Post on 10-Mar-2016
description
transcript
MARYLAND’S EASTERN SHOREFeaturing: Kent, Queen Anne’s,
Talbot, Caroline, Dorchester, Wicomico & Somerset Counties
DETAILS ON THIS PROPERTY Sharon Real Estate 410/228-2525Sharon Spedden JohnstonLocated on Page 3
FOR ADVERTISING INFORMATIONCall: 410/213-9200Toll Free 877/213-9220info@shorehomeguide.com
Vol. 01 : No. 06
YOUR RESOURCE FOR BUYING AND SELL ING ON THE SHOREREALESTATE g
uid
e
eastern shore’s
ESREG.01.06.indd 1 5/10/11 10:56:34 AM
Page 2 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 Page 2 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE® - Vol. 01, no. 06
www.sharonre.com sharon@sharonre.com
Penny M. WindsorRhonda Richardson Carol L. Wolf
THE BEST FOR THE $$$ - This solid built 3 bedroom, 2 bath home offers full basement, attic, living room, dining room, breakfast area and enclosed porch. Charming floor plan. New super efficient heating system. Located on double lot with off-street parking and garage. $119,000.00 DO7556713
SACRIFICING - This 5 bedroom Victorian due to the economy. Painstakingly restored, this beautiful home offers all new kitchen, baths, butlers pantry, wrap around porch, plumbing, electrical, landscaping and more. $458,000.00 DO7547400
OWNER FINANCING AVAILABLE - Private beach overlooking the Choptank River. Cape Cod features 3 bedrooms, 2 baths and large deck off back of house with gorgeous waterviews. $530,000.00 DO7547927
1ST FLOOR WATERVIEW CONDO – Located in Cambridge’s Historic District near Yacht Club and Long Wharf. Affordable boat dockage across the street from this 2 bedroom unit. Walking distance to downtown. $78,500.00 DO7568374
BUILD YOUR DREAM HOME – Enjoy country living at it’s best. Fishing, crabbing and boating. Beautiful sunsets overlooking Barren Island. Priced to sell at $36,000.00 DO7543249
BEST WATERFRONT VIEWS – Watch the boat races and fireworks from your front yard or front screened porch. Hardwood floors throughout this 3 bedroom house with fireplace. Cement drive and detached garage. $549,900.00 DO7462999 MAkE OFFER
REDUCED
REDUCED
REDUCED
REDUCED
REDUCED
REDUCED
ESREG.01.06.indd 2 5/10/11 10:57:00 AM
Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 - Page 3
WATERFRONT FARMETTE – 20+ acres with over 1200 ft. of shoreline and lovely 3 bedroom, 1-1/2 bath home with stocked fresh water pond and 2 car detached garage. Excellent hunting, boating and wildlife. $595,000.00 iNcludEs AddiTiONAl hOMEsiTE dO7587144
BEAuTiFul cusTOM BuilT hOME – Country location with 2.59 acres of privacy. Spacious 4 bedroom home with solid brick foundation, wrap around porch, rear deck, 2 car attached plus 2 car detached garage. Quality throughout. $319,900.00
TAKE A lOOK – Completely remodeled inside and out, this 3 bedroom, 2 bath home is practically brand new. New windows, siding, roof, kitchen, baths, HVAC and more. Great location, big yard and near YMCA. $139,000.00
MOVE-iN REAdY – Fully applianced kitchen and laundry room, 3 bedrooms and 2 baths. Spacious living room with wood burning fireplace, new roof, shutters and hot water heater. Paved driveway, shed and landscaped for privacy overlooking farm fields. Conveniently located for work commute to Easton, Federalsburg, Seaford, Cambridge or Salisbury. $99,000.00 dO7580783
OVERlOOKEd – This terrific 3 bedroom, 2 bath home has been overlooked by the market. Gorgeous floor plan with 1st floor bedroom and bath. New windows, remodeled kitchen, off-street parking, garage and more. $199,999.00 dO7537228
Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE® - Vol. 01, no. 06 - Page 3
www.sharonre.comsharon@sharonre.com
Penny M. WindsorRhonda Richardson Carol L. Wolf
NEW LISTING
ESREG.01.06.indd 3 5/10/11 10:57:21 AM
Page 4 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06
ON THE COVER
For additional information on thislisting, from this realtor see page 3 or contact:
BEAUTIFUL CUSTOM BUILT HOME –
Country location with 2.59 acres of privacy. Spacious 4 bedroom home with solid brick foundation, wrap around porch, rear deck, 2 car attached plus 2 car detached garage. Quality throughout. $319,900.00
1 Vol. 1 Issue No. 1 - Please saw you saw us in the Eastern Shore Home Improvement Guide
Who Should I Ask For: Specialty:
What Licenses Do You Have:
Service Area: When Were You Established:
What Are Your Hours:
email: web:
Vol. 1 Issue 1
Improving & EnhancingYour Home on the Shore
Hardscapes Perfection443.443.4444 | Page 15
www.ShoreHomeGuide.com
2. Here is Where
7. Business Categories
12. Featured in Each Issue
16. Would be Listed
MARYLAND’S EASTERN SHOREFeaturing: Kent, Queen Anne’s,
Talbot, Caroline, Dorchester, Wicomico & Somerset Counties
DETAILS ON THIS PROPERTY Sharon Real Estate 443/553-4984Sharon Spedden JohnstonLocated on Page 3
FOR ADVERTISING INFORMATIONCall: 410/213-9200Toll Free 877/213-9220info@shorehomeguide.com
Vol. 01 : No. 06
YOUR RESOURCE FOR BUYING AND SELL ING ON THE SHOREREALESTATE g
uid
e
eastern shore’s Be sure to pick up BOTH publications!
Eastern Shore’s Real Estate Guide
to help you fi nd a REALTOR® or a home, and Eastern Shore’s Home Improvement Guide
to help you fi nd local business to improve your new home, or boost your
exisiting home’s value!
With over 25,000 publications distributed over the entire Eastern Shore, whether you are a home owner looking to buy or sell, a REALTOR® looking to gain exposure, or a home improvement business looking to
target clients, both of these publications are here for you!
For advertising information in Eastern Shore Resort Real Estate Guide
contact:
Katie DavisToll Free: 1-877-213-9220
Offi ce: 410-213-9200Fax: 410-213-9240
Email: info@shorehomeguide.com
Next Ad Submission DeadlineMay 27th, 2011
Next Book DistributedJune 16th, 2011
Want to see your home advertised in this magazine? Contact any of the real estate
professionals in this magazine.
“All real estate advertised herein is subject to the Federal Fair Housing Act which makes it illegal to advertise any preference, limitations, or discrimination based on race, color, religion, sex,
handicap, familial status, or national origin, or intention to make any such preferences, limitation, or discrimination. We will not knowingly accept any advertising for real estate which is in violation of the law. All persons are hereby informed that all dwellings advertised are available on an equalopportunity basis.”
gui
deREALESTATE
eastern shore resort
Sharon Real EstateSharon Spedden JohnstonOffi ce: 410.228.2525sharon@sharonre.com
ESREG.01.06.indd 4 5/10/11 10:57:46 AM
Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06 - Page 5
Kelly MacomberCell: 443-553-4984
Offi ce: 410-641-8550www.sunshinepropinc.com
Sunshine Properties, Inc.61 Quarter Staff Place • Berlin, MD 21811
AN ENTERTAINER’S DELIGHT! Welcome to this magnifi cent waterfront estate property of over fi ve acres. The home and grounds area true respite. Highlights are many both inside and out. The home features a brick and stone front with dramatic roof lines, a well thought-out interior, and gorgeous rooms throughout. The main level is spacious and includes formal living and dining rooms, large open kitchen with table area, family room, game (or lounge) room, and a master suite. The upper level has four bedrooms and over three full baths with a spectacular theatre/media room. The exterior has it all! Private resort
setting, yard, patio, pier to dock, large pool, hot tub, deck, porches, and more!
Priced to sell at $1,499,000! Call Kelly Macomber today for your appointment to see this stunning home!
Visit this home online at www.MR4.View24Hours.com
Please Say You Saw It In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06 - Page 5
ESREG.01.06.indd 5 5/10/11 10:58:52 AM
Page 6 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06 Page 6 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06
$15,000 GRANT FOR BUYER * Available through SNHS* $95,000 (www.LNF.com\470074)* 4BR/2BA classic; 1954 Sq. Ft.* Move in ready - nicely updated* 9’ Ceilings; W-U Attic; Bsmt* C. Air; DOUBLE LOT
Looking for a cute & cozy 2 BR gem w/ C. Air that could easily become a 3BR sparkler? Its 1400 sq. ft. make each of the rooms look and feel LARGE. The over-sized garage interior is fi nished. Nice corner lot. Move in ready! $120,000 (472139) Call Nancy Althaus 410-726-6080
280’ ON WICOMICO RIVERThis is a once in a lifetime op-portunity to own WATERFRONT! The vintage 2 BR/2BA cottage w/ C. Air has all rooms facing the water! Awesome FLA Room; aweome location; awesome price: $195,000 (471979) Call Nancy Althaus 410-726-6080
$15,000 GRANT FOR BUYER * Available through SNHS* NOW $70,950 * (www.LNF.com\465412)* 4BR/1.5BA cutie; 1848 Sq. Ft.* New Roof & Zone Central Air* Walk-up Attic; Basement* Fenced Yd w/Koi Pond
$15,000 GRANT FOR BUYER * Available through SNHS* $162,000 (www.LNF.com\470558)* 4BR/2BA gem; 1952 Sq. Ft.* Fireplace; beautiful HW fl oors* 3 Season Porch; brick Patio* Fenced DOUBLE LOT; 2 C. garage
QUALIFIES for RURAL HOUSING! * Covered Bridge location provides special fi nancing!* $280,000 (www.LNF.com\470772)* 3BR/2.5BA jewel; 2800 Sq. Ft.* 2 Bonus Rms: now used as “Man Cave” & Offi ce with private entry* Exceptional use of Oak Wood throughout* Porch, Pool & Garages for 3 cars
RUARK’S MODEL HOME* Talk about bells and whistles!!!* 4BR/3BA w/ First Floor B&B* A WOW Master Bathroom * Potential 5th BR* Garage on own HVAC system* $325,000 * (www.LNF.com\471393)
COUNTY TAXES W/ CITY SERVICES * $174,900 (www.LNF.com\469586)* 4BRs/1 full, 2 half Baths, on .4 A * 2 Bonus Rms; 2617 Sq. Ft.* 3 Zone HVAC; Basement* AWESOME Kitchen & FR Addition* 3 Season Porch; Deck w/ Awning* Outstanding location near S.U. & PRMC
LOTS of LOTS! City: $19,900 (463053) or County: .4A for $29,900 (463041) CALL NANCY ALTHAUS 410-726-6080
GOLDEN OPPORTUNITY * To own in FOXCHASE!* $300,000 (www.LNF.com\458215)* 4BR/3BA Original Modle Home* First fl oor Offi ce* 2 Bonus Rooms* Expanded FR w/brick FP* 3 Zone HVAC; 3400 Sq. Ft* .8 Acres w/I-G Irrigation
FIRST FLOOR MASTER * NOW $255,000 * (www.LNF.com\470073)* 4BR/3BA w/ 1st & 2nd fl r MBRS* Like to entertain? Awesome FR & Deck* 2436 Sq. Ft. of perfection! * 1.74 A. park-like setting on Cul-de-Sac* Great Eastside location
LIVE FREE & EASY ON 1 LEVEL * No better time than the present!* Resize & relax @ Mallard Landing* NOW $113,900* 1BR/1.5 BA * (www.lnf.com\470127)* Bonus Rm; 1187 Sq. Ft)* “Oxford” modle w/upgrades* One of the few to have a Fireplace
THINK ABOUT ITWhether you rent or own, YOU pay for the house you live in. So, why pay the Landlord? THERE ARE SOME INCREDIBLE BUYS OUT THERE! Doesn’t it make sense to invest in
yourself? Call Nancy Althaus 410-726-6080 for FREE Buyer counseling.
THERE ARE SOME INCREDIBLE BUYS OUT THERE! Doesn’t it make sense to invest in
FIRST FLOOR MASTER * $170,000* (www.LNF.com\465146)* 3BR/2.5BA Townhouse; 1916 Sq. Ft.* 2 Bonus Rooms = 4th BR & a Craft Rm. or Offi ce* FR w/FP; E-I Kitchen * Formal LR & DR* California-style fi nished Garage
ESREG.01.06.indd 6 5/10/11 11:00:49 AM
Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 - Page 7
8407 Fishing island rd., westover - Comfortable and spacious home on 1.07 acre
lot close to the bay. 3 BR and 2BA plus large kitchen and LR. Fenced yard and
storage shed. $145,000 MLS# 464263
8605 Middlesex dr., delMar 4 bedsrooms 2 baths on .95 acres in Essex Ridge. Open floorplan with first floor bed
and bath $199,000 MLS# 471481
426 Priscilla st., salisbury REMODELED! This beautiful
home boasts 3BR and 2.5 BA including a 1st floor master, hardwood and tile flooring. Screened porch and rear
deck plus garage and shed. $129,900 MLS# 467906
29833 deer harbour dr., salisbury - 5 bedrooms, 3.5 baths with first floor master in Deer Harbour. $278,000 MLS# 471778
911 vaden ave., salisbury Great Investment! Triple
lot on corner. 3 bedrooms and 2 full bathrooms with separate apartment and
partial basement. $99,900 MLS# 471943
9331 croPPers island rd., newark custom built 4 bedrm 2.5 bath home on 1.5 acres in Newark. attention to detail throughout,
gourmet kitchen and delux master suite with private porch.
$369,800 MLS# 466803
lots
Sally Todd Stout 410.726.3506
sallystoutrealtor@yahoo.com
2618 N. Salisbury Blvd. Suite 120, Salisbury, MD 21801 • 410-912-4700An Independently owned and operated member of the Prudential Real Estate Affiliates
Skip Lyons 443.235.0200
skip.lyons@comcast.net
134 nina ln., Fruitland .41 acres $69,900 nanticoke rd., nanticoke 4.06 acres $69,900 9076 bistate blvd, delMar .34 acres $4,900
cove st., crisField .20 acres $13,900 cove st., crisField .17 acres $11,900
20214 nanticoke rd.700 feet of private beach on Nanticoke River on this 13 acre parcel with 4 bedroom
1600 square foot home. $578,853 MLS# 463711
7 139th st., ocean cityLooking for a great invest-
ment? This first floor 2 bed 2 bath unit is only 1/2 block from the beach with great rental potential! $239,900
MLS# 468214
reduced
new listing
161 nina ln, FruitlandBeautiful 5 BR home in East Field subdivision. 1st floor BR & BA along with large
LR, formal DR, FP, and back deck.
$269,900 MLS# 469550
600 edgewater dr., salisbury Recently updated 2 bed-
room, 2 bathroom home in immaculate condition; On a corner lot in Spring Chase.
$174,900 MLS# 472323
reduced
reduced
reduced reduced
See more of these listings at
www.youtube.com-enter property
address.
20 sandyhook rd.,ocean Pines - An Ocean
Pines best buy! Remodeled with all new appliances. 3 bed 2 bath home with large
fenced rear yard conve-nientlly located inside the
North Gate of Ocean Pines $176,853 MLS# 465630
reduced
1204 orchard cr., salisbury Close to the Universtiy- city
services and no city taxes. 3 bedroom 2 bath rancher with sunroom, living room, family room with fireplace, and din-
ing room. $205,000 MLS# 448793
28305 nanticoke rd., salisbury - Spacious
2100 square foot home on 1.62 acres with fenced yard, outbuilding and two
master suites, a great value! $199,900 MLS# 457283
231 canal Park dr - salisbury2 bedroom 2 bath condo in Canal Woods- enjoy maintenance free living! Freshly painted and great
views of the pond in this first floor unit. $93,900 MLS# 465784
1201 taney ave., salisbury Close to University, city services
and no city tax. This 1766 sq foot 3 bedroom 2 bath home
with basement on a lg corner lot is a must see.
$169,900 MLS# 470064
new listing
ESREG.01.06.indd 7 5/10/11 11:01:54 AM
Page 8 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06
“Main Office”(Between Panera Bread & Barnes & Noble)Salisbury Blvd, Salisbury, MD 21801
410.912.4700 800.241.9590
Prudential Carruthers SalisburyPrudentialCarruthers.com
“Model Home”Captain’s Cove, VA757.854.0548
Captain’s Galley Condo, Crisfield410.968.9686
Visit us Online Search the Entire MLS
www.prudentialcarruthers.com
Page 8 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06
An independently owned and operated member of the Prudential Real Estate Affiliates.
3 Bedrooms, 2.5 Baths$119,000(472195)
2 Bedrooms, 1 Bath$117,900(471773)
3 Bedrooms, 1.5 Baths$114,900(467744)
3 Bedrooms, 2 Baths$132,495(470115)
2 Bedrooms, 1 Bath$89,900(469294)
3 Bedrooms, 2 Baths $117,600(468611)
3 Bedrooms, 1 Bath$69,900(467666)
2 Bedrooms, 1 Bath$86,900(470320)
3 Bedrooms, 2.5 Baths$164,900(471192)
3 Bedrooms, 2 Baths$159,900(468314)
4 Bedrooms, 2 Baths$149,900(470366)
3 Bedrooms, 2 Baths$164,900(470763)
Smart Phone?Here’s the QR Code
for SALISBURY Prudential CarruthersREALTORS Website
www.facebook.com/SalisburyHomes
1.2 ACRES
3 Bedrooms, 2 Baths$168,900(472082)
4 Bedrooms, 1 Bath$139,900(471958)
Waterfront Lot$110,000(472439)
ESREG.01.06.indd 8 5/10/11 11:02:22 AM
Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 - Page 9
Kevin White
MAnAGeR
“Main Office”(Between Panera Bread & Barnes & Noble)Salisbury Blvd, Salisbury, MD 21801
410.912.4700 800.241.9590
Prudential Carruthers SalisburyPrudentialCarruthers.com
“Model Home”Captain’s Cove, VA757.854.0548
Captain’s Galley Condo, Crisfield410.968.9686
Please Say You Saw It In EASTErn ShorE’S rEAL ESTATE GUIDE- Vol. 01, no. 06 - Page 9
4 Bedrooms, 3.5 Baths32.5 Acres $1,800,000
(469465)
3 Bedrooms, 2.5 Baths$1,495,000(460879)
3 Bedrooms, 2 Baths$396,318(472011)
3 Bedrooms, 2 Baths$249,000(467835)
4 Bedrooms, 2 Baths$315,000(467876)
5 Bedrooms, 3 Baths$269,900(469550)
4 Bedrooms, 2.5 Baths$275,000(464516)
3 Bedrooms, 2.5 Baths$282,000(471639)
3 Bedrooms, 2.5 Baths$199,000(470767)
4 Bedrooms, 2.5 Baths$369,800(466803)
WATERFRONT21+ ACRES
4 Bedrooms, 1.5 Baths $289,900(468221)
15 ACRES
Visit us Online Search the Entire MLS
www.prudentialcarruthers.comAn independently owned and operated member of the Prudential Real Estate Affiliates.
4 Bedrooms, 2.5 Baths$329,000(471224)
4 Bedrooms, 2.5 Baths$279,900(466099)
3 Bedrooms, 2 Baths$177,900(469555)
•
•
•
3 Bedrooms, 2 Baths$164,986(468882)
ESREG.01.06.indd 9 5/10/11 11:02:55 AM
www.captainscoveproperties.com2618 N. Salisbury Blvd. Suite 120
Salisbury, MD 21801
CINDY WELSH302-381-6910 Cell
410-912-4700 OfficeCANDHWELSH@AOL.COM
Your Captains Cove Connection
Chincoteague Bay Views 70’ BoardwalkCanal Front, Owner Financing
MLS# 463872
NEW LISTING 943 Sailors Ct. Canal Front
$110,000 MLS# 472393
Interior Lots$9,900 4/1948 Wooded (465820)$9,900 7/227 Wooded (465783)$9,900 10/8 Cleared, cul-de-sac (465781)$10,000 9/112 Wooded, (466845)$10,000 1/816 Wooded, (469904)$11,900 5/2442 Wooded, Approved for septic (471387)$11,900 4/1993 Wooded, Approved for septic (472282)$12,000 6/85 Wooded, Approved for septic (466989)$12,895 8/24 mostly cleared, Approved for septic (470484)$13,000 11/91 Wooded, Approved for septic (468131)$13,495 5/2376 Wooded, Approved for septic (471602)$14,000 5/41 Wooded, Approved for septic (470205)$25,000 8/8 Wooded, Approved for septic (464430)$39,900 1/856 Wooded, corner lot Water & Sewer (464019)$59,900 1/1238 Cleared, Bay view, Water & Sewer (464021)
Golf Course Lots:$26,900 Mostly Cleared w/s Availability (472279)$27,000 2/136 Wooded, Views of 8th green & fairway (468729)$27,500 Cleared, Views of 9th Hole & Pond (471489)$29,500 2/313 Cleared, Views of 6th fairway (470230)$55,000 2/150 Wooded, Approved for septic, Views of 9th fairway & pond (463847)$55,000 2/125 Wooded, Approved for septic, Views of 8th fairway (463848)
Future Development/Investment Lots: Lots currently in undeveloped areas$3,900 17/81 (465778) $4,000 13/298 (467036) $9,900 13/97 (465835)$3,900 18/109 (465841) $4,000 13/357 (467038)$4,000 13/325 (467041) $4,000 10/49 (471390)
7 LOT PACKAGE:$9,900 For ALL 7 LOTS!! (1 buildable/6 future buildable) Great opportunity for a group of golfers/swimmers, ect. to own property in Captains Cove and enjoy all the amenities (469636)
Page 10 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06
An independently owned and operated member of the Prudential Real Estate Affiliates.
ESREG.01.06.indd 10 5/10/11 11:03:36 AM
Page 11 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 MHBRMHBR MHBR MHBR H # 457# 4545# 45775700
Actual view from residence
Have it all at The Gateway Grand, Ocean City’s premier oceanfront property. Ocean and bay views. Private terraces and shared lounges. Indoor and outdoor pools. The Vista residences off er beach lovers twice the luxury all year long.
Schedule your tour of the new Vista models today. Sales offi ce open daily from 10 a.m. to 5 p.m.
GrandValueOC.com866-531-5942 Two 48th Street, Ocean City, MD 21842
TTHHHHEEE GGGGGGGAAAAAAAATTTTTTEEEEEEEWWWWWAAAAYYYY GGGGGRRRRAAANDD IINNNTTTRRROOODDDDUUUCCEEEESSS......
LuLuLuLuxuxuxuxuryryryry TTTThrhrhreeeeeee- anana dd FoFoururu -BB- eddede rooommom RResese iddididennenencececec sss wiwithth BBototthhhh OcOceaeannnn anand d BaBaBay yy ViViViV ewewwss StStara tingg at $6$69999,9,90000..
TCC_GG_SpringAd_RealEstate_42806b.indd 1 4/19/11 4:21 PMESREG.01.06.indd 11 5/10/11 11:03:58 AM
Page 12 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06
VERY NICE 3 BR rancher within short distance of Schumaker Park pavil-ion & playground. Family rm has FP w/gas insert, sunroom, wood & tile floors, granite countertops & central air, 2-car detached garage w/shop area & woodstove, 10x21 shed & paved drive. $199,900. (468513)
SPACIOUS COLONIAL Northwest spa-cious colonial has 3Br, 2.5 bath with great room, DR, beautiful kitchen, screened porch, large MBR w/ walk-in closet and bath. 2 car attached garage and fenced patio. $249,900. Call Jill Yost 443-523-1365. (471089)
23 TIDEWATER SEAFORD, DEGlamorous contemporary 4BR, 4 bath Seaford home in Holly Shores has full finished basement, FP in Fam Rm, beau-tiful cathedral ceilings & state of the art kitchen, 3 car garage, walk up attic, spe-cial financing available. $599,900. Call Jill Yost (578562)
CHARMING rancher in a private setting. 3 bedrooms, 2 baths, fireplace in living room. Outside includes a deck, patio & a attached garage. $174,900. Call Jill Yost 443-523-1365. (470187)
SCOTLAND PARkWAY 3rd floor game room 580 sq ft; fireplace in family room; large rooms; formal living room & din-ing room; eat-in kitchen; 2 car garage. $324,900. Call Jill Yost 443-523-1365. (471825)
GREAT RANCHER Just around the corner from marina, over 4.5 acres sur-rounded by County Park. 3 bedroom rancher with central air, family room, and several outbuildings. $155,000. Call Jill Yost 443-523-1365. (468341)
CUSTOM bUILT 5bR, 3.5 bath Contem-porary with beautiful fireplace, cathedral ceiling Great Room, hardwood & tile floors, loft overlooking Great Room, of-fice, 2 master bedrooms, deck & 3 car garage on cul-de-sac just 13 miles East of Salisbury. $424,900 Call Jill Yost @ 443.523.1365 (453550)
CHARMING HOME In established neighborhood. Nice kitchen with tile floor, center island, recessed lighting, 2-car detached garage and large deck. $229,900. Call Jill Yost 443-523-1365.
AUGUSTA CIRCLE Contemporary 4 BR, 2.5 bath home with main floor MBR, of-fice, formal LR & DR, family room w/FP, kitchen w/central island, deck, inground pool, 2-car attached garage. $279,900 Call Jill Yost 443.523.1365 (472079)
Jill Yost REALTOR® / AGENT
cell 443.523.1365 office 1.800.842.5704
jill.yost@longandfoster.com
Long & Foster® Real Estate, Inc.
Salisbury, Md
Page 12 - Please Say You Saw It In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06
ESREG.01.06.indd 12 5/10/11 11:27:19 AM
Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 - Page 13
107 S. Commerce StreetCentreville, MD 21617
www.AshleyPremier.com
410.758.3000 410.763.7000
123 N. Washington StreetEaston, MD 21601
Rockcliff DRiveEaston - 2731 SF heated living space and a 480 SF Garage. Wonderful wrap around porches. Open kitchen, dining - family area. Sports a very large dining room, den and lots of bedroom space. $439,000 Joyce Wallace 410-829-5031
MaRshall DRiveBrand new Colonial to be placed on a premium 1.19 acre lot in Bridgetown Estates. 4 BR, 2.5 Ba. Great location. $340,000 (QA7548490) Jack Ashley 410-310-0800
Wye Mills 2+ unrestricted acres in picturesque Wye Mills and approx. 5 miles from the public boat ramp. First floor master, living areas upstairs and down, inground pool, and more! $450,000 Cynthia DeGuzman 410-725-6977
conquest DRiveHave it all - water views, gourmet kitchen, 1st floor master, luxurious pool area, separate driveway to huge outbuilding. $585,000 Kelli Miles 410-490-9107
centRevilleGreat kitchen w/breakfast area. Gas fire place, bright and airy foyer and open dining. Large master suite. $424,900 Norma Coursey 410-490-1307
haRMony RoaDNice Farmette that has been redone. New roof, siding, replacement windows add to the value. There is a stream and small pond. Mostly cleared; bring the horses and other pets. $298,000 Shirley Joyce 410-310-8635
colony ciRcle Stunning and private in affordable, sought after Easton community. Wood floors, built-ins, generous kitchen and more; Only $279,000 Cynthia DeGuzman 410-725-6977
Belle aiRe PlaceGood size rancher in nice community located on a quiet cul-de-sac backs to woods. (TA7582926) $133,400 Shirley Joyce 410-310-8635
henDeRson4+ acre wooded lot. Built with lots of special touches - rounded corners, arches, tile and wood flooring. $199,000 Shirley Joyce 410-310-8635
79+ Wooded Acres in Queen Anne Co. $475,000
ESREG.01.06.indd 13 5/10/11 11:04:40 AM
Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06 - Page 14
Staples & Associates Insurance offers peace of mind through quality insurance products and a caring staff of professionals that is always ready to serve. As a full service Insurance Agency providing Auto, Home, Life, Business, and Farm insurance solutions, Staples & Associates Insurance can help you control uncontrolable cirumstances.
Securities offered through Billy Staples as a Registered Representative of Nationwide Securities, LLC P.O. Box 183137, Columbus, OH 43218, 888-753-7364. Member FINRA, SIPC. DBA Nationwide Advisory Services, INc. in AR, FL, IL, WV. DBA NAtionwide Advisory Services in MA, NY, OK. Representative of Nationwide Life Insurance Copman af liated companies and other companies.
Billy Staples, MBA
Staples & Associates Insurance
1410 S. Salisbury Blvd.Salisbury, MD 21801
staplew@nationwide.comTel: 410.546.3999 | Fax: 410.546.6165
On Your Side Certified Agent
Nationwide Financial Network®
37101.22.13.indd 6 4/12/11 3:21:59 PMESREG.01.06.indd 14 5/10/11 11:04:53 AM
Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. No. 04 - Page 15 Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. No. 04 - Page 15
7802 Coastal HighwayOcean City, Maryland 21842
MELISSA BEROTTIREALTOR®, Licensed in MD
Cell: 443-497-1888Office: 410-723-0988Email: maberotti@yahoo.com
Please Say You Saw It In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 06 - Page 15
Austin Circle- Fabulous 4 bedroom home located just minutes from downtown Berlin. Great kitchen, gas fi replace, 3 full baths, open living area, fi rst fl oor master suite w/whirlpool tub, and a bonus room with a full bath as well. Great backyard with a rear screened deck for you to BBQ. This Contemporary home also features an oversized attached garage w/plenty of storage, ceiling fans in every room, and a vinyl fenced in rear yard...Priced to sell at $284,500!! Call Melissa Berotti
for your appointment to see Austin Circle today at 443-497-1888
ESREG.01.06.indd 15 5/10/11 11:05:50 AM
Page 16 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 06
ALL BRICK BEAUTY Offering a complete re do inside! Beautifully refinished hard-wood floors, all new kitchen with upgraded appliances, new tile floors, new high end cabinets, faucet, sink. A complete package! Custom painted through out. lovely crown molding. All new bathrooms. Two masonry fireplaces. Partial basement. Full walk up attic. This is a showplace!New high efficiency oil furnace installed 2007. $169,900 (471190)
2.26 ACRES Great potential for an in home business, in law quarters or just a lot of home for the money! Huge Deck w/screened room, lg open floor plan, skylights on the 2nd flr, Loads of possi-bilites w/adddition side, ramp already in place! Highly motivated seller that is easy to work with. Bring all offers for this coun-try living yet walk to Wor Wic convenient location!. $195,000 (467871)
SOLD!
GORGEOUS! 9 foot ceilings! Hardwood floors! Granite countertops! Lots of windows! 3 car garage! This 4 bedroom home has it all. Delmar school district. $275,000 Call Elaine Gordy 410-726-9001 (467424)
BEAUTIfUL LOCATIOn across from Tony Tank Lake. Gorgeous home with hard-wood floors, brand new gourmet kitchen, screened porch, fenced yard, 2 car garage, 2 fireplaces, 4 bedrooms, 2.5 baths & hardwood floors!! BEST Of BOTH WORLDS: COUnTY TAxES & CITY SERvICES... CALL ELAInE GORDY 410.726.9001 $324,900 (468678)
BEAUTIfUL TOWnHOME - Very well cared for one owner home in the new-est section of Stone Gate. Privacy in the back yard, attached storage shed. Huge living area flows into a large kitchen and dining area perfect for entertaining. Upstairs the master bed-room affords privacy and a larger than life walk in closet. This floorplan offers the most living space for the dollar in a Salisbury townhome. $139,900 (470250)
GREAT RAnCHER! - Beautiful little one owner home. Hardwood floors, oil furnace replaced 8 years ago, roof is 12 years old. Solid, well built and well cared for home. $69,900 (470283)
BEAUTIfUL double wide home with ca-thedral ceilings, 3 bedrooms, 2 baths, fireplace, deluxe master bathroom, almost 1800 square feet. Only 6 years old this home has been gently lived in, very clean and well cared for. New shed. Nicely landscaped.$59,900 (469554)
DELIGHTfULLY DECORATED Easy liv-ing home with a delightful screened porch, rear deck, full walk up attic, lovely upgraded kitchen with pantry, 2 lazy susans, appliance garage. HOA maintains the yard, sprinklers, shrub-bery, mulch. Lock it up and go lifestyle in a very comfortable setting. Located near the historic Teackle Mansion. $174,000 (471165)
CLOSE TO BEACH! - 3 Bedrooms, 2 baths, great floorplan, home features a sun-room overlooking a large back yard, an oversized 2 car detached garage, paved driveway, rear deck. Very com-fortable, convenient and economical. 15 minute drive to the beach. Call Elaine Gordy 410.726.9001 $164,900 (462211)
SPRInG CHASE BEAUTY located on a beau-tiful lot overlooking a serene and private wooded area. Comfortably updated and ready to move into this custom decorat-ed home is warm and perfect for anyone looking for a low maintenance home in a convenient location. $173,250 (462362)
GREAT LOCATIOn Close to Salisbury Uni-versity. Nice waterfront end unit with great views and extra windows. Water-front balcony. Updated bathrooms. Very nice, convenient carefree living. Condo fee includes water, sewer, and trash fee. No maintenance, no worries. $109,900 (466282)
LOvELY REMODELED and updated home on a very quiet dead end street. New carpeting, new vinyl, replacement windows, new exterior doors, brand new bathroom with tile wall and floors, freshly painted. Great back yard with a deck overlooking a wooded back drop. Attached garage. Well maintained and gently lived in, this home is in move in condition. .$159,900 (466607)
EASY LIvInG LIfESTYLE! Custom built, gently lived in one owner home in a convenient, well manicured com-munity. Lg open one floor living w/9 ft ceils, designer kitchen, FR w/FP, screened porch overlooking a peaceful, tranquil setting. Attached 2 car garage. $239,900 (454671)
PREPARE fOR nO MAInTEnAnCE! Prepare for low heating & cooling costs! Lock it up and go on vacation! - No worries! This lovely, all brick, Village in the Park home provides you peace of mind, se-curity & elegance! Move in tomorrow! Very private setting this 3 bedroom, 2 bath home with 2 car garage is a carefree home in a convenient location. $274,900 (457227)
Elaine Gordy410-726-9001
1-800-842-5704 ext.1337EGordy@ezy.net
LonG & FostEr rEaL EstatE , Inc.
LOTS...LOTS...LOTS 2.3 acres south of Salisbury. Country living! Cleared, perced, ready to go! fruitland School District. $69,900
Beautiful wooded private 1.5 acre lot in established neighborhood. Approved & ready to build on! $69,900
REDUCED
REDUCED
REDUCED
REDUCED
ESREG.01.06.indd 16 5/10/11 11:06:47 AM