Homework comments Read rubrics thoroughly! Any problems with groups, report to me immediately...

transcript

Homework comments• Read rubrics thoroughly!

• Any problems with groups, report to me immediately

• Quantum mine bonus scores added to pattern master scores

Exit Condition - 20% of quiz

1.) Pair up (two in a group)2.) Write your names and SECTION at the top of

the paper3.) EXPLAIN the process of TRANSLATION

Include the following in your answer: tRNAmRNA

ribosomeUAG codon

RNA Polymeraseaminoacyl tRNA synthetase

termination factordiffusion

1.) Pair up (two in a group)2.) Write your names and SECTION at the top of

the paper3.) EXPLAIN the process of TRANSLATION

Include the following in your answer: tRNAmRNA

ribosomeUAG codon

RNA Polymeraseaminoacyl tRNA synthetase

termination factordiffusion

Translation: Changing languages

How? Why?

Transcription: Writing againTranscription: Writing again

Today we’ll go from here... To here

We can do We can do anythinganything

5Off to see the wizard...

• DNA replication

• both strands => new DNA

• => new cell

• Transcription

• 1 strand => new RNA

• => new protein

Sending ‘messages’ out from DNA

6Transcription: seeing it

http://www.hhmi.org/biointeractive/media/DNAi_transcription_vo1-lg.mov

Amino acidsAmino acidsFrom 4 letters of

storage/information to

20 letters of action!!

From 4 letters of storage/information

to 20 letters of action!!

820 toys

• EVERY one has a blue part. Chem name?

• EVERY one has a red part. Chem name?

• Thus these are all...?

• How many are there?

9aaDancer• Why do nucleotides look like nucleotides, while

amino acids look like amino acids?

• Remember the handshakes

• What are amino acids ‘for’?

10Different tools; different jobs• You & partner have an amino acid; which is it? (StructViewer

or homepage => left column ‘big twenty’ amino acids)

• In what ways are all bases identical? Different?

• In what ways are all amino acids identical? Different?

• Which set is more diverse in terms of ‘feel’?

• Which more diverse in terms of shape?

• Which would allow you to build more diverse shapes & surfaces?

11Mutation--not always bad

• While the comparison is often made, proteins are not sentences

• An amino acid is a collection of properties; changing from one to another changes a region of the protein by (little/some/a lot/completely)

• It’s an exaggeration, but think of amino acids more like different vacuum cleaner nozzles

12How does a codon ‘mean’ an amino acid?

Walking the walkWalking the walkHow bio machines translate the

language of nucleotides into an amino acid string

How bio machines translate the language of nucleotides into an amino

acid string

Translation Key Players – define with a partner• RNA polymerase (important in transcription but

necessary for the prep of translation)

• mRNA

• tRNA

• Aminoacyl tRNA synthetase

• Ribosome

• Termination factor

15DNA template strand

5’ CTTAAATCCGAATGCCCATG 3’

How should the complimentary strand go?

16DNA template strand

(alternate version)

5’ CTTAAATCCGAATGCCCATG 3’5 ’ end is pointy/spiky

3 ’ end is soft/furry

17Roles--for single mRNA

• 4 tRNA (8 pp)

• 4 pairs to be synthetases (8 pp)

• 1 small ribosomal subunit x 1 person

• 1 large ribosomal subunit x 1 person

• 2 to be (RNA polymerase & the RNA it makes )

• 1 termination factor (1 person)

5 ’ end is pointy/spiky3 ’ end is soft/furry

18Learning your ‘lines’

• Handout: Each group find questions related to their role; answer them

• Lab manual, textbook, internet OK as sources

• RNA polymerase answer mRNA questions

• Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts

5 ’ end is pointy/spiky3 ’ end is soft/furry

19Special powers• Recall that ribosome assembly is the result of

methionine tRNA finding a match on mRNA in presence of small ribosome subunit

• Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’!

Choreographing translation

A play of many parts, many players, no brains

21Going with the flow• mRNA at the central bench

• ribosome assembles around it

• synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA)

• tRNAs will ‘diffuse’ by following a path through the room

• When any event first happens*, action stops, molecules involved will announce, explain

• Go until a protein happens

*This includes non-events (rejections, etc.)

22Walk-through with 1 tRNA

• Everybody watches visits to synthetase, ribosome

• In the real world, everything is happening all the time; all is happenstance

23Who knows the code?

• What happens if a tRNA carries the wrong amino acid?

• What happens if the mRNA contains a copy error relative to DNA?

• What happens if a tRNA has a mutated anticodon

24Review movie

• http://www.youtube.com/watch?v=-zb6r1MMTkc

Meet your semester-long

interest

Meet your semester-long

interest

Semester Project Desktop Lab 4

Perform the experiment with a group

For the next week or so, come up with hypotheses for what is going on, think about ways to test this phenomenon

HomeworkHomeworkStructViewer*--amino acid look & feel**

Begin thinking about your projectAssessor: mutation & translation

*As will always be the case in this course, no tricks; focus on the primary idea(s)

**‘SurfaceViewer’ link from Software page may help

...Ch. 3 reading about the immune system is just for fun

StructViewer*--amino acid look & feel**Begin thinking about your projectAssessor: mutation & translation

*As will always be the case in this course, no tricks; focus on the primary idea(s)

**‘SurfaceViewer’ link from Software page may help

...Ch. 3 reading about the immune system is just for fun

Homework comments Read rubrics thoroughly! Any problems with groups, report to me immediately...

Documents