Post on 20-Jan-2016
transcript
Genes, genomes
Seminar of molecular and cell biology
Markéta Dostalíková
Genome
• complete set of information in an organism´s DNA
• human genome– nuclear DNA – linear dsDNA
• 25 000 genes
– mitochondrial - circular dsDNA• 37 genes
– 13 genes encode for proteins (respiration complex – oxidative fosforylation)
– 24 genes encode for 22 tRNA and 2 rRNA
Gene
• Short strech of DNA encoding a single RNA or a single protein and adjacent sequences that are involved in gene regulation (they are transcribed, but not translated)
• Exon - transcribed into RNA and codes for the amino acid sequence of part of a protein
• Intron - transcribed into RNA, excised by RNA splicing to produce mRNA, does not code for protein
DNA
DNA molecule
• 4 types of nucleotides: A,G,C,T• Base,sugar, phosphate
• Hydrogen bonds• Phosphodiester bonds
• 2 polynucleotide chains• Double helix
Bases
DNA : A, G, C, TRNA : A, G, C, U
Sugars
The Formation of DNA
Base + Sugar = Nucleoside– the 1´ carbon of pentose is attached to
nitrogen 1 of pyrymidine or nitrogen 9 of purine
The Formation of DNA
Base + Sugar + Phosphate = Nucleotide– phosphate is attached to
the 5´-carbon of the pentose ring
►deoxyribonukleotides – basic structure of DNA
dAMP = deoxyadenosinmonophosphate dATP = deoxyadenosintriphosphate
dNTP
nukleoside(eg. deoxyadenosin)
{
The other functions of nucleotides
Energy carriers, chemical groups carriers Specific regulators
The Formation of DNA
Nucleotides join together to form nucleic acid • The hydroxyl group attached to the 3´-pentose carbon of one
nucleotide forms an ester bond with the phosphate of another molecule, eliminating a water molecule
• The link between nucleotides is known as a phosphodiester bond
• Thus, one end of a DNA strand has a sugar residue in which the 5´-carbon is not linked to another sugar residue (the 5´end)
• Whereas at the other end the 3´carbon lacks a phosphordiester bond (the 3´end)
3’
5’
3’
5’
Po
larity of D
NA
strand
DNA Structure• The double helical structure of DNA was proposed by Watson and
Crick (1950)• The DNA helix
– The „backbone“ on the outside of the helix consists of alternating sugars and phosphates
– The bases are attached to the sugars and form the „rungs“ of the helix
• The strands are – anti-parallel
• their 5´,3´-phosphordiester links run in opposite directions– complementary
• because of base pairing the chains complement each other
video
DNA is usually found in the structure of right-handed double helix of complementary and antiparallel strands
Minor groove
Major groove
Nucleid acid are polymers of nucleotids. Double-stranded DNA containing deoxyribose can have several conformations
A - DNA Z - DNA
B - DNA
RNA
can have (3D) conformation because of the intramolecular base-pairing (A-U, G-C)
Modifications of DNA
• methylation of cytosin
• CpG islands, in promotores, in non-coding regions
• they are involved in the gene imprinting, condensation of X chromosom
The elementary structural unit of DNA is nucleosome
Histons: H2A, H2B, H3, H4 are present in nucleosome core (each twice). This protein - octamer - scaffold and DNA altogether form nucleosome
The lenght of DNA from one nucleosome to another is 200 bpcca 150 bases pairs is wounded around nucleosome
Composition of nucleosome
Histons are very conservative proteins containing so call histon fold and long N-ends
Octamer of histons composes from tetramers H3/H4 and two dimers H2A/B
Nucleosome is dynamic structure
Dynamics of nucleosome condensing and releasing is regulated by other proteins
Other various types of histones can be found in some specific nucleosomes and sequences
Higher level of chromatin organisation – „solenoid“, 30 nm fiber
Nucleosomes are bound together by H1 activity and activity of N- ends, e.g. H4 free ends
Nucleosome beads on DNA wire
10 000 fold condensated DNA form mitotic...
...chromosome
Stick structure is in next step condensated by group of proteins - condensins
Organization of DNA into chromosomesEukaryotic chromosomes contain one linear dsDNADNA associates with histons and creates chromatin
Chromatin remodeling complexes
Modification of chromatin
Modification of histons: acetylation, methylation, fosphorylation
Modification of chromatin
Histon code
In addition to genetic code there is also „histon code“ – next level of genome information realization
Histon code
Modificated histons are bound to other types of proteins - system of readers and writers
DNA and histon modifications take place in epigenetic regulation of gene expression
Genetic vs epigenetic information and heredity
Genetic information
• nearly all information that is realized by cell is in DNA
• information concerning the structure and functioning of cell
• It is carried through generations
• It must be changeable but not too much (lasting and stable
enough vs capability of changing during evolution)
• Genom is complete set of DNA (and thus information)
• Genophore: carrier of genetic information
Genes• Gene: sequence of nucleid acid which encodes a single polypeptide
chain (protein) or a single RNA chain (rRNA, tRNA)• Eukaryotic and prokaryotic genes differs in many features
(monocistrons, introns)• Regulatory regions of genes – promotors; enhancers• Repetitive sequences: are used for identification • Mobil elementes (transposons): spread in genom• Pseudogenes
Gene locus
35
Repetitive sequences are used for identification
Seqences in DNA:
• Encode aminoacids – proteins (mRNA)• Encode RNA as a final product
Genetic codeGenetic code – a rule by which certain sequence of bases
determines relevant amino acid
tripletive, universal, redundant
Three bases code one amino acid = triplet = codon
20 coded amino acids
4 bases (A, G, C, T) → 64 (43) combination of triplets (codons)
initiation codon is also a codone for methionin
3 triplets function as stop codons 3 possibilities of reading of the sequence of triplets: reading frames
38
Some aminoacids can be encoded by one codon (methionine, tryptophan) some by six codons (leucine, serine, arginine)
Task
AGUGAAAUGAUUAAUGCAAGGUGAGGGGAGAACGAGUGAUAA
Tyrosine - Y
Tryptofan - W
Glutamine - Q
Arginine - R
Asparagine - N
Lysine - K
Aspartic acid - D
Glutamic acid - E
Frameshift
Deletion or addition of DNA sequences– They may arise as a result of unequal crossing over during
meiosis, or spontaneous breakage of chromosomes
• For example, deletion of a single base will alter remaining
amino acid sequence
• Duchenne muscular dystrophy (deletion and alteration of
reading frame)
• Becker muscular dystrophy (deletion but not alteration of
reading frame)
Expansion of trinucleotide repeats
expansion of a sequence of DNA that contains a series of repeated
nucleotide triplets
– In diseases identified so far the repetitive sequence is present in
the gene of normal individuals, but is expanded up to a 1000-fold
in the gene of affected patients
– Myotonic dystrophy – CAG repetition, progressive muscle
weakness
– Huntington‘s disease – progressive dementia and involuntary
movements, in middle age
– Fragile X syndrome – X chromosome linked mental retardation
Task
To find this nucleotide sequence on web site
gcccgagagaccatgcagaggtcgcctctggaaaaggccagcgttgtctccaaacttttt
http://blast.st-va.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome