Post on 02-Dec-2021
transcript
HUBUNGAN FILOGENETIK DUA POPULASI KATAK POHON Nyctimystes infrafrenatus infrafrenatus (TYLER 1971)
DI INDONESIA BERDASARKAN GEN 16S rRNA
ZOOGEOGRAPHY (BIO 562)
GRADUATE SCHOOL
IPB UNIVERSITY
Taufan Nurzaman Sulaeman
(G352180071)
Dr. Ir. Achmad Farajallah, MSi.
Dr. Amir Hamidy, MSc.
Sekolah Pascasarjana
Institut Pertanian Bogor
2020
Nyctimystes infrafrenatus (Gunther 1867)Katak Pohon Hijau Papua | White Lipped Treefrog| Australian Giant Treefrog
2
Bibir bawah (infralabial) berwarna putih. Strip putih memanjang hingga ke bagian bawah tympanum
Dorsal berwarna hijau
Dorsal berwarna putih
SVL = 130 mm (Menzies 2006)
Jari kaki depan berselaput sebagianJari kaki belakang
Berselaput penuh
Litoria
Nyctimystes
Ranoidea
Pyron dan Wiens 2011Duellman et al. 2016)
Latar Belakang
3
Permasalahan Sistematik :Morfologi : Litoria Molekuler : Nyctimystes(Menzies 2006; Pyron dan Wiens 2011; Duellman et al. 2016)
Distribusi luas :Wilayah timur Indonesia, Papua Nuginiutara Australia, Kaledonia Baru dan Kepulauan Solomon(Iskandar dan Colijn 2000; Menzies 2006; Iskandar et al. 2017; Frost 2020)
Peta distribusi Nyctimystes infrafrenatus
Species Kriptik (?)Chalcorana chalconota (Inger et al. 2009)
Rhacophorus dugritei (Li et al. 2012)
Polypedates leucomystax(Kuraishi et al. 2013)
Leptobrachium hasseltii(Hamidy dan Matsui 2017) Microhyla complex (Atmadja et al. 2018).
4
Kepulauan Maluku : Kei, Ambon, Obi, Buru, Seram, Talaud, Morotai, Halmahera
Papua :Papua, Papua Barat, Aru, Waigeo, Misol, Tanimbar
(Brongersma 1948; Boulenger 1912; Tyler 1978; Setiadi dan Hamidy 2006; Hamidy dan Mulyadi 2007; Koch et al. 2007; Karin et al. 2018; Nugroho et al. 2019).
Latar Belakang
2 Subspesies:Nyctimystes infrafrenatus infrafrenatusNyctimystes infrafrenatus militarius(Tyler 1971)
5
Subspesies : Nyctimystes infrafrenatus infrafrenatus
Sinonim :
Calamites dolichopsisLitoria guttataHyla dolichopsi var. tennuigranulataHyla spengeli) (Loveridge 1948; Tyler 1971; Iskandar dan Colijn 2000; Menzies 2006).
SubspesiesNyctimystes infrafrenatus militarius
Sinonim
Hyla militaria Hyla dolichopsi var. pollicaris
Latar Belakang
6
Latar Belakang Nyctimystes infrafrenatus infrafrenatus
2 populasi alopatrik - 2 subregion
Nyctimystes infrafrenatus infrafrenatusPopulasi Maluku
Wallacea
Nyctimystes infrafrenatus infrafrenatusPopulasi Papua
Australo-Papua
• Sejarah geologi pembentukan kawasan yang berbeda (Hall 1998; Hall 2002; Hall
2009; Hall 2013).
• Amfibi endemik terhadap benua atau unit biogeografi tunggal (Vences dan
Kohler 2008
• Distribusi amfibi melalui laut terbatas (Duellman dan Trueb 1986; Vences et al. 2003; Fonte et
al. 2019)
Molekuler ???:
Gen 16S rRNA(Vences et al. 2005)
Morfometrik:Perbedaan pada ukuran tungkai belakang betina(Prafiadi et al. 2016)
7
Latar Belakang
Permasalahan SistematikDistribusi luasDua populasi pada dua
subregion biogeografi Perbedaan morfometrik*
Tujuan
• Menentukan status taksonomi N. i. infrafrenatus • Mengevaluasi hubungan kekerabatan antara populasi
N. i. infrafrenatus Papua dan Maluku
8
Waktu dan Tempat• November 2019 – April 2020• Laboratorium Herpetologi, Lembaga Ilmu Penelitian Indonesia (LIPI),
Cibinong, Bogor.
Sampel Penelitian
• Sediaan sekuens gen 16S rRNA Nyctimystes infrafrenatus infrafrenatus Laboratorium Herpetologi, LIPI
Primer 16S rRNA :
16 H-1 (5’- CTCCGGTCTGAACTCAGATCACGTAGG -3’)
16 L-1 (5’- CTGACCGTGCAAAGGTAGCGTAATCACT –3’)
• Sediaan Sekuens 16S rRNA Nyctimystes infrafrenatus infrafrenatus dan outgrup yang tersedia di Genbank (https://www.ncbi.nlm.nih.gov/genbank/)
Metode Penelitian
9
METODE
1010
Sekuens LIPI
Sekuens Genbank
ALIGNMENT
MUSCLEPerangkat lunak : MEGA X
Metode Penelitian
Pensejajaran Sekuens Rekonstruksi Pohon Filogenetik Visualisasi
Perangkat lunak : FigTree
Maximum Likelihood (ML)
GTR + G1000 replikasi
Perangkat lunak : MEGA X
Bayesian Inference (BI)
GTR + G10.000.000 MCMC Frekuensi diagnosis 100.000Burn-in 25 %Topologi sampel tiap 1000 generasi
Perangkat lunak : MrBayes 3.2.7a
Jarak genetik(p-distance)
Hasil Pensejajaran
419 pb
1111
Table 1. Sampel N.i. infrafrenatus dan outgroup yang digunakan pada rekonstruksi pohon filogenetik.
Metode Penelitian
METODE
1212
Table 1 lanjutan.....
Metode Penelitian
Gambar 2. Pohon filogenetik berdasarkan topologi Bayesian Inference N. i. infrafrenatusdan outgrup berdasarkan sekuens 16Sr RNA (419 pb). Angka pada lengan pohon menunjukkan besarnya bootstrap ML (MLBS) dan probabilitas posterior (BPP).
13
Hasil dan Pembahasan
• Monofiletik• Membentuk 2 subclade
A
B
Gambar 1. A) Spesimen N. i. infrafrenatus dari Timika, Papuamemiliki “bibir putih” yang lebih tebal dari N. i. infrafrenatusdari Ternate, Maluku. Foto : Amir Hamidy (A) dan M. Iqbal Setiadi (B).
Gambar 2. Pohon filogenetik berdasarkan topologi Bayesian Inference N. i. infrafrenatusdan outgrup berdasarkan sekuens 16Sr RNA (419 pb). Angka pada lengan pohon menunjukkan besarnya bootstrap ML (MLBS) dan probabilitas posterior (BPP).
14
Table 2. Jarak genetik (uncorrected p-distances) diantara populasi N. i. infrafrenatus dan spesies lain dari genus Nycimystes
Ranoidea bella sp. nov danRanoidea auae 2.00 %(McDonald et al. 2016)
• Jarak genetik 3% , indikasi pemisahan tingkat species (Fouquet et al. 2007)
• Leptobrachium hasseltii Bali dan Jawa 3-4%(Hamidy dan Matsui 2017)
Hasil dan Pembahasan
15
Perubahan permukaan air laut dan garis pantai pada masa glasiasi maksimum terakhir (LGM) memunculkan dangkalan Sahul (Yokoyama et al. 2001)
20 mya 15 mya
10 mya 5 mya
(18,000 14C yr BP) (16,000 14C yr BP)
(12,000 14C yr BP) (9000 14C yr BP) (6000 14C yr BP)
P-distance :
1.3-1.5% ]
Vicariance memisahkan Papua dari Australia(Hantoro et al. 1995; Van der Kaars 1991; Voris 2000)
Hasil dan Pembahasan
16
Perubahan permukaan air laut dan garis pantai pada masa glasiasi maksimum terakhir (LGM) memunculkan dangkalan Sahul (Yokoyama et al. 2001)
20 mya 15 mya
10 mya 5 mya
(18,000 14C yr BP) (16,000 14C yr BP)
(12,000 14C yr BP) (9000 14C yr BP) (6000 14C yr BP)
Vicariance memisahkan Papua dari Australia(Hantoro et al. 1995; Van der Kaars 1991; Voris 2000)
Hasil dan Pembahasan
Jembatan distribusi/pertukaran Spesies• hutan tropis
dataran rendah• padang rumput-semak• sistem sungai (Hantoro et al. 1995; Van der Kaars 1991; Voris 2000)
17
Gambar Palaeogeografi Wallacea(Hall 2013)
20 mya 15 mya
10 mya 5 mya
Halmahera adalah Oceanic Islands(Hall 1998; Hall 2002; Hall 2009; Lohman et al. 2011; Hall 2013).
Mekanisme distribusi spesies pada
oceanic island :
overseas/overwater jump dispersal”
Katak :
Boophis dan Mantidactylus
Madagascar Comoros(Vences et al. 2003; Fonte et al. 2019).
Hasil dan Pembahasan
Tropicagama temporalis (Kadal)Kolonisasi Maluku dari Australia melalui Papua (Karin et al. 2020)
Simpulan
18
• Populasi N. i. infrafrenatus di Indonesia merupakan Clademonofiletik dengan dua subclade
• Berdasarkan pemisahan subclade pada pohon filogenetik dan jarakgenetik diatas ambang batas spesies, populasi N. i. infrafrenatusMaluku merupakan spesies yang berbeda dari populasi Papua.
• Secara morfologi terdapat perbedaan tebal garis putih padainfralabial yang dapat menjadi salah satu karakter diagnostik untukpendeskripsian spesies lebih lanjut.
19
Terima Kasih
19
20
Atmadja VY, Hamidy A, Arisuryanti T, Matsui M, Smith EN. 2018. A new species of Microhyla (Anura: Microhylidae) from Sumatra,Indonesia. Treubia. 45:25-46.
Bickford D, Lohman DJ, Sodhi NS, Ng PKL, Meier R, Winker K, Ingram KK, Das I. Cryptic species as a window on diversity and conservation. Trends Ecol Evol. 22(3): 148-155. doi: 10.1016/j.tree.2006.11.004.
Brongersma LD. 1948. Frogs and snakes from the island of Morotai (Moluccas). Zool Meded. 29: 306-310. Boulenger GA. 1912. On some treefrogs allied to Hyla caerulea, with remarks on noteworthy secondary sexual characters in the
family Hylidae. Zool Jahrb Abt Syst Geog Biol. 15: 211–218.Cox CB, Moore PD, Ladle RJ. 2016. Biogeography: An Ecological and Evolutionary Approach. 9th Edition. Chisester: John Wiley &
Son, Ltd.Darst CR, Cannatella DC. 2004. Novel relationships among hyloid frogs inferred from 12S and 16S mitochondrial DNA sequences.
Mol Phylogenet Evol. 31: 462-475. doi:10.1016/j.ympev.2003.09.003.Duellman WE, Trueb L. 1986. Biology of Amphibians. New York: McGraw-Hill.Duellman WE, Marion AB, Hedges SB. 2016. Phylogenetics, classification, and biogeography of the treefrogs (Amphibia: Anura:
Arboranae). Zootaxa. 4104: 1–109. doi.org/10.11646/zootaxa.4104.1.1.Fonte LFM, Mayer M, Lötters S. 2019. Long-distance dispersal in amphibians. Front Biogegr. 0(0): 1-14. doi: 10.21425/F5FBG44577.Fouquet A, Gilles A, Vences M, Marty C, Blanc M, Gemmell NJ. 2007. Underestimation of species richness in Neotropical frogs
revealed by mtDNA analyses. PLOS ONE. 2(10): e1109. doi:10.1371/journal.pone.0001109.Frost DR. 2020. Amphibian species of the world: an online reference. Version 6.0 [internet]. [diunduh 2020 22 Agustus 2020].
Tersedia pada: https://amphibiansoftheworld.amnh.org/Amphibia/Anura/Pelodryadidae/Pelodryadinae/Nyctimystes/Nyctimystes-infrafrenatus.
Günther ACLG. 1867. Additions to the knowledge of Australian reptiles and fishes. Ann Mag Nat Hist. 20: 45–68.Hall R. 1998. The Plate Tectonics of Cenozoic Southeast Asia and the Distribution of Land and Sea. Di dalam: Hall R, Holloway JD,
editor. Biogeography and Geological Evolution of Southeast Asia. Leiden: Backhuys Publishers. hlm 99-131.Hall R. 2002. Cenozoic geological and plate tectonic evolution of SE Asia and the SW Pacific: computer-based reconstructions,
model and animations. J Asian Earth Sci. 20: 353-431. Hall R. 2009. Southeast Asia’s changing palaeogeography. Blumea. 54: 148-161. doi:10.3767/000651909X475941.Hall R. 2013. The palaeogeography of Sundaland and Wallacea since the Late Jurassic. J Limnol. 72(2): 1-17. doi:
10.4081/jlimnol.2013.s2.e1.
Daftar Pustaka
20
21
Hamidy A, Mulyadi. 2007. Herpetofauna di Pulau Waigeo. Bogor: Puslit Biologi LIPI.Hamidy A, Matsui, M. 2017. Phylogenetic relationship of Leptobrachium hasseltii Tschudi, 1838 (Amphibia, Anura, Megophrydae) –
Detection of a possible cryptic species. Treubia. 44: 15-28. Hantoro WS, Faure H, Djuwansah R, Faure-Denard L, Pirazzoli PA. 1995. The Sunda and Sahul continental platform: Lost land of the
last glacial continent in S.E. Asia. Quat Int. 29/30: 129-134. Hedges SB. 1994. Molecular evidence for the origin of birds. Proc Natl Acad Sci USA. 91: 2621–2624. Hillis DM, Bull JJ. 1993. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst Biol.
42:182–192. Iskandar DT, Colijn E. 2001. Checklist of Southeast Asian herpetofauna I. Amphibians. Treubia. 31: 1-133.Iskandar DT, Mumpuni, Hero J, Retallick R, Richards S. 2017. Nyctimystes infrafrenatus (amended version of 2004 assessment). The
IUCN Red List of Threatened Species 2017: e.T41095A114114070. [internet]. [diunduh 2020 22 Agustus 2020]. Tersedia pada: https://dx.doi.org/10.2305/IUCN.UK.2017-1.RLTS.T41095A114114070.en.
Karin BK, Stubss AL, Arifin U, Bloch LM, Ramadhan G, Iskandar DT, Arida E, Reilly SB, Kusnadi A, Mcguire JA. 2018. The herpetofauna of the Kei Islands (Maluku, Indonesia): Comprehensive report on new and historical collections, biogeographic patterns, conservation concerns, and an annotated checklist of species from Kei Kecil, Kei Besar, Tam, and Kur. Raffles Bull Zool. 66: 704-738.
Karin BK, Stubss AL, Arifin U, Iskandar DT, Arida E, Austin CC, McGuire JA. 2020. Crossing Lydekker’s line: Northern water dragons (Tropicagama temporalis) colonized the Mollucan Islands of Indonesia from New Guinea. Herpetologica. 76(3): 344-350.
Koch A, Arida E, Riyanto A., BÖhme W. 2007. Islands between the realms: A revised checklist of the herpetofauna of the Talaud Archipelago, Indonesia, with a discussion about its biogeographic affinities. Bonn Zool Beitr. 56: 107-129.
Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol Biol Evol. 35:1547-1549. doi: 10.1093/molbev/msy096.
Kuraishi N, Matsui M, Hamidy A, Belabut DM, Ahmad N, Panha S, Sudin A, Yong HS, Jiang JP, Ota H et al. 2012. Phylogenetic and taxonomic relationship of the Polypedates leucomystax complex (Amphibia). Zool Script. 42(1):54-70. 10.1111/j.1463-6409.2012.00562.x.
Leaché AD, Reeder TW. 2002. Molecular systematics of the eastern fence lizard (Sceloporus undulatus): a comparison of parsimony, likelihood, and Bayesian approaches. Syst Biol. 51(1): 44–68. doi: 10.1080/106351502753475871.
Lohman DJ, de Bruyn M, Page T, von Rintelen K, Hall R, Ng PKL, Shih H, Carvalho GR, von Rintelen T. 2011. Biogeography of the Indo-Australian Archipelago. Annu Rev Ecol Evol Syst. 42: 205-226. doi: 10.1146/annurev-ecolsys-102710-145001. 21
Daftar Pustaka
22
Loveridge A. 1948. New Guinean reptiles and amphibians in the Museum of Comparative Zoology and United States National Museum. Bull Mus Comp Zool. 101: 305–430.
Mahony M, Knowles R, Foster R, Donnellan S. 2001. Systematics of the Litoria citropa (Anura: Hylidae) complex in Northern New South Wales and Southern Queensland, Australia, with the description of a new species. Rec Aust Mus. 53: 37–48. doi: 10.3853/j.0067-1975.53.2001.1322.
McDonald KR, Rowley JJ, Richards SJ, Frankham GJ. 2016 A new species of treefrog (Litoria) from Cape York Peninsula, Australia. Zootaxa. 4171: 153-169. doi: 10.11646/zootaxa.4171.1.6.
Menzies JI, Tyler MJ. 2004. Litoria gracilenta (Anura: Hylidae) and related species in New Guinea. Aust J Zool. 52: 191–214.doi:10.1071/ZO03008.
Menzies JI. 2006. The Frogs of New Guinea and the Solomon Islands. Sofia: Pensoft.Nei M, Kumar S. 2000. Molecular Evolution and Phylogenetics. New York: Oxford University Press.Nugroho H, Riyanto A, Wiantoro S, Santika Y, Irham M. 2000. Ekspedisi Tambrauw; Sepotong Surga di Tanah Papua. Jakarta: LIPI
Press.Oliver LA, Prendini E, Kraus F, Raxworthy CJ. 2015. Systematics and biogeography of the Hylarana frog (Anura: Ranidae) radiation
across tropical Australasia, Southeast Asia, and Africa. Mol Phylogenet Evol. 90: 176-192. doi : 10.1016/j.ympev.2015.05.001.Peloso, PLV, Frost D, Richards SJ, Rodrigues MT, Donellan S, Matsui M, Raxworthy CJ, Biju SD, Lemmon EM, Lemmon AR. Wheeler
WC. 2015. The impact of acnhored phylogenomics and taxon sampling on phylogenetic inference in narrow-mouthed frogs (Anura, Microhylidae). Cladistic. 0: 1-28. doi: 10.1111/cla.12118.
Prafiadi S, Kurniawan N, Hamidy A. 2016. Keberagaman spesies katak pohon hijau Papua Litoria infrafrenata infrafrenata Tyler, 1971 pada wilayah Kepulauan Wallacea dan Indo-Australia. J-PAL. 7(1): 33-43.
Pyron RA, Wiens JJ. 2011. A large-scale phylogeny of Amphibia including over 2800 species, and a revised classification of extant frogs, salamanders, and caecilians. Mol Phylogenet Evol. 61: 543-583. doi:10.1016/j.ympev.2011.06.012.
Ramsay EP. 1878. Description of a new species of Pelodryas, from New Ireland. Proc Linn Soc NSW. 2: 28–30.Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 19(12): 1572–
1574. doi: 10.1093/bioinformatics/btg180.Rosauer D, Lafffan SW, Crisp MD, Donnellan SC, Cook LG. (2009). Phylogenetic endemism: a new approach for identifying
geographical concentrations of evolutionary history. Mol Ecol. 18: 4061-4072. doi: 10.1111/j.1365-294X.2009.04311.x.Rueda M, Rodriguez MA, Hawkins BA. 2013. Identifying global zoogeographical regions: lessons from Wallace. J Biogeogr. 40:
2215-2225. doi:10.1111/jbi.12214. 22
Daftar Pustaka
23
Schauble CS, Moritz C, Slade RW. 2000. A molecular phylogeny for the frog genus Limnodynastes (Anura: Myobatrachidae). MolPhylogenet Evol. 16(3): 379-391. doi:10.1006/mpev.2000.0803.
Setiadi MI, Hamidy A. 2006. Jenis-jenis Herpetofauna di Pulau Halmahera. Cibinong: Puslit Biologi LIPI.Stejneger L. 1916. New generic name for a tree-toad from New Guinea. Proc Biol Soc. Wash. 29: 86.Tanabe AS. 2007. Kakusan: a computer program to automate the selection of a nucleotide substitution model and the
configuration of a mixed model on multilocus data. Mol Ecol Notes. 7: 962–964. doi: 10.1111/j.1471-8286.2007.01807.xTschudi JJv. 1838. Classification der Batrachier mit Berücksichtigung der Fossilen Thiere dieser Abtheilung der Reptilien. Neuchâtel:
Petitpierre.Tyler MJ. 1971. The phylogenetic significance of vocal sac structure in hylid frogs. University of Kansas Publications. Mus Nat Hist.
19: 319–360.Tyler MJ, Davies M. 1978. Species-groups within the Australopapuan Hylid frog Genus Litoria Tchudi. Aust. J. Zool. 63:1-47.Van der Kaars WA. 1991. Palinology of eastern Indonesian marine piston-cores: A late quaternary vegetational and climatic record
for Australasia. Palaeogeogr. 85: 239-302. doi: 10.1016/0031-0182(91)90163-L.Vences M, Vieites DR, Glaw F, Brinkmann H, Kosuch J, Veith M, Myer A. 2003. Multiple overseas dispersal in amphibians. Proc R Soc
Lond. 270: 2435-2442. doi: 10.1098/rspb.2003.2516. Vences M, Thomas M, Van der Meijden A, Chiari Y, Vieites D. 2005. Comparative performance of the 16S rRNA gene in DNA
barcoding of amphibians. Front Zool. 2(1):5. doi:10.1186/1742-9994-2-5.Vences M, Kohler J. 2008. Global diversity of amphibians (Amphibia) in freshwater. Hydrobiologia. 595:569-580. doi: 10.1007/978-
1-4020-8259-7_54.Voris HK. 2000. Maps of Pleistocene sea levels in Southeast Asia: shorelines, river systems and time durations. J Biogeogr. 27:
1153-1167. Wallace AR. 1876. The geographical distribution of animals, Vols 1 & 2. New York: Harper & Brothers.Werner F. 1898. Vorläufige Mittheilung über die von Herrn Prof. F. Dahl im Bismark-Archipel gesammelten Reptilien und Batrachier.
Zoologischer Anzeiger. 21: 552–556.Wiens JJ, Kuczynski CA, Hua X, Moen DS. 2010. An expanded phylogeny of treefrogs (Hylidae) based on nuclear and mitochondrial
sequence data. Mol Phylogenet Evol. 55: 871-882. doi:10.1016/j.ympev.2010.03.013.Yokoyama Y, Purcell A, Lambeck K, Johnston P. 2001. Shore-line reconstruction around Australia during the Last Glacial Maximum
and Late Glacial Stage. Quat Int. 83-85: 9-18.
23
Daftar Pustaka