E. Coli Fluorescing Red at Cold Temperature Senor

Post on 31-Jan-2016

17 views 0 download

Tags:

description

E. Coli Fluorescing Red at Cold Temperature Senor. Prm + I12007. . B0032. Team: E Cool I Tina Khoury Jeremy Gerbig Kerwin Dunham Derek Blanchard. Goals. Achieve E. coli to fluoresce red at low temp (37°C) in presence of Cl or Cl (ts). - PowerPoint PPT Presentation

transcript

E. Coli Fluorescing Red at Cold

Temperature Senor Prm +I12007

                               

.B0032

                                                                           

Team: E Cool ITina Khoury

Jeremy GerbigKerwin DunhamDerek Blanchard

Goals Achieve

E. coli to fluoresce red at low temp (37°C) in presence of Cl or Cl (ts).

Find optimum temp where color change will be found. ~ 30-37°C

Find optimum concentration of Cl.

Gene originally from coral.

Backup Plan Use high temp parts to make E. coli fluoresce at

high temp instead at low using a different gene. Expressing high (green) and low (red) temp.

genes in one sequence.

How to do it?

Part 1 BBa_I12007

82Bp Promoter: modified lambda Prm Promoter (OR-3 obliterated) 2010 Kit Plate 2 Box 5 Well 11L, pSB2K3

gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgt

Part 2 & 3 Super Part BBa_I13503 Spring 2008 Distribution Source Plate 1002 1D pSB1A2 BBa_B0032

13Bp Ribosome Binding Site RSB.3 (medium)- derivative of BBa_0030 2010 Kit Plate 1 Well 2I, pSB1A2

tcacacaggaaag

Part 2 & 3 Super Part BBa_I13503 Spring 2008 Distribution Source Plate 1002 1D pSB1A2 3 BBa_E1010

681Bp Gene: highly engineered mutant of red fluorescent protein

from Discosoma striata (coral) 2010 Kit Plate 1 Well 18F, pSB2K3

atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa

Part 4 & 5 Super Part BBa_B0015 BBa_B0010 doubleT

129 Bp Stop, T1 from E. coli rrn B (Transcriptional Terminator) 2010 Kit Plate 1 Well 13D, pSB1A2

BBa_B0012 Stop, TE from coliophage T7 (Transcriptional Terminator) Source Plate 1000 Well 1B, pSB1A2

ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

What’s new? The complete complex Biobricks

sequence that works! Combine 3 parts

BBa_I12007 - Promoter BBa_I13503 - RBS + Gene BBa_B0015 - Double Terminator

Promoter RBS + Gene Double Terminator

Alternate Part May use double terminator because the first

terminator has had problems working according to partsregistry.org

Possible double terminator is BBa_B0015 double terminator(B0010-B0012) 2010 Kit Plate 1 Well 23L, pSB1AK3. According to the website, this part works well.

Protocol Isolate biobricks out of wells.

BBa_I12007 - Promoter BBa_I13503 - RBS + Gene BBa_B0015 - Double Terminator

Transform the bacteria.

Grow the transformed bacteria.

Isolate & check plasmids. Gel Electrophoresis

Protocol cont… Combining biobrick parts by digestion & ligation.

BBa_I12007 - Promoter BBa_I13503 - RBS + Gene BBa_B0015 - Double Terminator

S X & P X & P

Protocol cont…. Transform bacteria with new recombinant plasmid.

Observe results Color change dependent on

Temp between ~ 30-37°C Cl concentration ~ 1x – 10x

References Openwetware.org Partsregistry.org http://filebox.vt.edu/.../biol_4684/Methods/

genes.html http://www.fasebj.org/content/vol20/issue14/

images/large/z386120661480003.jpeg http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?

book=mga&part=A1549 http://www.stat.berkeley.edu/users/terry/

Classes/s260.1998/Week8b/week8b/node3.html