Genes, genomes

Seminar of molecular and cell biology

Markéta Dostalíková

Genome

• complete set of information in an organism´s DNA

• human genome– nuclear DNA – linear dsDNA

• 25 000 genes

– mitochondrial - circular dsDNA• 37 genes

– 13 genes encode for proteins (respiration complex – oxidative fosforylation)

– 24 genes encode for 22 tRNA and 2 rRNA

Gene

• Short strech of DNA encoding a single RNA or a single protein and adjacent sequences that are involved in gene regulation (they are transcribed, but not translated)

• Exon - transcribed into RNA and codes for the amino acid sequence of part of a protein

• Intron - transcribed into RNA, excised by RNA splicing to produce mRNA, does not code for protein

DNA

DNA molecule

• 4 types of nucleotides: A,G,C,T• Base,sugar, phosphate

• Hydrogen bonds• Phosphodiester bonds

• 2 polynucleotide chains• Double helix

Bases

DNA : A, G, C, TRNA : A, G, C, U

Sugars

The Formation of DNA

Base + Sugar = Nucleoside– the 1´ carbon of pentose is attached to

nitrogen 1 of pyrymidine or nitrogen 9 of purine

The Formation of DNA

Base + Sugar + Phosphate = Nucleotide– phosphate is attached to

the 5´-carbon of the pentose ring

►deoxyribonukleotides – basic structure of DNA

dAMP = deoxyadenosinmonophosphate dATP = deoxyadenosintriphosphate

dNTP

nukleoside(eg. deoxyadenosin)

{

The other functions of nucleotides

Energy carriers, chemical groups carriers Specific regulators

The Formation of DNA

Nucleotides join together to form nucleic acid • The hydroxyl group attached to the 3´-pentose carbon of one

nucleotide forms an ester bond with the phosphate of another molecule, eliminating a water molecule

• The link between nucleotides is known as a phosphodiester bond

• Thus, one end of a DNA strand has a sugar residue in which the 5´-carbon is not linked to another sugar residue (the 5´end)

• Whereas at the other end the 3´carbon lacks a phosphordiester bond (the 3´end)

3’

5’

3’

5’

Po

larity of D

NA

strand

DNA Structure• The double helical structure of DNA was proposed by Watson and

Crick (1950)• The DNA helix

– The „backbone“ on the outside of the helix consists of alternating sugars and phosphates

– The bases are attached to the sugars and form the „rungs“ of the helix

• The strands are – anti-parallel

• their 5´,3´-phosphordiester links run in opposite directions– complementary

• because of base pairing the chains complement each other

video

DNA is usually found in the structure of right-handed double helix of complementary and antiparallel strands

Minor groove

Major groove

Nucleid acid are polymers of nucleotids. Double-stranded DNA containing deoxyribose can have several conformations

A - DNA Z - DNA

B - DNA

RNA

can have (3D) conformation because of the intramolecular base-pairing (A-U, G-C)

Modifications of DNA

• methylation of cytosin

• CpG islands, in promotores, in non-coding regions

• they are involved in the gene imprinting, condensation of X chromosom

The elementary structural unit of DNA is nucleosome

Histons: H2A, H2B, H3, H4 are present in nucleosome core (each twice). This protein - octamer - scaffold and DNA altogether form nucleosome

The lenght of DNA from one nucleosome to another is 200 bpcca 150 bases pairs is wounded around nucleosome

Composition of nucleosome

Histons are very conservative proteins containing so call histon fold and long N-ends

Octamer of histons composes from tetramers H3/H4 and two dimers H2A/B

Nucleosome is dynamic structure

Dynamics of nucleosome condensing and releasing is regulated by other proteins

Other various types of histones can be found in some specific nucleosomes and sequences

Higher level of chromatin organisation – „solenoid“, 30 nm fiber

Nucleosomes are bound together by H1 activity and activity of N- ends, e.g. H4 free ends

Nucleosome beads on DNA wire

10 000 fold condensated DNA form mitotic...

...chromosome

Stick structure is in next step condensated by group of proteins - condensins

Organization of DNA into chromosomesEukaryotic chromosomes contain one linear dsDNADNA associates with histons and creates chromatin

Chromatin remodeling complexes

Modification of chromatin

Modification of histons: acetylation, methylation, fosphorylation

Modification of chromatin

Histon code

In addition to genetic code there is also „histon code“ – next level of genome information realization

Histon code

Modificated histons are bound to other types of proteins - system of readers and writers

DNA and histon modifications take place in epigenetic regulation of gene expression

Genetic vs epigenetic information and heredity

Genetic information

• nearly all information that is realized by cell is in DNA

• information concerning the structure and functioning of cell

• It is carried through generations

• It must be changeable but not too much (lasting and stable

enough vs capability of changing during evolution)

• Genom is complete set of DNA (and thus information)

• Genophore: carrier of genetic information

Genes• Gene: sequence of nucleid acid which encodes a single polypeptide

chain (protein) or a single RNA chain (rRNA, tRNA)• Eukaryotic and prokaryotic genes differs in many features

(monocistrons, introns)• Regulatory regions of genes – promotors; enhancers• Repetitive sequences: are used for identification • Mobil elementes (transposons): spread in genom• Pseudogenes

Gene locus

35

Repetitive sequences are used for identification

Seqences in DNA:

• Encode aminoacids – proteins (mRNA)• Encode RNA as a final product

Genetic codeGenetic code – a rule by which certain sequence of bases

determines relevant amino acid

tripletive, universal, redundant

Three bases code one amino acid = triplet = codon

20 coded amino acids

4 bases (A, G, C, T) → 64 (43) combination of triplets (codons)

initiation codon is also a codone for methionin

3 triplets function as stop codons 3 possibilities of reading of the sequence of triplets: reading frames

38

Some aminoacids can be encoded by one codon (methionine, tryptophan) some by six codons (leucine, serine, arginine)

Task

AGUGAAAUGAUUAAUGCAAGGUGAGGGGAGAACGAGUGAUAA

Tyrosine - Y

Tryptofan - W

Glutamine - Q

Arginine - R

Asparagine - N

Lysine - K

Aspartic acid - D

Glutamic acid - E

Frameshift

Deletion or addition of DNA sequences– They may arise as a result of unequal crossing over during

meiosis, or spontaneous breakage of chromosomes

• For example, deletion of a single base will alter remaining

amino acid sequence

• Duchenne muscular dystrophy (deletion and alteration of

reading frame)

• Becker muscular dystrophy (deletion but not alteration of

reading frame)

Expansion of trinucleotide repeats

expansion of a sequence of DNA that contains a series of repeated

nucleotide triplets

– In diseases identified so far the repetitive sequence is present in

the gene of normal individuals, but is expanded up to a 1000-fold

in the gene of affected patients

– Myotonic dystrophy – CAG repetition, progressive muscle

weakness

– Huntington‘s disease – progressive dementia and involuntary

movements, in middle age

– Fragile X syndrome – X chromosome linked mental retardation

Task

To find this nucleotide sequence on web site

gcccgagagaccatgcagaggtcgcctctggaaaaggccagcgttgtctccaaacttttt

http://blast.st-va.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome