1mutation contributes to increased seizure susceptibility manifested as
seizure thresholds that are less than half that of wild-type flies. We have examined existing cpo
alleles and have shown that they fail to complement the electrophysiological defects associated
with cpoEG1. Taken together, these findings suggest a neurological basis for the complex cpo
behavioral defects described previously. In addition to the previously postulated role that cpo
plays in PNS differentiation and normal adult behavior, this work provides evidence that RNA-
binding proteins are also essential for the proper functioning of synapses in the adult CNS and
for regulating susceptibility to seizure.
TANOUYE--7
METHODS
Fly stocks: The cpo gene is located on the third chromosome at map location 90D1-6 and
encodes a putative RNA-binding protein (Bellen et al. 1992b). The mutant cpo allele, cpoEG1,
was identified in a screen that selected for bang-sensitive paralytic mutant phenotypes revealed
in a sensitized genetic background provided by slamdance heterozygotes (sda/+) (Zhang et al.
2002). The screen utilized P-element hybrid dysgenesis with the transposon P[lacZ, w+]. In
brief, mutants were isolated in a mating of X^X, 8:P[lacZ, w+]/Y; ry Sb P[ry+ delta2.3]/+
females crossed to w/Y; sda males. Exceptional w/Y; sda/+ male progeny that showed bang-
sensitive paralysis were individually crossed to set up appropriate stocks. The cpoEG1 allele has
previously been called line N (Zhang et al. 2002). Five additional cpo alleles: cpocp1, cpocp2,
cpov3, cpol2, and cpol∆cp11, were obtained as a generous gift (H. Bellen, Baylor College of
Medicine). The cpocp1 and cpocp2 alleles are due to 17-kb P[lArB] insertions at scaffold position
1229712298. The cpocp1, cpocp2, and cpov3 alleles have been reported as viable with delayed
development (Bellen et al. 1992a); at present, they behave as recessive lethals. The cpov3 allele is
due to a 10-kb P[lacZ, w+] insertion at 1230512306. The cpol2 allele is due to a P[lacZ, w+]
insertion at 1229712298. The cpol∆cp11 allele is due to 200-bp deletion of the cpo promoter,
causing a loss of cpo expression, except in the chordotonal neurons, which express Cpo later in
development than wild-type (Bellen et al. 1992a, b). The cpol2 and cpol∆cp11 alleles behave as
recessive lethals. Note that scaffold position 1229712298 appears to be a hot-spot for
transposon insertions since at least seven of the known cpo alleles map to this position. This hot-
spot is 38-bp upstream of the cpo transcription start site. The cpo∆125 allele was generated in this
work as a precise excision of the P-element in cpoEG1 flies that reverts cpoEG1 phenotypes to
wild-type. The slamdance (sda) gene maps to 97D and encodes an aminopeptidase N (Zhang et
TANOUYE--8
al. 2002). The sda allele utilized was sdaiso7.8, caused by a 2-bp insertion in the 5’ untranslated
region. The sda mutation causes seizure sensitivity and bang-sensitive paralysis (Zhang et al.
2002). Duplication and deficiency mapping for cpoEG1 was done using the following strains
obtained from the Bloomington Stock Center at Indiana University: Df(3R)P-14=Df(3R) 90C2-
D1;91A1-2 and Tp(3;Y)L58=Tp(3;Y) 88D;93D;Y. Stocks were maintained on standard
cornmeal-molasses medium at 21-24°C. Other markers and stocks are described in Lindsley and
Zimm (1992).
Behavioral testing: Testing for BS paralysis was performed on flies 1-4 days posteclosion. BS
paralysis was assayed by transferring the flies to a clean empty food vial (Applied Scientific) and
then vortexing on a VWR vortex at maximum setting for 10-s. Any fly that lay motionless
following the vortex was scored BS. Flies were considered recovered when they were able to
resume an upright standing position. Flies were rested for a minimum of 2 hrs following CO2
anesthesia prior to testing.
Electrophysiology: Electrophysiology was performed on male flies using methods previously
described to stimulate and record giant fiber (GF)-driven muscle potentials and seizures (Kuebler
and Tanouye 2000). Briefly, the fly was removed from a food vial by sucking onto its head with
a 23-gauge syringe needle attached to a vacuum line. Another syringe needle was then used to
suck onto the abdomen, thereby completely immobilizing the fly. The fly was then mounted by
gluing a tungsten wire across the fly’s neck. In experiments, the GF was driven by brain
stimulation via bipolar tungsten electrodes inserted through the ventral antennal margin and into
the brain. The preparations were grounded by placing an electrode into the abdomen.
Stimulating, recording, and ground electrodes were all made from uninsulated tungsten wire
(WPI 0.075 mm), electrolytically sharpened to the desired diameter, usually less than one
TANOUYE--9
micron. Experiments requiring thoracic ganglion stimulation of DLM and TTM motoneurons
were conducted similarly except that stimulating electrodes were bent at 45° angles and inserted
just through the anterior pre-episternum, near the base of the first coxa, as described in Kuebler
and Tanouye 2000.
To assess GF circuit performance, single pulses of 0.2-ms were used. Latency and
following frequency experiments were done at 21-24°C on flies that were ≤ 7 days posteclosion,
unless otherwise noted. The latency was the time from the end of the stimulus pulse to the
beginning of the evoked muscle response. Following frequency was the highest frequency at
which the muscle responded to 19 out of 20 pulses at stimulation intensity 1.4 times the GF
threshold. Flies were allowed to rest at least 1 min between following frequency trials. GF
thresholds were defined as the lowest voltage that elicits a stable, short latency (~1.4 ms) dorsal
longitudinal muscle (DLM) response.
Seizures were elicited by delivering a short wavetrain (0.5 ms pulses at 200 Hz for 300
ms) of high-frequency electrical stimuli (HFS) to the brain. Electroconvulsive shock (ECS) is
HFS of sufficient intensity (i.e. above threshold) to elicit seizure. Seizures consist of aberrant
high-frequency activity in at least seven different muscle groups and over 30 muscle fibers in the
thorax (Kuebler and Tanouye 2000). This seizure-like activity in a particular muscle corresponds
to activity in the motoneuron that innervates it. Seizure is followed by a period of synaptic
failure in the GF pathway (Pavlidis and Tanouye 1995). In this work, seizures were monitored by
DLM activity. Recovery time was assessed as the time required to elicit four consecutive stable
DLM responses following a buzz using a GF stimulation rate of 0.5 Hz.
Molecular mapping of cpoEG1: Plasmid rescue of genomic DNA was used to determine the
approximate insertion site of the P-element in cpoEG1 flies (Wilson et al. 1989). Genomic DNA
TANOUYE--10
(2-5 µg) was digested with EcoRI and fragments were self ligated with T4 DNA ligase. Ligated
products were transformed into XL-1 Blue electrocompetent cells (Stratagene) and the
transformants selected on kanamycin (10 mg/ml) plates. Plasmid DNA from positive clones
(Amp+) was isolated and the genomic fragment DNA sequenced using a primer complementary
to a site near the end of the P-element sequence (CGACGGGACCACCTTATGTTATTT
CATCATG). The exact insertion site was then determined by sequencing back toward the P-
element using a primer specific for the flanking genomic fragment
(GCACGAGACGAGCAGCTA).
Anatomy of the GF system: GF morphology was examined by X-gal staining, utilizing a 2nd
chromosome enhancer trap line P[GAL4]A307 that expresses Gal4 predominantly in the GFs
(Phelan et al. 1996; Allen et al. 1998). Mutant cpo flies were generated with A307 in
heterozygous combination with a 2nd chromosome UAS-lacZ insertion to drive β-galactosidase
expression in the GFs. The nervous systems of these A307/+ UAS-lacZ/+; cpo flies were
dissected in phosphate-buffered saline (PBS) and fixed in 0.5% glutaraldehyde in PBS for 15-30
minutes. These whole-mount preparations were then washed in 0.1% Triton-X 100 in PBS (PBT)
and stored for up to 1 day at 4°C. For β-galactosidase detection, the tissues were equilibrated
with staining solution (5 mM K3Fe(CN)6, 5 mM K3Fe(CN)6, 3 mM MgCl2 in PBT) for 10
minutes at 37°C and then incubated in freshly prepared 0.08% X-gal (5-bromo-4-chloro-3-
indolyl-β-D-galactopyranoside) in staining solution at 37°C for about 2 hours. Following
staining, the tissues were washed twice in PBS and then dehydrated in a 50-100% ethanol series.
The dehydrated tissues were then cleared and mounted using xylenes.
TANOUYE--11
RESULTS
Isolation of the cpoEG1 mutation: The cpoEG1 mutation was identified in a P-element
mutagenesis screen for new seizure-sensitive mutants that utilized sda heterozygotes as a
sensitized genetic background (Zhang et al. 2002). Subsequent mapping and complementation
tests showed that cpoEG1 is an allele of cpo. Behavioral and electrophysiological analysis showed
that cpoEG1 and other cpo alleles differ from canonical members of the bang-sensitive (BS)
paralytic class of Drosophila. The cpo mutations are pleiotropic: seizure-sensitivity is only one of
numerous neurological abnormalities.
Seizure-sensitivity is associated with members of the BS paralytic class of behavioral
mutants including sda (Pavlidis and Tanouye 1995; Kuebler and Tanouye 2000). BS mutants
display a unique behavioral response to mechanical shock, such as a brief vortex. When
subjected to such a mechanical stimulus, BS flies display bouts of hyperactivity, marked by wing
flapping, leg shaking, and abdominal contractions. After a few seconds, this hyperactive episode
gives way to a period of temporary paralysis, in which the fly lies completely motionless for a
time of 30 s to a few minutes depending on genotype (Benzer 1971; Ganetzky and Wu 1982;
Pavlidis et al. 1994). Mutants of the bang-sensitive class include bang-sensitive (bas),
bangsenseless (bss), easily shocked (eas), slamdance (sda), and technical knockout (tko). The eas
gene encodes an ethanolamine kinase, sda encodes an aminopeptidase N, and tko enocodes a
mitochondrial protein (Pavlidis et al. 1994; Zhang et al. 2002; Royden et al. 1987).
Heterozygotes of sda appear to be a useful tool for detecting new seizure-sensitive
mutants. Seizure threshold measured electrophysiologically is 21.0 ± 0.6 V ECS for sda/+ flies,
in-between the threshold for sda homozygotes (6.2 ± 0.8 V ECS) and CS wild type flies (30.1 ±
3.8 V ECS) (J. Tan, personal communication; Kuebler et al. 2001). Following mechanical
TANOUYE--12
stimulation, most sda/+ flies (>98%) exhibit normal behavior, but a few exhibit BS paralysis
(Zhang et al. 2002). Our interpretation from this is that the sda/+ genetic background is
sensitized for seizures indicated especially by the few flies that display BS paralysis. We infer
further that mutations increasing the percentage of flies paralyzed by mechanical stimulation
would indicate new seizure-sensitive mutants. The cpoEG1 mutation was isolated based on this
phenotype: a strain with the apparent genotype cpoEG1/+ sda/+ displayed 33% BS paralysis
following mechanical stimulation. The cpoEG1 mutants were analyzed for BS behavior
independent of the sda mutation. As heterozygotes, cpoEG1/+ flies show no paralysis following
mechanical stimulation. The behavior of cpoEG1 homozygotes could not be tested directly since
cpoEG1 causes recessive lethality.
Molecular and genetic basis of cpoEG1 mutation: The cpoEG1 mutation was mapped by both
molecular and genetic methods. Molecularly, plasmid rescue was used to isolate genomic DNA
flanking the insertion site of the P-element responsible for cpoEG1. This flanking DNA was then
sequenced and compared to the information available in the Drosophila genome database using
the Berkeley Drosophila Genome Project Blast program. This comparison identified the location
of the cpoEG1 insertion within the cpo gene in the 90D1-6 region of the third chromosome (Fig.
1). By sequencing the flanking genomic DNA back towards the P-element, the exact location of
the insertion was identified. The P-element responsible for the cpoEG1 mutation is inserted in an
intron 38-bp upstream of the transcription start site, between nucleotides 12297 and 12298 of
genomic scaffold AE003720 (release 3), corresponding to nucleotides 415 and 416 of the Cpo
61.1 cDNA described in Bellen et al. (1992b).
The location of cpoEG1 is situated between binding sites for several transcription factors
and the transcription start site and appears to be a hot-spot for P-element insertion. At least 10
TANOUYE--13
cpo P-element alleles have been mapped to the same 100-bp region of 90D, especially between
nucleotides 12297 and 12298 where cpoEG1 is inserted. Interestingly, six other cpo alleles share
the exact same insertion site as cpoEG1: alleles cpocp1, cpocp2, cpol2, cpol3, cpol6, and cpov2. The
different insertions produce different phenotypes apparently dependent on size, orientation, and
type (Bellen et al. 1992a,b). The cpocp1 and cpocp2 mutations are hypomorphic 17-kb P[lArB]
insertions that cause adult behavioral defects. The cpov2 mutation is a 10-kb P[lacZ, w+]
insertion that produces no discernible phenotype and is inserted in the opposite orientation
relative to the other alleles. The cpoEG1 mutation appears identical to the recessive lethal
mutations cpol2, cpol3, and cpol6. All are caused by 10-kb P[lacZ, w+] insertions at the exact
same site and all result in homozygous lethality.
Complementation analysis and deficiency and duplication mapping also confirms that the
cpoEG1 mutation is a new allele of cpo. The cpoEG1 mutation fails to complement lethality of cpol2
and cpol∆cp11. The cpo deletion Df(3R)P-14 fails to complement the lethality of cpoEG1.
Conversely, the cpo duplication Tp(3;Y)L58 complements cpoEG1. Furthermore, cpoEG1
phenotypes are reverted to wild-type by precise excision of the P-element, as seen in cpo∆125
flies.
Sequence analysis of the cpo gene: Analysis of the cpo gene sequence reveals three putative
ORFs which encode proteins containing a nuclear localization sequence, an OPA repeat, and a
conserved RNA-recognition motif (RRM) (Bellen et al. 1992b). Between residues 1-193 of Cpo
61.1 protein, cpo possesses a putative bipartite nuclear localization signal suggesting a role for
cpo in the nucleus. This assertion is corroborated by the results of antibody staining, which
shows that Cpo protein is localized to the nucleus (Bellen et al. 1992b). Cpo protein also
contains an OPA repeat between amino acids 194-296, implying a neural role for cpo that is
TANOUYE--14
supported by the behavioral, electrophysiological, and expression phenotypes of cpo (Bellen et
al. 1992b). OPA repeats were first discovered in the neurogenic gene Notch, which is important
for differentiation of the PNS (Wharton et al. 1985). They consist of glutamine dense regions of
CAG and CAA repeats and although their importance is not fully understood, they commonly
appear in neural specific proteins such as Notch. Similar long stretches of glutamine residues are
also common in neural specific genes such as Huntingtin, where they frequently show unstable
expansion to pathological lengths, leading to neurodegenerative disorders (Reddy et al. 1999).
Interestingly, cpo has been linked to the trinucleotide repeat disease spinocerebellar ataxia type 1
(SCA1). Overexpression of cpo enhances a SCA1-induced neurodegeneration phenotype in a
Drosophila model of the disease (Fernandez-Funez et al. 2000).
Cpo protein also contains a single RRM in the 61.1 and 61.2 cDNAs that shows
significant homology (>65% identical residues) to RRM domains in the hermes gene of M.
musculus, G. gallus, and X. laevis; the C. elegans gene, mec-8, and the human gene, RBP-MS
(Gerber et al. 1999; Lundquist et al. 1996; Shimamoto et al. 1996). RRM domains consist of 80-
100 amino acids and are usually present in one to four copies in proteins that bind pre-mRNA,
poly(A) RNA, heterogeneous nuclear RNA (hnRNA), and small nuclear RNA (snRNA). An
individual RRM domain contains two conserved sequences called RNP1 and RNP2, which are
necessary for binding to RNA, and the overall secondary structure β1α1β2β3α2β4, where the
RNP1 and RNP2 sequences correspond to β1 and β3, respectively. Specificity of binding is
conferred by the amino acids in the loop connecting β2 and β3 and by the residues at the termini
of the RRM (Burd and Dreyfuss 1994). Of the genes with homology to the RRM domain of cpo,
hermes and RBP-MS contain a single RRM domain as does cpo, while mec-8 contains two RRM
domains. The hermes protein shows nuclear and cytopolasmic localization and is proposed to
TANOUYE--15
play a role in heart development, possibly by regulating translation or mRNA stability (Gerber et
al. 2002). The mec-8 protein is nuclearly localized and mutants show embryonic lethality and
adult chemosensory and mechanosensory neuronal defects associated with impaired body muscle
attachments, resulting from defective alternative splicing (Lundquist and Herman 1994;
Lundquist et al. 1996). The RBP-MS gene was originally identified in the search for the gene
responsible for the premature aging disease Werner syndrome, which has since been identified
and it is not associated with RBP-MS. At this time, no expression data or function is known for
RBP-MS, but computer simulations support the idea that RBP-MS can bind to RNA
(Sahasrabudhe et al. 1998). Of these genes, mec-8 seems to align most closely with cpo in
expression and phenotype. Both exhibit nuclear localization and both are associated with nervous
system developmental defects. In addition, cpo and mec-8 both possess alanine and glutamine
(AQ) rich regions that are also common in other neural specific proteins with RRM domains,
such as embryonic lethal abnormal vision (elav) and musashi (Lundquist et al. 1996; Robinow et
al. 1986; Nakamura et al. 1994). It should be noted however that the homology of cpo to hermes,
mec-8, and RBP-MS is limited to the RRM domains of these proteins. Regardless, the striking
similarity between the RRM domains of cpo and these genes indicates that they may bind similar
targets and may act in similar pathways. When taken as a whole, the sequence, localization, and
phenotype of cpo seem to indicate an important role for cpo in regulating nervous system
specific transcripts required for proper nervous system function, possibly by mediation of
alternative splicing or RNA export out of the nucleus.
The cpo BS paralytic behavior: Mutants of cpo have been shown to display a number of
behavioral abnormalities including sluggishness, abnormal phototaxis, geotaxis, flight, ether
recovery, and mating vigor (Bellen et al. 1992a; Hall 1994). Here, we show that cpo mutants also
TANOUYE--16
show BS paralytic behavior with viable heteroallelic combinations. We examined especially the
viable genotypes cpoEG1/cpocp1, cpoEG1/cpocp2, cpoEG1/cpov3, cpocp1/cpocp2, cpocp1/cpol2, and
cpocp2/cpol2. We confirmed cpoEG1/cpocp1 and cpoEG1/cpocp2 behavioral abnormalities of
sluggishness, abnormal phototaxis, geotaxis, flight, ether recovery, and mating vigor (data not
shown). Furthermore, we confirmed that cpov3 complements cpo behavioral abnormalities (data
not shown). These are consistent with the observations of Bellen et al. (1992a). The heteroallelic
combinations cpoEG1/cpocp1 and cpoEG1/cpocp2 show BS paralysis in 32% and 18% of flies,
respectively (Fig. 2). In addition, other viable combinations of the cpo alleles tested showed
some degree of paralysis following mechanical stimulation, except for combinations involving
cpov3 (Fig. 2). The ability of the cpov3 allele to complement the paralysis phenotype of cpo
mutants correlates with previous behavioral analysis (Bellen et al. 1992a).
The BS paralysis seen in cpo flies shares some similarities and differences with members
of the BS paralytic class of behavioral mutants. The paralytic phenotype of cpo flies shows
incomplete penetrance, unlike canonical members of the BS paralytic class, such as eas, bss, and
sda, in which 100% of flies paralyze following mechanical stimulation. Paralysis in cpo flies
usually lasts about 25-45 s, during which time the flies lay completely motionless with
occasional slight leg movement. This recovery time is similar to the time required for recovery in
sda, which ranges from 30-60 s, but it is much briefer than the recovery period observed in eas
and bss, which ranges from 60-300 s for both (Zhang et al. 2002). Unlike BS paralytics, which
experience a hyperactive phase during recovery, cpo mutants do not display hyperactivity as they
recover, but instead just right themselves to a standing position and resume normal behavior.
Upon recovery, cpo flies do not exhibit a well-defined refractory period like BS mutants.
Following BS paralysis, cpo mutants do not always re-paralyze, even when tested a day later,
TANOUYE--17
probably owing to the incomplete penetrance of the BS phenotype. Conversely, cpo mutants
that did not paralyze after vortexing, sometimes paralyze when tested later. The incomplete
penetrance of the paralysis phenotype coupled with the potential of all cpo flies to paralyze
suggests that cpo flies have a seizure susceptibility that is close to the threshold for manifestation
of the BS phenotype and that they consequently receive adequate stimulus to paralyze some of
the time, while other times they do not.
cpo flies have increased seizure susceptibility: All mutants showing BS paralytic behavioral
phenotypes, including bss, eas, and sda, have been found to have low seizure thresholds in
electrophysiology experiments. We examined seizure thresholds for cpo mutations in
heteroallelic combinations to examine correlates with the BS behavioral defect. The seizure
threshold here is defined as the minimum voltage required to elicit aberrant high-frequency DLM
motoneuron activity by administration of an electroconvulsive shock (ECS) to the brain of the
fly. However, it should be noted that previous work has shown that seizures are not limited to
the DLMs, but rather involve at least seven different muscle groups and greater than 30 thoracic
motoneurons. A seizure, which appears as intense, high frequency muscle activity, is followed
by a brief period of synaptic failure through the GF pathway during which time brain stimulation
fails to elicit DLM muscle potentials.
The cpoEG1/cpocp1 and cpoEG1/cpocp2 mutants exhibit significant reductions in seizure
threshold, with buzzes of 11.1 ± 3.7 V ECS (n=10) and 13.3 ± 4.8 V ECS (n=7), respectively,
sufficient to elicit seizures (Fig. 3 and Table 1). These values are about two to five times higher
than the other BS mutants, but still approximately two times lower than wild-type, placing cpo
flies in the unique position of being almost exactly intermediate between the known BS mutants
and wild-type with regards to seizure susceptibility. BS mutants have seizure thresholds that
TANOUYE--18
range from 3.2 ± 0.6 V (bss) to 6.2 ± 0.8 V (sda). Wild-type strains do not show seizure activity
until given high-frequency stimuli ranging from 25.5 ± 3.7 V (Berlin) to 39.3 ± 6.6 V (Oregon-
R) (Kuebler et al. 2001). Precise excision of cpoEG1 in cpo∆125 flies reverts the seizure threshold
to a wild-type level of 29.0 ± 4.5 V ECS (n=10). This intermediacy in seizure threshold
correlates with the BS paralytic behavior of cpo mutants, which shows only ~30% penetrance
compared with the 100% penetrance seen in the known BS mutants.
The seizures in cpo flies appear qualitatively similar to those observed in other BS
mutants with a few quantitative differences. Seizures in cpo flies exhibit the three phases that
are characteristic of Drosophila seizures: initial seizure, synaptic failure, and recovery seizure.
These three phases of seizure in cpo mutants differ quantitatively from those seen in other
genotypes as would be expected since each of these characteristics is genotype dependent. The
maximum response frequency during the initial seizure is reduced in cpo flies compared to other
BS mutants. In cpo flies, the maximum response frequency during the seizure usually ranges
between 20-40 Hz, whereas in other BS mutants the frequency can often approach 100 Hz. This
frequency reduction scales with the impaired following frequency of the DLMs in cpo flies,
which probably limits the attainable muscle firing frequency during seizure. The recovery period
following seizure in cpo flies is consistent with the durations seen in other BS mutants.
cpoEG1/cpocp1 and cpoEG1/cpocp2 flies show recovery times of 83.2 ± 23.8 s (n=5) and 98.6 ± 15.0
s (n=7), respectively, which is longer than the 48.9 ± 5.4 s recovery for eas and shorter than the
136 ± 6 s recovery for bss (J. Tan, personal communication). These recovery periods are
decidedly longer than the 29.9 ± 1.6 s recovery for wild-type Canton-S flies (J. Tan, personal
communication) and the 34.4 ± 7.2 s (n=5) and 39.1 ± 5.5 s (n=10) recovery times for cpoEG1/+
and cpo∆125/cpo∆125 flies, respectively. Also similar to other BS mutants, cpo flies always exhibit
TANOUYE--19
recovery seizures following synaptic failure. Finally, the decreased seizure threshold of cpo
mutants is not accompanied by a change in GF response threshold, a phenomenon also observed
in BS mutants (Fig. 3).
cpo acts as an enhancer of seizure mutation: The cpoEG1/+ mutation was identified based on
genetic interaction with the BS paralytic mutation sda. We examined some general features of
this interaction. In the behavioral screen that identified cpoEG1, this allele was found to function
as a dominant enhancer of the sda/+ BS paralytic phenotype. That is, about 33% of cpoEG1/+
sda/+ double heterozygotes showed BS paralysis (n=425), a substantially greater number than
sda/+ and cpoEG1/+ parentals, about 1% (n=257) and 0% (n=71), respectively. We examined the
possibility that other cpo alleles also act as enhancers. The double heterozygote cpol2/+ sda/+
showed about 44% BS paralysis (n=119). The double heterozygote cpocp1/+ sda/+ showed about
75% BS paralysis (n=93). We examined the possibility that cpoEG1 can enhance other BS
mutations by testing for interaction with eas. The double heterozygote eas/+; cpoEG1/+ showed
about 7% BS paralysis (n=149), greater than for the eas/+ parental that shows 0% BS paralysis
(n=103).
Interaction between cpo and sda is also observed in seizure threshold measured
electrophysiologically. We have shown previously that seizure threshold for sda/+ heterozygotes
is 21.0 ± 0.6 V ECS (J. Tan, personal communication). The cpoEG1 allele acts as a dominant
enhancer of seizure susceptibility: the cpoEG1/+ sda/+ double heterozygote has a seizure
threshold of 14.4 ± 3.1 V ECS (n=10). The cpocp1 allele also acts as a dominant enhancer of
seizure susceptibility: the cpocp1/+ sda/+ double heterozygote has a seizure threshold of 11.8 ±
1.6 V ECS (n=9). Excision of the P-element in cpoEG1 eliminates the sda enhancement
phenotype restoring the seizure threshold to 20.3 ± 1.1 V ECS (n=10) in cpo∆125/+ sda/+ flies.
TANOUYE--20
cpo flies exhibit synaptic defects in the GF system: Mutants of cpo show alterations in
GF-TTM response, but the basis for this defect is not known. In wild-type, this response is via a
monosynaptic pathway and has a characteristically short latency that is stable at high frequencies
of stimulation. In cpo mutants, this short latency response is replaced by a longer latency GF-
TTM response that cannot follow even moderate frequencies of stimulation. This appears to be
due to an alteration in the GF-TTM neurocircuit in the mutant. Possibilities for such a
neurocircuit alteration include, for example: a) an action potential conduction abnormality in the
GF, b) a synaptic transmission defect between the GF and the TTM motoneuron, c) an action
potential conduction abnormality in the TTM motoneuron, d) a synaptic transmission defect at
the TTM neuromuscular junction (nmj), or e) some other, more complex neurocircuit alteration.
The abnormality in the GF-TTM pathway does not appear to be due to the TTM motoneuron or
the TTM nmj. This is indicated by direct electrical stimulation of the TTM motoneuron showing
that the cpo mutant response is similar to wild-type in latency and following frequency. The
latency of the TTM response following direct motoneuron stimulation for cpoEG1/cpocp1 is about
0.4 ms, which is similar to the CS wild-type latency of 0.66 ± 0.05 ms (Tanouye and Wyman
1980). The following frequencies of the TTM response following direct motoneuron stimulation
for cpoEG1/cpocp1 and CS are both greater than 100 Hz. The defect in the GF-TTM pathway is
probably not due to an action potential conduction abnormality of the GF. This is inferred from
an examination of the GF-DLM response in cpo mutants which is normal in latency and although
measurably impaired in following frequency, is markedly less impaired than the GF-TTM
response (Fig. 4 and Table 1). From this we infer that the latency abnormality of the GF-TTM
response is not due to the GF, which is common to both pathways. The latency abnormality and
at least a portion of the following frequency defect must occur after the GF pathways to the TTM
TANOUYE--21
and DLM diverge. The implication from these observations is that the defect for the GF-TTM
response occurs distal to the GF and proximal to the TTM motoneuron, that is, most likely the
synapse connecting the GF with the TTM motoneuron. Examination of GF anatomy in
cpoEG1/cpocp1 flies reveals no gross morphological abnormalities. In cpo flies, the GF appears to
make the proper lateral bend in the mesothoracic neuromere to contact the TTMn (data not
shown).
The GF-TTM synapse has been shown previously to be a bi-functional synapse with a
component that transmits electrically via gap junction and a component that transmits via
chemical transmitter (Blagburn et al. 1999). It is difficult from these experiments to determine
whether it is the electrical or chemical component that carries the cpo mutant defect. However, in
the GF-DLM pathway, there is a clearer separation of central synapses that transmit electrically
(i.e. the synapse between the GF and the PSI neuron) and chemically (i.e. the synapse between
the PSI and the DLM motoneuron). The cpo mutant shows a following frequency defect in the
GF-DLM pathway due to some labile site along the transmission pathway. We identified the
probable location of this labile site. The defect in the GF-DLM pathway does not appear to be
due to the DLM motoneuron or the DLM nmj. This is indicated by direct electrical stimulation of
the DLM motoneuron showing that the cpo mutant response is similar to wild-type in latency
and following frequency. The latency of the DLM response following direct motoneuron
stimulation for cpoEG1/cpocp1 is about 0.6 ms, which is similar to the CS wild-type latency of 0.83
± 0.06 ms (Tanouye and Wyman 1980). The following frequencies of the DLM response
following direct motoneuron stimulation for cpoEG1/cpocp1 and CS are both greater than 100 Hz.
The defect in the GF-DLM pathway does not appear to be due to GF action potential conduction,
the synapse between the GF and the PSI neuron, or PSI action potential conduction. This is
TANOUYE--22
inferred from comparison of the GF-DLM4 response with the GF-DLM5 response. DLM4 and
DLM5 are innervated by different motoneurons that receive independent synaptic connections
from a single PSI interneuron (King and Wyman 1980; Tanouye and Wyman 1980). That is, the
GF pathway to DLM4 diverges from the pathway to DLM5 at the PSI to DLM motoneuron
synapse (Fig. 4). We assumed that if the cpo mutant labile site occurs after pathway divergence,
transmission to the two DLM fibers will fail and recover independently. Conversely, we assumed
that if the labile site is a circuit element common to the two muscle fibers, that is, prior to
pathway divergence, transmission to the two DLM fibers would not fail or recover
independently. From this, we propose that the defect in the GF-DLM pathway is distal to the PSI
since the GF-DLM4 response and the GF-DLM5 response fail independently. That is, in
cpoEG1/cpocp2 mutants responses in both the DLM4 pathway and DLM5 pathway fail at about 14
± 4.8 Hz. During the period of stimulation when failures are occurring, a trace-by-trace
comparison reveals that usually, DLM4 and DLM5 responses fail together. However,
occasionally, an individual stimulus will drive a DLM4 response, but a failure in DLM5; another
individual stimulus might occasionally show the opposite, a DLM4 failure coupled with a DLM5
response (Fig. 5). These occasional stimuli indicate that DLM4 and DLM5 responses are capable
of failing independently. A trace-by-trace analysis of the recovery period shows that the
responses also recover independently. As control, we compared failure of GF-DLM5 response
with the GF-DLM6 response. DLM5 and DLM6 are innervated by a single motoneuron, usually
called motoneuron DLM5/6 (Harcombe and Wyman 1977; Tanouye and Wyman 1980; King and
Wyman 1980). Unlike other DLM pathways, the GF-DLM5 pathway does not diverge from the
GF-DLM6 pathway until the nmj. In cpoEG1/cpocp2 mutants responses in both the DLM5 pathway
and DLM6 pathway fail at about 14 ± 4.8 Hz. However, during the period of stimulation when
TANOUYE--23
failures are occurring, a trace-by trace comparison reveals that responses in the two DLM fibers
never fail independently. That is, every time a DLM5 response is seen, a response is always also
seen in DLM6. Every time there is a failure of the DLM5 response, there is also a failure of the
DLM6 response (Fig. 5). A trace-by-trace analysis of the recovery period shows that the
responses also do not recover independently. Our interpretation is that the labile site is the
synapse between the PSI and the DLM5/6 motoneuron, a circuit element that is common in the
pathway to the two muscle fibers. From these combined results, we infer that the labile site in the
GF-DLM pathway lies distal to the PSI and proximal to the DLM motoneuron, that is, most
likely the synapse between the PSI and the DLM motoneuron.
In sum, the GF neurocircuit apparently carries an alteration in the bi-functional synapse
connecting the GF with the TTM motoneuron that causes an increase in transmission latency and
a severe lability with transmission failure rapidly occurring with repeated stimulation. The GF
neurocircuit apparently also carries a moderate alteration in the synapse connecting the PSI with
the DLM motoneuron that causes a small change in following frequency without a change in
transmission latency.
Interestingly, cpo flies still retain the ability to jump when exposed to a light-off stimulus,
despite having a dysfunctional GF to TTM motoneuron connection. The TTM is the primary
jump muscle in the fly and is driven by the GF in response to a light-off stimulus. For a wild-
type fly, a light-off stimulus elicits an escape jump. However, some mutants with defective
TTM pathways, such as bendless (ben), are unable to jump in response to visual stimuli. In ben
flies, the GF fails to make the terminal bend to connect to the TTM motoneuron (Thomas and
Wyman 1982). The TTM in ben flies exhibits a long latency response of ~2.3 ms and a following
frequency of less than 1 Hz (Thomas and Wyman 1984; Oh et al. 1994). Although the cpo
TANOUYE--24
electrophysiological phenotype resembles ben in its TTM following frequency and latency
defects, the nature of the GF to TTM motoneuron synaptic defects in cpo flies must not be severe
enough to totally inhibit GF-driven jump behavior.
TANOUYE--25
DISCUSSION
Discovery of a new cpo allele: Several observations show that the cpoEG1 mutation is a new
recessive lethal allele of cpo. Genetically, the lethal cpo alleles l2 and l∆cp11 fail to complement
the recessive lethality of cpoEG1, as well as a deficiency with cpo deleted. However, the lethality
of cpoEG1 is rescued by replacement of the cpo gene region using a duplication line.
Behaviorally, cpoEG1 mutants show defects, such as overall sluggishness and lethargy, consistent
with previously characterized cpo mutants when put in heteroallelic combinations with viable
cpo mutants. The cpoEG1/cpocp1 and cpoEG1/cpocp2 flies also show BS paralysis that is shared by
other heteroallelic combinations without cpoEG1, such as cpocp1/cpocp2 and cpocp1/cpol2.
Electrophysiologically, cpoEG1 mutants manifest seizure susceptibility increases and giant fiber
synaptic defects when put in heteroallelic combination with cpocp1 and cpocp2. These
abnormalities are not seen in cpoEG1, cpocp1, and cpocp2 heterozygotes. Molecularly, comparison
to the Drosophila genome database of the genomic DNA flanking the cpoEG1 insertion uniquely
identifies the location of cpoEG1 as being at 90D in an intron of cpo at a site shared by several
other previously characterized alleles of cpo.
P-element insertions in cpo show complex genetic interactions: Of the numerous P-element
alleles of cpo, at least seven (EG1, cp1, cp2, l2, l3, l6, and v2) are inserted at exactly the same
site in an intronic region of cpo but with differing phenotypic consequences, thought to be due to
differences in P-element type, size, and orientation. The existence of multiple independent alleles
resulting from insertion of a transposable element in the exact same location is not a novel
phenomenon. Several examples are known, such as at the white locus, the singed locus, and the
ovo locus (O’Hare and Rubin 1983; Roiha et al. 1988; Dej et al. 1998). In addition, P-elements
TANOUYE--26
do not insert randomly, but show preference for euchromatic sites, the 5’-ends of genes, and GC
rich 8-bp target sequences that provide appropriate DNA secondary structure (Liao et al. 2000).
The seven P-element insertions between nucleotides 1229712298 meet each of these criteria:
they are inserted in euchromatin in the 5’ region of cpo next to an 8-bp target sequence of
GTTCAGGC, which closely approximates the sequence GTCCGGAC shown to be preferred by
P-elements (Liao et al. 2000).
P-element insertions in cpo exhibit complex genetic interactions. Most interestingly, the
P-elements inserted between 1229712298 show different phenotypes based on their type and
size. Previously, Bellen et al. noted that 17-kb P[lArB] insertions (cpocp1 and cpocp2) at this site
yield viable flies with adult behavioral defects (1992b). In contrast, flies with 10-kb P[lacZ, w+]
insertions in the same location (cpol2, cpol3, and cpol6) behave as recessive lethals (Bellen et al.
1992b). Bellen et al. also documented that the cpocp1 and cpocp2 alleles partially complement the
lethal cpol2, cpol3, and cpol6 alleles producing viable heteroallelic flies with behavioral defects
(1992a). Differences in phenotype due to the type of transposable element have also been
documented at the Notch locus, where different types of transposon insertions within a 3-bp span
result in different eye and wing phenotypes (Kidd and Young 1986). This implies that the
phenotypic differences between the P[lArB] and P[lacZ, w+] insertions in cpo may reflect the
unique properties of the P-elements themselves according to mechanisms we do not fully
understand yet. Interestingly, an oppositely-oriented 10-kb P[lacZ, w+] insertion 8-bp
downstream at 1230512306 (cpov3) is not lethal but produces viable adults with behavioral
defects similar to the P[lArB] insertions. Surprisingly, this insertion fully complements other
alleles of cpo (Bellen et al. 1992a,b), including the BS paralytic behavior associated with cpoEG1.
Bellen et al. hypothesized that this intragenic complementation may result from disrupted
TANOUYE--27
somatic pairing of the chromosomes in heterozygous flies leading to complex transvection-like
phenomena (1992a). Clearly, the genetic interactions of P-elements at the cpo locus show an
uncommon degree of complexity depending on the nature of the individual P-element alleles.
Of the alleles examined in this study, the cpoEG1 allele appears most similar to cpol2 (and
presumably to cpol3 and cpol6 which were unavailable for this study). Both cpoEG1 and cpol2
exhibit homozygous lethality due to insertions of the same P[lacZ, w+] element in the same
location at 1229712298. Both also yield viable progeny with bang-sensitive paralytic defects in
heteroallelic combinations with cpocp1 and cpocp2. Therefore, the cpoEG1 mutation and the alleles
examined in this study apparently form the allelic series: cpol∆cp11 > cpoEG1 ≥ cpol2 > cpocp1 ≥
cpocp2 (see Fig. 2).
cpo mutants display complex neurological deficits resembling human pathologies: The
neurological phenotypes of cpo are complex, perhaps more complex than any other behavioral
mutant described for Drosophila. Previous descriptions have noted a number of behavioral
phenotypes including sluggishness, abnormal phototaxis, geotaxis, flight ability, ether recovery,
and mating vigor (Bellen et al. 1992a; Hall 1994). In this study, we describe in detail additional
abnormalities: BS paralytic behavior, seizure-sensitivity, and synaptic transmission defects in the
GF circuit. The BS paralytic behavior and seizure-sensitivity phenotypes of cpo invite
comparisons with other BS mutants. Unlike cpo mutants, the canonical BS mutants, such as sda,
eas, and bss, usually show completely normal behavior: walking, flying, eating, mating, and
grooming activities are all normal. However, in response to mechanical stimulation, the
canonical BS mutants all show 100% paralysis unlike cpo mutants that show only ~30%
paralysis. Thus, the canonical BS mutants show far fewer overall abnormalities than cpo, but the
TANOUYE--28
paralytic defect itself is far more extreme. In addition, although canonical BS mutants show far
fewer neurological syndromes and no GF synaptic defects, they are much more sensitive to
seizures than cpo flies. The seizure threshold for cpo flies is 11-14 V ECS, whereas seizure
thresholds for canonical BS mutants are 3-7 V ECS.
The GF system phenotypes of cpo invite comparisons with other GF system mutants. The
canonical GF system mutants are bendless (ben) and passover (pas). Unlike cpo mutants, the
canonical GF system mutants usually show relatively normal behavior. The pas mutant shows a
weak leg-shaking behavioral defect under ether anesthesia and ben shows a photochoice
behavioral phenotype in choosing visible over UV light, as well as some lethargy. However, both
ben and pas show an extreme GF-system behavioral defect: they cannot mount an escape jump
response to a lights-off visual stimulus. Interestingly, cpo mutants do show escape jump
behavior. GF system synaptic defects also appear more extreme for canonical mutants than for
cpo. While cpo DLMs only have following frequency deficits, pas flies are incapable of any GF-
driven DLM responses. Similar to cpo mutants, pas and ben flies have abnormal TTM responses
marked by long latencies and following frequencies below 1 Hz. However, the TTM latency
defect in ben flies is more severe than cpo flies with a latency of 2.3 ms (Thomas and Wyman
1984; Oh et al. 1994). In addition, the ben GFs fail to bend to contact the TTMn in the
mesothoracic neuromeres, whereas, cpo GFs appear to bend normally. Interestingly, mutants of
Shak-B2, an allele of pas, show an extremely high seizure threshold at 94.7 ± 10.2 V ECS
(Kuebler et al. 2001). In addition, the Shak-B2 mutation is a potent suppressor of seizures. Both
of these characteristics set apart Shak-B2 flies as distinct from cpo mutants, which have lowered
seizure thresholds and behave as enhancers of seizure. Thus, the canonical GF system mutants
TANOUYE--29
show far fewer overall abnormalities than cpo, but the GF system-specific defects are more
extreme.
Although the complex neurological phenotype of cpo mutants makes it difficult to assign
them to a particular mutant class, it also makes them a more realistic model of neurological
disorders in humans and mice which tend to be more pleiotrophic. In humans, epilepsy is often
one of a set of symptoms found in people with diseases such as cerebral palsy,
neurofibromatosis, autism, tuberous sclerosis, and Landau-Kleffner syndrome. In each of these
human diseases, seizures are one of a number of other neurological disorders comprising the
disease (Frazin 2001). Numerous mouse models of epilepsy also exhibit additional neurological
conditions. Some examples include lethargic and quaking mice. The lethargic mouse exhibits
absence epilepsy accompanied by ataxia, hypoactivity, paroxysmal dyskinesis, and reduced
conduction velocity and prolonged distal latency in peripheral motor nerves (Herring et al. 1981;
Khan and Jinnah 2002). The quaking mouse exhibits tonic-clonic seizures accompanied by
generalized tremors and hypomyelination defects (Hogan and Greenfield 1984). Interestingly,
the deficits in quaking mice result from a defective RNA-binding protein that regulates nuclear
export of myelin basic protein mRNA (Larocque et al. 2002). Thus, the defects in cpo mutants
seem to approximate pathologies common in more complex organisms.
A role for cpo in regulating nervous system function: Several possibilities exist for how cpo
regulates proper nervous system function and seizure susceptibility. Because of its localization to
the nucleus, the interaction of cpo with RNA may involve participation in splicing or export of
transcripts out of the nucleus. Possibly cpo regulates proper nervous system function by altering
the balance of transcripts involved with neuronal excitation and inhibition via one of these
TANOUYE--30
processes. Several animal models with defects in nuclear export of transcripts and splicing
display neuronal excitability defects. Some examples include the previously mentioned quaking
mice, which exhibit defects resulting from a mutation affecting the RNA-binding protein QKI,
which regulates nuclear export of myelin basic protein (MBP) mRNA (Larocque et al. 2002;
Hogan and Greenfield 1984). Another example is seen in Nova-1 mice, which display
progressive motor dysfunction, marked by action-induced tremor and overt motor weakness,
culminating in death 7-10 days after birth (Jensen et al. 2000). These defects in Nova-1 mice
result from deletion of the RNA-binding protein, Nova-1, which regulates alternative splicing of
neural specific pre-mRNAs, such as the inhibitory GABAA receptor γ2 pre-mRNA (Dredge and
Darnell 2003). The NOVA family of RNA-binding proteins were first identified as the target
antigens in the human disease paraneoplastic opsoclonus myoclonus ataxia, a neurological
disorder characterized by loss of inhibitory control of motor neurons in the spinal cord and
brainstem (Musunuru and Darnell 2001). The examples of cpo, quaking, and Nova-1 show that
mutation of RNA-binding proteins can have serious consequences for nervous system function
and behavior.
Although the exact mechanism underlying the seizure susceptibility of cpo flies is
unknown, some possible explanations for the altered seizure threshold in cpo mutants seem
unlikely. Because of the unchanged GF threshold of cpo flies and their overall sluggish
demeanor, increased overall neuronal excitability as an explanation for the seizure sensitivity of
cpo mutants appears as an untenable hypothesis. One explanation for a decreased seizure
threshold could be that the neurons in cpo mutants are hyperexcitable with a lowered stimulation
threshold, which would allow for abnormal supernumerary recruitment of neurons upon
administration of an electrical buzz, facilitating the temporal and spatial summation known to
TANOUYE--31
occur in seizures. At least in the case of the GF interneuron, a decreased neuronal stimulation
threshold is not observed in cpo flies. However, this does not exclude the possibility that other
unexamined neurons critical for seizure genesis in the cpo nervous system are hyperexcitable
with decreased thresholds for stimulation. It should also be noted that seizures are not GF-driven
since they can never be elicited at the GF threshold voltage level. Thus, recruitment of other
unidentified neurons is required for seizure manifestation. In addition, cpo flies do not seem to
be good candidates for exhibiting increased temporal summation as is characteristic of seizures.
Their severely decreased following frequencies would be expected to hamper the ability of their
nervous system to temporally summate neuronal responses because they occur with lesser
frequency. Because increased excitatory character does not appear responsible for the increased
seizure susceptibility of cpo flies, maybe they exhibit unidentified deficits in inhibition, which
could hinder their nervous system’s ability to resist seizure following insult.
We thank Hugo Bellen for supplying alleles of cpo and for his insight and advice. We thank Rod
Murphey for providing the A307 enhancer trap line. We thank Pejmun Haghighi for performing
some crucial pilot experiments. We also thank fellow lab members for their guidance and wise
counsel, especially Daria Hekmat-Scafe, Jeff Tan, Juan Song, and Sang-Ohk Shim. This work
was supported by a National Institutes of Health (NIH) research grant and an Epilepsy
Foundation grant to M.T.
TANOUYE--32
LITERATURE CITED
Allen, M.J., J.A. Drummond and K.G. Moffat, 1998 Development of the giant fiber neuron of
Drosophila melanogaster. J. Comp. Neurol. 397: 519-531.
Ambros, V., 2001 MicroRNAs: tiny regulators with great potential. Cell 107: 823-826.
Bellen, H.J., S. Kooyer, D. D’Evelyn and J. Pearlman, 1992 The Drosophila couch potato
protein is expressed in nuclei of peripheral neuronal precursors and shows homology to RNA-
binding proteins. Genes Dev. 6: 2125-2136.
Bellen, H.J., H. Vaessin, E. Bier, A. Kolodkin, D. D’Evelyn et al., 1992 The Drosophila couch
potato gene: an essential gene required for normal adult behavior. Genetics 131: 365-375.
Benzer, S., 1971 From the gene to behavior. J. Am. Med. Assoc. 218: 1015-1022.
Blagburn, J.M., H. Alexopoulos, J.A. Davies, and J.P. Bacon, 1999 Null mutation in shaking-B
eliminates electrical, but not chemical, synapses in the Drosophila giant fiber system: a structural
study. J. Comp. Neurol. 404: 449-458.
Burd, C.G. and G. Dreyfuss, 1994 Conserved structure and diversity of functions of RNA-
binding proteins. Science 265: 614-621.
TANOUYE--33
Dredge, B.K. and R.B. Darnell, 2003 Nova Regulates GABAA Receptor γ2 alternative splicing
via a distal downstream UCAU-rich intronic splicing enhancer. Mol. Cell Bio. 23: 4687-4700.
Fernandez-Funez, P., M.L. Nino-Rosales, B. de Gouyan, W. She, J.M. Luchak et al., 2000
Identification of genes that modify ataxin-1-induced neurodegeneration. Nature 408: 101-106.
Frazin, N., 2001 Seizures and Epilepsy: Hope Through Research. Department of Health and
Human Services, National Institutes of Health, National Institute of Neurological Disorders and
Stroke, Bethesda, MD, NIH Publication No. 00-156.
Ganetzky, B. and C.-F. Wu, 1982 Indirect suppression involving behavioral mutants with altered
nerve excitability in Drosophila melanogaster. Genetics 100: 597-614.
Gerber, W.V., S.A. Vokes, N.R. Zearfoss and P.A. Krieg, 2002 A role for the RNA-binding
protein, hermes, in the regulation of heart development. Dev. Biol. 247:116-26.
Gerber, W.V., T.A. Yatskievych, P.B. Antin, K.M. Correia, R.A. Conlon et al., 1999 The RNA-
binding protein gene, hermes, is expressed at high levels in the developing heart. Mech. Dev. 80:
77-86.
Hall, J.C., 1994 The mating of a fly. Science 264: 1702-1714.
TANOUYE--34
Harcombe, E.S. and R.J. Wyman, 1977 Output pattern generation by Drosophila flight
motoneurons. J. Neurophys. 40: 1066-1077.
Herring, J.M., H.C. Dung, J.H. Yoo and J. Yu, 1981 Chronological studies of peripheral motor
nerve conduction in ‘lethargic’ mice. Electromyogr. Clin. Neurophysiol. 21: 121-134.
Hogan, E.L. and S. Greenfield, 1984 Animal models of genetic disorders and myelin. Myelin
489-534.
Ikeda, K., J.H. Koenig and T. Tsuruhara, 1980 Organization of identified axons innervating the
dorsal longitudinal flight muscle of Drosophila melanogaster. J. Neurocytol. 9: 799-823.
Jensen, K.B., K. Musunuru, H.A. Lewis, S.K. Burley and R.B. Darnell, 2000 The tetranucleotide
UCAY directs the specific recognition of RNA by the Nova K-homology 3 domain. Proc. Natl.
Acad. Sci. 97: 5470-5475.
Jensen, K. B., B. K. Dredge, G. Stefani, R. Zhong, R. J. Buckanovich et al., 2000 Nova-1
regulates neuron-specific alternative splicing and is essential for neuronal viability. Neuron 25:
359-371.
Khan, Z. and H.A. Jinnah, 2002 Paroxysmal dyskinesias in the lethargic mouse mutant. J.
Neurosci. 22: 8193-8200.
TANOUYE--35
Kidd, S. and M.W. Young, 1986 Transposon-dependent mutant phenotypes at the Notch locus of
Drosophila. Nature 323: 89-91.
Kiger, A.A., S. Gigliotti, S. and M.T. Fuller, 1999 Developmental genetics of the essential
Drosophila nucleoporin nup154: allelic differences due to an outward-directed promoter in the P-
element 3’ end. Genetics 153: 799-812.
King, D.G. and R.J. Wyman, 1980 Anatomy of the giant fibre pathway in Drosophila. I. Three
thoracic components of the pathway. J. Neurocytol. 9: 753-770.
Kuebler, D. and M.A. Tanouye, 2000 Modifications of seizure susceptibility in Drosophila. J.
Neurophysiol. 83: 998-1009.
Kuebler, D., H. Zhang, X. Ren and M.A. Tanouye, 2001 Genetic suppression of seizure-
susceptibility in Drosophila. J. Neurophysiol. 86: 1211-1225.
Larocque, D. J. Pilotte, T. Chen, F. Cloutier, B. Massie et al., 2002 Nuclear retention of MBP
mRNAs in the quaking viable mice. Neuron 36: 815-829.
Liao, G., E.J. Rehm and G.M. Rubin, 2000 Insertion site preferences of the P transposable
element in Drosophila melanogaster. Proc. Natl. Acad. Sci. 97: 3347-3351.
TANOUYE--36
Liu, W., J. Seto, G. Donovan and M. Toth, 2002 Jerky, a protein deficient in a mouse epilepsy
model, is associated with translationally inactive mRNA in neurons. J. Neurosci. 22: 176-182.
Lundquist, E.A. and R.K. Herman, 1994 The mec-8 gene of Caenorhabditis elegans affects
muscle and sensory neuron function and interacts with three other genes: unc-52, smu-1 and
smu-2. Genetics 138: 83-101.
Lundquist, E.A., R.K. Herman, T.M. Rogalski, G.P. Mullen, D.G. Moerman et al., 1996 The
mec-8 gene of C. elegans encodes a protein with two RNA recognition motifs and regulates
alternative slicing of unc-52 transcripts. Development 122: 1601-1610.
Musunuru, K. and R. B. Darnell, 2001 Paraneoplastic neurologic disease antigens: RNA-binding
proteins and signaling proteins in neuronal degeneration. Annu. Rev. Neurosci. 24: 239-262.
Nakamura, M., H. Okano, J. Blendy and C. Montell, 1994 Musashi, a neural RNA-binding
protein required for Drosophila adult external sensory organ development. Neuron 13: 67-81.
Oh, C.E., R. McMahon, S. Benzer and M.A. Tanouye, 1994 bendless, a Drosophila gene
affecting neuronal connectivity, encodes a ubiquitin-conjugating enzyme homolog. J. Neurosci.
14: 3166-3179.
O’Hare, K. and G.M. Rubin, 1983 Structures of P transposable elements and their sites of
insertion and excision in the Drosophila melanogaster genome. Cell 34: 25-35.
TANOUYE--37
Pavlidis, P., M. Ramaswami and M.A. Tanouye, 1994 The Drosophila easily shocked gene: a
mutation in a phospholipids pathway causes seizure, neuronal failure, and paralysis. Cell 79: 23-
33.
Pavlidis, P. and M.A. Tanouye, 1995 Seizures and failures in the giant fiber pathway of
Drosophila bang-sensitive paralytic mutants. J. Neurosci. 15: 5810-5819.
Perrone-Bizzozero, N. and F. Bolognani, 2002 Role of HuD and other RNA-binding proteins in
neural development and plasticity. J. Neurosci. Res. 68: 121-126.
Phelan, P., L.A. Stebbings, R.A. Baines, J.P. Bacon, J.A. Davies et al., 1996 Mutations in
shaking-B prevent electrical synapse formation in the Drosophila giant fiber system. J. Neurosci.
16: 1101-1113.
Reddy, P.H., M. Williams and D.A. Tagle, 1999 Recent advances in understanding the
pathogenesis of Huntington’s disease. Trends Neurosci. 22: 248-255.
Robinow, S., A.R. Campos, K.M. Yao and K. White, 1988 The elav gene product of Drosophila,
required in neurons, has three RNP consensus motifs. Science 242: 1570-1572.
Roiha, H., G.M. Rubin and K. O’Hare, 1988 P element insertions and rearrangements at the
singed locus of Drosophila melanogaster. Genetics 119: 75-83.
TANOUYE--38
Royden, C., V. Pirrotta and L. Jan, 1987 The tko locus, site of a behavioral mutation in D.
melanogaster, codes for a protein homologous to prokaryotic ribosomal protein S12. Cell 51:
165-173.
Sahasrabudhe, P.V., R. Tejero, S. Kitao, Y. Furuichi and G.T. Montelione, 1998 Homology
modeling of an RNP domain from a human RNA-binding protein: homology-constrained energy
optimization provides a criterion for distinguishing potential sequence alignments. PROTEINS
33: 558-566.
Schweers, B.A., K.J. Walters and M. Stern, 2002 The Drosophila melanogaster translational
repressor pumilio regulates neuronal excitability. Genetics 161: 1177-1185.
Shimamoto, A., S. Kitao, K. Ichikawa, N. Suzuki, Y. Yamabe et al., 1996 A unique human gene
that spans over 230 kb in the human chromosome 8p11-12 and codes multiple family proteins
sharing RNA-binding motifs. Proc. Natl. Acad. Sci. 93: 10913-10917.
Tanouye, M.A. and R.J. Wyman, 1980 Motor outputs of giant nerve fiber in Drosophila. J.
Neurophysiol. 44: 405-421.
Thomas, J.B. and R.J. Wyman, 1982 A mutation in Drosophila alters normal connectivity
between two identified neurons. Nature 298: 650-51.
TANOUYE--39
Thomas, J.B. and R.J. Wyman, 1984 Mutations altering synaptic connectivity between identified
neurons in Drosophila. J. Neurosci. 4: 530-538.
Trimarchi, J.R. and R.K. Murphey, 1997 The shaking-B2 mutation disrupts electrical synapses in
a flight circuit in adult Drosophila. J. Neurosci. 17: 4700-4710.
Wharton, K.A., B. Yedvobnick, V.G. Finnerty and S. Artavanis-Tsakonas, 1985 opa: a novel
family of transcribed repeats shared by the Notch locus and other developmentally regulated loci
in D. melanogaster. Cell 40: 55-62.
Wilson, C., R. Pearson, H. Bellen, C. O’Kane, U. Grossniklaus et al., 1989 P-element mediated
enhancer detection: an efficient method for isolating and characterizing developmentally
regulated genes in Drosophila. Genes Dev. 3: 1301-1313.
Wreden, C., A.C. Verotti, J.A. Schisa, M.E. Lieberfarb and S. Strickland, 1997 Nanos and
pumilio establish embryonic polarity in Drosophila by promoting posterior deadenylation of
hunchback mRNA. Development 124: 3015-3023.
Wu, J.I., R.B. Reed, P.J. Grabowski and K. Artzt, 2002 Function of quaking in myelination:
regulation of alternative splicing. Proc. Natl. Acad. Sci. 99: 4233-4238.
TANOUYE--40
Zhang, H., J. Tan, E. Reynolds, D. Kuebler, S. Faulhaber et al., 2002 The Drosophila slamdance
gene: a mutation in an aminopeptidase can cause seizure, paralysis and neuronal failure. Genetics
162: 1283-1299.
Figure 1. The cpo locus at 90D on chromosome III. The cpo locus at 90D1-6 is large
and complex, spanning >100 kb and encoding three different messages: cpo 61.1 (3.4
kb), cpo 61.2 (2.5 kb), and cpo 17 (3.0 kb). For simplicity, only the transcript
corresponding to cDNA 61.1 is shown above; the mutations described here apparently
only affect this transcript (Bellen et al. 1992b). The exons are represented as numbered
boxes. The black filled boxes correspond to untranslated exons, while the crosshatched
boxes correspond to protein-coding exons. The relationship of cpo 61.1 to the
corresponding nucleotide numbers in genomic scaffold AE003720 (release 3) is indicated
below the splicing diagram. All of the alleles examined in this study are P-element
insertions in the promoter region of transcript 61.1 just 5’ to exon 1. Interestingly, the cpo
alleles EG1, l2, cp1, and cp2 are all inserted at the same site between nucleotides 12297
and 12298 on scaffold AE003720. The v3 allele is a P-element insertion 8-nt 3’ of the
other alleles. All of these insertions are positioned between enhancer-like sequences and
1 2 3 4 5 6 7 8 9
12335 84022
AE003720
10 kb
TAA GTTCAGGC GATTTGGATTCGGATCGGGCTTCAGATTCA
EG1, l2, cp1, cp2 v3
5’ 3’ v v v v
the transcription start site for cpo 61.1 at 12335 (the transcription start site is indicated as
a large bold A in the expanded portion). This region has been shown to contain most of
the key regulatory sequences for cpo expression (Bellen et al. 1992b).
Figure 2. Bang-sensitive paralysis in cpo mutants. Various heteroallelic combinations
were created and tested for bang-sensitive paralysis. Paralysis is greatest with the
cpoEG1/cpocp1 combination in which 32% of flies paralyze (n = 299). Flies with the
genotype cpoEG1/cpocp2 show the second highest degree of bang-sensitivity with 18% of
flies paralyzing (n = 210). This bang-sensitive paralysis defect is also seen in viable cpo
mutant combinations independent of cpoEG1. Viable mutant combinations of cpocp1/cpocp2,
cpocp1/cpol2, and cpocp2/cpol2 show paralysis in 16% (n = 281), 12% (n = 65), and 7% (n =
55) of flies, respectively. Interestingly, the cpov3 allele complements the bang-sensitive
paralysis associated with the cpoEG1 mutation as no cpoEG1/cpov3 flies paralyze (n = 56).
The apparent allelic series is: cpoEG1 ≥ cpol2 > cpocp1 ≥ cpocp2.
0%
10%
20%
30%
40%Pa
raly
zed
flies
EG1 EG1 cp1 cp1 cp2 EG1cp1 cp2 l2 l2cp2 v3
cpo alleles
A B
C
cpoEG1/cpocp1
(8 V ECS)
cpoEG1/+(8 V ECS)
cpoEG1/+(32 V ECS)
D
E
0
10
20
30
40
EG1 EG1cp1 cp2
EG1+
cp1+
cp2+
cpo alleles
++
Seiz
ure t
hres
hold
(V)
∆125∆125
0
1
2
3
4
cpo alleles
Gia
nt fi
ber t
hres
hold
(V)
EG1 EG1cp1 cp2
EG1+
cp1+
cp2+
++
∆125∆125
Figure 3. cpo mutants exhibit increased seizure susceptibility without a concomitant
increase in single neuron excitability. (A) A representative seizure as recorded from the
DLM following a high-frequency brain stimulus of 8 V ECS (depicted above as a cross-
hatched box) in a cpoEG1/cpocp1 fly. The DLM shows aberrant high-frequency firing
approaching 50 Hz during the seizure phase. These high-frequency responses then give
way to synaptic failure (not depicted). (Calibrations: 10 mV, 200 ms) (B) A cpoEG1/+ fly
shows only a few spikes following an identical 8 V high-frequency stimulus to the brain,
since this voltage is below its threshold for seizure. (C) However, seizures are elicited in
cpoEG1/+ flies following administration of 32 V ECS. (D) Comparison of seizure
thresholds for various cpo genotypes shows increased seizure susceptibility for cpo
mutants (n ≥ 6 for each genotype). (E) Comparison of the firing thresholds of the giant
fiber in control flies and cpo mutants reveals no significant differences (n ≥ 6 for each
genotype).
Figure 4. Schematic of the GF neural circuit in Drosophila and transmission defects
in the GF-TTM pathway of cpo adults. (A) The GF is a large interneuron that drives
the escape jump in Drosophila in response to visual stimuli. The GF has a cell body in
the brain and projects its axon down the cervical connective to the thoracic ganglion
where it makes two major synaptic connections. One connection is with the
tergotrochanteral motoneuron (TTMn), which in turn drives the tergotrochanteral muscle
(TTM) that enables jumping. The second connection is with the peripherally synapsing
interneuron (PSI), which contacts the five dorsal longitudinal motoneurons (DLMns).
These five DLMns drive the six dorsal longitudinal muscle (DLM) fibers that are
responsible for wing depression during flight. Each DLMn innervates a single DLM fiber
TTM
DLM4
DLM5
DLM6
GF
TTMn
PSI
DLMn4
DLMn5
(0.8 ms)
(1.2 ms)
stim
e
e
BRAIN THORACIC GANGLIA
DLM
TTM
DLM
TTM 1 2
3
A
B C
except for DLMn 5, which drives both DLM fibers 5 and 6. For simplicity, DLMn1-3 and
DLM fibers 1-3 are not included. Transmission through the monosynaptic GF-TTM
pathway is fast, eliciting a response in the TTM in approximately 0.8 ms. The disynaptic
GF-DLM pathway produces a DLM response approximately 1.2 ms following brain
stimulation. In addition to producing responses with very short latencies, both pathways
can follow stimuli at high frequencies. The GF-TTM pathway can follow stimulation
exceeding 200 Hz, while the GF-DLM pathway exhibits following frequencies in excess
of 100 Hz (Tanouye and Wyman 1980; Ikeda et al. 1980). The small “e” designations in
the figure denote electrical synapses. All other synapses are chemical. The GF-TTMn
synapse has been shown to have both electrical and chemical components (Blagburn et
al. 1999). (B) Response to brain stimulation in a control fly (cpoEG1/+). The DLM and
TTM always fire together when the brain is stimulated at voltages above the GF threshold
and always differ in latency by ~0.4 ms (Tanouye and Wyman 1980). (Calibration: 10
mV, 1 ms) (C) Response to brain stimulation in a cpo fly (cpoEG1/cpocp1). Shown are
responses to three consecutive 0.2 s pulses given at 0.5 Hz. The DLM latency never
deviates while the TTM latency progressively increases before the muscle eventually
fails. This indicates that the DLM response is capable of following at this frequency (0.5
Hz), but the TTM response is not. (Calibration: 10 mV, 1 ms)
Figure 5. Transmission defects in the GF-DLM pathway of cpo adults. (A) DLM4
and 5 responses to brain stimulation in a cpo fly (cpoEG1/cpocp1). Shown are responses to
three consecutive 0.2 s pulses administered near the following frequency threshold of 22
± 9.2 Hz in cpoEG1/cpocp1 mutants. The response of DLM4 is invariant, while the DLM5
response shifts in latency and then fails independent of DLM4. Independent failure
between DLM4 and 5 implicates a defect distal to the PSI as the likely labile site in the
GF-DLM pathway. (B) DLM5 and 6 responses to brain stimulation in the same cpo fly
(cpoEG1/cpocp1). Three consecutive 0.2 s pulses administered near the following frequency
threshold do not produce independent failure between DLM5 and 6, which are innervated
by the same motoneuron, DLMn5. Instead both show identical shifts in latency before
eventually failing together. This synchronous firing and failing between DLM5 and 6
tends to rule out the DLM nmj as the labile site in the GF-DLM circuit. Thus, the labile
site in the GF-DLM pathway appears to be synapses between the PSI and DLM
motoneurons. (Calibration: 20 mV, 1 ms)
DLM4
DLM51
2
3
1 2
3
A B
TABLE 1. Performance of giant fiber system in cpo mutants and control fliesa
Genotype Seizure
threshold
(V)
DLM
latency
(ms)
DLM
following
frequency (Hz)
TTM
latency
(ms)
TTM
following
frequency (Hz)
+/+ 30.1 ± 3.8 1.25 ± 0.10 137 ± 14.7 0.81 ± 0.07 > 100
cpoD125/ cpoD125 29.0 ± 4.5 1.18 ± 0.08 128 ± 16.3 0.72 ± 0.10 191 ± 33.2
cpoEG1/+ 28.4 ± 4.3 1.35 ± 0.12 124 ± 31.3 0.86 ± 0.10 216 ± 44.3
cpocp1/+ 26.6 ± 7.4 1.31 ± 0.07 135 ± 30.6 0.89 ± 0.09 194 ± 40.3
cpocp2/+ 34.6 ± 6.7 1.39 ± 0.12 138 ± 16.1 0.94 ± 0.15 185 ± 32.5
cpoEG1/ cpocp1 11.1 ± 3.7 1.48 ± 0.09 22 ± 9.2 1.36 ± 0.05 < 1
cpoEG1/ cpocp2 13.3 ± 4.8 1.45 ± 0.05 14 ± 4.8 1.46 ± 0.24 < 1
a For each genotype, n ≥ 6.