Michael J. Leonard, PhDChief Technology Officermleonard@motiffoodworks.com@mikeleonardmadewithmotif.com

Future Developments in Plant-Based Foods

Ingredient Innovation

Our Ambition:

To unleash the promise of plant-based foods

Plant-Based Marketplaces are Getting Bigger

$29 Billion

27% Meat-alt

73% Dairy-alt

Sources: 2020 Euromonitor, 2020 Statista, 2020 Market Watch Plant Based Meats

Plant-Based Segments are Outpacing their Animal-Based Counterparts

One Year Global Growth Rates(Y/Y Average)

15%

12%

7%

2%

Meat Dairy

Sources: 2020 Euromonitor, 2020 Statista, 2020 Market Watch Plant Based Meats

Today, plant-based foods are NOT living up to expectations…there are still significant gaps in the

performance of…

plant-based foods

animal counterpartsvs.

The Reason is Taste

Plant-based consumers are making big compromises

44% 67% 31% 34%

Consumers who don’t like how plant-based

foods taste

Yale Climate Change report

Would eat plant-based over meat if products

tasted better

Yale Climate Change report

Not interested in alternatives to animal products

due to taste

Health Focus International

Name taste as a top reason for not wanting to eat

plant-based foods

Good Food Institute

Nielsen Homescan Panel, June 2020

And therefore, velocity and repeat purchasing behavior significantly lags animal-based foods

Dairy and Meat Alternative Sensory Focus Groups

Plant-based milk

Plant-based yogurt

Plant-based cheese

Plant-based ice cream

Plant-based meat

Taste is Very Much in the Mouth of the Beholder

Taste

Color

Moisture

“Taste”

Texture

Smell

Most Plant Substitutes are Limited in their Ability to Replace or Replicate Animal-Based Foods

AlmondNutty off-notes

Watery mouth coating

Grainy and powdery texture

Off-white/gray color

Low protein digestibility (PDCAAS)

Common Challenges:

CashewAllergen

Nutty off-notes

Off-notes from oxidation

SoybeanAllergen

Green, beany off-notes

Chalky and powdery texture

Gray/brown color (alt. dairy)

Wheat Gluten

Common allergen

Limited application space

Low solubility

Low protein digestibility (PDCAAS)

Pea

Green, beany off-notes

Chalky and powdery texture

Limited gelling

Gray/green color (alt. dairy)

Low protein digestibility (PDCAAS)

Mycoprotein

Limited application space

Off-flavors

Spongy texture

Success = Great Tasting, More Nutritious, Plant-Based Foods that People Crave

Target Applications for Novel Protein Sources

Whole Muscle

Ground applications Milk

Cheese

Yogurt

Ice Cream

Infant & Toddler Nutrition

Sports & Adult Nutrition

Snacks & Spreads Vegan Baking

Snacks & Jerky

Meat AlternativesDairy Alternatives Plant-Based Performance & Nutrition

Modify & Mask

Flavor Strategies

Process Strategies Soft Matter Physics & Material Science

Oral Processing Physics

Fundamental Understanding

Standard New

Formulation Strategies Gums Stabilizers

Sensory Testing QDA

Synthetic Biology

Cognitive Metrics

Novel Proteins and Ingredients Must Address Many Key Attributes

TasteRich, satisfying flavors and aromas

AppearanceTempting, mouth-watering color

TextureMeaty texture and juiciness

NutritionEnhanced fat, salt and protein quality

Meat Alternatives Dairy Alternatives Plant-Based Performance & NutritionTexture

Rich and creamy with smooth mouthfeel

StretchStringy, stretchy options

MeltConsistent bubble and meltiness

ProteinEnhanced nutrition

TextureSmooth and consistent mouthfeel

AppearanceColor and surface attributes

It is Critical to Look at Food Design Through the Lens of Physics, Chemistry, and Materials Science

Proteins

Fat performanceTexture

Rheological properties

Applying New Sciences to Food that Drive Breakthrough Discoveries

Oral processing physics Rheology Neurobiology

ShearThermalBiochemicalDilution Etc.

(saliva)

Oral Processing is Dynamic

Oral Processing

Structure

Property

Transport properties Sensory

Food transforms

Dynamic

oral processing time

Capturing the Physics in the “Stages” of Oral Processing

(i)

Rheology, tribology, interfacial techniques

Temporal Dominance Profiling

Multiple deformation scales & food-transformation

Oral process‘stages’

Partnership with Ginkgo Bioworks

Ginkgo can:

– To engineer strains at scale using rational and unbiased approaches simultaneously

– With gigabase-scale DNA synthesis capacity.

And they have significant physical and digital economies of scale.

TTGTTTAGTCGAGAGAGTTGCACACTTCACTGAAGTTCTGCAAATTATACATGAGCTGTACCCTGATTTGCAACTTCCAGAGAAATGTTCGGATGATAAACCTTTTGTGCCAACATATCAGGTGTCCAAAGAAAAGGCAAAGAGCTTGGGAATTGAGTTTATTCCATTAGACATTAGCCTCAAGGAAACAATTGAAAGCTTGAAGGAAAAGAGTATCGTCAGCTTCTGAATGAGCAACAAGGTGGTCTGCGTCACGGGTGCCTCCGGCTACATTGCTTCATGGCTCGTCAAGCTCCTCCTCCAACGCGGCTACACTGTCAAGGCCTCTGTTCGCAACCCAAATGATCCAACAAAGACGGAGCACTTGCTCGCACTTGATGGAGCTAAGGAGAGACTTCAACTTTTCAAAGCAGATCTATTAGAAGAAGGTTCTTTTGACTCTGCTGTTGAGGGCTGTGAGGGTGTTTTCCACACTGCATC

Biology is fundamentally programmable

22

Using Synthetic Biology to Produce Animal-Free Food Ingredients

Desired animal protein genes

DNA sequencer

Searchablesequencedatabases

Sequencing

Millions of gene sequences

1

Isolated genes

Programming and Gene Assembly

Nucleobases chemically synthesized from cane sugar derivatives

DNA Synthesizer “prints” small fragments of target sequence

Enzymes Enzymes

Target gene is assembled and prepared for host

Yeastvecto

r

2 Ingredient production

Animal proteins produced without animals

Fermentation process optimized for target

Energy source

Engineered metabolic pathways

New DNA incorporated

into yeast cells

3

The Cost of DNA Sequencing (Reading) and Synthesis (Writing) is Falling Dramatically

Gingko’s Foundry Produces Results

Synbio Case Study: Biodiversity for Better, More Functional Ovalbumin

Rapidly searching and screening thousands of potential ovalbumin proteins in bird eggs across the animal kingdom

Screening for Proteins that Express Well in P. Pastoris

Entirely New Food Forms that Create New Categories

Entirely New Food Forms that Create New Categories

Thank You

mleonard@motiffoodworks.com@mikeleonard

madewithmotif.com