Post on 16-Mar-2018
transcript
Elucidating the Role of gpW: an Essential Baseplate Protein in Bacteriophage P2
by
Mostafa Fatehi Hassanabad
A thesis submitted in conformity with the requirements for the degree of Master’s of Science
Department of Molecular Genetics University of Toronto
© Copyright by Mostafa Fatehi Hassanabad 2011
ii
Elucidating the role of gpW: an Essential Baseplate Protein in
Bacteriophage P2
Mostafa Fatehi Hassanabad
Master’s of Science
Department of Molecular Genetics
University of Toronto
2011
Abstract
The long, contractile tails of myophages are the conduit for phage DNA transfer into the
bacterial host cell and the most important part of the myophage tail is the baseplate; a complex
structure, distal to the phage head. To better understand the structure and function of myophage
baseplates, a component of the phage P2 baseplate, gpW was studied. This protein is widely
conserved among myophages and is essential for the formation of infectious phage particles.
Bioinformatic work confirmed that gpW homologues are found in almost all myophages and in
many prophages. Moreover, gpW was shown to be a structural component of the virion; and,
using electron microscopy, it was found to be at the top of the P2 baseplate. It was also found
that some single residue substitutions can completely disrupt gpW function. Finally, evidence is
presented that at least eight different proteins may be required to form intermediate P2 baseplate
structures while other proteins may be necessary for the formation of stable baseplate complexes.
iii
Acknowledgments
First and foremost, I’d like to thank my supervisor, Alan Davidson, for giving me the
opportunity to pursue graduate studies in Molecular Genetics. His support and supervision
throughout the past two years have helped make my introduction to the life sciences exciting and
scientifically rewarding. I thank my supervisory committee; Dr. Barbara Funnell and Dr. John
Parkinson who helped guide my project and kept me on my toes at committee meetings. I am
also thankful to Battista Calvieri and Steven Doyle for teaching me how to use the electron
microscope.
I have certainly come a long way since I joined the lab in 2010 and for this progress I must thank
everyone in the Edwards lab. Dr. Karen Maxwell deserves special thanks for her constant
guidance, constructive comments and enthusiasm. I’d also like to thank Dr. Lisa Pell for helping
me organize my original experiments and for her insightful suggestions. Kelly, Nichole and
Diane are incredible teachers and they always supervised me the first time I tried an experiment.
On the “rarest” occasion that an experiment didn’t work perfectly, they helped dissect what went
wrong. Senjuti, Norrapat and Kris took turns in getting me to do things outside the lab; a
restaurant, a game of bowling or trips to the gym. In addition to stimulating discussions about
everything, from theatre to world politics and sports, my lab mates were always supportive and
encouraging; they have all become very valuable friends. I also thank all of the members of the
Davidson lab; specifically, Dave was a very helpful mentor and Tom was my phage P2 colleague
who kindly lent me several of his cloning constructs.
I must also sincerely thank all of my other teachers. I am thankful for the support and invaluable
friendship of my brothers. Most importantly, I am grateful to my first two teachers, my mother
and father who taught me the reason for any pursuit.
iv
Table of Contents
Acknowledgments .......................................................................................................................... iii
List of Tables ................................................................................................................................. vi
List of Figures ............................................................................................................................... vii
List of Appendices ......................................................................................................................... ix
Chapter 1 Introduction .................................................................................................................... 1
1 Introduction ................................................................................................................................ 1
1.1 Background ......................................................................................................................... 1
1.2 The phage tail ...................................................................................................................... 2
1.2.1 The myophage tail ................................................................................................... 3
1.2.2 The baseplate is the command center of infection .................................................. 4
1.3 Phage P2 is a good model to study myophage baseplates .................................................. 5
1.4 GpW is homologous to gp25 in phage T4 .......................................................................... 7
1.5 Research goals .................................................................................................................... 9
Chapter 2 Materials and Methods ................................................................................................. 10
2 Materials and Methods ............................................................................................................. 10
2.1 Media and Buffers ............................................................................................................. 10
2.2 Bacterial Strains ................................................................................................................ 11
2.3 PCR amplification ............................................................................................................. 11
2.4 Gene cloning, plasmids and mutagenesis ......................................................................... 12
2.4.1 Gene Cloning ........................................................................................................ 12
2.4.2 Plasmids ................................................................................................................ 12
2.4.3 Mutagenesis .......................................................................................................... 14
2.5 Preparation and transformation of competent cells .......................................................... 14
2.6 Phage preparation and purification ................................................................................... 15
2.7 The in vivo complementation assay .................................................................................. 16
v
2.8 Electron Microscopy ......................................................................................................... 17
2.8.1 Grid Preparation .................................................................................................... 17
2.8.2 Sample Staining .................................................................................................... 17
2.8.3 Image acquisition .................................................................................................. 17
2.9 Particle alignment and averaging ...................................................................................... 17
2.10 Protein expression and purification .................................................................................. 18
2.10.1 Native protein purification .................................................................................... 18
2.10.2 Determining protein concentration ....................................................................... 19
2.11 SDS-Page and Western blotting ........................................................................................ 19
Chapter 3 Results .......................................................................................................................... 21
3 Results ...................................................................................................................................... 21
3.1 GpW is a very widely conserved protein in Myophages .................................................. 21
3.2 GpW is a structural component of the P2 baseplate ......................................................... 24
3.3 Different mutations in gene W affect gpW function ........................................................ 26
3.4 The formation of intermediate P2 baseplate structures requires at least eight proteins .... 32
Chapter 4 Discussion and Future Directions ................................................................................ 36
4 Discussion and future directions .............................................................................................. 36
References ..................................................................................................................................... 41
Appendices .................................................................................................................................... 46
vi
List of Tables
Table 2.1 List of media and buffers used in this study
Table 2.2 Bacterial strains used in this study
Table 3.1 Classifying gpW homologues involved in T6SS
vii
List of Figures
Figure 1.1 The Caudovirales.
Figure 1.2. The contractile tail sheath.
Figure 1.3 R-type Pyocin
Figure 1.4 The dynamic baseplate structure.
Figure 1.5 The myophage baseplate.
Figure 1.6 Sequence alignment of gpW and gp25
Figure 1.7 The putative location of gpW in the P2 baseplate.
Figure 2.1 The gpW_MBP and gpW_trc constructs.
Figure 2.2 The V-G, D and UD constructs.
Figure 2.3. The XUD construct.
Figure 3.1. Distribution of gpW homologues in prophages.
Figure 3.2 gp46 of phage Mu is homologous to gpW.
Figure 3.3. Electron microscope image of the Wam lysate.
Figure 3.4. GpW is a structural component of P2.
Figure 3.5. EM images were used to determine the position of gpW.
Figure 3.6 The X-ray crystallography structure of a gpW homologue in G. sulfurreducens.
Figure 3.7 Selecting residues for substitutions.
Figure 3.8. In vivo complementation assays with gpW expressed from the gpW_trc construct
Figure 3.9. Transmission Electron Microscope images of mutant phage lysates.
viii
Figure 3.10. Varying levels of gpW expression.
Figure 3.11. In vivo complementation assays with gpW expressed from the gpW_ENDO
construct
Figure 3.12 GpX is required for P2 tail formation.
Figure 3.13. EM images were used to determine the position of gpX.
Figure 3.14. Purifying intermediate baseplate complexes.
Figure 3.15. EM image of putative baseplate complexes.
Figure 4.1 Our model of the P2 baseplate.
ix
List of Appendices
Appendix A1. The P2 baseplate proteins
Appendix A2. The P2 Genome
Appendix A3. List of Primers used in this study
1
Chapter 1 Introduction
1 Introduction
1.1 Background
Bacteriophages (phages) are a diverse group of viruses that infect eubacteria and archea. Phages
are ubiquitous in the biosphere; i.e., anywhere there are bacteria or archea, there are phages.
They are especially abundant in the oceans, with approximately 1010
particles per liter in surface
waters (Bergh et al., 1989; Wommack and Colwell, 2000). Hence, phages are the most abundant
biological entity on Earth with an estimated global population on the order of 1031
(Hendrix,
2003). In addition, most cultivable bacteria harbor at least one prophage, a phage genome that
has been incorporated into the bacterial genetic material (Casjens, 2003; Ackermann, 2007).
Because of their prevalence and abundance, phage play a significant role in regulating microbial
populations and in the cycling of nutrients within the environment (Calendar, 2006). Moreover,
phage contribute to bacterial diversity and evolution in several ways. Phage mediate genetic
exchange among bacterial strains, and even species; hence, increasing diversity at the genetic
level (Calendar, 2006). Also, by killing dominant bacterial strains or species, phage allow
bacterial strains or species to survive that would otherwise have been out-competed by more
dominant bacteria (Thingstad, 2000). Concurrently, the parasitic nature of phages drives
antagonistic coevolution between them and their bacterial hosts.
To date, more than 5500 different bacteriophages have been examined under the electron
microscope (Ackermann, 2007). A great majority of these, 96%, belong to the order
Caudovirales (tailed virus) while the rest are more unusual phages such as the polyhedral,
pleiomorphic and filamentous phages. The Caudovirales are an extremely diverse order with tail
lengths ranging from 10-800nm and genome sizes ranging from 17 to 500 kb. However, they all
have double stranded DNA (dsDNA), icosahedral capsids (85% have isometric capsids) and tails
that consist of stacked disks or helical strands (Calendar, 2006).
As shown in Figure 1.1, tailed bacteriophages can be classified into three families based upon
their tail structure. The myophages have a long tail surrounded by a contractile sheath; the
2
siphophages have a long, non-contractile, tail and podophages have short tails (Ackermann,
2007) (Figure 1.1). In general, myophages have larger genome sizes than the other two families
and the myophage tail is usually more complex, consisting of more proteins than siphophage or
podophage tails.
Figure 1.2 The Caudovirales. From left to right, Schematic of a long-tailed phage, electron
microscope (EM) images of a myophage, P2, a siphophage, λ and a podophage, T7 are shown.
Image of phage λ is adapted from (www.biochem.wisc.edu/faculty/inman/empics/virus.htm)
1.2 The phage tail
The bacterial cell wall is a multilayered structure that provides structural integrity and protects
the bacteria against osmotic pressure. This structure is also a barrier across which phage have to
translocate their genetic material. Moreover, prior to the injection of genetic material, phage have
to recognize and bind to their host cells. In the Caudovirales, both of these challenges are
overcome by the action of phage tail proteins. The tail spike protein and the tail fibers bind to
molecules on the surface of the bacterial cell wall during phage adsorption. Subsequently, tail
proteins form a channel in the bacterial cell wall for DNA entry (Fuecht et al, 1990; Calendar,
2006). For example, the tail spike protein of phage P2 (a myophage which is the focus of our
study) most likely binds to lipopolysaccharide (LPS); a molecule on the outer membrane of
E.coli (and many other gram-negative bacteria) (Kagayama et al., 2009). Next, the P2 tail sheath
and tail tube proteins must act in concert to create a channel that traverses the outer membrane,
the periplasm and the cytoplasmic membrane of E.coli.
Capsid
Tail
Connector complex
Baseplate
Tail Fibers
3
Due to its role in host recognition and DNA injection, the tail may be considered as the phage
infection machinery. As mentioned above, the myophage tail is structurally more complex than
other phage tails and understanding the function of a myophage tail (phage P2) is the ultimate
aim of this study.
1.2.1 The myophage tail
The myophage tail is composed of the tail tube and a surrounding contractile sheath. Hundreds of
copies of the Tail Tube Protein, TTP are stacked as hexameric rings to form the tail tube. The
sheath consists of hundreds of copies of the Tail Sheath Protein, TSP, stacked as hexameric rings
or as helical strands: 31-33 hexameric rings in phage P2 (Lengyel et. al, 1974) and 6 strands
(each with 23 copies of the TSP) in myophage T4 (Aksyuk et al., 2009). The tail is connected to
the capsid through a connecter complex and, distal to the capsid, there is a complex of proteins
referred to as the baseplate. As shown in Figure 1.2, the sheath almost always contracts toward
the capsid, thus exposing the lower end of the inner tail tube (Calendar, 2006).
Figure 1.2. The contractile tail sheath. EM image of P2 phages, one with a contracted tail sheath
and the other with a relaxed tail sheath (the bar represents 20nm).
Gene clusters that encode myophage tail-like structures have been incorporated by bacteria.
These structures may be used directly as bacteria killing agents; for example, the R-type Pyocins
(Figure 1.3) secreted by many Pseudemonas species selectively kill other bacterial strains. The
operons encoding Pyocins are related to phage genomes because significant sequence similarity
exists between phage tail proteins and Pyocin proteins (Nakayama et al., 2000). Another
myophage tail-like structure employed by bacteria is the type VI secretion system, T6SS, which
4
is used to secrete proteins. T6SS and phage tails are clearly connected evolutionarily; several
studies have found sequence and structural similarities between T6SS proteins and proteins from
siphophage (Pell et. al, 2009) and myophage (Leiman et al., 2009) tails. Many gram negative
bacteria use T6SS to secrete effector proteins and toxins into their environment, into surrounding
bacteria or even into eukaryotic cells. Hence, the T6SS is a major virulence determinant in many
pathogenic strains of bacteria (Filloux et al., 2008; Burtnik et al., 2011).
Figure 1.3 R-type Pyocin. This myophage tail-like bacteria killing agent is secreted by
P.aeruginosa PAO1 (EM image from Senjuti Saha).
1.2.2 The baseplate is the command center of infection
During myophage assembly, tail polymerization starts at a complex structure referred to as the
baseplate; and in fully formed phage, the baseplate is located on the end of the tail (Calendar,
2006; Ackermann, 1999). The baseplate which includes a protruding spike protein plays an
important role in myophages. Tail fiber proteins bind reversibly to cell surface receptors and the
protruding spike binds irreversibly to cell-surface receptors in a two-step adsorption process.
Upon adsorption to the host cell, conformational changes in the baseplate trigger contraction of
the tail sheath and ultimately lead to the ejection of the phage DNA through the tail tube and into
the bacterial cytoplasm (Figure 1.4). Hence, the baseplate may be considered the command
center of myophage infection (Kostyuchenko et al., 2003). To fully understand myophage
infection, one needs to elucidate the structure and function of baseplates.
5
Figure 1.4. The dynamic baseplate structure. The conformation of the T4 baseplate changes upon
interaction with the host cell, leading to the contraction of tail sheath protein and the ejection of
phage DNA. The cryoEM reconstructions of the baseplate structure prior to (A), and after (B),
sheath contraction have been included (modified from Leiman et al., 2010).
1.3 Phage P2 is a good model to study myophage baseplates
Most studies of the myophage baseplate have focused on the uncharacteristically complex phage
T4 baseplate. This baseplate is constructed in a stepwise fashion where six wedge-like structures
surround a central hub complex to form an intermediate structure. T4 baseplate wedges and the
central hub are created separately and their assembly requires 7 and 5 proteins respectively. The
addition of tail fibers and two other proteins (gp48 and gp54 which are at the very top of the
baseplate) complete the formation of the T4 baseplate (Yap et al., 2010). The baseplate wedges
and central hub structures exist in other myophage baseplates but their formation usually requires
fewer proteins.
While much of our current knowledge of myophage baseplate structure and function stems from
studies of the uncharacteristically complex T4 baseplate, some interactions between T4 baseplate
proteins are uncharacterized. Hence, studying their homologues in a less complex system may
help in understanding the interactions. An ideal candidate for such research is the baseplate of
phage P2 which is less complex than the T4 baseplate and more representative of myophage
baseplate complexity.
B. A.
6
P2 is a temperate myophage with a 33.6 kb genome packaged in a 60 nm icosahedral head,
which is attached to a 135 nm long tail (Calendar, 2006). Bacteriophages and prophages that are
similar to P2 with respect to genome organization and nucleotide sequence are called P2-like.
P2-like prophages are commonly found in E. coli. In fact, at least 26% of the strains in the E. coli
reference collection (a collection of 72 E.coli strains chosen from 2600 isolates from around the
world; Ochman et al., 1984) contain a P2-like prophage (Calendar, 2006). In addition, P2-like
phages and prophages are distributed among other proteobacteria of the gamma subgroup such as
phages HP1 and HP2 of Haemophilus influenzae (Esposito et al., 1996; Williams et al., 2002),
ΦCTX of Pseudomonas aeruginosa (Nakayama, 1999), K139 of Vibrio cholerae (Nesper et al.,
1999), PSP3 of Salmonella potsdam (Bullas et al., 1991) and SopEΦ of Salmonella typhimurium
(Mirold et al., 2001).
Of the 44 P2 genes (Appendix A2), 15 are involved in tail formation and of these, 9 may be
required for baseplate assembly. By comparison, the formation of the T4 baseplate alone requires
17 proteins (Yap et al., 2010). The functions of four of the P2 baseplate proteins (gpD: a hub
protein; gpV:tail spike; gpH: tail fiber; gpG: chaperone required for fiber formation) are known
(Haggard-Ljungquist et al., 1995; Temple et al. 1991); and, due to its relative simplicity, the P2
baseplate should be an easier system to fully understand. Illustrated below, are cartoon diagrams
of our current (incomplete) model of the P2 and (better studied) T4 baseplates alongside the
cryo-EM reconstruction of the dome-shaped T4 baseplate.
7
Figure 1.5 The myophage baseplate. A cartoon representation for our model of the P2 baseplate
region along with the more complex T4 baseplate region. Also included is the cryoEM
reconstruction of the T4 baseplate (Kostyuchenko et al., 2003) B. Stretches of the T4 and P2
genomes with baseplate proteins coloured in red. The lines connect gpJ and gpW of phage P2
with their homologues in phage T4, gp6 and gp25, respectively.
1.4 GpW is homologous to gp25 in phage T4
Gp25 (132 a.a., 15.1 kDa) of bacteriophage T4 is an essential protein of unknown function and is
one of the most widely conserved proteins in myophages. It is the last of seven proteins to be
incorporated into baseplate wedges and is required for the formation of stable wedges (Yap et al.,
2010; Leiman et al., 2010). Gp25 specifically interacts with gp6 and gp53 to form a structure at
the top of the dome-shaped T4 baseplate (Fig. 1.7); however, in the cryoEM reconstruction of the
T4 baseplate, the precise position of gp25 is not fully determined. Moreover, new evidence
suggests that gp25 may interact with other tail proteins, such as, the TSP.
P2 T4
Baseplate proteins
Other tail proteins
T4
P2
gpWgpJ
gp25 gp6
A.
B.
8
The gp25 homologue in phage P2 is gpW (pairwise sequence identity of 19.33%, similarity of
33%). A sequence alignment of these two proteins created using the MAFFT algorithm (Katoh et
al, 2002) in Jalview (Waterhouse et al., 2009) is presented in Figure 1.6. Like gp25, gpW is a
small (115 a.a., 12.6 kDa) protein that is required for the formation of infectious particles.
Figure 1.6. Sequence alignment of gpW and gp25. This alignment was created using the MAFFT
algorithm (Katoh et al., 2002) in the Jalview (Waterhouse et al., 2009) program.
As mentioned above, gp25 is at the top of the T4 baseplate and it interacts with gp6 (Yap et al.,
2010) which is homologous to gpJ from P2. In an earlier study, Haggard-Ljungquist et al.,
(1995) found that gpJ is a peripheral protein in the P2 baseplate. Based upon this information,
gpW is thought to be a protein at the top of the P2 baseplate (Fig. 1.7).
Figure 1.7 The putative location of gpW in the P2 baseplate. GpW is thought to be at the top of
the baseplate and may interact with other P2 tail proteins such as gpJ.
gp25
9
1.5 Research goals
The overall objective of this study was to gain insight into the mechanism by which the baseplate
of bacteriophage P2 carries out its crucial role in the initial stages of the phage infection cycle.
More specifically, the aim was to better understand the role of gpW, a baseplate protein of
unknown function which is required for P2 infectivity. To accomplish this goal, the following
questions were addressed in this study: How widespread are gpW homologues? Is gpW a
structural component of the virion; and, if so, where is gpW? How do mutations in gene W affect
gpW function and phage infectivity? And finally, which P2 proteins are required for P2 baseplate
assembly? As gpW is one of the most widely conserved proteins in myophages, information
gathered about its interactions within the baseplate will further our understanding of the
myophage baseplate.
10
Chapter 2 Materials and Methods
2 Materials and Methods
2.1 Media and Buffers
Table 2.1. List of media and buffers used in this study
LB-Lennox 5g yeast extract, 10 g tryptone, 5 g NaCl; H2O added for a final volume of 1 L
Super LB 1 g glucose, 0.190 g MgCl2, 0.110 g CaCl2; LB-Lennox added for a final
volume of 1 L
Top agar 7 g agar; LB-Lennox added for a final volume of 1 L
SOC media 5 g yeast extract, 10 g tryptone, 0.5 g NaCl, 0.186 g KCl, 0.952 g MgCl2, 1.20
g MgSO4, 3.603 g glucose; H2O added for a final volume of 1 L
Storage Media
(SM)
0.05 M Tris, 0.1 M NaCl, 8 mM MgSO4.7H2O; adjusted to pH 7.5 with Tris
HCl
Binding buffer 0.05 M Tris, 0.5 M NaCl, 5 mM imidazole; adjusted to pH 7.5 with Tris HCl
Wash buffer: 0.05 M Tris, 0.5 M NaCl, 0.03 M imidazole; adjusted to pH 7.5 with Tris HCl
Elution buffer: 0.05 M Tris, 0.5 M NaCl, 0.25 M imidazole; adjusted to pH 7.5 with Tris HCl
Dialysis buffer 0.05 M Tris, 0.4 M NaCl, 2 mM dithiothreitol; adjusted to pH 8.0 with Tris
HCl
Transfer
buffer
0.05 M Tris, 0.04 M glycine, 1.4 mM SDS, 20% v/v methanol; adjusted to pH
7.5 with Tris HCl
Tris buffered
saline tween
(TBST)
0.015 M Tris, 0.15 M NaCl, 0.1% v/v tween-20; adjusted to pH 7.5 with Tris
HCl
11
2.2 Bacterial Strains
The K-12 strain of E.coli has a small remnant of a P2-like prophage in the preferred P2
integration site (Nilsson et al., 2004). Moreover, Lindahl et al. reported that P2 grows better in
E.coli C than in the K12 strain (Lindahl et al., 1971) and this allows higher titres of phage to be
propagated in E.coli C. As such, P2 was always grown in E.coli strain C in this study. The table
below includes information on the various strains used in this study.
Table 2.2. List of E.coli strains used in this study. Relevant characteristics are shown along with
the original reference for each strain
Designation Relevant Characteristic Original Reference
C1a Prototrophic, non-suppressor Sasaki and Bertani (1965)
C1792 SuIII+ (Tyr inserted) Amber suppressor; Sunshine et. al (1971)
BL21 (DE3)T1R E. coli B strain with DE3, a λ prophage
carrying the T7 RNA polymerase gene and
lacIq. In addition, the FhuA (tonA) genotype
confers resistance to the lytic bacteriophages
T1 and T5.
Studier and Moffatt (1986)
DH5α Slow growing, transforms with high
efficiency
Hanahan (1985)
2.3 PCR amplification
All primers (Appendix A3) used in this study were purchased from Eurofins MWG Operon and
were either salt-free or HPLC purified (primers used for sequencing). When amplifying genes W
and X, a purified sample of phage P2 was used as the source of the template DNA and the Pfu
DNA polymerase (Fermentas) was used. Colony screens were usually carried out with one gene-
specific and one plasmid-specific primer (i.e., T7 promoter). To amplify larger pieces of DNA,
12
the Phusion High Fidelity DNA polymerase (New England BioLabs) was used. The amplified
DNA fragments were subjected to 1% agrose gel electrophoresis and visualized using UV light.
2.4 Gene cloning, plasmids and mutagenesis
2.4.1 Gene Cloning
I used the Clontech In-Fusion® PCR Cloning System to fuse the ends of the PCR amplified
fragment to the homologous ends of a linearized vector. The 3' and 5' regions of homology were
generated by adding extensions (at least 15 bps) to both PCR primers (forward and reverse) that
precisely match the ends of the linearized vector. To improve the efficiency of this cloning
reaction, the insert DNA fragments were PCR purified (Qiagen Purification Kit) and the
linearized plasmids were gel purified (Qiagen Gel Extraction Kit). Linearized vector and insert
DNA were mixed at a molar ratio of at least 1:2 and incubated with the In-Fusion® enzyme,
which promotes single-strand annealing reactions, for 15 minutes at 50oC and at 37
oC for another
15 minutes. The mixture was then used to transform competent cells (see Sec. 2.5).
2.4.2 Plasmids
I used several plasmids extensively in this study for cloning gene W and expressing tagged gpW.
As shown in Figure 2.1, gene W was cloned downstream of the malE sequence in the pMal.c4x
(NEB) plasmid using the EcoRI and XbaI restriction sites. E.coli transformed with this construct
expresses Maltose Binding Protein (MBP) fused to the N-terminus of gpW (gpW_MBP). Gene
W was also cloned into pAD100 (Davidson and Sauer 1994) using the NcoI and XbaI sites. The
construct which uses a trc hybrid promoter (-35 region of the trp and -10 region of the lac
promoters) and is under the regulation of lacI and lacIq, produces gpW with a C-terminal FLAG
epitope and 6xHis tag (gpW_trc; Fig. 2.1).
For the co-expression of various P2 tail proteins, the PCDF (Novagen; Streptomycin resistance
conferred) and pET-21d (Novagen; Ampicillin resistance conferred) plasmids were used. As
shown in Figure 2.2, genes V, W, J, I, H and G were cloned into PCDF and this construct (V-G)
produces an N-terminally 6xHis-tagged gpV (made by Tom Chang). Genes U and D were cloned
(UD; Fig 2.2) into pET-21d such that a C-terminally 6xHis-tagged gpD is expressed (made by Tom
13
Chang). I cloned Gene X into the UD construct immediately upstream of gene U. To accomplish this,
linear vector was generated by PCR amplifying the entire UD construct (pET-21D plasmid
containing genes U and D); gene X was amplified with flanking regions homologous to the ends of
the linear plasmid (Fig. 2.3).
Figure 2.1 The gpW_MBP and gpW_trc constructs. Gene W was cloned into the (A.) pAD 100
and (B.) pMal.c4x vectors to allow the expression of FLAG and MBP tagged gpW respectively.
Figure 2.2 The V-G, D and UD constructs. Genes V, W, J, I, H and G were cloned into the
PCDF (Novagen) plasmid such that gpV was expressed fused to an N-terminal hexahistidine
(6xHis). The red stars in the figure represent the 6xHis tag. The D and UD constructs were made
V W J I H G
U D
A)
B)
14
by cloning gene D and genes U and D into the pET-21D expression vector (C-terminal tagged
gpD) (constructs made by Tom Chang).
Figure 2.3. The XUD construct. Linearized UD was produced by PCR amplifying the entire
plasmid which contained genes U and D (UD). Gene X was amplified with flanking regions that
were identical to plasmid ends and cloning was completed using the In-Fusion® PCR Cloning
System.
2.4.3 Mutagenesis
Gene W mutations were made in the gpW_trc construct by site-directed mutagenesis. In this
technique, I used a pair of complementary mutagenic primers to amplify the complete plasmid
and generate a nicked, circular DNA which contained mutated geneW. As the product DNA was
the same size as the plasmid, the template DNA had to be eliminated by digestion using the DpnI
restriction enzyme (1hr at 37oC). This enzyme digests methylated DNA and thus, only the
biosynthesized template DNA was cut. Prior to transforming into competent cells, the in vitro
generated (mutated) plasmid was gel purified (Qiagen Gel Extraction Kit).
2.5 Preparation and transformation of competent cells
In this study, chemically competent E.coli, cells that can uptake extracellular DNA, were
prepared by treating the bacteria with calcium chloride. In this method, I used an overnight
culture to inoculate LB-Lennox at a 1:100 dilution which was subsequently incubated at 37°C
until an OD600 of 0.4-0.6 (optical density of culture measured at a wavelength of 600 nm; also
15
known as A600 or absorbance at 600 nm). The cells were transferred to a conical tube and chilled
on ice for half an hour before being pelleted at 2560g for 10 minutes at 4°C. The pellet was then
re-suspended in 0.1 M calcium chloride (1/25th the original volume) and placed on ice for 10
minutes. The cells were again pelleted as above and the pellet re-suspended in 0.1 M calcium
chloride (1/125th the original volume of cell culture). Glycerol was added to the cells for a final
concentration of 40% v/v (glycerol/total volume). The cells were aliquoted and flash frozen in an
ethanol-dry ice bath before being stored at -80°C.
Competent cells were thawed on ice (5-10 minutes) and 1.5 μL of plasmid DNA was added to 50
μL of cells which were then incubated on ice (15-30 minutes). Next, cells were heat shocked at
42°C for 45 seconds and incubated on ice for 5 minutes. Prior to plating the transformed cells, I
added 450 μL of LB (or SOC) and allowed the cells to recover at 37°C for 1hr (the recovery step
was not performed when the plasmid conferred ampicillin resistance to the transformed cells).
2.6 Phage preparation and purification
To prepare phage P2, I grew the C1a strain (37oC, 200 rpm shaking incubator) in super LB to an
OD600 of 0.1 (corresponding to ~2x108 cfu/ml) before being challenged with P2 at a multiplicity
of infection (M.O.I) of 1/5000 (phage/cells). The low MOI allowed at least two rounds of
infection and lysis and yielded very high titres ( >1012
pfu/ml). After the addition of phage, the
culture continued to grow (37oC, 100 rpm) and OD measurements were made every 20 minutes.
When the OD started to decrease (usually 90-120 min after phage addition), I added EGTA (16
ml of filter-sterilized 8% w/v solution added per liter of culture). EGTA is a Ca2+
chelator which
disrupts the binding of newly formed phage to cellular debris.
The process for preparing Wam and Xam phage mutants was similar to the one described above.
To determine the effects of the amber mutations on phage formation, I grew a culture of C1a in
super LB to an OD600 of 0.5 (~109 cfu/ml) before adding mutant phage at an MOI of 1/100
(phage/cells). Finally, to produce phage that had incorporated MBP or FLAG tagged gpW or
gpX, cells expressing the tagged protein were challenged with Wam or Xam mutant phage
respectively.
16
Subsequent to phage production, I concentrated and purified the particles. A simple procedure
that served to both purify and concentrate the phage particles was PEG (polyethylene glycol)
precipitation. In this procedure, the phage lysate was added to a mixture of PEG 8000 and NaCl
(80 g/L and 25 g/L respectively) and kept at 4oC overnight. The mechanism through which PEG
induces phage precipitation is not fully known; but precipitation is partially due to the fact that
PEG molecules attract water molecules away from the phage. This, in turn, decreases the solvent
volume available to particles (Vajda, 1978; Atha et al., 1981) and promotes precipitation. The
solution was centrifuged (4500g, 30 min at 4oC) and the resultant pellet was resuspended in SM.
Chloroform was added and, upon centrifugation (4500g, 30 min at 4oC), phage were separated
from PEG and resuspended in SM.
To further purify phage, I used equilibrium centrifugation (CsCl purification). In this technique,
the phage lysate was added to a concentrated solution of CsCl (final concentration: 0.64 g/ml)
and the mixture was subjected to extended centrifugation (Beckman 75 Ti: 50000 rpm: 223320g,
24hr). During the centrifugation, cesium ions are influenced by the centrifugal force and the
tendency to diffuse; eventually, a stable gradient of cesium ions is formed in the tube. Particles
with equivalent densities form narrow bands which can then be extracted by puncturing the tube
(Karp, 2009).
Cesium chloride interferes with phage binding and must be removed from the phage after CsCl
purification. To this end, the collected phage bands were always dialyzed (using 6-8 kDa dialysis
membrane) against SM. Phage preparations kept in SM at 4oC were found to have very stable
titres over long periods (less than ten-fold drop in titre over one year).
2.7 The in vivo complementation assay
To assess the function of various modified versions (amino acid substitutions) of gpW and of
tagged gpW, I performed the in vivo complementation assay. This assay determined the ability of
gpW and modified versions of gpW to complement the activity of Wam phage mutants.
Complementation can be assessed by adding Wam phage to liquid cultures or by spotting serial
dilutions of Wam phage onto a lawn of gpW-expressing E.coli. The lawns were made by adding
17
150 μL of E.coli carrying gpW plasmids cells to 3 mL of top agar, and pouring the mixture onto
agar plates. Plates were then incubated overnight, usually at 37°C.
2.8 Electron Microscopy
2.8.1 Grid Preparation
I used high electrical current to vaporize carbon which then deposited as a very thin layer (6-20
nm) on a smooth surface of mica. After a week, the coated mica was submerged in water; thus
the carbon film was separated from the mica and allowed to cover copper electron microscopy
grids (Aurion, Electron Microscopy Sciences). The carbon coated girds were then dried in a 60oC
oven for 2 hours; after which, they were stored for use for several weeks. Prior to loading the
sample, grids were glow discharged in a reduced atmosphere of air to increase the affinity of the
carbon coat for charged particles (Aebi et al., 1987).
2.8.2 Sample Staining
After a grid was glow discharged, I placed 5μL of sample on the carbon-coated side of the grid
for 2 minutes before being dried off. The grid was then washed three times by being submerged
in water drops. Samples were stained by submerging the entire grid in a 15 μl drop of 2% (w/v)
uranyl acetate for several seconds. Excess stain was blotted off with filter paper and the grid was
air-dried for 2 minutes.
2.8.3 Image acquisition
Except for particle averaging (see below), I acquired all EM images at the Microscopy Image
Laboratories of the Faculty of Medicine, University of Toronto, using an H-7000 Hitachi
Transmission Electron Microscope (TEM). To obtain the best images, aperture alignment of this
machine was performed under the supervision of the facility technicians. All images were
acquired using a 100 kV electron beam and recorded with a 6.0 megapixel CCD camera
2.9 Particle alignment and averaging
The alignment and averaging processes increase the contrast between the phage tail (which ought
to have invariant features in all images) and its surroundings (which vary in each image)
18
(Cardarelli, 2010). To obtain the best results, phage samples used for particle averaging were
CsCl purified and then dialyzed against SM to remove the salt. Furthermore, image acquisition
was performed by Nawaz Pirani at 50000x magnification using a Tecnai F20 electron
microscope operating at 200 kV (FEI Company). Images were recorded on photographic films
and subsequently digitized by scanning the micrographs.
The program SPIDER (Frank & Radermacher, 1996) was used to align the particles. The
particles were translationally and rotationally aligned using an iterative approach whereby the
average image of each iteration was used as the reference for the next round of particle
alignments (the initial reference was the average of unaligned particle images).
2.10 Protein expression and purification
I expressed wild-type and modified versions (with amino acid substitutions) of gpW using E.coli
C1a cells transformed by the gpW_trc construct. The V-G, D, UD and XUD plasmids contained
these genes under the control of the T7 promoter. These plasmids were transformed into BL21
(DE3) cells, which express T7 RNA polymerase.
To assess the expression of proteins, I grew a 5 mL bacterial culture until the OD600 reached 0.6-
0.8; after which, protein expression was induced by the addition of isopropyl-beta-D-
thiogalactopyranoside (IPTG) to a final concentration of 0.190 g/L (0.8 mM). IPTG induction
was followed by incubation at 37oC for 3hours. Next, cells were pelleted (15000 g for 2 minutes)
and the pellet was resuspended in SDS loading dye. This suspension was boiled at 100oC for 5
minutes before being subjected to SDS-PAGE (see Sec. 2.11).
For protein purification, I inoculated 1L of LB-Lennox with 10 ml of overnight culture and then
incubated at 37oC until the culture reached an OD600 of 0.8 and 0.8mM IPTG was added. IPTG
induction was followed by incubating the culture at 18oC overnight. Cells were harvested by
centrifugation (15 min at 12000g) and the pellet was frozen in preparation for purification.
2.10.1 Native protein purification
When trying to purify protein complexes, I used the native protein purification method. The
frozen pellet was resuspended in 37.5ml of binding buffer and cells were lysed by sonication.
19
Cellular debris was removed by centrifugation (35000g for 30 minutes at 4oC) and Ni
2+-NTA
was added to the supernatant. After rocking for 20 minutes, the supernatant mixture was poured
onto the column and the column was washed 10 times with 15ml of wash buffer. The protein was
eluted with 5ml of elution buffer and subsequently dialyzed against dialysis buffer to remove the
imidazole (imidazole interferes with concentration measurements). Purified protein was stored at
4oC.
2.10.2 Determining protein concentration
In addition to qualitatively visualizing protein expression levels using SDS-PAGE (see Sec. 2.11), I
determined the concentration of purified protein using absorbance at 280 nm. The predicted molar
extinction coefficient was determined using the ExPasy ProtParam program available at:
http://expasy.org/tools/protparam.html. Using the absorbance value and the molar extinction
coefficient, the protein concentration was calculated according to the following equation:
2.11 SDS-Page and Western blotting
I used sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) to separate
proteins according to their electrophoretic mobility (a function of protein molecular weight). To
directly visualize protein migration, gels (15% polyacrylamide) were stained with Coomassie
brilliant blue R-250. However, to more sensitively detect proteins, I performed Western blots. In
this method, the gel and a nitrocellulose membrane were soaked in transfer buffer for 15 minutes
after SDS-PAGE. Two pieces of extra-thick membrane were also soaked in transfer buffer and
used to sandwich the gel and nitrocellulose membrane during the transfer. Transfer was carried
out at 10 V in a Bio-Rad TransBlot semi-dry electrophoretic transfer cell for ~40 minutes. The
nitrocellulose membrane was blocked with 5% (w/v) skim milk (Bio-Shop) in TBST for one
hour at room temperature (RT). Subsequently, the membrane was incubated with primary
antibody (diluted in %5 skimmed milk) overnight at 4°C.
After primary antibody incubation, I washed the membrane three washes in TBST (10 minutes
each). Next, secondary antibody, goat-anti-mouse IgG-HRP (Santa Cruz Biotechnology; diluted
20
1:10,000 in 5% milk TBST) was applied to the membrane which was kept at RT for 1hr. Three
more TBST washes were performed before the membrane was prepared for detection using the
West-one™ detection system or the ECL+ detection kit (GE Health Sciences).
21
82%
8%
4%3% 3%
Proteobacteria
Firmicutes
Actinobacteria
CFB group
Other
Chapter 3 Results
3 Results
3.1 GpW is a very widely conserved protein in Myophages
To determine how widely conserved gpW is across phages and prophages, I performed
comprehensive psi-BLAST searches on the NCBI non-redundant (NR) protein database (with an
E-value cutoff of 0.005). Over a thousand proteins from a variety of bacterial genomes,
prophages and phages were found to have significant sequence similarity with gpW. As shown in
Figure 3.1, most of these proteins were found in bacterial genomes and prophages from
proteobacteria (primarily the γ-proteobacteria) but many homologous proteins were also found in
other Gram negative and Gram positive bacteria.
Figure 3.1. Distribution of gpW homologues in prophages. Over a thousand gpW homologues
were identified in prophages from different bacteria. The great majority of these homologues
were found in the proteobacteria. The inset table indicates the number of gpW homologues found
in various groups of bacteria.
Moreover, at least 80% of sequenced myophage genomes have a gene W homologue. Even a
group of Pseudomonas phages, which have massive genomes (200-300kb) and are
morphologically different from P2, have proteins that seem to share significant sequence
similarity with gpW. Somewhat surprisingly, enterobacteria phage Mu, which is morphologically
Bacteria (1314)
Proteobacteria (1059)
γ-proteobacteria (671)
β-proteobacteria (198)
α-proteobacteria (100)
δ-proteobacteria (67)
ε-proteobacteria (15)
Firmicutes (101)
Actinobacteria (45)
Bacteroidetes (45)
Other (45)
22
almost identical to phage P2 (and also has a similar genome size; Mu: 36.7kb, P2: 33.6kb), does
not seem to have any proteins with significant sequence similarity to gpW. However, based upon
the presence of surrounding baseplate protein-encoding genes and protein size, Mup46 (145a.a;
16.3kDa) may be inferred to be homologous to gpW (Fig. 3.2).
The homology between gpW and Mup46 was confirmed using the protein structure and function
prediction program HHpred (Soding, 2005). Unlike BLAST which uses sequence-sequence
comparisons and searches sequence databases like NR, HHpred is based upon the pair-wise
comparison of profile Hidden Markov Models (HMMs) and it searches alignment databases. As
such, HHpred can be used to detect remote protein homologues which may not share significant
sequence similarity. Using HHpred, I also found that the N-terminal domain of gp104 (231 a.a.)
of phage A9 is a lysM domain (gpX of P2 also includes a lysM domain) while the C-terminal
domain is homologous to gpW. This interesting finding, along with the close proximity of the
two proteins in the virion (Sec 3.4), suggests that gpW and gpX interact with each other.
Figure 3.2 gp46 of phage Mu is homologous to gpW A) Comparison of P2 and Mu phage
genomes. The genes encoding most of the P2 baseplate proteins are included with a region of the
Mu genome that contains homologous proteins (Red colored genes encode annotated tail
proteins). Also included are some sequence identities between P2 and Mu proteins. B) Predicted
secondary structures of gpW and gp46. The green arrows represent β sheets and the red bars are
α helices. This prediction was made using the JNet Secondary Structure Prediction utility in
Jalview and is based upon protein sequence (Green arrows: β sheets and red blocks: α-helicies)
Mup45 Mup47 Mup49 Mup50
gpV gpJ gpH gpG
P2
Mu
28% 93% 24%
A)
B)
gp46 of Mu
gpW of P2
5’
5’
3’
3’
23
In addition to homologues in phages and prophages, gpW was found to have a homologue in
structures such as R-type pyocins (tail-like bacterial killing agents). For example, a baseplate
protein in the R-type pyocin secreted by P. aeruginosa (Nakayama et al., 2000) was found to
have very high sequence similarity with gpW (40% identity). Another example of a gpW
homologue encoded by a bacterial gene can be found in the type six secretion systems (T6SS).
As mentioned in the Introduction, earlier studies had reported structural similarities between
phage tail proteins and constituent proteins of type six secretion systems. Specifically, Leiman
et.al (2009), found structural similarity between gp25 of phage T4 and a protein in the T6SS;
and, in fact, almost 100 gpW homologues from various gram-negative bacteria are annotated as
T6SS proteins in the NCBI protein database.
Some gpW homologues that are T6SS proteins may not be classified as such in the NCBI protein
database. To confidently classify a bacterial protein as being expressed from a prophage or from
the bacterial genome itself (as in the T6SS proteins or pyocin proteins) one can consider the
proteins encoded by nearby genes. Prophages have clusters of genes required for phage
formation. Proteins specific to phages, such as the major capsid protein, can be used as markers
for prophages; alternatively, T6SS-specific proteins, such as Vgr family proteins (which contains
domains that are structurally similar to the T4 tail spike complex and gpV in P2) or ClpV1
(members of this protein family are homologous to ClpB, an ATPase associated with chaperone-
related functions and are a key component of the T6SS) family proteins, may be used as markers
for T6SS. In this way, I annotated almost thirty unclassified proteins which were surrounded by
T6SS-speciifc proteins (Table 3.1).
Table 3.1. Classifying T6SS proteins. Several gpW homologues which were previously
unclassified are surrounded by T6SS-specific proteins and thus, are likely to be T6SS proteins.
Accession Code Protein Classification Organism
YP_001185595 T6SS-associated; ImpA domain-containing Pseudomonas Mendonica
YP_001185598 GPW/gp25 family protein Pseudomonas Mendonica
YP_001185601 T6SS component; VasA [Intracellular trafficking, secretion, and vesicular transport] Pseudomonas Mendonica
YP_001185603 T6SS ATPase, ClpV1 family Pseudomonas Mendonica
YP_001267440 Rhs element VgrG protein Pseudomonas putida F1
YP_001267448 GPW/gp25 family protein Pseudomonas putida F1
24
YP_001267450 T6SS component protein Pseudomonas putida F1
YP_001267465 T6SS ATPase, ClpV1 family Pseudomonas putida F1
EES52233 Rhs element VgrG protein Leptospirilum ferrodiazotrop
EES52234 T6SS ATPase, ClpV1 family Leptospirilum ferrodiazotrop
EES52237 GPW/gp25 family protein Leptospirilum ferrodiazotrop
EES52238 Secreted T6SS effector, Hcp1 family Leptospirilum ferrodiazotrop
3.2 GpW is a structural component of the P2 baseplate
It was previously known that gpW is required to form infectious phage particles (Haggard-
Ljungquist et al., 1995); however, it was unclear whether phage particles are capable of
assembling in the absence of gpW. To address this question, I used EM to observe the phage
products produced by Wam phage (P2 phage bearing an amber mutation in gene W). These
lysates were prepared by infecting C1a (non-suppressor E.coli) cells with P2 phages that bear the
amber mutation in gene W. After cell lysis, cellular debris was removed by centrifugation and the
supernatant used for electron microscopy (as described in Sec. 2.8). In this manner, I determined
that phage tails are not assembled in the absence of gpW (Fig. 3.3). However, there was no effect
in phage head (capsid) assembly, which occurs in a pathway independent from tail assembly.
Figure 3.3. Electron microscope image of the Wam lysate. There were no fully formed phages or
tails in a Wam lysate while DNA-filled heads were observed (Scale bar is 20 nm).
25
After determining that phage tails cannot be formed in the absence of gpW, I sought to confirm
that gpW is a structural component of the phage. As mentioned in Sec 2.4.2, E. coli cells
transformed with pMal_W expressed gpW fused to the large maltose binding protein (MBP).
Thus, when cultures of these cells were infected with Wam phage, the produced phage particles
had MBP incorporated into the particle. I purified these phage using two rounds of CsCl
centrifugation (see Sec. 2.5). The purified phage were analyzed by SDS-PAGE; and, a Western
blot (see Sec. 2.9) was performed with an anti-MBP primary antibody (NEB, 1:10000 dilution).
As shown in Figure 3.4, a single 55kDa band was visualized, corresponding to the molecular
weight of the gpW MBP fusion protein. This experiment proved that gpW is indeed a structural
component of the phage particle.
Figure 3.4. GpW is a structural component of P2. CsCl purification of MBP-tagged phage
particles and the subsequent western blot proved that gpW is indeed a structural component of
the phage particle (control is cell lysate of cells transformed with pMal_W). Below and above
are fractions collected from below and above the phage band (titre of phage 4x1012
pfu/ml) in the
centrifuge tube where there is no phage (titre of phage <104 pfu/ml) and there should be no
MBP-tagged gpW; negative controls).
While the previous experiment confirmed that gpW is a structural component of the P2 virion, it
did not provide any information about its location within the phage. Based upon the location of
its homologue in phage T4, gpW was hypothesized to be a baseplate protein. To confirm this
hypothesis, we used EM images of phage particles with and without MBP fused to gpW.
Compared to gpW, MBP is a large molecule and is easily distinguishable in high resolution
electron microscope images. Thus, the location of MBP helped us determine the position of gpW
in the phage baseplate.
26
EM images were acquired and particles from the images were aligned and averaged (Sec. 2.6) by
Nawaz Pirani in our lab. The averaging process was required to yield high-resolution images of
the tail tip region. As shown in Figure 3.5, the position of gpW was determined by comparing the
average images of the tail-tip region of MBP-tagged P2 (318 phage tails) and wild type P2 (353
phage tails). Hence, gpW was found to be at the top of the P2 baseplate.
Figure 3.5. EM images were used to determine the position of gpW. A) The average of 318
aligned images from the tail tip region of MBP-tagged P2. B) The average of 353 aligned images
from the tail tip region of P2. The averaged images exhibit much improved resolution compared
to individual image. The arrows point to the location of MBP-tagged gpW. The tail spike protein,
gpV, is also visible in both images (arrow in B).
3.3 Different mutations in gene W affect gpW function
As discussed above, Wam phage mutants are unable to produce phage tails in non-suppressor
E.coli. To determine how mutations in gene W affect gpW function within the baseplate, I made
point mutations in geneW. As the structure of gpW is not known, the X-ray crystal structure of a
gpW homologue (27% sequence identity) from a prophage in G. Sulfurreducen (Fig. 3.6; PDB
ID: 2IA7) was used to determine residues that are highly exposed (SwissPDB program, Guex
and Peitsch, 1997). Exposed residues were selected because mutating buried residues usually
disrupts protein secondary structure and abrogates protein function. I used the MAFFT algorithm
(Katoh et al., 2002) and Jalview (Waterhouse et al., 2009) program to obtain multiple sequence
alignments of gpW homologues and determine highly conserved residues. Using this
B) A)
gpV
27
information, the R37, R40, D42, W74, P76 and R77 residues were selected for mutagenesis (Fig.
3.7) because they were highly conserved and exposed residues (>25% exposed).
Non-suppressor E. coli cells transformed with constructs that expressed residue substituted
versions of gpW (modified gpW_trc constructs which express gpW fused to a FLAG epitope and
are inducible with IPTG; Sec 2.4.2) were used for in vivo complementation assays. As shown in
Figure 3.8A, without IPTG induction, spotting patterns on lawns of bacteria expressing the
R40A, D42R, W74A and R77A substitutions were similar to a lawn of bacteria expressing gpW
(spotting was performed with 100 fold dilutions of Wam phage). Thus, these substitutions had
little effect on in vivo complementation. However, the R37A, R37D and P76A substitutions had
deleterious effects (zones of clearing weren’t observed with diluted Wam phage and this
confirms that in vivo complementation was low).
Initially, all in vivo complementation studies were performed without IPTG induction; i.e.,
proteins were expressed at basal levels through leaky expression. However, with IPTG induction,
the function of the R37A residue substituted gpW protein was partially rescued (Fig. 3.8b) while
R37D and P76A were still inactive (Fig 3.8b).
Figure 3.6 The X-ray crystallography structure of a gpW homologue in G. sulfurreducens. For
comparison with Figure 3.7, the arrow points to where W74 of gpW maps onto the structure.
Also included is a secondary structure prediction of gpW and its homologue. This prediction was
made using the JNet Secondary Structure Prediction utility in Jalview and is based upon protein
sequence (Green arrows: β sheets and red blocks: α-helicies)
gpW of P2
gpW homologue in G.Sulfurreducens W74
28
Figure 3.7 Selecting residues for substitutions. A representative alignment of gpW homologues
from various prophages and phage highlighting the R37, R40, D42, W74, P76 and R77 residues.
GpW from P2 and its homologue from a prophage in G. sulfurreducens have been boxed. Three
perspectives are presented from the crystal structure of a gpW homologue and the positions of
various residues from gpW have been mapped unto this structure (prophage in
G.sulfurreducens).
R37, R40
W74
D42
W74
R77
P76
W74
29
Figure 3.8 In vivo complementation assays with gpW expressed from the gpW_trc construct. A)
Spotting assays to determine the ability of residue substituted gpW to complement Wam phage.
Non-suppressor E.coli cells transformed with constructs coding for a residue substituted gpW are
challenged with serial dilutions of Wam (no IPTG induction). B) IPTG induction improves the
complementation in cells expressing R37A but not in cells expressing R37D or P76A.
Next, I assessed in vivo complementation by adding Wam phage to liquid cultures of cells
transformed by the mutant constructs and then using electron microscopy to examine the
produced phage. Observations made thus were consistent with the earlier spotting assay results,
i.e., R40A had no effect on phage formation while no tail like structures were observed with the
R37A and P76A substitutions. Moreover, the function of R37A was improved when more
protein was expressed by IPTG induction (Fig. 3.9).
A) Empty vector
gpW
R37A
R37D
R40A
D42R
W74A
P76A
R77A
B)
gpW+IPTG
R37A+IPTG
R37D+IPTG
P76A+IPTG
30
Figure 3.9. Transmission Electron Microscope images of mutant phage lysates. The R40A
substitution complements for fully formed phage but other substitutions have serious effects on
phage formation. The R37A residue substitution’s deleterious effect can be partially overcome
by IPTG induction.
I tested the expression levels of R37A, R37D, W74A and R77A versions of gpW (see Sections
2.10 and 2.11) by performing a Western Blot with the anti-flag antibody (Fig.3.10). Interestingly,
the R37D substituted protein was expressed at a higher level than the R37A protein but had
lower complementation and its function could not be rescued by IPTG induction (Fig 3.8). To
test the activity of gpW (and modified gpW versions) at lower expression levels, I cloned gene
W and 45 bps upstream of the gene into pAD100 (gpW_ENDO) so as to include the endogenous
translation start site. This led to much lower levels of gpW expression which were undetectable
in the Western Blot (Fig.3.10).
I mutated gene W in the gpW_ENDO construct to encode residue substituted versions (R37A,
R37D, W74A and R77A) of gpW. As shown in Figure 3.10, the expression levels of these
proteins are much lower than the gpW_trc. Furthermore, non-suppressor E. coli cells
R40A R37A P76A
R37A+IPTG
31
transformed with the gpW_ENDO constructs were used for in vivo complementation assays. The
effects of the residue substitutions are much more pronounced when gpW was under its
endogenous translation start site (Figure 3.11). The W74A and R77A substitutions which had
previously not shown any effects in complementation (Fig3.8), lead to 104 fold decreased phage
production when expressed at lower levels. However, adding IPTG increases protein levels and
the function of R37A, W74A and R77A was partially recovered (Fig 3.11B). Not surprisingly,
the R37D substitution completely knocks out gpW function and this effect is not reversed by
expressing the protein at higher levels.
Figure 3.10. Varying levels of gpW expression. The bands are just under 15kDa (corresponding
to gpW which is flag and his-tagged). The lanes are from gpW_trc, gpW_trc(R37A),
gpW_trc(R37A), gpW_trc(W74A), gpW_trc(R77A) and ladder. The next five lanes are for gpW
expressed with its endogenous translation start site and the same residue substitutions
(expression too low to visualize).
trc Endogenous translation start site
15kDa
10kDa
32
Figure 3.11. In vivo complementation assays with gpW expressed from the gpW_ENDO
construct. A) gpW_trc, gpW_ENDO and various residue substituted versions expressed at basal
levels (without IPTG induction). B) The same assays performed with IPTG induction. The
effects of residue substitutions are much more pronounced when less protein is expressed.
3.4 The formation of intermediate P2 baseplate structures requires at least eight proteins
Aside from gpV, the tail spike protein (Haggard-Ljungquist et al., 1995; Kagyama et al., 2009),
and gpW, at least five other proteins are thought to be required for P2 baseplate formation; gpD,
gpH, gpG, gpI and gpJ. gpD is the hub protein, gpH and gpG are required for tail fiber formation
(Haggard-Ljungquist et al., 1995). GpJ (homologous to the T4 baseplate wedge subunit gp6) and
gpI share a common structural fold (detected by HHpred); and as geneJ is adjacent to geneI in
the P2 genome, gpI and gpJ may interact in forming the baseplate wedges of P2.
In addition to the seven proteins described above, gpU and gpX are also likely to be required for
the formation of complete baseplates. Using HHpred, I found gpU to be structurally similar to
gp54 of phage T4 (which along with gp48 creates a platform on top of the hub to initiate tail tube
oligomerization; Yap et al., 2010). This similarity, along with the genomic position of geneU in
IPTG induction
gpW_trc
gpW_ENDO
R37A_ENDO
R37D_ENDO
W74A_ENDO
R77A_ENDO
No IPTG
A) B)
33
P2 (adjacent to geneD) suggests that gpU interacts with the central hub in the P2 baseplate (Fig.
1.7). Furthermore, I showed that gpX, a small protein of unknown function, was required for tail
formation (Fig 3.12); and, as tail formation requires a fully formed baseplate, it was inferred that
gpX may also be required for baseplate assembly. Moreover, using electron microscopy (in a
process similar to the one used to determine the position of gpW) we found gpX to be a baseplate
protein located close to gpW (Fig 3.13).
Figure 3.12 GpX is required for P2 tail formation. GpX is a small protein of unknown function,
without which, no phage tails are observed. I used Xam phage to infect non-suppressor E.coli and
only fully packaged capsids were observed using EM.
Figure 3.13 EM images were used to determine the position of gpX. A) The average of 353
aligned images from the tail tip region of wild-type P2. B) The average of 576 aligned images
from the tail tip region of P2 with MBP-tagged gpX. The averaged images exhibit much
improved resolution compared to individual images. The arrows point to the location of MBP-
tagged gpX.
A) B)
34
Thus, 9 proteins (gpV, W, J, I, H, G, U, D and X) may be required for the formation of complete
P2 baseplates. To test this, I co-expressed groups of these proteins and looked for the formation
of intermediate or stable structures. Tom Chang in our lab had made construct that expressed
gene D (encoding C-terminal His-tagged gpD), a construct that coexpressed genes VWIJHG (V-
G; N-terminal His-tagged gpV) and a construct that coexpressed genes U and D (UD; C-terminal
His-tagged gpD) (Sec. 2.4). These plasmids were transformed (and contransformed) into cells
such that we could coexpress V-G, V-G/D and V-G/UD. Using affinity chromatography (Sec.
2.11), His-tagged proteins were purified and the eluted proteins were analyzed by SDS-PAGE.
As shown in Figure 3.14, there was no copurification of non-tagged baseplate proteins when the
V-G construct was used. However, some proteins seemed to co-purify with the His-tagged gpV
and gpD when using the V-G/D and V-G/UD constructs (gpV and gpD are the most intense
bands in Fig. 3.14A because they are His-tagged). The sizes of the protein bands observed in
Figure 3.14A correspond closely with the expected molecular weights of baseplate proteins gpW
(12.6 kDa), gpU (17.4 kDa), gpI (19.6 kDa), gpV (22.1 kDa), gpJ (33 kDa) and gpD (43 kDa)
(Appendix A1).
Figure 3.14. Purifying intermediate baseplate complexes. A) Using the V-G/UD (1st lane) and V-
G/D (3rd
lane) constructs, strong bands corresponding to gpV and gpD were observed along with
other bands at sizes that corresponded to the expected molecular weight of other baseplate
proteins. There are also some bands corresponding to proteins larger than gpD which may
include gpH but these are poorly resolved. B) Using SDS-PAGE, only one band (gpV) was
gpV
gpI
gpV
B. V-G
55kDa
40kDa
35kDa
25kDa
15kDa
10kDa
A.
gpU
gpW
gpD
gpJ
35
observed when purifying proteins expressed from the V-G construct alone (Purification using
affinity chromatography)
Finally, I used electron microscopy to visualize intermediate protein complexes. The elutions of
each of the purifications outlined above (V-G, V-G/D and V-G/UD) were investigated and
particles of the right shape (circular/hexagonal) and size (~25 nm diameter) of intermediate
baseplate structures were only observed when using the V-G/UD co-transformation (Fig. 3.15).
Together, these experiments confirmed that at least 8 proteins (V, W, J, I, H, G U and D) are
required for the formation of intermediate baseplate structures. However, the V-G/UD purified
samples which had been inspected by EM immediately after purification did not seem to have
any complexes after a few days (re-inspection with EM). It was thus inferred that the formed
complexes may have been unstable. This may be due to the absence of gpX; and thus, to fully
elucidate the proteins required for P2 baseplate formation, further work is required (as outlined
in the Future Directions).
Figure 3.15. EM image of putative baseplate complexes. A) Arrows point to particles which are
similar in shape and size to baseplates; they are seen in the V-G/UD purification only. The
baseplate complexes shown above may be in two different conformations as has been observed
for purified baseplate complexes from other phages (Yap et al., 2010; Campannaci et al., 2010)
(Scale bar is 20nm). B) For comparison, lactococcal phage baseplates are shown. Scale bar is
50nm (Campannaci et al., 2010)
B. A.
36
Chapter 4 Discussion and Future Directions
4 Discussion and future directions
The purpose of this study was to gain insight into the structure and function of the baseplate of
myophage P2. Baseplate proteins are required for recognizing and binding to cell surface
molecules during phage adsorption to its bacterial host. Moreover, in myophages, conformational
changes in the baseplate lead to the contraction of the tail sheath and eventual release of phage
DNA. To better understand the baseplate, we studied the role of gpW; a putative baseplate
protein in phage P2. This small protein is one of the most widely conserved proteins in all
myophages and is homologous to gp25 in the extensively studied myophage T4. In T4, gp25 is
the seventh and last protein to be incorporated into the baseplate wedges and is placed at the top
of the dome-shaped baseplate. Gp25 is known to be required for the formation of stable wedges;
however, its precise interactions within the baseplate are not fully understood. As the T4
baseplate is uncharacteristically complex, understanding the role of gpW within the P2 baseplate
should be a more tractable aim.
Before characterizing the role of gpW in phage P2, I used bioinformatic methods to study the
wide distribution of gpW homologues. By performing comprehensive psiBLAST searches, I
found that most sequenced myophage (93/132) have a protein with significant sequence
similarity to gpW. In some myophages which have no proteins with significant sequence
similarity to gpW (i.e., enterobacteria phage Mu), a protein can be inferred to be homologous to
gpW by similarities in secondary structure, by genome position (proteins encoded by
surrounding genes have high sequence identity with P2 proteins gpV, gpH and gpG) and by
HHPred.
I also found that there are over 1000 gpW homologues (sequence identity ranged from >95% to
15%) in various prophages from phylogenetically diverse bacteria. An earlier study (Leiman et
al., 2009) had found a gp25 homologue in the bacterial type VI secretion system (T6SS) and
almost 100 proteins from different T6SS were found to be gpW homologues. Moreover, it was
possible to classify some gpW homologues as belonging to T6SS by inspecting the proteins
37
encoded by surrounding genes. The very wide conservation of gpW in myophage tail producing
gene clusters suggests that this protein plays an important role in myophage tail formation.
The first priority in my study was to determine whether gpW is a structural component of the
phage; and, if so, determine its position within the virion. Using electron microscopy, I showed
Wam phage (phage that cannot produce gpW) cannot form tail structures when infecting non-
suppressor E.coli strains (Fig. 3.3). This finding suggested that gpW is required for baseplate
formation. In addition, by purifying P2 phage with MBP-tagged gpW and performing a Western
Blot with an anti-MBP, I showed that gpW is a structural component of the phage (Fig. 3.4).
Finally, using electron microscopy, we determined the position of gpW and confirmed that it is
at the top of the P2 baseplate (Fig. 3.5).
After determining the position of gpW, I sought to characterize the interactions of gpW within
the phage tail. One way to do this is by making residue substitutions in the interaction surfaces of
the protein which may knock out specific interactions. To choose residues for substitutions, I
mapped the sequence of gpW onto the crystal structure of a gpW homologue (from a prophage in
G. sulfurreducens) and determined residues that were conserved and exposed. Using in vivo
complementation assays and electron microscopy, the effects of these residue substitutions were
assessed. Mutations in gene W were shown to have differing impacts on the expression level
(R37A was expressed at lower than normal levels) and functionality of gpW; sometimes fully
abrogating function (R37D and P76A). Moreover, when expressed at lower levels (from the
endogenous translation start site), every substitution checked (R37A, R37D, W74A and R77A)
abrogated gpW function (Fig 3.11A).
The effects of residue substitution on gpW function may have been due to the destabilization of
modified gpW instead of being due to the disruption of surfaces required for interactions with
other tail proteins. To confirm that residue substitutions had not destabilized the secondary
structure of gpW, circular dichroism (CD) should be performed.
Another important question that had to be addressed was “which P2 proteins are required for
baseplate formation?”. By purifying tagged proteins, putative baseplate complexes were isolated
and it was determined that at least 8 proteins (gpV, W, J, I, H, G, U, D; V-G/UD) are necessary
for the formation of intermediate baseplate structures (Fig 3.14). However, complexes made by
the coexpression of these proteins were unstable (over several days in SM buffer at 4oC) and this
38
suggests that other proteins are required for stable complexes or that baseplates are inherently
unstable without the tape measure and/or tail polymerization.
In an attempt to form more stable baseplates, gene X has been cloned into a coexpression
construct, XUD (Sec. 2.4 gpD is His-tagged). Using electron microscopy, I showed that gpX is
required for tail formation (Fig 3.12). Moreover, we were able to determine the position of gpX
in the P2 baseplate and found that gpX is very close to gpW (Fig. 3.13). Hence, the coexpression
of gpX may lead to the formation of more stable baseplate structures. The formation of these
structures can be investigated using co-purification experiments with the XUD/V-G constructs
and confirmed by EM.
EM images of baseplate complexes made by coexpressing 8 proteins (V-G/UD) have been
acquired (Fig. 3.15). However, the resolution of single images is not great enough to make
definitive conclusions about the structure of these complexes. Hence, the image alignment and
averaging process may have to be applied to these EM images. Moreover, earlier studies that
have produced and imaged baseplate complexes (Campanacci et al., 2010; Yap et al., 2010) have
used size-exclusion chromatography to purify the sample and this procedure may also have to be
applied to P2 baseplates before extensive EM work.
To fully determine the role of gpW, we will need to understand its interactions with proteins in
the P2 baseplate and tail. In bacteriophage T4, gp25 interacts with six other proteins in the
stepwise assembly of the baseplate wedges that form the structural basis of the baseplate (Yap et
al., 2010). While the P2 baseplate is simpler than the T4 baseplate, gpW may interact with gpJ
(homologous to gp6, a wedge protein in T4) and gpI to form a simplified version of the baseplate
wedge. Furthermore, with the identification of a protein which has gpX and gpW-like domains,
and with the confirmation that gpX is close to gpW in the P2 baseplate, gpX also likely interacts
with gpW.
In addition to its interactions with other baseplate proteins, there are several indications that gpW
may also interact with the tail sheath protein, gpFI. First, the location of both gpW and gp25 is
quite close to the tail sheath protein. More significantly, the N-terminal domain structure of the
tail sheath protein from a Mu-like phage is similar to the structure of the gpW homologue in a
prophage from G. sulfurreducens. Hence, in myophages, gpW homologues may interact with the
39
tail sheath protein; perhaps helping initiate its polymerization (which would explain the lack of
tail structures in Wam mutants).
The direct method to fully elucidate the interactions between gpW and other P2 proteins would
be to express and purify tagged gpW and attempt to “pull down” other tail and baseplate proteins
which interact with gpW. As gpW and gp25 are quite insoluble, the gpW MBP fusion protein
which is much more soluble can be used. In addition to the pull down experiment, the collected
elutions from this purification can be observed with EM to look for the formation of intermediate
baseplate complexes.
Alternatively, one may perform the same pull down experiment using modified gpW (expressed
from mutated gene W) to determine whether any interactions have been specifically knocked out
and whether these disrupted interactions affect tail and baseplate formation. As mentioned above,
I have already started this experiment and the residue substitutions made in this study all affected
the function of gpW; they may be a good starting point for investigating knocked-out
interactions. However, I have only made substitutions in one surface of the gpW (residues
selected were the most highly exposed and conserved in gpW homologues) and other surfaces
may have to be targeted.
Finally, it may be possible to produce P2 baseplates in vitro, i.e., by mixing constituent proteins
at stoichiometrically correct ratios. The resultant intermediate complexes may be isolated and
characterized by EM and analytical ultracentrifugation (through the differential sedimentation of
heterogeneous particles). Recently, similar studies on the T4 baseplate assembly process
confirmed the sequential incorporation of proteins in the baseplate wedges, the baseplate hub and
the subsequent attachment of the two structures (Yap et al., 2010).
Based upon its position in the P2 baseplate and the interactions of gp25 (the gpW homologue in
T4), gpW may be required for baseplate wedge formation along with gpJ (homologous to gp6
from T4), gpI and gpX in P2. Phage proteins in the gpW/gp25 family may also interact with the
tail sheath protein, gpF1. Hence, we have hypothesized a model for the P2 baseplate and this is
represented in Figure 4.1.
40
Figure 4.1 Our model of the P2 baseplate. This model is based upon known positions for gpW,
gpJ and gpX along with our hypothesized interactions between gpW, gpX, gpJ and gpF1.
The experiments proposed above should greatly improve our understanding of the interactions of
gpW within the P2 baseplate. Moreover, the potential interaction of gpW with the tail sheath
protein may suggest a reason for its very widespread existence in myophage tail-like structures.
Finally, the experiments should elucidate the baseplate assembly pathway and the precise
structure of the P2 baseplate.
gpX
gpW
gpFII
gpI
gpFI
gpJ gpH gpV
gpU
gpD
41
References
Aebi, U., Pollard, T. D. (1987) A glow discharge unit to render electron microscope grids and
other surfaces hydrophilic. Journal of Electron Microscopy Technique 7:29-33
Ackermann, H.W. (1999). Tailed bacteriophages: The order Caudovirales. Adv.Virus Res.
51:135-201
Ackermann, H.W. (2007) 5500 phages examined in the electron microscope. Arch Virol
152:227–243
Aksyuk, A. Leiman, P.G., Kurochkina, L.P., Shneider, M. M., Kostyuchenko1, V.A.,
Mesyanzhinov, V.V., et al. (2009) The tail sheath structure of bacteriophage T4: a molecular
machine for infecting bacteria. EMBO J 28: 821-829
Atha, D.H., Ingham, K.C. (1981) Mechanism of precipitation of proteins by polyethylene
glycols. The Journal of Biological Chemistry 256(23): 12108-12117
Bergh, O., Borsheim, K.Y., Bratbak, G., Heldal, M. (1989) High abundance of viruses found in
aquatic environments. Nature 340:467-468.
Bullas, L. R., Mostaghimi, A. R., Arensdorf, J. J., Rajadas, P.T., Zuccarelli, A. J. (1991)
Salmonella phage PSP3, another member of the P2-like phage group. Virology 185:918-921
Burtnick M.N., Brett P.J., Harding S.V., Ngugi S.A., Ribot W.J., Chantratita N. et al. (2011) The
Cluster 1 Type VI Secretion System Is a Major Virulence Determinant in Burkholderia
pseudomallei. Infect Immun. 79(4):1512-25
Calendar, R., (2006). The Bacteriophages (2nd Ed.). Oxford University Press, New York
Campanacci, V., Veesler, D., Lichière, J., Blangy, S., Sciara, G., Moineau, S. et al., (2010)
Solution and electron microscopy characterization of lactococcal phage baseplates expressed in
Escherichia coli. J Struct Biol. 172(1):75-84.
Cardarelli, L. and Pell, L.G. and Neudecker, P. and Pirani, N. and Liu, A., Baker, L.A. et al.,
(2010). Evolutionary relationships may exist among very diverse groups of proteins even though
42
they perform different functions and display little sequence similarity. Proc Natl Acad Sci U S A
107(32): 14384-14389
Casjens, S. (2003). Prophages and bacterial genomics: what have we learned so far? Mol.
Microbiol. 49:277–300.
Davidson, A.R. and Sauer, R.T. (1994) Folded Proteins Occur Frequently in Libraries of
Random Amino Acid Sequences. Proc. Natl. Acad. Sci. USA 91: 2146-2150
Esposito, D., Fitzmaurice, W. P., Benjamin, R. C., Goodman, S. D., Waldman, A. S., Scocca, J.
J. (1996). The complete nucleotide sequence of bacteriophage HP1DNA. Nucleic Acids Res.
24:2360-2368.
Feucht, A., Schmid, A., Benz, R., Schwarz, H., Heller, K. J. (1990). Pore formation associated
with the tail-tip protein pb2 of bacteriophage T5. The Journal of Biological Chemistry 265 (30):
18561-7.
Guex, N. and Peitsch, M.C. (1997) SWISS-MODEL and the Swiss-PdbViewer: An environment
for comparative protein modeling. Electrophoresis 18: 2714-2723.
Haggard-Ljungquist, E., Jacobsen, E., Rishovd, S., Six, E., Nilssen, Φ., Sunshine, M., et al.,
(1995). Bacteriophage P2: genes involved in baseplate assembly. Viriology 213:109-121
Hanahan, D. (1985) Techniques for transformation of E. coli, p. 109-135. In D. M. Glover, DNA
cloning: a practical approach, vol. 1. IRL Press, Oxford, United Kingdom
Bozzola, J.J., Russell L. D. (1999) Electron microscopy: principles and techniques for
biologists.(2nd
Edition) Jones & Bartlett Learning
Karp, G (2009) Cell and Molecular Biology: Concepts and Experiments (9th
Edition) John Wiley
and Sons
Katoh, K., Misawa, K., Kuma, K., Miyata, T. (2002). MAFFT: a novel method for rapid multiple
sequence alignment based on fast Fourier transform. Nucleic Acids Res 30: 3059–3066.
43
Kostyuchenko, V. A., Leiman, P. G., Chipman, P. R., Kanamaru, S., van Raaij, M. I., Arisakaa,
F., et a.l, (2003). Three-dimensional structure of bacteriophage T4 baseplate. Nat. Struct. Biol..
10: 688-693
Leiman, P. G., Basler, M., Ramagopal, U. A., Bonanno, J. B., Sauder, J. M., Pukatzki, S., et al.,
(2009). Type VI secretion apparatus and phage tail-associated protein complexes share a
common evolutionary origin. Proc. Nat. Acad. Sci. 106:4154-4159
Leiman P.G., Arisaka F., van Raaij M.J., Kostyuchenko V.A., Aksyuk A.A., Kanamaru S., et al.,
(2010) Morphogenesis of the T4 tail and tail fibers. Virol J. 7:355-383.
Lengyel, J., Goldstein, R.N., Marsh, M., Calendar, R. (1974) Structure of the bacteriophage P2
tail. Virology 62:161-174
Lindahl, G., Hirota, Y., Jacob, F. (1971) On the process of cellular division in Escherichia coli:
Replication of the bacterial chromosome under control of prophage P2 Proc. Nat. Acad. Sci.
USA 68(10): 2407-2411
Mirold, S., Rabsch, W., Tschape, H., Hardt, W.-D. (2001) Transfer of the Salmonella type III
effector sopE between unrelated phage families. J. Mol. Biol. 312:7-16.
Nakayama, K., Kanaya, S., Ohnishi, M., Terawaki, Y., and Hayashi, T. (1999). The complete
nucleotide sequence of FCTX, a cytotoxin-converting phage of Pseudomonas aeruginosa:
implications for phage evolution and horizontal transfer via bacteriophages. Mol. Microbiol. 31:
399-419.
Nakayama, k., Takashima, K., Ishihara,H., Shinomiya, T., Kageyama, M., Kanaya,S et al.,
(2000). The R-type pyocin of Pseudomonas aeruginosa is related to P2 phage, and the F-type is
related to lambda phage. Mol Microbiology. 38:213-231
Nesper, J., J. Blass, M. Fountoulakis, and J. Reidl. (1999). Characterization of the major control
region of Vibrio cholerae bacteriophage K139: immunity, exclusion, and integration. J.
Bacteriol. 181:2902-2913.
Nilsson, A.S., Karlsson, J.L., Haggard-Ljungquist, E. (2004) Site-specific recombination links
the evolution of P2-like coliphages and pathogenic enterobacteria Mol. Biol. Evol. 21(1):1–13.
44
Ochman, H., and Selander, R. K. (1984). Standard reference strains of Escherichia coli from
natural populations. J. Bacteriol.157:690-693
Pell, L. G., Kanelis, V., Donaldson, L. W., Howell, P. L., Davidson, A. R. (2009). The phage
lambda major tail protein structure reveals a common evolution for long-tailed phages and the
type VI bacterial secretion system. Proc. Nat. Acad. Sci. 106:4160-4165
Sasaki, I., Bertani, G., (1965) Growth abnormalities in Hfr derivatives of Escherichia coli strain
C. J. Gen. Microbiol. 40:365-376.
Söding, J. (2005) Protein homology detection by HMM-HMM comparison. Bioinformatics 21:
951-960
Studier, F.W., Moffatt B.A. (1986) Use of bacteriophage T7 RNA polymerase to direct selective
high-level expression of cloned genes. J Mol Biol. 189(1):113-30
Sunshine, M., Thorn, M., Gibbs, W. and Calendar, R., (1971) P2 Phage Amber Mutants:
Characterization by use of a Polarity Supressor Virology 46: 691–702
Temple, L.M., Forsburg, S.L., Calender, R., Christie, G.E. (1991) Nucleotide sequence of the
genes encoding the major tail sheath and tail tube protein of bacteriophage P2. Virology 181:
353–388.
Thingstad,T. F. (2000) Elements of a theory for the mechanisms controlling abundance,
diversity, and biogeochemical role of lytic bacterial viruses in aquatic systems. Limnol.
Oceanogr. 45:1320-1328.
Vajda, B.P. (1978) Concentration and purification of viruses and bacteriophages with
polyethylene glycol. Folia Microbiol. 28:88-96
Waterhouse, A. M., Procter J. B., Martin D. M., Clamp, M., Barton, G.J., (2009). Jalview
Version 2; a multiple sequence alignment editor and analysis workbench, Bioinformatics
25:1189-1191
Williams, B. J., Golomb, M., Phillips, T., Brownlee, J., Olson, M. V., Smith. A. L. (2002).
Bacteriophage HP2 of Haemophilus influenzae. J. Bacteriol. 184:6893-6905.
45
Wommack, K.E. & Colwell, R.R. (2000) Virioplankton: viruses in aquatic ecosystems.
Microbiology and Molecular Biology Reviews, 64: 69–114.
Yap, M.L, Mio, K., Leiman, P.G., Kanamau, S., Arisaka, F. (2010) The baseplate wedges of
bacteriophage T4 spontaneously assemble into hubless baseplate-like structure in vitro. J. Mol.
Biol. 395:349-360
46
Appendices
Appendix A1. The P2 baseplate proteins
*These proteins are putative members of the P2 baseplate
Appendix A2. The P2 genome
Protein Residues Predicted Molecular Weight Function
gpH 669 71 kDa Tail Fiber
gpD 387 43 kDa Baseplate hub
gpJ 302 33 kDa Peripheral member of baseplate
gpV 211 22.1 kDa Tail spike
gpG 175 20.2 kDa Required for fiber formation
gpI 176 19.6 kDa
gpU* 159 17.4 kDa
gpW 115 12.6 kDa Baseplate wedge protein
gpX* 67 7.1 kDa
Capsid Proteins
Baseplate Proteins
lys Proteins; lysA, lysB and lysC
Tail Proteins Hypothetical Proteins
Portal Protein
Q P O N M L X Y K R S
V W J I H G fun(Z) FI FII E E’ T
U D ogr int C cox B A tin old
47
Gene Description of encoded protein Gene Description of encoded protein
Q Portal protein fun (Z)
P Terminase ATPase F I Tail sheath protein
O Capsid scaffold protein F II Tail tube protein
N Major capsid protein E, E’ Putative tail proteins
M Terminase endonuclease T Tape measure protein
L Capsid completion protein U Putative baseplate protein
X Putative baseplate protein D Baseplate hub protein
Y Holin protein ogr Late gene activator
K Lysin protein int Integrase
lysA Regulation of lysis C Predicted transcriptional regulator
lysB Regulation of lysis cox
lysC Regulation of lysis P2p34
R Tail completion protein B
S Tail completion protein P2p36
P2p15 P2p37
V Tail Spike P2p38
W Baseplate assembly protein P2p39
J Baseplate assembly protein A Putative replication initiator
I Baseplate assembly protein P2p41
H Tail fiber protein tin
G Fiber assembly protein old Overcoming Lysogenation Defect
48
Appendix A3 List of Primers used in this Study
Primer Name Primer Sequence (5’3’) Use
gpW_pAD
Forward AGGAAACAGAC
CATGGCAATGACAGCGCGTTATCTCG
Cloning gene W in pAD100
gpW_pAD
Reverse GTCCTTGTAGTCTAGAGCACTCACAGGGATGGT
TAATG
Cloning gene W in pAD100
gpW_pAD ENDO
For
AGGAAACAGACCATGGCCATAAACACCCCGGC
GAC
Cloning gene W with 45 base pairs
upstream into pAD100
gpW_pMAL
Forward
AAGGATTTCAGAATTCATGACAGCGCGTTATCT
C G
Cloning gene W in pMal.c4x
gpW_pMAL
Reverse
GCAGGTCGACTCTAGATCAACTCACAGGGATGG
T TAATG
Cloning gene W in pMal.c4x
R37A Forward ACACCGGTCGGCTCAGCGGTGATGCGTCGTGAT Mutating gene W; encoding R37A
R37A Reverse ATCACGACGCATCACCGCTGAGCCGACCGGTGT Mutating gene W; encoding R37A
R37D Forward GCACACCGGTCGGCTCAGATGTGATGCGTCGTG
ATTAC
Mutating gene W; encoding R37D
R37D Reverse GTAATCACGACGCATCACATCTGAGC
CGACCGGTGTGC
Mutating gene W; encoding R37D
R40A Forward GCTCACGGGTGATGGCGCGTGATTACGGCTC Mutating gene W; encoding R40A
R40A Reverse GAGCCGTAATCACGCGCCATCACCCGTGAGC Mutating gene W; encoding R40A
D42A Forward GTGATGCGTCGTGCGTACGGCTCGTTG Mutating gene W; encoding D42A
D42A Reverse CAACGAGCCGTACGCACGACGCATCAC Mutating gene W; encoding D42A
D42R Forward GGTGATGCGTCGTCGTTACGGCTCGTTG Mutating gene W; encoding D42R
D42R Reverse CAACGAGCCGTAACGACGACGCATCACC Mutating gene W; encoding D42R
W74A Forward CAT GGC AGT GCT GAA AGC GGA ACC CCG
CGT CAC
Mutating gene W; encoding W74A
W74A Reverse GTG ACG CGG GGT TCC GCT TTC AGC ACT
GCC ATG
Mutating gene W; encoding W74A
P76A Forward CAGTGCTGAAATGGGAAGCGCGCGTCACCCTGT
CATC
Mutating gene W; encoding P76A
P76A Reverse GATGACAGGGTGACGCGCGCTTCCCATTTCAGC Mutating gene W; encoding P76A
49
ACTG
R77A Forward CTGAAATGGGAACCCGCGGTCACCCTGTCATC Mutating gene W; encoding R77A
R77A Reverse GATGACAGGGTGACCGCGGGTTCCCATTTCAG Mutating gene W; encoding R77A
p21d_UD_For ATGATGCTCGCGTTAGGTATGTTTG Amplifying pET-21d
p21d_UD_Rev GGTATATCTCCTTCTTAAAGTTAAA Amplifying pET-21d
X_p21d_UD_For AGAAGGAGATATACCATGAAGACCTTTGCGC Cloning gene X in pET-21d
X_p21d_UD_Rev TAACGCGAGCATCATCTCCCACAGATTGAC Cloning gene X in pET-21d
pADseqFor GCTGTTGACAATTAATCATCCGGCTCG Sequencing constructs in pAD100
pADseqRev CTCAAGACCCGTTTAGAGGCCCCAAGGGG Sequencing constructs in pAD100