Post on 08-Jun-2020
transcript
i
ANALYSIS OF THE ANTIBIOTIC ACTIVITIES OF SALINISPORA STRAINS FROM MARINE SEDIMENT
AS A GUIDE TO NEW PHYLOGENETIC AND CHEMICAL DIVERSITY
by
Joape G. M. GINIGINI
A thesis submitted in partial fulfilment of the requirement for the degree of
Master of Science in Biology
Copyright © 2012 by Joape Ginigini
School of Biological and Chemical Sciences
Faculty of Science, Technology and Environment
The University of the South Pacific
April, 2012
i
Declaration of Originality
Statement by Author
I, Joape Ginigini, hereby declare that this thesis is my own work and that, to the best
of my knowledge, it contains no material previously published, or substantially
overlapping with the material submitted for the award of any other degree at any
institute, except where due acknowledgment is made in the text.
ii
Dedication
To my beloved parents for their sacrifice and to my lovely wife Laniana
and
my son Tu Ma for their love and support
iii
Acknowledgement
I would like to acknowledge all who have assisted me directly or indirectly in my
research. I would like to thank my supervisor Prof. William Aalbersberg, the Director
of Institute of Applied Sciences (IAS), for his guidance throughout this project, not to
mention his sound advice, words of encouragement and especially for his patience
and understanding. I am also grateful to Dr. Paul Jenson (research microbiologist at
Scripps Institute of Oceanography and my co-supervisor) who was instrumental in
the study design and also for giving me such an interesting and very much enjoyable
project to work on. I am also indebted to Miss Kelle Freel (Graduate Assistant at
Scripps) for her invaluable assistance and advice throughout my project especially
the sequencing aspect of the project. It has been an honor and a privilege to learn
from such revered and devoted scientists as such.
Many thanks to Prof. Peter Lockhart (molecular biologist at Massey University) for
his assistance in the phylogenetic analysis of my 16S rRNA sequences in particular
the editing portion of the analysis.
I am grateful to Mr. Klaus Feussner, the Assistant Project Manager for the Centre for
Drug Discovery and Conservation and Mr. Rohitesh Kumar for initially collecting
my sediment samples. Additionally, I would like to thank Miss Kavita R. Latchman
and Mr. Girish Lakhan for showing me the ropes during the initial stages of the
project. Special thanks to Dr. Ramesh Subramani for his assistance in the analyses of
data and Mr. Danwei Huang for his assistance in freighting. Furthermore, I would
like to extend my appreciation to the IAS drug discovery team at large for their
support and cooperation.
Special thanks are due to the Biology and Chemistry technical staff at the School of
Biological and Chemical Sciences at the Faculty of Science, Technology and
Engineering, for their kind assistance in supplying me with the necessary reagents
and TLC plates when there were shortages in the lab.
iv
To my parents may they rest in peace, I thank them for making me the person I am
now. I would not have been able to complete my studies without the support and
encouragement of my families here and abroad. Last but not the least; I thank Jehova
for showing me the road less travelled and leading me in the right path.
Vinaka
v
ABSTRACT
The Salinispora genus previously reported as the first obligate marine actinomycete
was recently identified at the species level by the characteristic secondary
metabolites they produce (chemotype). A small percentage of strains within the
species level of the genus showed new sequence types which are typically reflected
in the production of added secondary metabolites. A classical chemical profiling
technique known as TLC-Bioautography was employed to facilitate both species
recognition as well as the presence of unique metabolites present within a species
level. This allows a metabolite grouping of unknown strains to known standards.
Results from this approach were compared to genetic analysis using 16S rRNA
sequencing to reveal species diversity and thus possible metabolite diversity of the
isolated strains.
Sediment samples collected from the Pacific Ocean in the Fiji archipelago were
plated on isolation media and the resulting bacterial colonies were cultured under
conditions favourable for actinomycete growth. Samples fitting the Salinispora
morphotype were (based on appearance and their obligate growth behaviour towards
0.45um filtered 100% seawater media) isolated and purified. These suspected
Salinispora strains (100 in number) were fermented and the crude cultures screened
against resistant pathogenic bacteria and fungi. Screening results assisted in
identification of new strain secondary metabolite profiles as compared to the known
Salinispora standards.
Of the 100 strains for the project, 29 showed unusual profiles on TLC-bioautography.
Sequencing of these 29 strains showed 26 (89.7%) with 99-100% homology with S.
arenicola while 2 (6.9%) strains showed 99-100% homology to S. pacifica.
Furthermore, 2 (6.9%) strains appeared to be new sequence types for S. pacifica
according to 16S rRNA sequence results matching (100%) maximum identity to
sponge-isolated Salinispora strains deposited in The National Center for
Biotechnology Information (NCBI) GenBank designated with YPKC collection ID.
These results are contrary to present knowledge of the S. pacifica species
pharmacology.
vi
Despite this exhaustive effort, no new species level diversity was uncovered but only
sub-species level diversity. The cosmopolitan distribution of rifamycin producing S.
arenicola was again established in the study. A further 3% of the 26 strains identified
as S. arenicola possessed an unusual activity profile active only in Wild Type
Staphylococcus Aureus (WTSA) and Methicillin Resistant Staphylococcus Aureus
(MRSA) but not in Vancomycin Resistant Enterococcus Faecium (VREF).
Metabolite profiling through normal phase N-TLC of the 29 Salinispora strains to
group them into similar chemotypes revealed the existence of 4 N-TLC patterns
within the genus level. Group 1 was predominant as 38% of these were strains
exhibiting similar separation patterns to CNS205 (S. arenicola standard) but with
new spots at Rf <0.8 as well as rifampin spots (rifamycin derivative). The smallest,
group 3 strains (10%) showed spots at Rf = 0.8-0.9 including the rifampin spot.
Similarly, group 4 strains showed spots at Rf >0.9 in addition to the rifampin
standard. However, group 2 (28%) strains produced UV active spots at Rf = 0.3-0.4
plus rifampin standard. Interestingly, strain 652 was classified into group 2 and 1424
was classed as group 3 despite their common genetic homogeneity. Further 16S
rRNA analysis showed substitution patterns consistent with the known species from
the NCBI database and interestingly appeared to be correlated with secondary
metabolite production.
A closer look at the strain sequences, cytotoxicity and antibacterial results showed
the existance of new S. pacifica sequence type strains in the study collection. The
extensive hits recorded in the cytotoxicity tests and the apparent lack of antibacterial
activity was a clear indicator of this pattern. In addition, the identification of two
strains from DNA analysis which match S. pacifica but have S. tropica like activity
are convincing evidence of this new sub-species. Surprisingly, an overall view of all
the antimicrobial and cytotoxic activities of these hundred strains studied reveals that
there are more (8) of these new S. pacifica strains in collection. A DNA analysis of
these strains would produce reliable data on the taxon catergory of these strains. The
results reveal new insight into the intra-species diversity of Salinispora especially
within the Fiji region.
vii
ABBREVIATION °C Degrees Celsius 16S 16 Svedberg 2D Two dimensional A1B Seawater based broth consisting of Starch, Yeast, Peptone ASW Artificial seawater ATCC American type culture collection ATCA Amphotericin resistant Candida albicans BLAST Basic local alignment search tool bp Base pair C18 Carbon 18 CFU Colony forming units CH3Cl Chloroform cm Centimeter CNB440 Pure isolate of S. tropica CNR114 Pure isolate of S. pacifica CNS205 Pure isolate of S. arenicola D/W DIW
Distilled water Deionized distilled water
DCM Dichloromethane DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid dNTP Deoxyribonucleotide phosphate EDTA Ethylene diamine tetra acetic acid
viii
EtOAc Ethyl acetate EtOH
Ethanol
FC27 Forward primers (universal for gram +ve bacteria) FSW
(100% 0.45μm) filtered seawater
g Gram G + C Guanine and cytosine gyr Gyrase H2O Water hr Hour IAS Institute of Applied Science Kb Kilobase KOH Potassium Hydroxide KS Ketosynthase LBA Lima bean agar LGT Lateral gene transfer lym Lymphostin M1A Agar media formulation of starch, peptone and yeast. MAR Marinispora mg Milligrams MIC Minimum Inhibitory Concentration min Minutes mL Milliliter mm Millimeter mM Millimolar MRSA Methicillin resistant Staphylococcus aureus
ix
NA Nutrient agar NaCl Sodium Chloride NCBI National Centre for Biotechnology Information NJ Neighbor joining NF-κB Nuclear factor kappa light chain enhancer of activated B cells NMR N-TLC
Nuclear Magnetic Resonance Normal phase TLC
ODC Ornithine decarboxylase OTU Operational taxonomic unit PC Paper chromatography PAUP Phylogeny analysis using parsimony PCR Polymerase chain reaction PDA Potato dextrose agar pH Measure of hydrogen ion concentration in a solution RC1492 Reverse primers (universal for gram +ve bacteria) RF Retention factors RP Reverse phase rpm Revolutions per minute rRNA Ribosomal ribonucleic acid sal Salinisporamide SDS Sodium dodecyl sulfate sec Seconds SIO Scripps Institute of Oceanography slm Salinilactam spo Sporolide
x
SSU rRNA Sub-unit ribosomal ribonucleic acid SYP Starch, yeast and peptone TAE Tris- acetate- EDTA TAQ Thermus aquaticus polymerase TFA Trifluoroacetic acid TLC Thin Layer Chromatography Tris Tris (hydroxymethyl)aminomethane TSB Tryptic soy broth TTC 2, 3, 5-triphenyltetrazolium chloride UV Ultraviolet VREF Vancomycin resistant Enterococcus faecium WTCA Wild type Candida albicans WTSA Wild type Staphylococcus aureus µg Micrograms µL Microliter UCSD University of California San Diego UPGMA Unweighted pair group method with arithmetic mean
xi
Table of Contents Declaration of Originality ......................................................................................................... i
Dedication ........................................................................................................................................ ii
Acknowledgement ..................................................................................................................... iii
ABSTRACT ........................................................................................................................................ v
ABBREVIATION .......................................................................................................................... vii
Chapter 1 Introduction and Literature Review ......................................................... 1
1.0 Introduction ........................................................................................................................ 1
1.1 Literature Review ............................................................................................................. 3
1.1.2 Marine Natural Products Discovery .................................................................. 3
1.2 Actinomycete History...................................................................................................... 4
1.2.1 The Marine Actinomycetes ................................................................................... 5
1.2.2 Actinomycete Diversity .......................................................................................... 6
1.2.3 Associations between Sponges and Actinomycetes.................................... 7
1.2.4 Actinomycete Secondary Metabolites .............................................................. 8
1.3 Discovery of Novel Actinomycetes.......................................................................... 11
1.3.1 Varied Culturing Effects on Actinomycete Diversity ............................... 13
1.4 Isolation and Characterization of Genus Salinispora ....................................... 16
1.4.1 Ecology and Distribution of Salinispora ...................................................... 16
1.4.2 Biogeography of the Salinispora ...................................................................... 16
1.4.3 Species-Specific Chemotype characteristics of the Salinispora ........... 18
Genus .......................................................................................................................... 18
1.4.4 Salinispora tropica ................................................................................................ 18
1.4.5 Salinispora arenicola and Salinispora pacifica ........................................... 22
1.5 Analytical Applications in Natural Products ....................................................... 24
1.5.1 Chemotyping through Thin Layer Chromatography (TLC) and
advent of 2D-TLC and High Performance Thin Layer Chromatography
(HPTLC).. ................................................................................................................................ 26
1.5.2 Co-chromatography.............................................................................................. 27
1.5.3 Bioautography ........................................................................................................ 28
xii
1.5.3.1 Contact Bioautography .................................................................................... 28
1.5.3.2 Agar-overlay Bioautography ......................................................................... 28
1.5.3.3 Direct Bioautography ....................................................................................... 29
1.6 Molecular Sequencing and Phylogenetic Analyses ........................................... 29
1.6.1 DNA-rRNA Hybridization and Oligonucleotide Cataloguing ................ 29
1.6.2 16S rRNA and Protein Subunits ....................................................................... 29
1.6.3 Phylogenetic Reconstruction from 16S rRNA Sequences ...................... 30
1.6.3.1 Parsimony Methods .......................................................................................... 31
1.6.3.2 Unweighted Pair Group Method with Arithmetic Mean (UPGMA)
................................................................................................................................................... 32
1.6.3.3 Neighbour Joining (NJ) Method.................................................................. 33
Chapter 2 Methods and Materials ........................................................................34
2.1 Sampling ............................................................................................................................ 34
2.2 Isolation and Purification ........................................................................................... 35
2.3 Culturing, Extraction and Screening ...................................................................... 36
2.3.1 Pathogenic Bacterial Assays.............................................................................. 37
2.3.2 Disc Diffusion Bioactivity Tests ....................................................................... 37
2.3.3 Brine Shrimp Assays (BSA) ............................................................................... 38
2.3.4 Thin Layer Chromatography and Sub-profiling ........................................ 39
2.3.5 Grams Positive Test and Seawater Requirement Tests .......................... 39
2.3.6 Solvent System Trials for Thin Layer Chromatography (TLC) ............ 40
2.3.7 Contact-bioautography Screening .................................................................. 41
2.3.8 Profiling through Exploratory TLC ................................................................. 41
2.3.9 Compound Representation from Standards ............................................... 42
2.4 DNA Extraction for Genomic DNA ........................................................................... 42
2.4.1 Gel Electrophoresis............................................................................................... 43
2.5 DNA Amplification and Phylogenetic Analysis of Isolates ............................. 43
2.5.1 Primer Preparation and Reagent Master Mix............................................. 43
2.5.2 16S rRNA Sequencing .......................................................................................... 44
2.5.3 Phylogenetic Analyses ......................................................................................... 45
Chapter 3 Results and Discussion ....................................................................................... 46
3.1 Isolation and Culture of Marine Actinomycetes Samples .............................. 46
3.2 Optimization of Mobile Phase and Diluents ........................................................ 46
xiii
3.3 Presumptive Identification of Non-standard Strains....................................... 48
3.3.1 Morphological Characterization of Marine ................................................. 48
3.3.2 Seawater Requirement and 3% Potassium Hydroxide (KOH) Tests…
................................................................................................................................................... 49
3.4 Bioactivity Screening of Ferment Extracts .......................................................... 49
3.4.1 Pathogenic Anti-bacterial and Anti-fungal Assays ................................... 49
3.4.2 Anticancer Screening through Brine Shrimp Assay (BSA) .................... 54
3.5 Chemotaxonomy via TLC- bioautography and Strain Identifications ....... 55
3.5.1 TLC Profiling via Co-chromatography ........................................................... 55
3.5.2 TLC Reproducibility.............................................................................................. 57
3.5.3 Bioautography and Identification of New Strains .................................... 60
3.5.4 Exploratory TLC ..................................................................................................... 62
3.5.5 Bioautography Positive Control ...................................................................... 63
3.6 Phylogenetic Diversity of the Salinispora Genera ............................................. 64
3.6.1 Sequencing Reports .............................................................................................. 64
3.6.2 16s rRNA Sequencing and Data Analyses .................................................... 64
3.6.3 Phylogenetic Analysis .......................................................................................... 64
3.6.4 Re-construction of Phylogenetic Trees ......................................................... 65
4.0 Sequencing Analyses of 16S rRNA Genome......................................................... 71
4.1 Effects of Horizontal Gene Transfer ....................................................................... 72
4.2 Phylogenetic Inference from Reconstruction Process .................................... 72
4.3 Conclusion ......................................................................................................................... 76
References ....................................................................................................................78
Appendices ...................................................................................................................93
Appendix 1 ................................................................................................................................. 93
Appendix 2 ................................................................................................................................. 94
Appendix 3 ................................................................................................................................. 94
Appendix 4 ................................................................................................................................. 97
Appendix 5 ...............................................................................................................................109
Appendix 6 ...............................................................................................................................110
Appendix 7 ...............................................................................................................................111
Appendix 8 ...............................................................................................................................112
Appendix 9 ...............................................................................................................................112
xiv
Appendix 10 ............................................................................................................................116
Appendix 11 ............................................................................................................................120
Appendix 12 ............................................................................................................................121
List of Figures
Figure 1. Relative composition of actinomycete in sponges ........................................ 7
Figure 2. The radial tree depicting the phylogenetic relationships of 13 groups
of marine-derived actinomycetes within six different families. ........... 13
Figure 3. Circular chromosome of S. tropica CNB-440, oriented to the dnaA
gene. ............................................................................................................................. 21
Figure 4. Basic TLC and HPTLC processes. ...................................................................... 27
Figure 5. Map of Fiji archipelago showing collection sites. ....................................... 35
Figure 6. TLC chromatogram of DMSO constituted under UV low λ...................... 48
Figure 7. Antibacterial disc diffusion test of Standard Salinispora and a sample
strain. ........................................................................................................................... 54
Figure 8. TLC chromatograms of strains spotted against standard Salinispora
chemotype under short λ UV254nm. .............................................................. 56
Figure 9. The marked TLC chromatograms before bioautography.. ...................... 56
Figure 10. Scatter plot showing the linear correlation between the standard
(CNS205) Rf values and an isolated strain (824) Rf. values.. .............. 60
Figure 11. Bioautograph of sample crude and the three standard Salinispora
chemotype run against MRSA culture. ......................................................... 61
Figure 12. Pie graph showing the Salinispora composition after screening and
profiling. ................................................................................................................... 62
Figure 13. TLC results of non-standard Salinispora strains against cluster group
from subprofiling of the 29 strains identified. .......................................... 63
Figure 14. a) Indel recoding of regions at the beginning of the sequences.
b) Missing base pairs which were miss called by the sequencing
machine. ................................................................................................................... 65
Figure 15. Maximum Parsimony tree................................................................................. 67
Figure 16. UPGMA tree for sequences generated with 16S rRNA sequences. ... 68
Figure 17. Neighbour Joining tree for most sequence generated from 16S rRNA
xv
sequences................................................................................................................ 69
Figure 18. The percentage of Salinispora composition in 80 sediment samples
collected from the Fijian ocean.. ..................................................................... 75
Figure 19. HPLC chromatogram of fermented extracts .............................................. 93
Figure 20. HPLC chromatogram of crude extracted from DMSO dissolved
samples ..................................................................................................................... 93
Figure 21. LC-MS spectral data of rifampicin (sigma) in positive ion mode....... 94
Figure 22. 16S rRNA sequences aligned from MUSCLE EBI ...................................... 97
Figure 23. Memorandom of understanding between collaborators from Geogia
Institute of Technology.................................................................................... 109
Figure 24. LD50 Calculation from logarithmic graph .................................................. 111
Figure 25. Schematic diagram of the experimental process ................................... 120
List of Tables
Table 1. Novel secondary metabolites from 2003-2005 .............................................. 9
Table 2. Actinomycete ecological diversity and species relationships ................. 15
Table 3. Strain collection data and growth medium utilised .................................... 37
Table 4. Table of master mix for PCR amplification ..................................................... 44
Table 5. Solvent System Trials for TLC on Normal Phase Si Plates. ....................... 47
Table 6. Anti-biotic and anti-fungal activities of non-standard samples ............. 51
Table 7. Standard Salinispora chemotype antibiotic test against pathogenic
bacteria ........................................................................................................................ 52
Table 8. Morphological Identification and characterization tests .......................... 53
Table 9. Correlation coefficients of isolated Salinispora and standard
Salinispora strains from TLC plate 1. ............................................................... 59
Table 10. Morphological data, BSA results, sampling locations and taxa
assignment. .............................................................................................................. 94
Table 11. Strain 1416 BSA results ..................................................................................... 110
Table 12. BSA results for calculation of LD50 ................................................................ 110
Table 13. Results from exploratory the TLC of the 29 strains ............................... 111
Table 14. TLC Rf results for 100 extracts and activities against MRSA and WTSA
bioautography assays………………………………………………………………..112
Table 15. Retention factors for the three Salinispora species and plate the
xvi
numbers.................................................................................................................. 116
Table 16. Correlation coefficient tables of the TLC Rf values for Salinispora
standard extracts vs sample extracts..........................................................122
1
Chapter 1 Introduction and Literature Review
1.0 Introduction Natural products remains a source of novel pharmaceutical agents often packaged in
small molecule units. The potential of the unprecedented structural diversity and
potent biological activity has been a driving force in their pharmaceutical application.
Recent de-emphasis due to re-isolation from terrestrial sources has caused a
“paradigm shift” from terrestrial exploration of natural products to the marine
environment. Although, a modest amount of work has been applied to echinoderms
and other marine motile organisms (Scheuer, 1995) the sessile sponge from the phyla
Porifera have been the center of natural products exploration due to their immense
array of growth forms and varied ecology; they are easily collected and capable of
facilitating new secondary metabolites in myriad classes. Sponges have been
observed to house high bacterial diversity (Gandhimathi et al., 2008; Fieseler et al.,
2006). Actinobacteria that produce bioactive secondary metabolites are common in
these communities, which include diverse, sponge-specific lineages (Hentschel et al.,
2002), including marine actinomycetes (Montalvo et al., 2005) and Salinispora-
related strains (Kim et al., 2005). This habitat is apart from their normal sediment
habitat from which they have also been isolated.
Numerous natural products research targeting bacterial secondary metabolites have
concentrated on the sediment isolation of actinomycetes due to their pharmaceutical
importance as a source of natural products with novel and diverse structural motifs
exhibiting sensitivity against pathogenic bacteria and fungi. In addition, the diversity
of activity of these secondary metabolites also includes cytotoxicity against a number
of cancer cell lines and pathogenic helminths. With the discovery of the first marine
obligate actinomycete in 1991, cultivation of actinomycetes has reached sediment
sampling depths of up to 1,100m (Mincer et al., 2005). The utilization of culture-
independent approaches such as semi-nested PCR and Restriction Fragment Length
Polymorphism (RFLP) analysis in addition to culture-based approaches has partially
eliminated actinomycete diversity at varied depths especially of the economically
important genus Salinispora. However, as observed by Mincer et al. (2005), the
2
exploration for spore occurring actinomycetes in the ocean and the application of
semi-nested PCR may still need to be fully exhausted before the true diversity of
marine actinomycetes is realized and therefore the discovery of new secondary
compounds of pharmaceutical importance.
The evolution of pathogenic bacteria and fungi to survive from stress induced by
antibiotic pressures has compounded the so called search for the “magic bullet” as
there is no clear remedy for some chronic bacterial infections. An example of which
is S. aureus, which has evolved resistance to the narrow spectrum β-lactam
methicillin in 1996 and therefore being termed as Methicillin Resistant
Staphylococcus Aureus. The consequence of these evolutionary changes has fuelled
the search for a suitable cure. Fortunately, the use of resistant strains in screening
tests has led to the isolation of Vancomycin from Amycolatopsis orientalis and
Noviobicin from Actinoplanes teichomyceticus which are active against MRSA.
Similarly, a multitude of compounds have been isolated such as Oxytetracycline
produced by Streptomyces rimosus, Demelocycline produced by Streptomyces
aureofaciens and the well-known Chloramphenicol from Streptomyces venezuelae. It
is quite noticeable that all these drugs are produced by actinomycetes; in fact 80% of
actinomycete natural product drugs are produced by the Streptomcyes genus alone.
Recent predictions by Watve et al. (2001) have shown that only 10% of the
secondary metabolite producing capacity for the Streptomyces genus has been
discovered. This evidence supports further secondary metabolite mining within the
actinobacteria phylum and more specifically in the Actinomycetales order which
contains some marine obligate genera of pharmaceutical importance of which
Streptomyces is the largest.
Polyphasic taxonomy is the utilization of phenotypic and genotypic data to identify
bacterial taxa up to the genus and species level. However, with the recent discovery
of the Salinispora genus, which is species-specific for secondary metabolite
production (Jensen et al., 2007), the incorporation of chemotype data has also been
possible through simple but efficient thin layer layer chromatography (TLC).
Moreover, molecular techniques are continuously developing from the application of
small ribosomal units such as that of 16S rRNA and 23S rRNA to genomic mining
using knowledge of the natural product biosynthetic systems responsible. These
3
highly variable but conserved regions can be utilized in concert with other
characterization information such as morphological data and chemotype data to
identify new bacterial genus and species diversity and resulting in new secondary
metabolite discovery. Using a combination of these afore mentioned techniques, the
the study design was proposed based on the hypothesis that;
1. Secondary metabolite synthesis is species specific for the genus Salinispora and
therefore new Salinispora diversity could be uncovered using the chemotype
specificity of the Salinispora genus under optimum TLC conditions and also against
pathogenic bacteria.
2. New secondary metabolites may tentatively be identified from the discovery of
new Salinispora diversity.
1.1 Literature Review A brief literature review of the project has been compiled from previous work on
natural products research with a special emphasis on actinomycete research and its
secondary metabolites.
1.1.1 Marine Natural Products Discovery Success in discovering new antibiotics from microbial natural products requires
having a microorganism grown in conditions appropriate to induce the production of
the desired metabolite, which is then extracted and tested in a screen able to detect
this as a “hit”. One of the major questions to address in any discovery effort of new
natural antibiotics is which group of organisms should be selected to improve the
probability of success. The search for natural products has been littered with
numerous rediscoveries of previously isolated compounds, which wastes resources.
As the need for more extensive studies of these organisms increased, processes
involved in the discovery of natural products have required more refining from
fermentation and extraction to screening leading to hit and lead processes. This is
because of subsequent losses that occurred during isolation through heat shock and
chemical degradation which are pre-treatments and the production of low
fermentation titers of the desired secondary metabolite. Therefore non-conventional
sources of natural products discovery were approached such as the use of
environmental DNA as a source of genes involved in secondary metabolite
4
biosynthesis (Pelaez, 2006). The idea was to isolate DNA from soil or other
environments, followed by the generation of genomic libraries using large DNA
fragments cloned in Escherichia coli (E. coli) or Streptomyces species. Unfortunately
there were no significant leads generated for antibiotic development.
A shift from conventional terrestrial exploration of natural products to the marine
environment was necessary due to the occurrence of “rediscoveries” from terrestrial
originating natural products. As 70% of the earth’s surface is covered in water, the
undoubted wealth of organic matter it holds was a point that the scientific community
focused on as evidence for the existence of new natural products (Mincer et al.,
2002). The new strategy not only provided a way to reduce risks of rediscovery but
also opened up a new source of natural product structural diversity and secondary
metabolites isolated from myriad sources such as sponges, algae, sediment,
vertebrates and invertebrates. Of the 53 known bacterial phyla, only five have been
found to produce anti-infective agents (Jensen et al., 2005). From this five, the Class
Actinobacteria and Order Actinomycetales account for approximately 7000
compounds reported in the dictionary of natural products. This phenomenon is
unrivalled in the microbial world.
1.2 Actinomycete History
Evidence shows that only a small portion of species or genetically distinct strains of
actinomycetes and fungi isolated from the environment have been grown in culture
(Pelaez, 2006). Due to their filamentous aspect, actinomycetes were thought to be
fungi, explaining the origin of the name actinomycetes, which in Greek means
“radiant fungi”. Actinomycetes used to form a group on their own between the
bacteria and the fungi but in the 1950s, after investigation of their chemical
composition and fine structure, they were confirmed as prokaryotes and joined the
bacterial domain. Actinomycetes belong to the class Actinobacteria (Stackebrandt et
al., 1997), order Actinomycetales, which includes 10 suborders and 30 families. The
relatively recent Actinobacteria class was proposed based on the 16S rDNA analysis
of hundreds of actinomycete sequences.
Mathematical models suggest that the number of antibiotics still to be discovered
from actinomycetes could well be above 105 (Watve et al., 2001). Actinomycete
5
bacteria contain DNA high in guanine and cytosine. They are gram-positive bacteria
and are unicellular, generally filamentous micro-organisms that branch
monopodially, more rarely dichotomously. Originally thought to be a terrestrial
inhabitant, recent studies have proven this to be untrue as there are also marine
species. They are saprophytic and are known to contribute to the turnover of
biopolymers like lignocellulose and pectin (Mincer et al., 2002).
1.2.1 The Marine Actinomycetes Due to their over exploitation as antibiotic resources, soil derived actinomycete
extracts produced a large number of previously described metabolites which rendered
any further work on soil actinomycetes to be non productive (Lam, 2006; Williams et
al., 2005; Mincer et al., 2005). This has seen the focus of natural products research
shift from terrestrial to the marine environment in order to culture novel
actinomycete taxa. The search for actinomycetes in the marine environment was
originally based on speculation that actinomycetes isolated from the sea were
primarily washed out from land. There was also scepticism as to the existence of any
indigenous marine actinomycetes. It was finally revealed by Mincer et al. (2005) that
some actinomycete genera such as that of the Salinispora strains are metabolically
active in the marine environment. Grossart et al. (2004) illustrated that actinomycetes
account for 10% of the bacteria colonizing marine organic aggregates and that their
activity might have some affect on the mineralization of organic matter (Grossart et
al., 2004; in Lam, 2006). This evidence showed that actinomycetes are indeed
capable of forming stable, persistent populations in various marine ecosystems. In
addition, other actinomycete genera such as Dietzia, Rhodococcus, Marinophilus,
Solwaraspora, Salinibacterium, Aeromicrobium and Verrucosispora have been found
to exist in ocean sediments (Lam, 2006).
Even now, the distribution patterns of actinomycetes in the sea remain largely
undescribed due to the vast area that is yet to be sampled. There is also the unknown
genetic and metabolic diversity of actinomycetes, which may be attributed to the
different physiochemical parameters present in the marine environment as compared
to the terrestrial environment. The discovery of marine actinomycetes has led to
numerous investigations of their secondary metabolites and the subsequent discovery
6
of novel anticancer compounds such as Salinisporamide A and other compounds of
pharmaceutical importance.
1.2.2 Actinomycete Diversity Actinomycetes have been found almost everywhere in the ocean from deep sea floor
to coral reef, from sediments to vertebrates and plants. Marine actinomycetes were
isolated from samples collected at the deepest abyss, the Challenger Deep off the
Marianas at the depth of 10,923 meters (Bull et al., 2005). Recent studies have also
shown their presence in deep-sea gas hydrate reservoirs, where they were found to be
the major components of the microbial communities. Closer to Fiji, novel
actinomycete groups have been discovered in the Great Barrier Reef sponges
Rhopaloeides odorabile, Pseudoceratina clavata and Candida flabellate as reported
by Kim et al., 2005 showing the cosmopolitan distribution (Jensen et al., 2005) of the
bacteria.
Of a more economical and health importance, the genus Mycobacterium is a common
genus of the phylum actinobacteria being given its own family Mycobacteriaceae. It
has been identified as the causative agent of a number of mammalian diseases such
as tuberculosis (M. bovis in ruminants and M. tuberculosis in humans) and leprosy
(M. leprae). Actinomycetes belonging to the suborder Propionibactericeae, which
includes the genus Nocardioides have been identified as common intestinal
inhabitants and are used in cheese manufacture (Cerning, 1995).
Given that the Streptomyces coelicolor genome sequence revealed 18 biosynthetic
clusters in addition to those specifying the biosynthesis of previously analyzed
metabolites (Bently et al., 2002 in Jensen et al., 2005), the metabolite producing
capacity of this well-studied genus appears to be far from exhausted. It has not
escaped the notice of numerous researchers such as Lam (2006) that most of the
unique compounds produced by actinomycetes may possibly be survival mechanisms
against predation and environmental degradation in either sediment or on
invertebrate substrate that they choose to colonize. In addition, intra and interspecies
competition pressures may also be a contributing factor to their varied distribution
patterns and genetic diversity.
7
1.2.3 Associations between Sponges and Actinomycetes Numerous studies have elaborated on the contribution of bacteria to sponge biomass,
which may be equivalent to 108-109 bacteria/g of tissue (Friedrich et al., 2001;
Thoms et al., 2003 in Gandhimathi et al., 2008). Research by Gandhimathi et al.
(2008) revealed the extent of bacterial colonization of marine sponges and
specifically concentrated on actinomycete composition in sponges. As observed from
Figure 1, the sponge Callyspongia diffusa (CD) had the highest density of
actinomycetes at 38.46% followed by Spongia offiscinalis (SO) at 23.08%. The other
three sponges Fasciospongia cavernosa (FC), Spirastrella inconstans (SI) and
Tedania anhelans (TA) were found to be colonized moderately as compared to the
former which can be attributed to differences in biosynthetic capacities of the
sponges and their dependency on symbiotic microorganisms (Gandhimathi et al.,
2008).
Figure 1. Relative composition of actinomycete in sponges
[Adapted from Gandhimathi et al., 2008]
Actinomycetes have a vast growth distribution. In the marine environment, they are
often found among culturable sponge microbes. Members of genera such as
Streptomyces (Imamura et al., 1993; Lee et al., 1998), Saccharopolyspora (Liu et al.,
2005), Gordonia (Montalvo et al., 2005), Micrococcus (Montalvo et al., 2005),
Bradybacterium (Montalvo et al., 2005) and Salinispora (Kim et al., 2005) have
been isolated from sponges. The colonies that are easily grown on plates usually
CD38%
SI8%
SO23%
FC19%
TA12%
TA
FC
SO
CD
SI
8
represent less than 1% of all microbial cells present in the sample in normal
community based studies therefore new techniques were invented to circumvent
these complications. Studies by Mincer et al. (2005) have shown the isolation of
previously unrecognized species by utilizing carbon data level and other nutrients
present in a specific environment from where the samples are collected.
The advancement of DNA and molecular techniques in the last decade has seen the
emergence of finer and more resolved sequencing tools in the biotechnology field
such as rRNA and protein analysis. The different 16S rRNA gene sequence analyses
of sponge associated microbial communities have demonstrated that sponges are a
good source for actinomycetes both in abundance and diversity. At the same time,
their use has overcome limitations found in community based studies. These sponge-
derived actinomycetes could possibly be a source for new bioactive compounds. The
role of sponge-associated actinomycetes remains unclear. It is possible that by their
saprophytic1 nature they are involved in the processing of metabolic waste. Bacterial
symbionts are believed to provide their host sponge with a range of benefits: nutrient
acquirement, stabilization of the sponge skeleton, processing of metabolic waste
(Wilkinson, 1978), protection from UV light (Shick and Dunlap, 2002) and chemical
defense (Schmidt et al., 2000). However, the association of pigmentation to the
resistance of solar radiation has not been proven.
1.2.4 Actinomycete Secondary Metabolites Actinomycetes are the most prolific microorganisms for the production of antibiotics
accounting for approximately two-thirds of the world’s naturally occurring
antibiotics by the 1980s. Recent advances in marine natural products research have
lately been centred on the marine actinomycete bacteria as two thirds of polyketide
biosynthesized antibiotics used today are from this group of bacteria alone (Udwary,
et al., 2007; Zhang et al., 2008). Numerous secondary metabolites have been
discovered from marine actinomycetes in recent years. Secondary metabolites are the
compounds that an organism produces which provide an advantage in
communication, defence or mating. They are not absolutely necessary for survival,
and in this sense they are secondary. Secondary metabolites are further classified by
their chemical structure or biosynthetic mechanism. A few of the classes of 1 Obtaining food by absorbing dissolved organic material
9
secondary metabolites are terpenes, polyketides, phenols, iridoids, and steroids.
Table 1 shows some novel secondary metabolites that have been isolated from 2003
to 2005. As observed from the table, a majority have anticancer and antibacterial
activities.
Table 1. Novel secondary metabolites from 2003-2005 [Adapted from Lam, 2006]
Novel Metabolites produced by marine actinomycetes during the period 2003-2005 Compound Source Activity Salinisporamide A Salinispora tropica Anticancer Sporolides Salinispora tropica Unknown biological activity Marinomycins Marinospora Antibacterial, anticancer Abyssomicins Verrucosispora spp Antibacterial Trioxacarcins Streptomyces spp Antibacterial, anticancer & antimalarial Bonactin Streptomyces spp Antibacterial, antifungal
Continued research into the chemistry of marine actinomycetes has produced a new
wealth of antibiotics with a few currently undergoing clinical trials. An example is
Salinisporamide A, which is a novel β-lactone-γ-lactam isolated from the
fermentation broth of the obligate marine actinomycete Salinispora tropica.
Salinisporamide A is in phase 1 of clinical trials at Nereus Pharmaceuticals for
treatment of cancer. It is an orally active proteosome2 inhibitor that induces
apoptosis in multiple myeloma cells (Lam, 2006; Williams et al., 2005 & Jensen et
al., 2005) with mechanisms distinct from any other commercial proteosome inhibitor
anticancer and mantle cell lymphoma drug such as Bortezomib (also known as
Velcade) (Lam, 2006).
Marmycins A and B are cytotoxic pentacyclic C-Glycosides from a marine sediment
derived actinomycete related to the genus Streptomyces. Initial testing showed
Marmycin A having significant activity against several cancer cell lines even at
nanomolar concentrations (Martin et al., 2007). Discovery of platensimycin, a
previously unknown class of antibiotics produced by Streptomyces platensis
demonstrated strong, broad-spectrum gram-positive antibacterial activity by
selectively inhibiting cellular lipid biosynthesis. It exhibited minimum inhibitory
concentration (MIC) values of 0.5 and 1 g ml-1 against Staphylococcus aureus and
Staphylococcus pneumoniae, respectively (Wang et al., 2006). By chemical
2 Large protein complexes involved in degrading unwanted or damaged proteins
10
metabolite profiling a trace metabolite was identified from a large-scale fermentation
of Streptomyces lavendulae as a novel aromatic polyketide and its structure was
solved by 2D NMR spectroscopy. The new compound, benzopyrenomycin [1], is the
first natural product with a carbocyclic benzo[a]pyrene ring system to be discovered
and demonstrated significant activity against various tumor cell lines (Huang et al.,
2008).
MeOOC CH3
OCH3
O
OH
[1]
O
NH2
CH3OH
CH3
H
R O
O
CH3
[2] A, R = H [3] B, R = Cl
The MAR 2 genus, also called Marinispora, has been found to produce four
antitumor-antibiotics of a new structure class, the marinomycins A [2] and B [3]
(Kwon et al., 2006). The structures of the marinomycins, which are unusual
macrodiolides, are composed of dimeric 2-hydroxy-6-alkenyl-benzoic acid lactones
with conjugated tetraene-pentahydroxy polyketide chains. Marinomycins A and B
show significant antimicrobial activities against drug resistant bacterial pathogens
and demonstrate selective cancer cell cytotoxicities against six of the eight melanoma
cell lines in the National Cancer Institute's 60 cell line panel (Kwon et al., 2006).
Abyssomicin C [4] (Nicolaou and Harrison, 2006) is a novel polycyclic polyketide
antibiotic produced by the marine actinomycete Verrucosispora. It has been reported
11
to be active against gram-positive bacteria including clinical isolates of multiple-
resistant and Vancomycin-resistant Staphylococcus aureus (Riedlinger et al., 2004).
O
O
OHOH
O
O
O
OH
CH3
[4]
1.3 Discovery of Novel Actinomycetes The use of high nutrient media may have explained why most gram-positive bacteria
remained uncultured until recent modifications to culturing techniques and isolation
strategies were adopted. This involved the use of low nutrient media with seawater or
sodium based solvents. These changes assisted in the recovery of a diverse range of
microorganisms in addition to avoiding any contamination (Gontang et al., 2007).
Culture-dependent and culture-independent studies have shown similar levels of
species diversity for some micro-organisms, an example of which is Salinispora. A
study by Mincer et al. (2005) has shown that searching for a particular taxon can be
highly successful if both cultivation techniques are utilized.
The discovery of the first obligate marine actinomycete genus Salinispora was
reported in 1991 by researchers from the Scripps Institute of Oceanography (SIO)
although the new marine taxa was not fully recognized as a new genera until 2005
when DNA sequence based methods were used to understand their evolutionary
relationships (Fenical et al., 2006). Using phylogenetic analyses, the Scripps research
group classified 15 groups from over six actinomycete families designated as MAR
groups with Salinispora being MAR 1. Salinispora species have a tough leathery
texture, dry or folded appearance and branching filamentous, with or without aerial
mycelia (Mincer et al., 2002) and are orange to pale brown in colour.
12
Further studies recently led to the isolation of another taxon namely the Marinispora
genus from marine sediments. By utilizing seawater requirement tests and small sub-
unit ribosomal ribonucleic acid (SSU rRNA) gene sequences as guides to
chemotaxonomic and genetic relationships, the new marine taxon was given a
provisional name. Previously designated as MAR 2, the genus showed considerable
phylogenetic diversity, which suggested the presence of many species. As observed
with the Salinispora species, novel secondary metabolites were discovered such as
Marinomycin A [5] (Fenical and Jensen, 2006).
CH3 OH
CH3
O H H OH H OH
CH3
OH
H OHOHOH HHOHOO
OH
CH3 CH3 [5]
Through chemical analysis, new hybrids of polyketide-terpenoid origin compounds
were discovered. Up until 2006, 13 strains belonging to the new taxa were isolated
with all of them producing polyketide-terpenoid secondary metabolites (Fenical,
2006). A recent publication by kwon et al. (2009) has revealed a further isolation of 7
more strains. Formalization of the taxa is currently in progress. The taxonomic
position of the other MAR groups is still unclear at the present time but according to
Fenical and Jensen (2009), numerous new species may be present in these
unformulated groups as observed from Figure 1.2.
13
Figure 2. The radial tree depicting the phylogenetic relationships of 13 groups of marine-
derived actinomycetes within six different families. These strains include the new genus
Salinispora as well as the MAR2 group, for which a formal taxonomic description as the genus
Marinispora has been proposed. [Adapted from Fenical et al., 2006]
1.3.1. Varied Culturing Effects on Actinomycete Diversity Actinomycetes’ ecological role has been mostly ignored and various rediscoveries
and assumptions have created a lack of confidence in further investments in the
isolation of strains for the search and the discovery of new drugs (Bora and Ward,
2006). The low species diversity especially for certain novel actinomycetes such as
Salinispora suggests that the full extent of most marine actinomycete diversity at
genus, species and even subspecies levels are yet to be fully realized (Table 2).
Surveys based on cultivation schemes as previously mentioned have revealed the
relative abundance of a number of actinomycetes such as Salinispora and
Streptomyces, but cultivation-independent studies utilizing DNA and 16S rDNA
analysis have shown more detailed information of actinomycete diversity even
revealing new uncultivated intraspecies diversity within Salinispora arenicola and
Salinispora tropica phylotypes (Mincer et al., 2005).
14
Information gathered by recent reviews has shed light on the extent of actinomycete
discovery regardless of their terrestrial or marine ecosystem origin. Interestingly, the
Solwaraspora and Micromonospora genera have been isolated from Papua New
Guinea sediments, an indication of the biodiversity the Pacific Ocean holds for
potential actinomycete mining. In addition, depth sampling of up to 3800m also may
show an unexplored potential of current sampling efforts in the pacific to isolate
actinomycetes as observed from Table 2.
According to Stach et al. (2003) there are four mechanisms for the production of
non-competitive diversity profiles: (i) superabundant resources (ii) resource
heterogeneity (iii) spatial isolation and (iv) non-equilibrium conditions. It was
suggested that resource heterogeneity and non-equilibrium conditions were major
factors contributing to actinomycete diversity. These observations were made after it
was discovered that the diversity of actinomycete at the 5 to 12cm marine sediment
depth was non-competitive with high species diversity owing to resource
heterogeneity and non-equilibrium conditions (Stach et al., 2003; in Maldonado et
al., 2005). In other words, high species diversity may have been attributed to the
presence of a diverse resource base having a direct effect on inter and intra-species
competition for food and shelter, predation and reproduction for organisms. Non-
equilibrium conditions may support a diverse assemblage of microbes and limit
overpopulation of a single organism.
Numerous studies such as that of Tseung and Lam (2008); Oh et al. (2008) and
Williams et al. (2007) have utilized media formulations consisting of starch, yeast
and peptone (SYP) with minor changes in supplement ratios and sodium chloride
(NaCl) sources from artificial seawater (ASW) or from 100% seawater (SW). The
media formulations have proven to be suitable for selective enrichment of marine
derived actinobacteria especially the Salinispora genera.
15
Table 2. Actinomycete ecological diversity and species relationships
[Adapted from Ward and Bora, 2006].
Actinomycete genera Species affiliation Source and location
Actinomadura A. formosans, A. fulvescens Japan Trench, Canary Basin, fjord site. Sub-tropical sediment
Actinosynnema Actinosynnema sp. IM-1402 Deep sea sediment 3800 m Amycolatopsis Amycolatopsis sp. GY109 Deep sea sediment 3800 m Arthrobacter Arthrobacter sp. ‘‘SMCC G960’’,
A. agilis, A. nitroguajacolicus Deep sea sediment 3800 m
Blastococcus Blastococcus sp. BC412, sp.BC448 Deep sea sediment 3800 m Brachybacterium B. arcticum Barcelona neuston Corynebacterium C. ammonigenes, C. appendicis,
C. striatum, C. Ulcerans Deep sea sediment 3800 m
Dietzia D. maris Japan Trench, Canary Basin, fjord site. Deep sea sediment 3800 m. Barcelona neuston
Frankia Frankia sp. Deep sea sediment 3800 m Frigoribacterium Frigoribacterium sp. 301 Deep sea sediment 3800 m Geodermatophilus Geodermatophilus sp. BC509, IM-1092 Deep sea sediment 3800 m Gordonia Japan Trench, Canary Basin, fjord site.
Barcelona neuston Kineococcus-like Kineococcus-like AS2978 Deep sea sediment 3800 m Kitasatospora Kitasatospora sp. IM-6832 Deep sea sediment 3800 m Micrococcus M. luteus Barcelona neuston, Wadden Sea
aggregate Microbacterium M. kitamiense, M. esteraromaticum Japan Trench, Canary Basin, fjord site.
Barcelona neuston. Wadden Sea aggregate
Mycobacterium M. manitobense, STR-11, STR-21 Japan Trench, Canary Basin, fjord site. Deep sea sediment 3800 m
Nocardioides Nocardioides sp. V4.BO.15, N. jensenii Deep sea sediment 3800 m. Barcelona Neuston
Nocardiopsis N. dassonvillei Ovaries of Pufferfish, Bohai Sea of China Nonomurea Japan Trench, Canary Basin, fjord site Pseudonocardia P. alaniniphila, P. aurantiaca, P. alnii Deep sea sediment 3800 m Rhodococcus R. fascians, R. koreensis, R. opacus,
R. ruber, R. tsukamurensis, R. zo Deep sea sediment 3800 m, Pelagic clay
Saccharopolyspora Japan Trench, Canary Basin and fjord site Salinispora S. arenicola, S. Tropica Sub-tropical sediment Serinicoccus S. marinus Sea water East Sea, Korea ‘‘Solwaraspora’’ Sediment Papua New Guinea Streptomyces S. capensis, S. giseus (MAR4),
‘S. maritimus’, S. pallidus, S. somaliensis, S. thermocarboxydovorans
Deep sea sediment 3800 m
Streptosporangium Japan Trench, Canary Basin and fjord site Tsukamurella T. inchonensis Deep sea sediment 3800 m Turicella T. otitidis Deep sea sediment 3800 m Verrucosispora Verrucosispora sp. AB-18-032, IM-6907 Japan Trench, Canary Basin and fjord site
16
1.4 Isolation and Characterization of Genus Salinispora The first common appearance of the genus is its orange colour3, which fades to a pale
brown colour with age in NaCl containing media (Magarvey et al., 2004; Mincer et
al., 2002). In M1A media (40g starch, 4g yeast extract, 2g peptone, 18g agar and 1
liter of 0.45µm filtered natural seawater), colonies appear after 3-6 weeks with finely
branched vegetative hyphae and spores being produced singularly or in clusters.
Seawater requirement tests using M1A media (40g starch, 4g yeast extract, 2g
peptone, 18g agar and 1 liter of distilled water) and also the 3% KOH test were a few
of the preliminary tests subjected to the strains to investigate if they were consistent
with Salinispora biochemical features and proves to be an effective preliminary
characterization technique for marine actinomycetes (Gontang et al., 2007; Jensen
and Mafnas, 2006).
1.4.1 Ecology and Distribution of Salinispora Salinispora spp. have been cultivated from marine sediments collected around the
world including the Caribbean Sea, the Sea of Cortez, the Red Sea, and the tropical
Pacific Ocean off Guam (Jensen and Mafnas, 2006). In addition, strains have been
reported from the sponge Pseudoceratum clavata found on the Great Barrier Reef
(Kim et al., 2005) and interestingly from the ascidian Polysyncraton lithostrotum
found in Fiji (He et al., 2001). To date, no Salinispora strains have been recovered
from samples collected off San Diego or in the Bering Sea off the coast of Alaska
suggesting latitudinal distribution barriers as observed by Jensen et al. (2005) even
though cultivation studies have shed light on their relative abundance of up to 104
CFU/mL in sediment (Mincer et al., 2005). While more then 2000 strains fitting the
Salinispora morphology have been isolated and cultured to date, only three species
have been identified so far, which are S. arenicola, S. tropica and S. pacifica.
1.4.2 Biogeography of the Salinispora
Little emphasis has been given to the study of bacterial biogeography (Cho and
Tiedje, 2000; in Jensen et al., 2006) thus it is not clear as to the existence of a
particular bacterium in an analogous environment on a global scale. In addition,
Staley and Gosink (1999) have given three reasons for the importance of bacterial
3 Log phase of Salinispora genera optimum for culture and DNA analysis.
17
biogeography: determination of how many bacterial species exist, species
preservation and the identification of ecological roles through knowledge of bacterial
distribution. Updated work has proposed the use of molecular sequencing data as a
tool for describing genetic units or protein structures otherwise known as natural
units of bacteria in assisting bio-geographical characterization of bacteria (Cohan,
2002; in Jensen et al., 2006). Recent studies by Jensen and Mafnas (2006) revealed
the use of 16S rRNA and gyrB4 gene sequences as an effective approach to prove that
Salinispora speciation was caused by ecological selection and not by geographical
isolation bearing in mind of the almost cosmopolitan patchy distribution of the
genera.
Salinispora strains have been cultivated from six of the tropical and subtropical
locations sampled so far. Using the detailed sequencing tools of 16S rRNA and gyrB
genes, the existence of the three species was established. Although they have close
sequence similarities e.g. a comparison (through Basic Local Alignment Search Tool
(BLAST) bi2seq, the National Centre for Biotechnology Information (NCBI))
showed that S. tropica and S. arenicola share a 99.53% 16S rRNA (Jensen and
Mafnas, 2006) gene sequence identity, the three species also differ in their
distribution.
Salinispora arenicola was found to have a cosmopolitan distribution having been
recovered from all six of the locations sampled namely; Caribbean Sea, the Sea of
Cortez, the US Virgin Islands, the Red Sea, the tropical Pacific Ocean off Guam and
Palau (Jensen and Mafnas, 2006). Salinispora tropica by far is the most restricted in
distribution compared to the other two species. Up until 2006, it has only been
detected from the Bahamas where it was monitored for a 15 year period. Salinispora
pacifica, on the other hand, has been discovered from Guam, Palau and the Red Sea
with a recent sample strain from Fiji (He et al., 2001) sharing an identical 16S rRNA
sequence.
4 DNA gyrase subunit B- a type II topoisomerase found in bacteria that is capable of introducing negative supercoils into a relaxed closed circular DNA molecule. Used as a gene marker.
18
1.4.3 Species-Specific Chemotype characteristics of the Salinispora
Genus
A distinctive characteristic that occurs commonly in the genus is the ability to
produce secondary compounds that are unique to each of the three phylotypes found
to date. This has allowed correlations between phylotypes and chemotypes to be
achieved. The species specificity of the metabolites was revealed by Jensen et al.
(2007) i.e. each of the three Salinispora species produced unique signature
compounds, which were not produced by any other within the genera. In addition,
further genomic evidence was found to show no overlapping of secondary metabolite
production. These unique compounds have been described by Jensen et al. (2007) as
accessory compounds produced by a few strains from each of the three species. Their
ecological significance has yet to be studied extensively. This has contradicted an
earlier systematics paradigm, which had insisted on different strains from the same
species producing different compounds. Interestingly, only S. pacifica has been
observed to have produced further compounds up to the subspecies level which show
the complexity and extent of biosynthetic pathways that have yet to be fully
explored. Noting their relationship with sponges, one wonders as to the origins of the
Salinispora biosynthetic pathways and whether it is inherited vertically from a
common ancestor or laterally from unrelated organisms.
1.4.4 Salinispora tropica
Salinispora tropica has been proven to hold a number of bioactive metabolites
although it is rarely cultured compared to the other two species. A possible reason for
this may be due to its restricted distribution mostly around the Bahamas particularly
in course sand (Maldonado et al., 2005). Although the species appear to be similar in
morphology to the other two in the genus Salinispora, it differs in its optimum
growth conditions of 15 –28 C temperature and use of (+)-D- galactose and inulin as
sources of carbon for energy and growth compared to S. arenicola which utilizes
carbon sources (Arbutin, L-proline, (+)-D-salicin, L-threonine and L-tyrosine) for
growth and energy requirements.
19
(i) Secondary Metabolites
Analysis of the culture broth of S. tropica strain CNB-392 by Williams et al. (2005)
led to the isolation of the β-lactone-γ-lactam Salinisporamide A including seven new
γ-lactam secondary metabolites with Salinisporamide A [6] being the most prominent
followed by Salinisporamide B [7]. Salinisporamide A has been the subject of
numerous studies recently due to its ability to inhibit the proteolytic activity of the
20S subunit of the proteosome without affecting any other protease activity. As
mentioned earlier, it has been advanced to phase I clinical trials after it showed a
higher cytotoxicity to the human colon carcinoma cell line HCT-116 compared to the
other metabolites found so far from S. tropica fermentation broth. In addition to its
present biosynthetic capabilities, novel secondary metabolites were produced by S.
tropica when Reed et al. (2007) replaced synthetic sea salt with sodium bromide in
the fermentation media for S. tropica and consequently produced
bromosalinosporamide [8] and salinosporamide H [9].
O
N
(S)
OHH
O
O
H3CC2H5
H
R
O NH
CH3O
O
H
OH
[9] Salinosporamide H [6] Salinosporamide A R = Cl [7] Salinosporamide B R = H [8] Bromosalinosporomide R = Br
(ii) Effect on NF-κb Activity An important protein that is regulated by proteosome is the transcription factor NF-
κB. This promotes cell survival by regulating genes encoding cell-adhesion
molecules, proinflammatory cytokines, and antiapoptotic proteins (Williams et al.,
2005). NF-κB was first discovered in the laboratory of Nobel Prize laureate David
Baltimore via its interaction with an 11-base pair sequence in the immunoglobulin
light-chain enhancer in B cells of white cells (Bours et al., 1993). NF-κB was found
20
to be active in many malignancies, including multiple myeloma. Interrupting its
activity by use of proteosome inhibition was the basis for the approval of the drug
Velcade but interestingly Salinisporamide A has not only been found to exhibit
activity against the 20S subunit of the proteosome but also against Velcade-resistant
multiple myeloma cells. Blocking NF-κB can cause tumor cells to stop proliferating,
to die, or to become more sensitive to the action of anti-tumor agents. Thus, NF-κB is
the subject of much active research among pharmaceutical companies as a target for
anti-cancer therapy.
(iii) Biosynthetic Capacities of S. tropica
The chemotaxonomy of actinomycetes using spectrometric analysis between genus
and within genus levels was insufficient to justify the presence of new phylogeny
especially for the Salinispora genus without the high level of taxonomic resolution
provided by sequencing based research especially involving 16S rRNA (16S rDNA),
the gene that encodes the RNA component of the smaller subunit of the bacterial
ribosome. With the discovery of the extremophile Thermus aquaticus by Dr. Thomas
Brock in 1969, the heat stable enzyme TAQ polymerase was derived which enabled
the development of the DNA amplification technology Polymerase Chain Reaction
(PCR) thus bacterial genomes such as that of E. coli were successfully sequenced. In
addition to identifying all genes present in a secondary metabolite producing
actinomycete, the application of genomics offers more advantages such as it
facilitates the cloning of key genes and important elements which lead to metabolic
re-construction of secondary metabolite synthetic pathways and the identification of
key control genes. Advances in biotechnology, particularly in the ability to transfer
genetic material from one bacterium to another, has opened up the exciting
possibility of transferring segments of DNA that are responsible for the biosynthesis
of secondary metabolites from slow-growing or unculturable bacteria into easily
cultured bacteria such as Escherichia coli (Dunlap et al., 2006). The frequent re-isolation of bacterial secondary metabolites has created an increase
in demand for molecular engineering including combinatorial biosynthesis of
bacterial DNA. Bacterial genes have been re-engineered in bacterial circular DNA
and plasmids to produce new compounds. A recent study by Udwary et al. (2007)
revealed the most diverse assemblage of polyketide biosynthetic mechanisms known
21
from a single organism in S. tropica. Figure 1.8 shows the circular genome of S.
tropica and the gene clusters being investigated for their functionality in the
biosynthetic capabilities of the actinomycete. Four gene clusters have been linked so
far to secondary metabolite production. These are designated slm (Salinilactam), spo
(Sporolide), sal (Salinisporamide) and lym (Lymphostin). The majority of the
biosynthetic pathways use carrier based biosynthetic logic in the assembly of their
products (Udwary et al., 2007). The analysis by Udwary and his team revealed 17
secondary metabolite pathways that have been predicted to be involved in
siderophore, melanin, polyketide, nonribosomal peptide, terpenoid and aminocyclitol
production. The metabolic capacity of S. tropica may be reflected by its genomic size
of 5 183 331 bp as compared to recently sequenced actinomycetes such as
Clavibacter michiganensis (3 297 891bp) and Mycobacterium tuberculosis (4 419
977bp) (Galperin et al., 2007) which are both terrestrial phyto- and anthro-pathogens
respectively. Most of the clusters are concentrated on a single quadrant of the
chromosome and some were found to have been introduced through horizontal gene
transfer also known as lateral gene transfer (LGT).
Figure 3. Circular chromosome of S. tropica CNB-440, oriented to the dnaA gene. The outside
outer ring shows the locations of secondary metabolic gene clusters. The inside outer ring shows
the locations of putative mobile genetic elements. The centre ring shows a normalized plot of GC
content (maximum, 75.5%; minimum, 60.3%; average, 69.5%). The inner ring shows a
normalized plot of GC skew (maximum, 0.2346; minimum, _0.2504; average, _0.0020). [Adapted
from Udwary et al., 2007]
22
1.4.5 Salinispora arenicola and Salinispora pacifica
Salinispora arenicola as previously discussed has a cosmopolitan distribution.
Morphological characteristics are the same as that of S. tropica but with slight
changes in optimum growth temperature (10 -30˚C) and carbon sources (arbutin, L-
proline, (+)-D-salicin, L-threonine and L-tyrosine) for growth and energy
requirements. A study by Jensen et al. (2007) examined a total of 30 S. arenicola
strains from six geographically distinct locations and discovered compounds in the
rifamycin and staurosporine classes. Rifamycin B [10] and Saliniketal A [11] were
found to be present in all tested strains. Patchy distribution was observed for
Arenicolide and Cyclomarin compounds which could mean possible ecological
dependence of the species to produce these accessory compounds. Similarities were
observed when DNA sequences between S. arenicola and S. tropica were compared
showing the two strains sharing a 99.53% 16S rRNA gene sequence identity (Jensen
and Mafnas, 2006). Despite of high sequence similarity, S. tropica and S. arenicola
have been classified as distinct species (Maldonado et al., 2005).
NH
O
O O COOH
O
OHOH
OHOHO
O
H3C
O
O
H3C
[10]
23
O
NH2
O
O
H3C
HO
OH
CH3
CH3 NH2
CH3
H
H [11]
O
CH3 CH3
HO
H3C CH3
OH
CH3
O [12]
O
CH3
HO
H3C
O
CH3
CH3H3C
OH [13]
CH3
CH3 CH3
OHOH
CH3
H3C
O
CH3
[14]
24
CH3
CH3 CH3
OHOH
CH3
CH3
H3C
O [15]
Salinispora pacifica, the third phylotype to be discovered from the genera, although
not as vast in its distribution to the other two species, was found to produce a
common secondary metabolite in Cyanosporasides A [16] and B [17] (Oh et al.,
2006) apart from accessory compounds of Salinipyrones A [12] and B [13] and
Pacificanones A [14] and B [15] (Oh et al., 2008). Since it is the most recent of the
Salinispora species to be found, further work into its chemotaxonomy is still in
progress but morphological characteristics are similar to S. tropica and S. arenicola.
Saliniketals A [11] and B which are bicyclic polyketides produced by S. pacifica
(Williams et al., 2007) were found to inhibit ornithine decarboxylase (ODC) which is
an important target for the chemoprevention of cancer (Williams et al., 2007). S.
pacifica was observed to share < 60% genomic similarity to S. arenicola and S.
tropica.
O
N
R2
OOH
OHO
CH3CH3
OHR1
[16] A R1 = Cl R2 = H
[17] B R1 = H R2 = Cl
1.5 Analytical Applications in Natural Products Genomics is the sequencing of an organism's genome and the analysis of its gene
content. It deals with the systematic use of genome information, associated with
other physiological data, to provide answers in biology, medicine, and industry.
25
Genomics has been of a particular importance in natural products research due to
actinomycete secondary metabolite classes such as polyketides, nonribosomal
peptides and hybrids, which are well known as broad spectrum activities against
bacteria (Udwary et al., 2007). Genomics has also proved to be a powerful tool in
identifying biosynthetic gene clusters from complex microbial communities, this
technique being termed environmental genomics or metagenomics. The biosynthetic
genes responsible are usually encased into operon-like clusters and include
regulatory elements and resistance mechanisms. Utilization of 16S gene sequence
and DNA-DNA relatedness has shed new light on taxonomic relationships between
groups of similar strains and their secondary metabolite products even up to
subspecies level as in the case of Salinispora pacifica (Dong-Chan, et al., 2008).
Lateral gene transfer (LGT) has long been recognized as the mechanism by which
unrelated organisms are capable of producing similar chemical compounds. It has
been identified to play an integral role in the evolution of the bacterial genome in
providing an effective strategy for the exploration of natural resources by bacteria
(Doolittle, 1999; in Jensen et al., 2007). Furthermore, it was suggested to be the
selective force behind the physical clustering of genes within bacterial genomes
(Lawrence, 1997; in Jensen et al., 2007). Evidence that secondary metabolic genes
are subject to LGT can be inferred from sequence analysis, unrelated phylogenies,
their occurrence on plasmids and their chromosomal association with mobile
elements (Jensen et al., 2007). An example of LGT occurring in sponge-microbial
associations is the phylogenetic analysis of the β-ketosynthase (KS) gene from
sponge-derived Salinispora strains. This study showed that the closest related
polyketide synthase gene was from the rifamycin β-ketosynthase of actinomycete
Amycolatopsis rifamycinica formerly known as A. mediterranei and Streptomyces
mediterranei (Kim et al., 2006). This was proven when the study of the sponge
derived actinomycetes KS gene in liquid chromatography-tandem mass spectra
revealed that the rifamycin producing ability was indeed present in the sponge
isolated Salinispora strain as is the case for A. rifamycinica. The study also indicated
that the actinomycete rifamycin-producing gene was not only present in only one
bacterial genus but was also in the other genera.
26
1.5.1 Chemotyping through Thin Layer Chromatography (TLC) and
advent of 2D-TLC and High Performance Thin Layer
Chromatography (HPTLC)
The TLC technique has been categorized under planar chromatography together with
Paper Chromatography (PC) (Lough and Wainer, 1996; in Touchstone and Dobbins,
1983). It was first referred to in 1938 by two Russian workers, Izmailov and Shraiber
(Touchstone and Dobbins; 1983) in what they called drop chromatography on
horizontal thin layers. It was not until ten years later that the separation technique
was noticed by two American scientists who used the technique to separate terpenes
in essential oils. It has a number of advantages over basic liquid chromatography in
using a smaller amount of solvent, which can also be adjusted for polarity in a few
minutes. Little equilibration is required and only a small amount of solvent is
necessary for a chromatogram. Perhaps the most advantageous feature of TLC is its
capacity to test for more then one sample at one time i.e. almost 20 samples may be
spotted on a 20 X 20 cm TLC plate (at 1cm intervals) for determination at one time.
Advances in screening techniques have elicited TLC-Bioautography (Hanka and
Barnett, 1974; Runyoro et al., 2006) in organic chemistry research. Chromatographic
techniques have vastly improved through time with recent advances emerging such
as 2D-TLC where samples are run on one side of a plate and removed before solvent
front approaches plate edge (Tirimanna, 1980; Lord and Tirimanna, 1976;
Soczewinski et al., 2001). The plate is then inverted 90° and run on adjacent side of
the plate in a solvent system with different polarity. Coupled with bioautography, the
new method has simplified chromatographic separations especially for plant extracts
with numerous secondary metabolites. More automated and highly efficient
separation are now possible through high performance thin layer chromatography
(HPTLC) (Chopade et al., 2008). Below (figure 4) is a flow chart summarizing the
basic steps through HPTLC as compared to the normal TLC route of analysis.
27
1. Sample and standard Preparation 1a Selection of appropriate chromatographic layer 1b Layer rewashing 1c Layer reconditioning
2. Application of standard and sample to prepared chromatographic layer
3. Chromatographic development
4. Detection of spots/Visualization using chemical agents 5. Scanning and documentation of chromatoplates Figure 4. Basic TLC and HPTLC processes adapted from Chopade et al., 2008.
HPTLC route follows from 1a – 5.
Apart from its high output rate and low running cost, minimal sample clean up,
qualitative, quantitative and preparative analysis can also be achieved with the same
system.
1.5.2 Co-chromatography
The co-chromatography technique is the comparison of two or more unknown
substances by chromatographic comparison with a known substance (American
Psychological Association). It is a common technique used in the chemical screening
of known chemotypes from unknown chemical mixtures with specific importance to
agro-chemistry, natural products bio-prospecting and now in chemotaxonomy
studies. A widely used technique in natural products chemistry especially when
screening for new compounds, co-chromatography permits the detection of similar
compounds if not the same from unknown crude extracts (Stierle et al., 1993;
Mercadante et al., 1998; and McNally et al., 2003).
28
1.5.3 Bioautography
Bioautography provides a chemical fingerprint of the activity of the crude against
bacterial cultures. The two main advantages of the technique is that (i) it uses less
crude material to identify bioactivity hits and (ii) the crude extract is already resolved
on the chromatographic plate thus simplifying detection process (Runyoro et al,
2006). There are three known methods: contact bioautography, immersion
bioautography and direct bioautography. Contact bioautography has been utilized the
most. The method enables the adsorbent surface to come in contact with the agar
enabling the compounds from the spots to be absorbed into the media directly.
Although it has numerous advantages, the technique is not sensitive enough to
differentiate the extent of inhibitory response by the compound from an active spot as
compared to the disc diffusion method.
1.5.3.1 Contact Bioautography In contact bioautography, antimicrobial compounds diffuse from a developed TLC
plate onto the agar surface inoculated with a bacterial culture. The chromatogram is
left faced down onto the agar surface for a few minutes or even hours to allow for
diffusion of compounds (Meyers and Smith, 1964; in Choma, 2005). All spots on the
TLC plate are marked on the Petri dish before the plates are removed. Active spots
may be easily identified by following the marked spots on the Petri dish and looking
for inhibition zones. A major disadvantage of the method is the difficulties of getting
full contact between the chromatograms with the agar surface. Most reverse phase
(RP) plates are not suitable for this method as C18 silica residues are often stuck on
the agar surface when the chromatograms are removed from the petri dish.
1.5.3.2 Agar-overlay Bioautography
In the above method, the chromatogram is covered in a molten seeded medium agar
inoculated with the bacterial isolate to be tested against antimicrobials and
antifungals (Iscan et al., 2002; Runyoro et al., 2006). After solidification, the plates
are left for a few hours to allow diffusion before incubation. Staining with a
tetrazolium salt follows before visualization of spots (Williams and Bergesen, 2001;
in Choma, 2005). The main disadvantage is the dilution of antimicrobials in the agar
layer as compared to direct bioautography.
29
1.5.3.3 Direct Bioautography
In the above method, a developed chromatogram is dipped into a suspension of
micro-organisms in a suitable broth or the chromatogram is sprayed with the
suspension (Wedge and Nagle, 2000; Seto et al., 2005). Therefore pre-conditioning,
development, incubation and visualization are all performed on the chromatographic
plate (Choma, 2005). As with the normal visualization of most bioautographed
samples, tetrazolium salts are used to aid in visualization of inhibition zones.
1.6 Molecular Sequencing and Phylogenetic Analyses Molecular phylogeny analysis of a given organism can be accomplished through use
of its DNA, RNA, and protein sequences. The evolution of DNA sequencing has
ushered in a new era of molecular phylogeny. Before this, only DNA-rRNA
hybridization and oligonucleotide cataloguing were in common practice.
1.6.1 DNA-rRNA Hybridization and Oligonucleotide Cataloguing The large-scale application of DNA hybridization techniques to systematics was
pioneered by Charles Sibley and Jon Ahlquist, but their method was closely
scrutinized because some nucleotides remained unidentified. Proponents of the
technique however have argued that the sheer number of nucleotides under
comparison compensate for the lack of nucleotide identification (Hillis et al., 2000).
Since only a single strand of DNA is used as a template for RNA synthesis, and RNA
molecules are single stranded and do not pair with each other, rRNA relatedness is
determined by hybridization with 14C-labelled 16S or 23S rRNA with single stranded
DNA (ssDNA) (Stent, 1981). The 16S rRNA oligonucleotide cataloguing application
has provided a more exacting way of detecting phylogenetic relationships between
prokaryotes (Fox et al., 1977).
1.6.2 16S rRNA and Protein Subunits
Bacteria have 70S ribosomes, each consisting of a small (30S) and a large (50S)
subunit. Their large subunit is composed of a 5S RNA subunit (consisting of 120
nucleotides), a 23S RNA subunit (2900 nucleotides) and 34 proteins. The 30S
subunit has a 16S RNA sub-unit consisting of 1540 nucleotides, which are bound to
21 proteins (Korostelev et al., 2006). The 16S rRNA serves as scaffolding for protein
30
elements in addition to its highly conserved sequences for prokaryotes. In addition,
its sequences contain highly variable regions, which can provide species-specific
signature sequences for the identification of bacterial species (Jensen et al., 2007).
The potential for its use in investigating bacterial diversity intaclade (genus-genus)
and intraclade (genus-species and species-species) is enormous. Its reliability and
defined properties stems from a number of reasons:
1. Due to its low mutation rate, it can be used as a molecular chronometer
allowing taxonomic work to investigate evolutionary distances and
relatedness of organisms (Thorne et al., 1998)
2. The size is large enough with sufficient interspecific polymorphism to allow
distinguishing and valid statistical measurements (Clarridge, 2004)
3. The gene is universal in all bacteria enabling it to be used to measure
relatedness across all bacterial taxa (Woese, 1987)
Isolation and culturing approaches are applied to improve strain purity and to target
specific marine bacteria belonging to the Actinomycetales family. Actinomycete
groups have been detected and characterized by their 16S rRNA sequences in cases
where cultivation has proved unsuccessful (Rheims et al., 1996; Niner et al., 1996).
Although profiling according to morphological and cultural features is the simplest
ways to identify and isolate Salinispora bacteria, definitive and more reliable data are
obtained from genetic analysis through their highly conserved 16S rRNA sequences.
1.6.3 Phylogenetic Reconstruction from 16S rRNA Sequences
Phylogeny is the study of the evolutionary history of organisms. As early as the late
1960’s the newest branch of biology-molecular biology began creating important
contributions to one of the most established biological disciplines of systematics.
Before this, most classification was based on morphological studies. As the
development of this new branch continued throughout the years, there has been
considerable debate between morphological and molecular systematics caused by a
change in a long accepted taxonomic grouping (Hillis and Weins, 2000) due to
molecular work. Although there are a few disadvantages for molecular analyses such
as the sequencing costs. The advantages include the large number of characters
available for analysis (Hills, 1987), highly conserved regions and variable regions
31
that allow finer resolution (Hills, 1987). In addition, numerous programs to generate
phylogenetic trees and organismal cladograms are available. The only common
agreement among most systematicists is that both methods have advantages and
disadvantages and that the incorporation of both techniques is useful to describe and
interpret biological diversity. (Weins, 2000; Moritz and Hills, 1996).
There are several sequence analysis software packages available such as BLAST
(available on line in the NCBI database), PHYLIP, BIBI and the widely used PAUP
(Clarridge, 2004). Comparisons or reconstructed phylogenetic trees are usually
represented in cladograms either rooted (using outgroups) or phylograms (unrooted)
and are generated using specific algorithms to calculate distances and to infer
topography of trees. Distance based methods and Character based methods are the
two main methods to which most algorithms are designed to reconstruct a
phylogenetic tree. Distance based methods construct trees by calculating distances
between molecular sequences and involves information about the distance between
the OTUs in a multiple sequence alignment. Common algorithms used in distance-
based methods are UPGMA and Neighbor joining. Character based methods like
Maximum parsimony and Maximum likelihood analyze candidate trees based on the
relationships inferred directly from the sequence alignment.
1.6.3.1 Parsimony Methods
From the existing numerical approaches for inferring phylogenies directly from
character data, methods based on the principle of maximum parsimony have been
widely utilized by far. Methods used for estimating trees under the criterion of
parsimony e.g. Fitch and Wagner Parsimony and Dollo Parsimony (Swofford et al.,
1996) operate by selecting trees that minimize the total tree length: number of
evolutionary steps (transformations from one character to another) required to
explain a given set of data. Since the symmetrical nature of Fitch and Wagner
parsimony are unsuitable for restriction sites5 because loss in an existing restriction
site is more probable than a parallel gain of the same site at a different location,
certain researchers have suggested the Dollo parsimony model as being more
appropriate for restriction site data analysis since it uses an asymmetric criterion on 5Sites on a DNA molecule containing specific sequences of nucleotides usually cut by restriction enzymes
32
transformation (Debry and Slade, 1985). It is also possible to construct an unrooted
tree using the Dollo parsimony model. The maximum parsimony (MP) inference
method was initially designed for morphological characters (Nei and Kumar, 2000).
The concept underlying the method is that the best tree is the tree with shortest
branches i.e. having fewer changes to account for the way a group of OTU sequences
evolved is more easier rather than using more complex explanations of molecular
evolution (Pevsner, 2003). The method although has a number of weaknesses such as
generation of incorrect topology when the rate of nucleotide substitution varies
extensively with evolutionary lineage and also when backward and parallel
substitutions in nucleotides and number of taxa under study (n) are small (Nei and
Kumar, 2000; Saitou and Nei, 1986). Despite these disadvantages, the MP method is
more reliable than distance based methods in obtaining true tree topology due largely
to scenarios where the extent of sequence divergence is more or less constant, and the
number of nucleotide examined are large. Furthermore, the MP methods are free
from various assumptions that are required for nucleotide or amino acid substitutions
as in distance based methods (Miyamoto and Cracraft, 1991).
1.6.3.2 Unweighted Pair Group Method with Arithmetic Mean (UPGMA)
In distance matrix methods, the evolutionary distances of all pairs of taxa are
constructed using the relationships within these distance values. The simplest in this
category is the Unweighted Pair Group Method with Arithmetic Mean (UPGMA). A
tree constructed by this method is sometimes called a phenogram (Nei and Kumar,
2000) and is usually rooted because it assumes that the nucleotides are under a
constant rate of evolution. Intended to construct species trees, topological errors have
been known to occur when the number of nucleotides is small or when gene
substitution rates are not constant. However, the reliability of a tree obtained may be
tested by (Nei et al., 1985) interior branch test or Felsentein’s 1985 boot strap test. In
cases where closely related DNA or protein sequences are used for construction of a
tree, tie trees (two or more trees) may be produced from the same distance (Takezaki,
1998). These tie trees occurs when two or more distance values in a distance matrix
occasionally become identical. In such cases, a boot strap consensus tree is obtained
by generating a boot strap value for each interior branch.
33
1.6.3.3 Neighbour Joining (NJ) Method
The (Saitou and Nei, 1987) Neighbour Joining method is also a well known distance
matrix method centred around the pairwise comparisons of the two most closely
related neighbour sequences which are defined as OTUs connected through a single
node. The algorithm minimizes the sum of branch lengths at each stage of clustering
of OTUs (Pevsner, 2003). It produces both a tree topology and an estimate of branch
length. The method is widely used due to its high computational speed and its
accuracy in phylogenetic inference as revealed in computer simulation studies
(Kumar and Gadagkar, 2000).
34
Chapter 2 Methods and Materials
The experimental methodology of the project is described in this section. In addition,
a schematic diagram of the experimental process is shown in figure 25 (Appendix
11).
2.1 Sampling
Marine actinomycetes originating from marine sediment samples dominate current
literature on actinomycete research (Mincer, et al., 2002; Jensen, et al., 2007;
Magarvey et al., 2004; Mincer, et al., 2005; Gontang et al., 2007). In addition,
significant developments have emerged in their isolation and identification. Various
strategies have been designed to target specific genera for culture and extraction of
secondary metabolites. This project is not an exception. All sediment samples were
collected from Fijian waters by dive crews through the combined IAS and Scripps
Institute of Oceanography actinomycete project, which has been on-going since
2006. Samples of the top 5 - 20 cm of sediment were scooped by hand into sterile 50-
ml plastic Whirl-Pak bags (NASCO, Modesto, Calif.) by divers using SCUBA gear
when necessary. Sediment samples were then placed in 15mL plastic tubes and
transported to the IAS labs and stored in cold freezers below 1-2˚C for isolation of
bacterial colonies as soon as possible.
Figure 5 below is a map of the project sampling locations plotted using GPS
coordinates from within the Fijian archipelago. Samples were collected from 16
locations in 9 provinces that have been sampled by the combined IAS and Scripps
dive crews. The red dots do not represent all the locations that have been sampled by
the dive crews nor the amount of samples collected but aim to illustrate the locations
respective to this project as the number of locations were too numerous to map out
since the current sample numbers are well into the thousands and could be too
cumbersome to document.
Sediment samples were collected from around Fiji from nine provinces of;
1. Tailevu 6. Ovalau/Lomaiviti,
2. Nadroga 7. Lau
3. Kadavu 8. Macuata
35
4. Cakaudrove 9. Rewa
5. Yasawa and Tavua /Ba
Sampling permits were obtained from the relevant provincial head quarters. An
MOU figure 23 (Appendix 5) was drafted with the landowners agreeing on the
dissemination of research results after the completion of the project.
Figure 5. Map of Fiji archipelago showing collection sites.
2.2 Isolation and Purification Numerous methods have been developed to isolate actinomycetes from soil and
sediment samples. Central to most methods is the application of selective treatments
to reduce the numbers of gram-negative bacteria. One common method used is
heat/thermal degradation also known as heat shock. The effect of heat on the sample
is that it kills non-sporforming bacteria. Drying prior to plating was also used as this
method also selects for spore-forming bacteria. All sediments were vortexed for 1
minute and then sonicated for 1 minute before they were dried and then either (i)
36
stamped or (ii) diluted and heat shocked. Some samples were subjected to both
techniques before being inoculated onto M1A media (10g starch, 2g peptone casein,
4g yeast extract and 18g agar in 1iter of 100% 0.45μm filtered sea water (S/W)) and
incubated for 4-6weeks at 27ºC (Mincer et al., 2005). The isolation medium for
actinomycetes was amended with 100μg/mL of the (0.2μm filtered) antifungal agent
cycloheximide and 5μg/mL of the anti-gram negative antibiotic polymixin B before
plating. Dilution and heat shock were as follows: 1 ml of wet sediment was added to
4 ml of sterile seawater, heated for 6 min at 55°C, vigorously shaken, and further
diluted (1:4) in sterile S/W; 50μL of each dilution was then inoculated by spread
plate method onto agar-based isolation media M1A.
The stamping method was carried out as follows: 10 ml of wet sediment was
aseptically placed into a sterile aluminium dish, dried for 24 hr in a laminar flow
hood, ground lightly and pressed into a sterile foam plug (14 mm in diameter), and
inoculated onto agar media by stamping eight or nine times in a circular fashion,
giving a serial dilution effect. Purification of actinomycete colonies was through
morphological recognition of mycelium growing bacteria with a flacky orange
texture. Re-streaking on M1A agar was repeated in order to purify Salinispora like
bacteria in enrichment media 1\5 M1A (2g starch, 0.04g peptone casein, 0.8g yeast
extract and 18g agar in 1 litre S/W).
2.3 Culturing, Extraction and Screening Fermentations began with the transfer of a loopful of culture from a petri dish into a
50mL volume of AIB medium containing 0.2g starch, 0.04g peptone, and 0.08g yeast
extract in 100% 0.45μm filtered S/W. This served as the seed culture and was
incubated for 7-14 days in a shaking incubator at 230rpm and 25-27 ºC before it was
ready for the next process known as step up fermentation. A total volume of 2.4mL
culture was transferred in separate 600μL volumes into a larger shake flask
containing 100mL of A1B broth and incubated for a further 7-14 days. After the
recommended period a high cell density was observed and the cultures were
extracted by ethyl acetate in a 1:1 ratio and the solvent removed using a rotary
evaporator at 36°C. The residue was dissolved in EtOAc: Acetone: MeOH 1:1:1 v/v
and dried in vacuo before finally reconstituted in EtOAc for bioactivity screening.
37
2.3.1 Pathogenic Bacterial Assays
Test organisms #310: Methicillin-Resistant Staphylococcus aureus (MRSA), #375:
Wild type S. aureus (WTSA), #379: Vancomycin-Resistant Enterococcus faecium
(VREF) were the three main bacteria tested against the crude extracts. A preserved
MRSA culture (10μL) was added to a 10mL volume of TSB. The same treatment
was subjected to the WTSA and VREF preserved cultures. These were to serve as
seed cultures and are incubated for 18-20±2hrs at 37ºC before they can be inoculated
onto the agar. Readings are taken in UV-Spec for bacterial density. A normal
absorbance reading for a bacterial seed culture would be 0.1 to 0.3. A ratio of 2:1
volume nutrient agar (NA) to seed culture is prepared for WTSA and MRSA while
the ratio increases to 4:1 LBA agar to seed culture for VREF. Once pour plating is
completed the plates are ready for bioassays and may be conducted together with
necessary bio-autography and incubated overnight for 18-20±2hrs at 37ºC.
Table 3. Strain collection data and growth medium utilised Strain Collection N.o Source Growth Medium
Salinispora arenicola CNS205 SIO M1A (1/10 strength in FSW)
Salinispora tropica CNB440 SIO M1A (1/10 strength in FSW)
Salinispora pacifica CNR114 SIO M1A (1/10 strength in FSW)
Wild Type Staphylococcus
aureus (WTSA) ATCC
TSB broth and Nutrient Agar
Methicillin Resistant
Staphylococcus aureus (MRSA) 10537 ATCC
TSB broth and Nutrient Agar
Vancomycin Resistant
Enterococcus faecium (VREF) 12952 ATCC
TSB broth and LBA agar
Wild Type Candida albicans
(WTCA) 32354 ATCC
RPM1 1640 broth and PDA
Amphotericin B Resistant
Candida Albicans (ARCA) 90873 ATCC
RPM1 1640 broth and PDA
2.3.2 Disc Diffusion Bioactivity Tests
After re-constitution of extracts in CH3C(O)CH3: EtOAc: MeOH (A:E:M)
(1:1:1v/v/v) at [25mg/mL], 10μL volumes were pipetted onto Advantec 6mm blank
paper discs. The process was repeated in triplicate for each strain before being left for
38
30-60mins to allow for absorption of extracts into paper disc. After the stipulated
period, discs were placed onto WTSA, MRSA and VREF plates and left for 10mins
to allow for adsorption of compounds onto the agar surface before being incubated
for 20hr± 2hrs at 37°C. The zone of inhibition was taken and recorded in mm.
2.3.3 Brine Shrimp Assays (BSA)
The brine shrimp eggs from the golden fish Artemia salina were obtained from the
Golden Ocean Aquasupply Enterprise, Taiwan. Hatching of eggs was archieved by
weighing out 100mg of brine shrimp and placing them in a 250mL beaker filled with
a 200mL volume of 0.45μm filtered seawater (FSW). An aerator was connected to
the beaker to provide sufficient aeration and keep the eggs in circulation. A light
source was also fitted to the setup to maintain an optimum temperature for hatching
before being covered with aluminium foil and left for 48 hrs to allow for hatching.
Test samples were dissolved in AEM at 25mg/mL (25000ppm) concentration. To
make a 250ppm concentration, 980μL of FSW was pipetted into an eppendorf tube
and 20uL of the dissolved sample was added to top up (100x dilution). The brine
shrimp bioassay was carried out in 96-well plates and tests were done in triplicates
for each concentration beginning from the maximum of 250ppm (sample stock) and
decreasing by half the concentration for each triplicate until plates showed all dead
for brine shrimp. Dilutions were archieved by adding a 500 μL of sample stock to a
5.0 mL eppendorf tube filled with 500 μL of FSW. Thus, in repeated fashion can a
50% dilution be archieved for each previous concentration. Roughly 10-15 adult
shrimps were pippetted together with 100μL of FSW into each well. A 100 μL of test
sample was then added. Once all samples were added, the wells were covered and
results were recorded after 24 hrs using a light microscope. Results were recorded as
number of dead shrimps over total number of brine shrimps per well. From these
results, the LD50i of the samples were calculated to determine the toxicity of the
samples using the Reed Muench method (Dass et al., 2010; Carballo et al., 2002).
From the method, the LD50 is calculated by plotting the number of accumulated
survivors and the number of accumulated deaths on the same axes against log dose
(number of animals vs log dose) and finding the antilog of the log dose value at
i The lethal dose at which 50% of a tested population dies.
39
which the two curves meet (where number of survivors is equal to the number of
deaths). An example of a calculation of LD50 can be seen in Appendix 7 (Table 11).
2.3.4 Thin Layer Chromatography and Sub-profiling
Chemotyping tests were subjected to the bioactive strains through Thin Layer
Chromatography (TLC) where the stationary phase was a Silica UV254 aluminum
backed plate and the mobile phase was n-hexane: EtOH: Acetic acid (10:9:1 v/v/v).
Spotting was done at 1cm distances from each strain number and 1cm from the
bottom of the plate. The development chamber was left for a period of 10-20 minutes
after the mobile phase has been poured in to saturate the vessel before each run.
Strains with unique TLC retention factor (Rf) profiles outside of the three standard
TLC profiles exhibited by the known Salinispora species were further subjected to
contact bio-autography counter screening in WTSA and MRSA. Sub-profiling of the
non-standard strains selected due to their non-standard spots was accomplished by
spotting all the non-standard strains together with the three standard Salinispora
isolates and rifampin (Rifamycin derivative). Rifamycin is produced by S. arenicola.
Strains were recorded into clusters of different retention factor ranging from 0.10 –
0.96. The UV activity of spots was recorded by viewing developed chromatograms
under a UV lamp at both UVλ254nm and UVλ345nm. The visualized spots were circled
lightly with a pencil. Retention factors (Rf) readings were taken and recorded. The
correlation coefficients for standards against samples on the same TLC plate were
obtained using the excel (Microsoft office 2003-2007) software as a reproducibility
index for samples and standards. This was also to cater for inhibitory effects of
solvent mixture evaporation rates and development system saturation time on the
reproducibility of Rf values.
2.3.5 Grams Positive Test and Seawater Requirement Tests All strains isolated and purified were tested for the requirement of seawater for
growth to ascertain if they are truly indigenous to the marine environment. Purified
cultures on M1A plates were re-streaked using the quadrant streaking method on agar
with a similar medium formulation prepared with distilled water (DIW) instead of
0.45μm filtered seawater in place. Plates were then incubated for a period of 6 weeks
at 27°C and observed for the presence or absence of growth. The absence of growth
indicates a positive seawater requirement. The 3% KOH gram test test was also
40
applied to the strains. A loopful of bacteria was streaked on a drop of 3% KOH and
observed for viscosity. If the 3% KOH mixture turns viscous then the bacterial strain
was reported as gram negative, if the strain produced no viscous paste then it was
reported as gram positive. Results from tests were recorded and noted in the selection
of the samples.
2.3.6 Solvent System Trials for Thin Layer Chromatography (TLC) Solvent system trials were conducted to find a suitable mobile phase that would
produce good separation of spots, no dragging (dragging complicates identification
of bioactive spots especially in bioautography) and allows differentiation of activity
between each sample on bioautography agar plates. Initially, trials were performed
on stored crude extracts that were reconstituted in DMSO. Possible DMSO
azeotropes6 were utilized together with extractive distillation to remove the DMSO.
A volume ratio of 1:2 DMSO: H2O was mixed until it turned milky white. A semi-
polar solvent (toluene) was then used to extract crude from the milky mixture at a 1:1
ratio v/v. An analysis of normal EtOAc extracted crude was done in HPLC followed
by DMSO extracted crude and comparisons made on peak intensity and number of
major peaks. Re-culturing of the bacteria and re-constitution of the crude in EtOAc or in AEM was
a necessary solution. Volumes of 3uL crude extract were spotted at distances of 1cm
apart on Silica gel UV254 aluminium backed TLC plates, dried with a heat gun before
being placed in development tanks pre-saturated with the mobile phase to be tested.
Plates were left to run until the solvent front reached a distance of 8-9 cm on the TLC
plate before they were removed and dried again with a heat gun. Viewing of
compound spots was then observed in UV345 (Long wavelength) and UV254 (Short
wavelength) under a UV lamp and active spots were also pencil marked. The use of
visualization reagents was not applied to detect non UV active spots due to time
constraints analyzing 100 samples and the utilization of limited normal phase plating
sheets. In addition, provisions for non-UV active spots have been covered in the
bioautography assay. New spots can be identified if they are non-UV active but are
active against the bioautography assays. Since only S. arenicola has been found to be
6 A mixture of two liquids mixed in a ratio that cannot be separated by simple distillation. Mixture maintains a constant boiling point and produces vapour with the same composition as the mixture.
41
active against bioautography assayed strains, any strain may produce active spots at
different Rf. Therefore differences in TLC profiles may be easily identified when
strains producing this pattern are observed relative to the known standards.
Further testing has resulted in the use of aqueous 2, 3, 5-triphenyltetrazolium
chloride (TTC) to assist in differentiation of active zones on bioautography and also
act as a colorimetric indicator of viability in respiring bacteria (Roslev and King,
1993). Each sample was analysed in duplicates.
2.3.7 Contact-bioautography Screening A volume of 200uL of Wild Type Staphylococcus Aureus (WTSA) and also
Methicillin Resistant Staphylococcus Aureus (MRSA) cultures (after growth for 20±
2hrs) were pipetted into 100mL of nutrient agar (NA) mixed thoroughly and plated.
Similarly, a volume of 400uL Vancomycin Resistant Enterococcus faecium (VREF)
overnight culture (20± 2hrs) was pipetted into 100mL of Potato Dextrose Agar
(PDA) and then plated. After TLC plates were removed from the developments
tanks, they were dried for 2-3 minutes before being placed face down with the Si
coating pressed against the dried agar surface to allow the compounds from the spots
to be absorbed into the agar. Plates are then left for a period of 10 – 20 minutes for
absorption before UV active spots from TLC plates are copied onto the face of the
petri dish (to allow easy identification of spots on agar once the TLC plates are
removed from agar) and TLC are removed from assay plates. Assay plates are then
para-filmed and incubated for 20± 2hrs at 37°C. Results are recorded afterwards and
spots which are almost inconspicuous are sprayed with TTC to allow easier
identification. Duplicates testing were subjected to MRSA and WTSA plates to
verify activity of a non-standard spot and also for statistical purposes.
2.3.8 Profiling through Exploratory TLC An assessment of the chemotype diversity within the most abundant species in the
100 Salinispora (S. arenicola) collections was carried out. Strains selected for the
study were chosen due to their 99-100% similarity to S. arenicola from DNA
analysis. The logic of the study was to examine the differences in sensitivity within
the species level against the pathogenic assays. Salinispora arenicola Rf results
recorded initially from TLC profiling were collated and correlation was done to
42
generate a representative graph representing the intra-species chemotype patterns
existing in the taxa.
2.3.9 Compound Representation from Standards A major research objective was to identify non-standard spots from Salinispora
strains. An idea of the metabolic capacity of the known strains to produce secondary
compounds would be useful in order to differentiate new Salinispora strains from the
standards. An investigation into the extent of UV visible spots expected to be
visualized on TLC was done for the standard strains through HPLC using a Waters
515 HPLC pump and a dual λ absorbance detector. All standard crude (CNS205,
CNB440 and CNR114) were injected in an analytical column Econisil C18 (RP) at
[5µg/µL] separately, flow rate-1mL/min, UV detection set at 254nm and 230nm
chart speed set at 2 and 5mm/min respectively. The solvent system used was MeOH:
H2O 1:1(v/v).
2.4 DNA Extraction for Genomic DNA
The extraction protocol was modified from Marmur (1961) and also from QIAGEN
blood tissue kit and was as follows: 20-50mg of cells from the plate were added to a
1.5mL eppendorf tube and crushed with a pestle. Cells were then centrifuged in an
eppendorf mini spin plus at 14,000 x g for 2 minutes. The resulting supernatant was
poured off. Cells were then resuspended completely in 750μL of P1 buffer (50 mM
Tris pH 8; 10mM EDTA) with 3.75μL of 100mg/mL RNase A (0.5mg/mL final
concentration); 1 mg/mL lysozyme (final concentration) was then added directly to
the lysis solution. The pestle was then carefully removed so as to decrease the chance
of product loses. The mixture was then incubated for 30 – 60 minutes at 37°C before
37.5μL of 20% SDS (1% final concentration), ~ 8μL of 10mg/mL Proteinase K
0.1mg/mL (final concentration) was added and homogenized completely. The
mixture was then incubated for 30 minutes at 37°C. Chloroform (200μL) was added
in a fume hood and the mixture was vortexed for 30 sec. Further adjustments were
made to samples where emulsification was not complete by adding more chloroform
before repeating the spin at 14,000 x g for 2 minutes. A biphasic layer appears with
the chloroform layer appearing at the bottom. A volume of 200μL saturated
potassium acetate was added to precipitate SDS. The solution was then mixed gently
43
and spun again at 14,000 x g for 2 minutes. The centrifuging process was repeated
until the top aqueous layer appeared clear and not hazy. A 700μL volume of cleared
aqueous layer was transferred to a fresh tube together with the same volume of
isopropanol and mixed before being spun for 10 minutes at 14,000 x g. The resultant
supernatant was decanted from the DNA pellet and washed with 70% EtOH (~ 200 –
400μL) and centrifuged again for 2 minutes at 14,000 x g. EtOH was then again
decanted leaving the pellet to dry but not completely by placing the tubes on the side.
The remaining DNA was resuspended in 50μL of Low Tris EDTA (TE) buffer
(10mM Tris pH 7.6 – 8.5; 0.1 mM EDTA). Sample was left overnight at room
temperature to be tested for purity in gel electrophoresis and PCR amplification.
2.4.1 Gel Electrophoresis
A 0.7% by mass of agarose was placed into 65mL Tris acetate EDTA (TAE) buffer ~
0.720g and mixed thoroughly. The solution was heated for 3 minutes in a microwave
oven until agarose were completely dissolved and then cooled to almost body
temperature before being poured into an agar well to be left to solidify. The well
comb was inserted before the gel solidified and then samples were run. Each sample
loaded in gel consisted of 1.5μL loading dye, 5μL distilled water and 3.5μL DNA. In
contrast, the DNA ladder (serves as a reference for differentiating DNA molecules of
different lengths) consists of 1.5μL dye, 8μL of D/W and 2μL of 1kb DNA ladder.
For checking the PCR purity, a mass percent of 1.2% agarose is used and 0.7% for
genomic DNA.
2.5 DNA Amplification and Phylogenetic Analysis of
Isolates
2.5.1 Primer Preparation and Reagent Master Mix
A primer mixture was prepared from the pure stock that was purchased from
Invitrogen. A 1:1 ratio of primer stock with distilled water was prepared by pipetting
29.7µg each (primer stock FC27 and RC1492) into separate tubes containing 29.7µL
distilled H2O to make a 1mM stock. A further 1:50 dilution to 0.02mM sub-stock
was made to each tube, which would now be called the working stock and cryo-
preserved. A master stock of reagents was prepared as shown in table 4 below.
44
Table 4. Table of master mix for PCR amplification
Reagents 10X
buffer
10mM
dNTP
Q
buffer
0.02mM
FC27
0.02Mm
RC1492
Distilled
H2O
Sample
DNA
Taq
Polymerase
Master
Mix (µL) 39 78 78 39 39 - - 6.5
Sample
(µL) 3 6 6 3 3 6.5 2 0.5
The table shows specific volumes which have to be pipetted for each sample, in the
above case 13 samples were prepared as prepared by ratio of reagents to sample.
Forward primers FC27 (5'-AGAGTTTGATCCTGGCTCAG-3') and the reverse
primer RC1492 (5′-TACGGCTACCTTGTTACGACTT-3′) were thawed before use
as they were cryogenically stored at -70°C. Actinomycete sequencing in other related
studies such as that by Mincer et al. (2005) used more than one forward and reverse
primer especially primers specifically coding for Salinispora (FC468) and also
coding for actinomycetales (F270, and R530). The study utilizes only forward and
reverse primers (universal primers) specifically coding for high G + C gram positive
bacteria.
2.5.2 16S rRNA Sequencing
The 16S rRNA genes were PCR amplified with primers FC27 and RC1492 in an
eppendorf mastercycler consisting of 30 cycles of 94°C for 15 min, 60°C for 1min,
annealing at 72°C for 1min followed by extension at 72°C for 7 minutes. PCR
products were then viewed in agarose gel electrophoresis and purified using Qiagen’s
QIAquick cleanup kit according to the manufacturers recommended protocol. A
partial consensus sequence (E. coli number 20-531) for each isolate was obtained
using the primers FC27 and R530 (5’-CCGCGGCTGCTGGCACGTA-3’). Nearly
complete sequences were obtained for select 16S rRNA amplicons (E. coli number
20-1392) using four additional primers: RC1492, R936 (5’-
GTGCGGGCCCCCGTCAATT-3’), F514 (5’-GTGCCAGCAGCCGCGGTAA-3’),
AND F1114 (5’-GCAACGAGCGCAACCC-3’). Sequencing reactions were carried
out with an ABI 3100 DNA sequencer at the DNA Sequencing Shared Resource,
UCSD Cancer Center. The above protocol has been proposed according to work done
45
at Scripps Institute of Oceanography (SIO). All sequencing was done at SIO where
partial consensus sequences may be obtained for each strain to investigate common
nucleotide and amino acid sequence (i.e. sequence motifs and variable sequence
motifs to enable identification of new phyla).
2.5.3 Phylogenetic Analyses
All nucleotide sequences were assembled, analyzed and manually edited using the
sequencer software package (version 4.5, Gene Codes Co., Ann Arbor, Mich.) and
compared to sequences within the NCBI database (http://www.ncbi.nlm.nih.gov)
using the Basic Local Alignment Search Tool (BLAST). All partial 16S rRNA gene
sequences sharing a phylogenetic affiliation with either the Actinobacteria or
Firmicutes were imported into ARB and aligned. Aligned partial 16S rRNA gene
sequences (E. coli number 20-531) were analysed using the clusterer program
(http://www.bugaco.com/bioinf) and the number of OTUs calculated using sequence
identity values ranging from 90% to 100%. For at least one representative of the
OTU generated using the 98% sequence identity value, a nearly complete 16S rRNA
gene sequence was obtained. Phylogenetic analyses were performed using the
software Phylogenetic Analysis Using Parsimony (PAUP) (Swofford, 1987) and
Mesquite programs (Maddison, W.P and Maddison, D.R., 2011). The trees re-
constructed were distance neighbour joining tree, an unweighted pair group method
with arithmetic mean (UPGMA) tree and a maximum parsimony tree.
46
Chapter 3 Results and Discussion
3.1 Isolation and Culture of Marine Actinomycetes
Samples The GPS coordinates and depth were recorded for each sampling location. The use of
selective antibiotic and heat treatment is an isolation strategy utilized by most
microbiologists to selectively isolate gram-positive sporulating bacteria (Mincer et
al., 2005; Kalakoutskii and Agre, 1976). The effects of selective antibiotics on strain
isolation and purification have been highly positive with regards to their application
to culturing efforts. Cycloheximide is the antifungal agent produced by Streptomyces
griseus (Ennis and Lubin, 1964) and Polymyxin B produced by the bacterium
Bacillus polymyxa is an antibiotic which is specific in targeting gram negative
bacteria by altering cell membrane permeability (Cardoso et al., 2007). Both
selective agents have been employed in solid phase media for the inhibition of gram-
negative bacteria and fungal growth.
Although cultivation based surveys reveal Salinispora occurring at abundances of up
to 104 CFU/mL from sediment, S. tropica clade was not isolated from the Fijian
samples studied as part of this research. This result is in aggreemnt with previous
reports thst it is only found in the Caribbean ocean (Jensen and Mafnas, 2006). There
is also a possibility of low detection rates bought about by the use of a fewer media
formulations and range of growth conditions. Hence, culturing efforts can also be a
cause of low isolation rates.
3.2 Optimization of Mobile Phase and Diluents
Since the IAS drug discovery actinomycete fermention extract collection was
suspended in DMSO, TLC trials on crude extracts did not produce any satisfactory
results in N-TLC separation as compound spots were not optimally separated when
DMSO was present. Tailing patterns and distortion of compound spots were evident
(figure 6). The use of triflouroacetic acid (TFA) and buffer addition to assist
stationary phase and mobile phase interactions did not improve the separation of
compounds on TLC plates. One possible problem was that DMSO did not fully
evaporate on the TLC plate surface (DMSO Material Safety Data Sheet, 2007) and so
47
its use as a diluent was abandoned. Consequently, isolation, culture and extraction of
the 100 strains were repeated. Ferment extracts were than constituted in Acetone:
EtOAc: MeOH (A: E: M) (1:1:1 v/v/v) as the final diluent. Table 5 shows the trials
that were conducted to set an appropriate solvent system for the crude ferment
extracts on TLC. The final solvent system was n-hexane: EtOAc: CH3COOH (10:9:1
v/v/v). As mentioned in the work by Poole and Dias (2000), the solvent system was
only three of the fifteen solvents they recommended for solvent system on a N-TLC
system. Table 5. Solvent System Trials for TLC on Normal Phase Si Plates.
Solvent System Ratio v/v % Observation
EtOAc 100 Dragging of spots on TLC plates
EtOAc : MeOH 95 : 5
90 : 10
Tailing and rapid elution rate
Dragging present, rapid elution rate
DCM : MeOH 95 : 5 Dragging decreased but patterns mimicked in bio-
autography
CH3Cl : MeOH 90 : 10
Good separation, reduced drag but mimicked in bio-
autography
EtOAc : DCM + 0.2% TFA 90 : 10 Reduced drag but pattern mimicked in bio-autography
MeCN : MeOH : H20 (Rev) 20 : 60 : 20 Tailing patterns observed, C18 showed no activity in bio-
autography
MeCN : MeOH : n-Hexane 20 : 70 : 10
No dragging but distortion of spots. Compound front close
to solvent front on TLC i.e. RF=0.8
MeCN : MeOH : Diethyl
ether 20 : 60 : 20
Distortion pronounced, minimum tailing
Observed
MeOH : MeCN : Toluene 20 : 40 : 40 Good separation and reference activity in bio-autography
but distortion of spot pronounced
MeCN : MeOH : EtOAc 20: 40 : 40 Good reference activity in bio-autography. No distortion of
compound spots but pure separation of spots
n-hexane : EtOAc : Acetic acid
50 : 45 : 5
Optimum separation and good reference activity in bio-
autography. No distortion of spots and no mimicking
patterns observed. Final solvent system.
The finalized mobile system has been labelled in bold letters for convenience.
48
Figure 6. TLC chromatogram of DMSO constituted crude as seen under UV low λ. Solvent
system MeCN: MeOH: EtOAc (1:2:2 v/v/v).
3.3 Presumptive Identification of Non-standard Strains
3.3.1 Morphological Characterization of Marine Actinomycetes Only those fitting the orange/black/brown color and flaky appearance of the
Salinispora genus were included in the initial project sample list. Sporulating (lag
phase) strains appearing black in appearance were also picked for culture. Numbering
of strains was from isolation plates where colonies were picked to be purified. A
single colony picked from isolation plates represented a strain and thus was
numbered according to the IAS actinomycete numbering system where the letter F
preceded the strain number. A combination of seawater requirement tests and the 3%
KOH test has been shown to be sufficient to support morphological identification.
Research by Halebien et al. (1981) has shown false positive effects of gram staining
on anaerobic bacteria. Some gram-positive bacteria may readily decolorize under
50% EtOH wash during staining such as Clostridium strains. Although Salinispora
are aerobic in nature, a combinatorial approach of using antibiotic disk susceptibility
tests, colonial morphology and selective media adds confidence in characterization
tests. In work by Takizawa et al. (1993) actinomycete chemotype profiles were
drawn from wall chemotype and whole-cell sugar patterns. The utilization of existing
chemotype variability from specificity in secondary metabolite production within the
Dragging patterns observed under UV low λ light
49
genus level of Salinispora has been used in work by Jensen et al. (2006) to guide
species delineation in addition to characterisation. Although microscopic
examination was not applied (Halebien, et al., 1981) for characterisation,
morphological profiling confirmed the colour, texture and shape of bacterial
Salinispora colony where most of the strains were reported to be at log phase
(orange) while there were also a number at stationary growth phase (black).
3.3.2 Seawater Requirement and 3% Potassium Hydroxide (KOH)
Tests The use of deionised water was to mimic terrestrial conditions where the habitat
would be lacking or void of ions otherwise universally concentrated in seawater such
as Na+ and Mg2+. Almost all strains showed affinity to seawater indicating their
obligate nature in the marine environment as previously observed by Han et al.
(2003) and Jensen et al. (2006).
Colonies were gram tested using 3% Potassium Hydroxide (KOH) to test bacterial
cell wall response specifically targeting the peptidoglycan7. A total of 40
actinomycete strains were tested with 3% KOH chosen to corroborate morphological
identification and seawater requirement data. As expected, samples appearing
orange/black/brown and flaky were positive for the 3% KOH test (90%) while those
which failed morphological profiling were negative for the 3% KOH test. Results are
shown for the possible new strains in Table 6.
3.4 Bioactivity Screening of Ferment Extracts
3.4.1 Pathogenic Anti-bacterial and Anti-fungal Assays
Natural product extracts frequently possess highly selective and specific biological
activity. The use of broad bioactivity screens based on antimicrobial and cytotoxic
activities is still utilized today to guide natural products work. A vast amount of
compounds have been isolated using these relative cost effective and efficient
techniques. Bioassay guided fractionation of crude extracts has been utilized on
numerous occasions (Rahalison et al., 1991; Nostro et al., 2000 and Runyoro et al.,
2006) as an initial hit screening technique. A majority of hits for antimicrobial 7 Polymer present on the cell wall outside the plasma membrane of most bacteria giving structural strength and countering the osmotic pressure of the cytoplasm.
50
activity were observed for WTSA, MRSA and VREF from table 4. This may be
attributed to the known chemotype pattern of the genus in producing certain known
antimicrobial compounds of the polyketide class (Kim et al., 2006; and Buchanan et
al., 2005), which have a high affinity to inhibit growth of these three pathogenic
strains.
With the use of antibiotics in medical treatments of bacterial infections, the efficacy
of most antibiotics was seen to diminish as most of these strains evolved resistance
against antibiotics. Therefore, inclusion of resistant strains in screening has led to the
identification of new classes of antibiotics. An example is MRSA which when
incorporated into screening resulted in the identification of the glycopeptide class of
antibiotics; the common derivatives which have been produced are vancomycin and
teicoplanin actively prescribed for gram positive bacterial infections.
Disc assay results showed most of the sample strains were active in anti-bacterial
assays (74%) and not in anti-fungal assays. In addition, 50% of active hits were
found to be active against MRSA and WTSA with the least against VREF (24%) and
a further 26% showing no activity at all. Results are shown below for strains
producing non-standard TLC spots. There were no strains showing anti-fungal
sensitivity.
51
Table 6. Anti-biotic and anti-fungal activities of non-standard samples
Anti-fungal and anti-bacterial cultures in collection
#
Strain WTSA
(mm)
MRSA
(mm)
VREF
(mm)
WTCA
(mm)
ARCA
(mm)
1 1052 ++ +++ + - -
2 1072 + + - - -
3 1075 ++ ++ + - -
4 1070 ++ ++ + - -
5 1256 +++ +++ + - -
6 1262 ++ +++ ++ - -
7 1263 +++ +++ ++ - -
8 1293 +++ +++ + - -
9 1305 ++ +++ + - -
10 1308 +++ +++ + - -
11 1380 - - - - -
12 1403 ++ ++ - - -
13 1416 ++ +++ + - -
14 1431 +++ +++ + - -
15 1246 ++ +++ ++ - -
16 992 ++ ++ + - -
17 1377 ++ +++ - - -
18 1406 +++ ++ + - -
19 1424 - - - - -
20 1294 ++ ++ - - -
21 1295 +++ +++ + - -
22 785 + + + - -
23 1300 + ++ + - -
24 1288 +++ +++ ++ - -
25 1275 - - - - -
26 720 + + + - -
27 652 - - - - -
28 587 +++ +++ + - -
52
29 559 ++ ++ ++ - -
Pathogenic strains were cultured to an optical density of 0.1-0.3 before inoculation into
agar.
+ - Moderate activity (8-15mm) ++ - Strong activity (16-20mm)
+++ - Very strong activity (21-30mm) – No activity
Table 7. Standard Salinispora chemotype antibiotic test against pathogenic bacteria
Strains Pathogenic Strain
WTSA
MRSA
VREF
Descriptions
CNS205 1 11 13 8 Moderate CNS205 2 11 12 8 Moderate
CNB440 1 - - - No activity
CNB440 2 - - - No activity
CNR114 1 - - - No activity
CNR114 2 - - - No activity
Control 22 (V) 28 (V) 8 (R) Pronounced
V – Vancomycin R- Rifamycin 1 - DMSO constituted 2 - Acetone: EtOAc: MeOH (1:1:1) CNS205 – S. arenicola CNB440 – S. tropica CNR114 – S. pacifica
53
Table 8. Morphological Identification and characterization tests
# Strain Morphological Description S/W
requirement 3%
KOH
BSA (ppm)
1 1052 Smooth shiny and black
spores
+ - 222
2 1072 Brown flaky + - >250
3 1075 Beige flaky + - 250
4 1070 Brown flaky + - <8
5 1256 Pale orange black center + - >250
6 1262 Pale Yellow + - 48
7 1263 Orange smooth + - 18
8 1293 Orange with black outer
center
+ - 94
9 1305 Orange black center. Flaky + - >250
10 1308 White outer, black center + - >250
11 1380 Dark orange smooth, shiny + - >250
12 1403 Dark brown, flaky + - 85
13 1416 Orange, Dark orange center + - 219
14 1431 Orange, black center + - 63
15 1246 Beige outer, black center + - 42
16 992 Black centre, flaky orange + - <8
17 1377 Beige brown center + - 94
18 1406 Black smooth + - >250
19 1424 Orange black + - >250
20 1294 Peach with black center + - 48
21 1295 Grey black center + - <8
22 785
Dark orange + - 47
TAB
54
+ Positive for test
– Negative for 3% KOH test thus strains are gram positive
Figure 7. Antibacterial disc diffusion test of standard Salinispora and a sample strain. V – Vancomycin 1 - DMSO constituted 2 - Acetone: EtOAc: MeOH (1:1:1) CNS205 – S. arenicola CNB440 – S. tropica CNR114 – S. pacifica
3.4.2 Anticancer Screening through Brine Shrimp Assay (BSA)
A result giving values <250ppm (0.25µg/mL) was of high interest for anticancer
investigations. A result showing >250ppm infers that a lethal dose may be present at
a higher concentration but was not tested for in the current work. A varied pattern
was observed for Lethal Dose (LD50) values observed from the assay as some
23 1300 Beige, black center, smooth + - 48
24 1288 Dark brown, light orange and
flaky outer
+ - 39
25 1275 D. orange, brown center + - >250
26 720 Beige orange and black + - 31
27 652 Orange flaky + - 76
28 587 Shiny bright orange + - 8
29 559 Orange flaky + - 250
55
samples screened exhibited antibacterial activity and surprisingly were observed to
have highly cytotoxicity values indicating the presence of possible anticancer
compounds which points to S. tropica diversity. Salinispora tropica and S. arenicola
are the only species that display anticancer activity within the genus. Salinispora
tropica are known to produce Salinisporamide A while S. arenicola are known to
produce Staurosporine. In addition, S. tropica (CNB440) has been revealed to exhibit
no antibacterial activity against the pathogenic bacterial panel utilized in the project.
A further look into genomic data may explain this phenomenon. Recent studies by
Freel et al. (2011) have produced evidence of secondary pathway divergence of the
Salinisporamide A and K pathways in the S. tropica and S. pacifica clades. The
absence of the salL chlorinase and associated genes responsible for the ethyl chloride
moiety associated with Salinisporamide A production in S. tropica from S. pacifica
strain CNT-133 was enough to establish the species-specificity concept mentioned in
work by Jensen et al. (2007) existing between the two species. Furthermore, this
explains why there has been a high incidence of BSA active samples detected.
Interestingly, all strains that have been classified as S. tropica in this work have been
assigned to the mentioned clade due to lack of activity in the antibacterial and
antifungal testing panel. Results are shown below for strains producing non-standard
TLC spots.
3.5 Chemotaxonomy via TLC- bioautography and Strain
Identifications
Separation of secondary metabolite compounds was accomplished through TLC.
Central to all chromatographic techniques is the application of a suitable mobile
phase and also an appropriate stationary phase to efficiently separate all compounds
that are present in a chemical mixture or crude extract.
3.5.1 TLC Profiling via Co-chromatography
The co-chromatography of unknown chemotypes compared to known chemotypes of
secondary metabolites was accomplished by spotting the four standards (CNS205,
CNR114, CNB440 and pure Rifampicin) in addition to the three unknowns in a 10 x
10 cm plate (figure 9). Each chromatogram was run in duplicate, one as a reference
viewed under low λ UV254nm and then WTSA bio-autographed and the second for
56
MRSA-bioautography. Results were recorded for all retention factors (Rf) of
compound spots and showed that twenty-nine strains from the 100 samples appeared
to have spots which were absent from the standard Salinispora chemotype in the
collection. Retention factors were seen to be characteristic for each of the three
phylotypes. Crude extracts for Salinispora arenicola were observed to produce six
spots on the current stationary phase and mobile phase mixture. In contrast, S.
tropica extracts produced seven compound spots and S. pacifica produced six
compound spots.
Figure 8. TLC chromatograms of strains spotted against standard Salinispora chemotype when
viewed under short λ UV254nm. Mobile phase n-hexane: EtOAc: CH3COOH (10:9:1 v/v/v). Rif
– Rifampicin standard
. Figure 9. The marked TLC chromatograms before bioautography. Note Rf values measured at
this stage of the screening process.
Solvent front
Compound front
CNS Rif CNB CNR
Rif
57
The Salinispora species diversity profiles were observed from TLC profiling of crude
extracts but not from morphological identification, gram tests and seawater
requirement tests. Compared to S. arenicola, S. pacifica which has been isolated
from the Fijiian ocean in the past (He et al., 2001), was second highest in abundance
where as S. tropica was observed the least or not at all (from TLC). Salinispora
tropica to date has only been isolated from the Bahamas and is further established in
this study to be isolated in only one location. New evidence discovered by
researchers from the University of California’s Scripps Institute of Oceanography has
shed light on the existence of a new S. pacifica gene locus which was responsible for
producing Salinosporamide K (Eustaquio et al., 2011). Similarly, the NCBI database
also reports new Salinispora pacifica sequence types which are all unpublished as
yet. In addition, unpublished data from Freel et al. (per.comm.) has revealed the
existence of four new S. pacifica 16S rRNA gene sequence types. These studies show
a genetic ambiguity within these so called S. pacifica new sequence types.
Considering the high sequence similarity between S. pacifica and S. tropica (99.59%
similarity) representing a difference of only six nucleotides, the existence of
Horizontal Gene Transfer (HGT) otherwise known as LGT can be observed.
3.5.2 TLC Reproducibility Measurement uncertainty cannot estimate the reliability of analytical results because
it evaluates the quality of only certain procedures. It can only be evaluated with
carefully planned validation procedures and quality control samples. In TLC, it may
be possible to get reliable results if all biases are eliminated and through the use of
internal standards. Unfortunately, this criterion is very difficult to be met with
absolute certainty. Differences in Rf values observed in the data can be attributed to
the use of high volatility solvents. Smith and Feinberg (1972) observed that where
low volatility solvents were used, little or no differences was observed within
replicates, but when high volatility solvents were used, equilibration time was
observed to affect results. A plausible explanation may be due to the different
evaporation rates of the solvent mixtures used in a solvent system. In addition,
insufficient saturation within a development tank may also be a contributing factor to
replication problems on TLC. Furthermore, several factors have been shown by
Prosek and Vovk (2003) to contribute to TLC repeatability and precision:
58
1. Positioning of spots on plate with internal standards. Higher reproducibility has
been observed if each sample was spotted beside the standard(s).
2. Drying step. If too much extract is used, spots can remain at the start and samples
or standards may be degraded. In addition, during the drying process, the mobile
phase evaporates from the upper part of the plate and produces secondary
chromatography. This has been identified as the main source of poor precision in
TLC with up to 10% of relative standard deviation in some cases.
3. Temperatures within the separation chambers may also affect solvent
evaporations.
In spite of these factors, the use of internal standards (pure Salinispora species)
should have catered for possible reproducibility problems. Any changes in solvent
elution rates should affect all extracts spotted on the plates thus Rf variability may be
observed for each Salinispora extract relative to the standard Rf values at the same
spot number. The correlation coefficient was calculated for all samples including
standards to ascertain if there is a linear relationship between the Rf values of
standards and the Rf values of Salinispora samples. The analysis was also used to
explain any common patterns observed between the standards and the unknowns in
terms of Rf variability and reproducibility. In addition, since standards were run
together with samples, a positive correlation coefficient for the two variables in each
plate would show that increases or decreases in Rf values for samples and standards
at the time of analysis are not attributed to error, to inhibitory factors such as solvent
evaporation and development tank saturation decreasing the reproducibility of spots
at each spot level but are due to compound interactions with the mobile and
stationary phases at the time of analysis and are not linked. As observed from figure
10, a positive correlation shows that the increasing Rf values of unknown samples is
linearly related to increases in the standard Rf values. Table 9 shows the correlation
coefficients of the four (652, 720, 1176 and 824) strains against the three Salinispora
standards.
59
Table 9. Correlation coefficients of isolated Salinispora and standard Salinispora strains from
TLC plate 1.
652 720 1176 824 CNS205 CNB440 CNR114 652 1 720 0.976866 1 1176 0.936843 0.970235 1 824 0.926916 0.965525 0.960583 1 CNS205 0.468768 0.384261 0.205445 0.366513 1 CNB440 0.989151 0.989623 0.962412 0.970261 0.449688 1 CNR114 0.863147 0.93325 0.931778 0.945779 0.273048 0.908481 1
A positive value closer to +1 gives a strong positive correlation between the two
variables and a -1 value gives a strong negative correlation. Values that equal either
+1 or -1 are said to be in perfect correlation with each other. Therefore, the higher the
correlation coefficient is, the stronger the linear relationship between the two strains
and shows that both variables are both increasing. On the other hand, the weaker the
value shows that one variable is increasing while the other is decreasing. A
correlation coefficient guide is given here to grade the different levels of strength.
a) 0.7 to 0.9-Strong positive, b) 0.5 to 0.6-Moderate positive, c) 0.1 to 0.4-Weak
positive, d) 0-No correlation, e) -0.1 to -0.4-Weak negative, f) -0.5 to -0.6-Moderate
negative, g) -0.7 to -0.9-Strong negative.
As an example, plate 1 results from the TLC analysis of strains are shown to explain
existing associations between the two variables (standards and unknown). As
observed from table 9, strain 652 appears to have a strong positive correlation with
strains 720, 1176 824, CNB440 and a moderate positive correlation with CNR114.
Conversely, Salinispora arenicola (CNS205) is seen here to have low positive
correlations with strains 652, 720, 1176 and 824. Further correlations obtained here
show a positive correlation although weak in this case which may be attributed to
saturation and solvent evaporation rates within the TLC development system. In
addition, the correlations from all TLC plates (Appendix 13) are positive in nature
and can be used to explain the precision of data as mentioned earlier. The linear
patterns seen below shows that there is indeed certain factors acting in limiting TLC
reproducibility as both standards are observed to approach a moderate to strong
correlation coefficient.
60
Figure 10. Scatter plot showing the linear correlation between the standard (CNS205) Rf values
and an isolated Salinispora strain (824) Rf. values. The trendline shows the linear association
between the standard Salinispora and the isolated Salinispora strain 824. The Pearson’s
correlation coefficient for the above scatter plot is r = 0.3665. Scatter plot and data analysis has
been calculated using Microsoft excel (ver 2003-2007).
3.5.3 Bioautography and Identification of New Strains Further screening of fermentation extract TLC chromatograms in bioautography was
performed immediately after the plates were dried sufficiently in cold air from an air
gun/blower. Only assays for WTSA and MRSA were prepared for the test due to the
large sample size and lack of special culture plates for bioautography. High
sensitivity was observed against WTSA and MRSA pathogenic assays. Figure 11
shows a bioautograph of three samples with strain 1396 showing activity against
MRSA. A majority of strains produced inhibition zones, measurements were not
taken for diameter of the zones since most could not be visualized by the naked eye
possibly owing to adsorption losses from chromatograms to culture agar and
therefore required 2, 3, 5- triphenyltetrazolium chloride (TTC) for visualization. The
salt also known as tetrazole red reacts with respiring bacteria and is reduced to a pink
compound known as formazan. Accumulation of pink color causes the whole plate
agar to appear red (Fish and Codd, 1994; Runyoro et al., 2006). Thus, on bacterially
inoculated agar, uninhibited zones would appear blood red in colour while zones of
0
0.2
0.4
0.6
0.8
1
1.2
0 0.2 0.4 0.6 0.8 1 1.2
Stri
an 8
24 R
f
CNS205 Rf
Scatter plot of CNS205 vs strain 824 showing linear correlation
CNS205
824
Linear (824)
61
inhibition would be colourless. The protocol is slightly altered from that of Runyoro
et al. (2006). Tetrazolium salt was applied in this study as an indicator for detecting
low concentration metabolites, which were almost unobservable on agar. A recent
study has been conducted using TTC as a dehydrogenase8 indicator capable of
detecting compounds of analyte concentrations down to as low as 0.1% (1mg/mL)
(Fish and Codd, 1994).
Figure 11. Bioautograph of sample crude and the three standard Salinispora chemotype run
against MRSA culture. Rf – Rifampicin bioautography positive control
An assignment of Salinispora species names was applied to the fermentation extracts
based on the results of all the tests. All data (including morphological, seawater test,
3% KOH test, bioactivity, BSA and TLC-Bioautography) gathered relating to the
strains were used in the assignment process. At this stage, assignment was kept as
assumptive since identification at a species level within genera would require a more
detailed approach such as DNA analysis (Jensen et al., 2005). Although all strains
appeared to be the same morphologically at log phase, they differed tremendously in
the BSA and antibiotic tests possibly owing to their inherent chemical abilities to
inhibit certain pathogenic bacteria such as those used in this study. Morphological
descriptions provided in table 12 (Appendix 4) shows the results from the
morphological identification of all strains. It is quite visible from the data that a large 8 An enzyme that oxidises a substrate by a reduction reaction that transfers one or more hydrides (H−) to an electron acceptor e.g. NAD+/NADP+
Inhibition zone visualized through TTC
62
number of the sampled strains showed Salinispora like characteristics, which was the
initial basis for their selection. To date, this is the second extensive work done on the
Salinispora genus from the Fijian ocean as it has previous work was performed by
Freel, et al. (2011). Although the data from the 80 sediments and 100 actinomycete
strains does not represent the true diversity or the abundance of the species found. A
broader isolation of actinomycete bacteria from the Fiji locale could have given more
information on diversity and abundance estimates. A pie graph below shows the
species composition in the Fijian ocean according to morphological data, seawater
tests, 3% KOH tests, bioactivity tests and BSA. As visible from the pie graph figure
12, S. arenicola is most prevalent and surprisingly followed by strains identified as
new. The lower percentage consists of the S. pacifica and the strains identified at this
stage to belong to the S. tropica taxa. Note, species assignment at this stage is not
confirmed as this is only to potray the species diversity after the presumptive tests
and before DNA analysis is applied.
Figure 12. Pie graph showing the Salinispora composition after screening and profiling. The
graph has been generated from the collation of data relating to the strains and assumes that
composition of species is reflected by taxa assignment after presumptive tests.
3.5.4 Exploratory TLC
An exploratory TLC of strains identified as S. arenicola from the sequencing process
revealed 4 TLC profile categories. The results (figure 13) were recorded by using
metabolite retention factors. Cluster 1 has been designated for strains showing spots
49%
13%
9%
29%
S. arenicola
S. pacifica
S. tropica
New Strains
63
at Rf <0.8 with the presence of rifamycin detected (correlated to rifampin standard).
Cluster 2 was for strains with high λ UV spots visualized at R f= 0.3-0.4 and
rifamycin which are mid-range polar compounds. Cluster 3 was for strains with
compound spots detected at Rf =0.8-0.9 plus rifamycin and profile 4 were reserved
for compound spots detected at Rf =>0.90. The rifampin standard was detected in the
mid-range polar region. From figure 13, a majority (38%) of the strains were grouped
into Cluster 1.
Figure 13. TLC results of non-standard Salinispora strains against cluster group from
subprofiling of the 29 strains identified. 1- Strain Rf = Rifamycin plus new spots <0.8 2- Strains
with high λ UV spots at Rf= 0.3-0.4 plus rifamycin 3- New compound spots detected at Rf=0.8-
0.9 plus rifamycin 4- New compound spot detected at Rf=>0.90 plus rifamycin
3.5.5 Bioautography Positive Control Rifampin (U.S.A) or rifampicin (UK) is a stable derivative of rifamycin SV. Analysis
of rifampicin (Sigma) mass spectral data (figure 21 in Appendix 2) from LC-MS
revealed two major peaks with the major peak 1 (m/z 823.4121) corresponding to
rifamycin mass from the marinelit data base but the minor peak (m/z 821.3983) is
unknown. Since they differ by 2H+, peak 2 is possibly an analog that may have been
formed from compound oxidation as the standard was semi-synthetic in nature.
Therefore, the above evidence terminated the use of rifampicin in the current work as
optimization of TLC was set. Consequently, the pure Salinispora isolates were
Percentage Salinispora strains vs Cluster group
38%
28%
10%
24%
0
2
4
6
8
10
12
1 2 3 4
Cluster group
Perc
enta
ge S
alin
ispo
ra s
trai
ns
Strains
64
considered as the only suitable standard for TLC. However, the Rif standard was
continuously used in TLC chromatograms as a positive control in bioautography.
3.6 Phylogenetic Diversity of the Salinispora Genera
3.6.1 Sequencing Reports A total of 29 strains were sent for 16S rRNA sequencing to the Scripps Institution of
Oceanography in the USA. Structural integrity and cell viability were observed to be
the main problems as cold storage was necessary to keep the DNA intact. The issue
arose from freighting delays. Thus samples were re-sent for sequencing in two
instances due to freighting delays. Strain numbers 1300, 1329, and 1437 were re-sent
due to gDNA purity causing signal noises in sequencing. Each sample was viewed in
gel electrophoresis for purity and yield with 90% of stains exhibiting normal gDNA
lengths.
3.6.2 16s rRNA Sequencing and Data Analyses
PCR products were sequenced using a sequence ABI scanner at SCRIPPS in
California under the IAS and SCRIPPS collaboration. Appendix A1 shows the
reliable sequence lengths taken from the varying regions of 16S rRNA (1600
nucleotides) ranging from 250-1000 bps and aligned using MUSCLE EBI. From
partial sequences gathered, a large number of sequenced strains appeared to have a
98-99% sequence identity to S. arenicola with the exception of 1380, 1424 and 720
(Table 10). The observed substitution patterns coupled with their lack of antibacterial
and antifungal activities supported their 100% sequence identity to S. pacifica.
However, 1288, 720, and 1275 could not be included into the reconstruction process
owing to their short sequence lengths.
3.6.3 Phylogenetic Analysis
Sequences were pasted onto Multiple Accurate and Fast Sequence Comparison by
Log-Expectation (MUSCLE EBI) and CLUSTAL X Version 2.0 and aligned. Since
the first few sequences were irregular and therefore unreliable, they were not
included. Sequence data were indel recoded 9 to allow tree distances to reflect true
9 Editing method used to remove deletions and insertions in a nucleotide sequence
65
relatedness of taxa on a tree. A bootstrap analysis10 was not subjected to the strains
as little variability was observed within a clade.
(a) Indel Recoded
---------------------------------------------------------------------------------------------CTTACACATGCA 1263 ---------------------------------------------------------------------------------------------CTTACACATGCA 1403 ---------------------------------------------------------------------------------------------CTTACACATGCA 1070 ---------------------------------------------------------------------------------------------CTTACACATGCA 1246 ---------------------------------------------------------------------------------------------CTTACACATGCA 1256 TGGAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCTTACACATGCA S. arenicola NPS -14803
(b) Miss called base pairs from sequencing
--TGCAAGTCGAGCGGAAAGGCCCTTCGGGGTACTCGAGCGGCGAACGGGT 1295 --TGCAAGTCGAGCGGAAAGGCCCTTCGGGGTACTCGAGCGGCGAACGGGT 652 CATGCAAGTCGAGCGGAAAGGCCCTTCGGGGTACTCGAGCGGCGAACGGGT 587 --TGCAAGTCGAGCGGAAAGGCCCTTCGGGGTACTCGAGCGGCGAACGGGT 559
Figure 14. a) Indel recoding of regions at the beginning of the sequences. Shaded is a coded
region showing base pairs missing in the previous five samples. b) Missing base pairs which were
miss called by the sequencing machine.
A sequencing miss call at the 1-10bp region may have resulted in the lower
percentage identity of most of the strains giving the 99% identity revealed in some
BLAST results. Two base pairs are observed to be missing as shown in figure 14 (b).
The high G + C content of the samples are evident in their strong signal intensities.
Signal intensities and peak shape were also considered when checking for indel
regions and sequence accuracies.
3.6.4 Re-construction of Phylogenetic Trees The distance methods UPGMA, Neighbour Joining Methods and Maximum
Parsimony were successfully applied to data and respective trees generated. As
observed from the reconstruction data, the core clades for all reconstruction methods
10 Algorithm designed to search for a maximum parsimony tree when n>20 and n is the sample number
66
are the S. arenicola (clade 3) identical strains. Although positioning of certain clades
are the same in UPGMA (figure 16) and Neighbour Joining (NJ) (figure 17), they
appear to be different in Maximum Parsimony (MP) (figure 15) owing to the
different algorithms these methods use to generate phylogenetic data. The MP
method searches for the shortest branch route possible to explain evolutionary
relationships. Branch lengths are not present as boot strapping has not been applied
as only regions from clade 1 and 2 are suitable for bootstrapping (Felsenstein, 1985).
Clades 1 and 2 belong to strains from the other two Salinispora species i.e. S. tropica
and S. pacifica which were extracted from the NCBI database. Again, ATCC
numbers are shown for convenience. Out-groups included in analysis are
Micromonospora and Solwaraspora. Strain 992 has been classified into Clade 3
although it was observed to display 100% identity to sponge isolated bacteria from
the NCBI database. In addition, MV0004 and YKPC3 have also been included into
Clade 3 in spite of their unformalized status.
67
Figure 15. Maximum Parsimony tree generated with 16rRNA sequences using PhyML
program and Mesquite treeview.
Clade 1
Outgroup
Clade 2
Clade 3
68
Figure 16. UPGMA tree for sequences generated with 16S rRNA sequences using PAUP vers
4.10. Scale represents substitutions per site.
Outgroup
Clade 1
Clade 2
Clade 3
69
Figure 17. Neighbour Joining tree for most sequence generated from 16S rRNA sequences. Tree was constructed using PAUP ver 4.10 and treeview programs.
Outgroup
Clade 1
Clade 2
Clade 3
70
Table 10. Maximum Sequence Identities from nucleotide BLAST in NCBI (blastn11 tool)
# Samples Sequence length Closest BLAST Hit % Sequence ID
1 1052 843 S. arenicola 99
2 1072 739 S. arenicola 99
3 1075 900 S. arenicola/ S. sp 99
4 1070 918 S. arenicola/ S. sp 100
5 1256 877 S. arenicola 99
6 1262 840 S. arenicola/ S. sp 100
7 1263 964 S. arenicola/ S. sp 100
8 1293 954 S. arenicola/ S. sp 100
9 1305 859 S. arenicola 99
10 1308 750 S. arenicola 99
11 1380 789 S. pacifica 99
12 1403 939 S. arenicola/ S. sp 100
13 1416 911 S. arenicola/ S. sp 99
14 1431 738 S. arenicola/ S. sp 99
15 1246 796 S. arenicola/ S. sp 100
16 992 624 S. arenicola/ S. sp 99/100
17 1377 887 S. arenicola/ S. sp 100
18 1406 937 S. arenicola 99
19 *1424 897 S. pacifica 100
20 1294 900 S. arenicola/ S. sp 100
21 1295 1367 S. arenicola 100
22 785 1144 S. arenicola/ S. sp 100
23 1300 1291 S. arenicola 100
24 1288 300 S. arenicola 98
25 1275 150 S. arenicola 100
11 Blast search for nucleotides sequences only deposited in the NCBI data base
71
26 720 496 S. sp AE70 98
27 *652 1367 S. arenicola/ S. sp 100
28 587 1367 S. arenicola/ S. sp 100
29 559 1367 S. arenicola 99
S. sp – Salinispora species * S. pacifica new sequence type
4.0 Sequencing Analyses of 16S rRNA Genome
Twenty-nine gDNA extracts were sent for sequencing to the SCRIPPS Institute of
Oceanography based at the University of San Diego, California and data were
generated using an ABI 3100 DNA sequencer at the DNA Sequencing Shared
Resource, UCSD. The four stages of phylogenetic analysis as mentioned by Pervsner
(2003) were subjected to the strain sequences once sequences were received. These
included;
1. Selection of sequences for analysis (reliable regions)
2. Multiple sequence alignment for homologous nucleic acid sequences
(MUSCLE EBI and CLUSTAL X)
3. Tree building using PAUP and PHYML software (UPGMA, Neighbour
Joining, Maximum Likelihood)
4. Tree evaluation (Boot strap or heuristic search) if required for the trees
As only partial sequences were obtained, sequence lengths analyzed were variable
(ranging from 400-900bp in Appendix 4) due to only reliable regions being chosen
for further analyses. Indel12 recoding was required to remove indel polymorphisms
observed in the sequences (Chaux et al., 2007). This was a necessary step to avoid
misinterpretation of data and further complications when using tree inference and
distance matrices algorithms to reconstruct phylogenetic trees. A simple measure that
can be accounted for multiple sequence alignments is the amino acid differences
between two sequences. It has been practiced by most phylogeneticists to eliminate
all gaps or indels when many sequences are compared (Nei and Kumar, 2000).
12 Has different meaning in different fields. In molecular biological terams, it refers to mutation class involving either a deletion or a insertion.
72
4.1 Effects of Horizontal Gene Transfer A number of strains revealed 99% species identity to sponge isolated bacteria as
noted on table 10. Due to this aspect, strain 992 was of high interest owing to its
massive inhibition in the antibacterial line of screening and its blast identity showing
100% homology to a Red Sea sponge extracted Salinispora spp. with the accession
number GQ16317 and surprisingly to a second sponge isolated Salinispora with
NCBI identification YKPC1. The possible presence of staurosporine may have been
the cause for the occurance of this patterns. Interest in these sponge isolated bacteria
stems from the fact that strain’s 652 and 1424 exhibited no inhibitory activity against
the antibacterial testing panel but showed significant activity in the BSA tests thus
showed similar activity to S. pacifica new sequence types which have isolated from
sponge. These data suggests the possibility of HGT within the Salinispora genera in
addition to previously published data by Penn et al. (2009); Kim et al. (2006) and
Jensen et al. (2005). The isolation and mass culture of these S. pacifica sequence
types presents natural products chemists with a vast source of natural products.
Research by Gandhimathi et al. (2008) describes the antimicrobial potential of
culturable endosymbiotic marine actinomycetes as enormous and unexplored and
may indeed be an avenue to isolate compounds that would otherwise be difficult to
isolate, as they possibly are present as minor constituents (Clardy, 2005).
4.2 Phylogenetic Inference from Reconstruction Process
Molecular phylogenetics aims to show relationships between organisms and
molecules through the use of molecular techniques (Pervsner, 2003). While
morphological systematics together with its phylogenetic branch evolved prior to the
new technique, molecular phylogenetics has been highly utilized in modern day to
represent evolutionary data due to the conserved and variable regions present in
relatively all organisms existing in their DNA and rRNA structures. While, most
systematicists prefer inference methods over the traditional distance methods, the
assumption that all strains in the project sample list are Salinispora (from
morphological and grams test) and thus have almost equal substitution rate from the
73
molecular clock hypothesis13 is a reason why distance based methods has been
employed to re-construct phylogenetic trees.
Although Salinispora tropica has been profiled from presumptive tests (TLC-
bioautography, BSA, SW and 3% KOH tests) sequencing results showed that there
were no S. tropica strains detected but only S. pacifica and S. arenicola.
Interestingly, two sequence types (652 and 1424) detected appeared to be grouped to
a new Salinispora sequence type found in the NCBI database designated YKPC3 and
YKPC1 (344bp) from Fig 14, 15 and 16. Interestingly, genomic mining on a S.
pacifica (CNT-133) strain isolated from a Fiji sediment has led to the discovery of
Salinosporamide K (Eustaquio et al., 2011), an analog of the proteosome inhibitor
Salinosporamide A currently in phase I clinical trials. As these proteosome inhibitors
would furnish anti-cancer activity in any normal non-mechanistic assay such as the
BSA currently performed at IAS, this could explain false positives for S. tropica
detected in TLC-bioautography profiling due to the mimicking effects observed in
assays from these S. pacifica new sequence types caused by this new analog and the
existance of strains like 652 and 1424 in the collection.
A recent comparative study has uncovered the full extent of secondary metabolite
gene clusters in S. tropica and S. arenicola furnishing 19 and 30 secondary
metabolite gene clusters respectively. Furthermore, three biosynthetic products from
the S. arenicola SA pksnrps1, SA pks2 and SA pksnrps2 gene clusters are
undetermined yet in addition to 13 bio-actively undetermined gene clusters for the
same (Penn et al., 2009). The immense genotypic capacity of S. arenicola supports
its cosmopolitan distribution and diversity as these secondary metabolites have been
reported to serve: (i) as competitive weapons used against other bacteria, fungi,
amoebae, and large animals; (ii) as metal transporting agents; (iii) as agents of
symbiosis between microbes and invertebrates (iv) as sexual hormones; (v) as a
communication mechanism between bacteria coordinating interactions and (vi) as
differentiation effectors (Demain & Fang, 2000). Therefore, the utilization of a wide
array of media formulations may accomplish culture of endosymbiotic bacteria and
13 Uses fossil constraints or rates of molecular change to deduce time in molecular history of when two species or taxa may have diverged.
74
inducing stress to these strains could up-regulate specific genes responsible for
secondary metabolite production.
Different substitution patterns were observed between the sequencing data generated
and the cluster patterns from the exploratory TLC results. Notably, the two S.
pacifica strains were observed to produce highly non-polar compounds at Rf =0.8-0.9
with the exception of strain 559 in group 3. Triplet changes at positions 76 to 78 can
be observed as the two strains showed “TGG” while S. arenicola strains displayed
the “CAT” base triplets at the same positions. Other differences included changes at
base positions 81 and 151 relative to S. arenicola identical strains. Surprisingly, the
“TGG” base triplets can also be found in S. tropica strains included in the analysis.
These substitution patterns are possible evidence of the divergence of S. tropica and
S. pacifica thousands of years ago. Interestingly, strain 652 and 1424 which appeared
to be new sequence types for S. pacifica have been grouped into cluster group 2 with
base pair changes noticeable at positions 416 and 152. The “CAT” base triplets at
positions 75 to 77 has been subsituted for the “TGG” base triplets at the same
positions for CNR114. Besides these notable patterns, no differences could be
observed for strain 652 and 1424 against all other strains including those matching
100% identity to sponge isolated Salinispora. Although no significant substitution
pattern can be observed for strains in groups 1 and 4, they may be designated as the
S. arenicola cluster groups as 94% are active against the pathogenic bacterial assays.
A minor 39.1% from the 100 samples were not active in cytotoxicity tests or may
have required a higher concentration in the tests in order to show any activity. Figure
18 shows the Salinispora species composition from the 80 sediment samples. Note
the absence of S. tropica from the graph. This omission has been drawn from
extensive work by Jensen et al. (2006) and Freel et al. (2011) since S. tropica and S.
pacifica have not been found to co-exist in the same location. Therefore, previous
hits for S. tropica from the presumptive tests could well be these new S. pacifica
sequence types that have been detected in two of the 29 strains sent for DNA
analysis. Although, sequencing has not been done for 8 of the 10 S. pacifica-N strains
(from the 100 sample number), antibiotic activity data and BSA results (Appendix 3,
Table 10.) suggest that they lie within or close to the S. pacifica clade. A more
extensive DNA analysis, which would include these 8 strains, may shed more light
75
on this issue and show whether they belong to the S. pacifica-N or the S. tropica
clades. In addition, further analyses of ferment extract through HPLC separation of
fractions and corresponding LCMS and NMR analysis of these strains may yet reveal
some new compounds in the taxa.
Figure 18. The percentage of Salinispora composition in 80 sediment samples collected from the
Fijian ocean. The pie graph was generated using the combined presumptive data and the 16S
rRNA data from the study. S. pacifica-N represents the S. pacifica new sequence types.
10%
16%
74%
S. pacifica-N
S. pacifica
S. arenicola
76
4.3 Conclusion
A total of 100 actinomycetes matching the morphology of the marine obligate
Salinispora bacteria were isolated from 80 sediment samples collected from the
Fijian ocean. Growth requirement tests on 1/10 M1A media prepared with deionized
water confirmed their obligate requirement of seawater for growth. Antibacterial
assays against MRSA, WTSA, and VREF showed strong activity for 25% of the
sample strains. However, antifungal assays were all negative. The brine shrimp assay
revealed some interesting results as certain strains e.g. 652 and 1424 exhibited S.
tropica like behaviour in lacking antibacterial activity but showing high activity in
BSA tests. However, poor sequences were acquired for strains 1275 and 720 due to
freighting delays. Strain 652 and 1424 were found to be new sequence types for S.
pacifica based on bioassay, BSA and 16S rRNA data. Chemotaxonomy was
accomplished through TLC co-chromatography with standard Salinispora taxa
fermented extracts producing four TLC profiles, which were further screened in bio-
autography. This revealed 29 strains differing from normal standard Salinispora TLC
profiles. Genomic analyses in 16S rRNA showed 86.2% of the strains with 99-100%
sequence identity to S. arenicola and 6.9% of the strains displaying 99-100%
homology to S. pacifica with a further 6.9% representing new sequence types of S.
pacifica.
The diversity and abundance of S. arenicola was significant in the screening aspect
leading to more hits detected for the species. Although the discovery of a
Salinosporamide K producing gene in S. pacifica from recent work may have raised
questions about the species-specific concept of secondary metabolite production, it
shows that there is certainly more work required to be done on the genera to fully
realize their maximum potential for secondary metabolite production. The
application of correlation studies involving chemotaxonomy and phylogenetic
analysis such as performed in this project are observed to be effective techniques in
investigating how minor nucleotide substitutions can influence secondary metabolite
production and thus reveal finer details into inter and intra-species evolutionary
processes such as that which appears to be present for S. tropica and S. pacifica. As
compared to its terrestrial relatives such as Micromonospora and Streptomyces which
77
have diverged within the species level, the Salinispora have not been observed to
show any new diversity within the species level possibly owing to the presence of
less selective pressures to drive speciation events.
The apparent substitution patterns observed for the three clades were mimicked by
homologous strains isolated from this study and are evidence of the isolated strains
taxon designations at species level. It also reveals the species diversity of the
Salinispora pacifica within the Fiji region even up to the sub-species level.
Presumptive identification through morphological identification, selective growth
requirements, chemical tests and TLC-bioautography are by no means replacements
for the accuracy and precision offered by 16S rRNA analysis for the delineation of
bacteria at the genus, species and even at sub-species level. However, a synergistic
approach such as applied in this study establishes a more robust course of action in
natural products search strategies. The study appears to be in agreement with current
knowledge on the distribution patterns of the Salinispora genera especially the non-
occurrence of S. tropica and S. pacifica in the same local. However, the composition
of S. pacifica and its new sequence types in the Fiji region can be seen in this study
to be highly underestimated. A more extensive sample size and DNA analysis of
strains with similar chemotype and morphotype might give a clearer view into the
true diversity and distribution of this species.
78
References
American Psychological Association (APA): co-chromatography. (n.d.).
Merriam-Webster's Medical Dictionary. Retrieved April 27, 2011, from
website: http://dictionary.reference.com/browse/cochromatogr-aphy.
Bently, S.D. and Chater, K.F. 2002. Complete genome sequence of the model
actinomycete Streptomyces coelicolor. In Jensen, P.R., Mincer, T.J., Philip
G.W. and Fenical, W. 2005. Marine actinomycete diversity and natural
product discovery. Antonie Leeuwenhoek. 87, 43–48.
Bora, N. and Ward, A.C. 2006. Diversity and biogeography of marine
actinobacteria. Curr. Opin. Microbiol. 9, 279-286.
Bours, V., Franzoso, G., Azarenko, V., Park, S., Kanno, T., Brown, K. and
Siebenlist, U. 1993. The oncoprotein Bcl-3 directly transactivates through κ B
motifs via association with DNA-binding p50B homodimers. Cell. 72(5),
729–739.
Buchanan, G.O., Williams, P.G., Feling, R.H., Kauffman, C.A., Jensen, P.R.
and Fenical, W. 2005. Sporolides A and B: Structurally Unprecedented
Halogenated Macrolides from the Marine Actinomycete Salinispora tropica.
Org. Lett. 7(13), 2731-2734.
Bull, A.T., Stach, J.E.M., Ward, A.C. and Goodfellow, M. 2005. Marine
Actinobacteria: perspectives, challenges, future directions. Antonie
Leeuwenhoek. 87, 65-79.
Carballo, J.L., Hernandez-Inda, Z.L., Perez, P. and Garcia-Gravalos, M.D.
2002. A comparison between two brine shrimp assays to detect in vitro
cytotoxicity of marine natural products. BMC Biotechnol. 2(17), 1-5.
Cardoso L.S., Araujo M.I., Goes, A.M., Pacífico, L.G., Oliveira, R.R. and
Oliveira, S.C. 2007. "Polymyxin B as inhibitor of LPS contamination of
79
Schistosoma mansoni recombinant proteins in human cytokine analysis".
Microb. Cell Fact. 6, 1.
Cerning, J. 1995. Production of exopolysaccharides by lactic acid bacteria
and dairy Propionibacteria. Lait. 75, 463 – 472.
Chaux, N., Messer, P.W. and Arndt, P.F. 2007. DNA indels in coding regions
reveal selective constraints on protein evolution in the human lineage. BMC
Evol. Biol. 7 (191), 1-12.
Cho, J.C. and Tiedje, J.M. 2000. Biogeography and degree of endemicity of
fluorescent Pseudomonas strains in soil. In Jensen, P.R., Mafnas, C. 2006.
Biogeography of the marine actinomycete Salinispora. Environmen.
Microbiol. 8(11), 1881-1888.
Choma, I. 2005. The Use of Thin-Layer Chromatography with Direct
Bioautography for Antimicrobial Analysis. LCGC. 18(9).
Chopade, V.V., Lakade, S., Suvarna, J.K., Polshettiwar, S.A. and Wani, M.S.
2008. Validated Analytical Methods For Determination Of Active Ingredients
From Bulk Drugs And Pharmaceutical Dosage Forms. Pharmaceu. Rev. 6(1).
Clardy, J. 2005. Minireview. Using genomics to deliver natural products from
symbiotic bacteria. Genome Biol. 6, 232-235.
Clarridge, J.E. 2004. Impact of 16S rRNA Gene Sequence Analysis for
Identification of Bacteria on Clinical Microbiology and Infectious Diseases.
Clin. Microbiol. Rev. 17(4), 840-862.
Cohan, F.M. 2002. What are bacterial species? In Jensen, P.R. and Mafnas,
C. 2006. Biogeography of the marine actinomycete Salinispora. Environmen.
Microbiol. 8(11), 1881-1888.
Dass, S., Ward, L.R. and Burke, C. 2010. Screening for marine Streptomyces
spp. For potential use as probiotics in aquaculture. Aquaculture. 305, 32-41.
Debry, R.W. and Slade, N.A. 1985. Cladistic analysis of restriction
endonuclease cleavage maps within maximum-likelihood framework. In
80
Hills, D.M., Moritz, C. and Mable, B.K. Molecular Systematics 2nd Edition.
Massachusetts, USA: Sinauer Associates, Inc, 1996. pp 420-421.
Demain, A.L. and Fang, A. 2000. The natural functions of secondary
metabolites. Adv. Biochem. Eng. Biotechnol. 69, 1-39.
DMSO Product bulletin. 2007. Gaylord Chemical Company, USA. Bulletin
123B.
Dong-Chan, O., Williams, P.G., Kauffman, C.A., Jensen, P.R. and Fenical,
W. 2006. Cyanosporasides A and B, Chloro- and Cyano-cyclopenta[a] indene
Glycosides from the Marine Actinomycete “Salinispora pacifica”. Org. Lett.
8(6), 1021-1024.
Dong-Chan, O., Gontang, E.A., Kauffman, C.A., Jensen, P.R. and Fenical,
W. 2008. Salinipyrones and Pacificanones, Mixed-Precursor Polyketides
from the Marine Actinomycete Salinispora pacifica. J. Nat. Prod. 71, 570-
575.
Doolittle, W.F. 1999. Phylogenetic classification and the universal tree of life.
In Jensen, P.R., Williams, P.G., Oh, D., Zeigler, L. and Fenical, W. 2007.
Species-specific Secondary Metabolite Production in Marine Actinomycetes
of the Genus Salinispora. Appl. Environ. Microbiol. 73(4), 1146-1152.
Dunlap, W.C., Jaspars, M., Hranueli, D., Battershill, C.N., Peric- Concha, N.,
Zucko, J., Wright, S. and Long, P.F. 2006. New methods for medicinal
chemistry – universal gene cloning and expression systems for production of
marine bioactive metabolites. Curr. Med. Chemistry. 13, 697–710.
Ennis, H.L. and Lubin, M. 1964. Cycloheximide: Aspects of Inhibition of
Protein Synthesis in Mammalian Cells. Science. 146, 1474-1476.
Eustaquio, A.S., Nam, S., Penn, K., Lechner, A., Wolson, M.C., Fenical, W.,
Jensen, R.P. and Moore, B.S. 2011. The Discovery of Salinosporamide K
from the Marine Bacterium “Salinispora pacifica” by Genome Mining Gives
Insight into Pathway Evolution. Chem. Bio. Chem. 12, 61 – 64.
81
Fenical, W. and Jensen, P. 2006. Developing a new Resource of drug
discovery: marine actinomycete bacteria. Nat. Chem. Biology. 2(12), 666-
673.
Fish, S.A. and Codd, G.A. 1994. Bioactive compound production by
thermophilic and thermotolerant cyanobacteria (blue-green algae). World J.
Microb. Biot. 10, 338-341.
Fox, G.E., Pechman, K.R. and Woese, C.R. 1977. Comparative cataloging of
16S ribosomal ribonucleic acid: molecular approach to prokaryotic
systematics. Int. J. Syst. Bacteriol. 27, 44-57.
Felsenstein, J. 1985. Confidence limits on phylogenetics: An approach on
using the boot strap. Evol. 39, 783-789.
Fieseler, L.A., Quaiser, C., Schleper, C. and Hentschel, U. 2006. Analysis of
the first genome fragment from the marine sponge-associated, novel
candidate phylum Poribacteria by environmental genomics. Environ.
Microbiol. 8, 612– 624.
Freel, K., Nam, S., Fenical, W. and Jensen, P.R. 2011. Evolution of
Secondary Metabolite Genes in Three Closely Related Marine Actinomycete
Species. Appl. Environ. Microbiol. 77 (20), 7261-7270.
Friedrich A.B., Hacker, J., Fischer, I., Proksch, P. and Hentschel, U. 2001.
Temporal variation of the microbial community associated with the
Mediterranean sponge Aplysina aerophoba. In Gandhimathi, R., Arunkumar,
M., Selvin, J., Thangavelu, T., Sivaramakrishnan, S., Kiran, G.S.,
Shanmughapriya, S. and Natarajaseenivasan, K. 2008. Antimicrobial
potential of sponge associated marine actinomycetes. J. Mycol. Med. 18, 16—
22.
Galperin, M.Y. 2007. Genomics against flatulence. Environ. Microbiol. 9(8),
1869–1877.
82
Gandhimathi, R., Arunkumar, M., Selvin, J., Thangavelu, T.,
Sivaramakrishnan, S., Kiran, G.S., Shanmughapriya, S. and
Natarajaseenivasan, K. 2008. Antimicrobial potential of sponge associated
marine actinomycetes. J. Mycol. Med. 18, 16—22.
Gontang, E.A., Fenical, W. and Jensen, P.R. 2007. Phylogenetic Diversity of
Gram- Positive Bacteria Cultured from Marine Sediments. Appl. Environ.
Microbiol. 73(10), 3272-3282.
Grossart, H.P., Schlingloff, A., Bernard, M., Simon, M. and Brinkoff, T.
2004. Antagonistic activity of bacteria isolated from organic aggregates
isolated from the German Wadden Sea. In Lam, K.S. 2006. Discovery of
novel metabolites from marine actinomycetes. Curr. Opin. Microbiol. 9, 245-
251.
Halebien, S., Harris, B., Finegold, S.M. and Rolfe, R.D. 1981. Rapid method
that aids in distinguishing gram–positive from gram-negative anaerobic
bacteria. J. Clin. Microbiol. 13(3), 444-448.
Hanka, L.J. and Barnett, M.S. 1974. Microbiological Assays and
Bioautography of Maytansine and Its Homologues. Antimicrob. Agents
Chemother. 6(5), 651-652.
Han, S.K., Nedashkovzkaya, O.I., Mikhailov, V.V., Kim, S.B. and Bae, K.S.
2003. Salinibacterium amurkyense gen. nov., sp. nov., a novel genus of the
family Microbacteriaceae from the marine environment. Int. J. Syst. Evol.
Microbiol. 53, 2061–2066.
He, H., Ding, W.D., Bernan, V.S., Richardson, A.D., Ireland, C.M. and
Greenstein, M. 2001. Lomaiviticins A and B, potent antitumor antibiotics
from Micromonospora lomaivitensis. J. Am. Chem. Soc. 123, 5362-5363.
Hentschel, U., Hopke, J., Horn, M., Friedrich, A.B., Wagner, M., Hacker, J.
and Moore, B.S. 2002. Molecular evidence for a uniform microbial
community in sponges from different oceans. Appl. Environ. Microbiol.
68,4431-4440.
83
Hills, D.M. 1987. Molecular versus Morphological Approaches in
Systematics. In Weins, J.J. Phylogenetic Analysis of Morphological Data.
Washington, USA: Smithsonian Institution, 2000. pp 5-30.
Hillis, D.M. and Wiens, J.J. 2000. Molecules versus Morphology in
Systematics. In Weins, J.J. Phylogenetic Analysis of Morphological Data.
Washington, USA: Smithsonian Institution, 2000. pp 3-10.
Huang, X., He, J., Niu, X., Menzel, K., Dahse, H., Grabley, S., Feidler, H.,
Sattler, S. and Herweck, C. 2008. Benzopyrenomycin, a Cytotoxic Bacterial
Polyketide Metabolite with a Benzo[a]pyrene-Type Carbocyclic Ring
System. Angew. Chem. Int. Edit. 47, 3995 –3998.
Imamura, N., Nishijima, M., Adachi, K. and Sano, H. 1993. Novel antimycin
antibiotics, urauchimycins A and B, produced by marine actinomycete. J.
Antibio. 46, 241-246.
Iscan, G., Kirimer, N., Kurkguoglu, M., Baser, K.H.C. and Demirci, F. 2002.
Antimicrobial Screening of Mentha piperita Essential Oils. J. Agri. Food
Chem. 50, 3943-3946.
Jensen, P.R., Mincer, T.J., Williams, P.G. and Fenical, W. 2005. Marine
actinomycete diversity and natural product discovery. Antonie Leeuwenhoek
87, 43–48.
Jensen, P.R. and Mafnas, C. 2006. Biogeography of the marine actinomycete
Salinispora. Environ. Microbiol. 8(11), 1881-1888.
Jensen, P.R., Williams, P.G., Oh, D., Zeigler, L. and Fenical, W. 2007.
Species-specific Secondary Metabolite Production in Marine Actinomycetes
of the Genus Salinispora. Appl. Environ. Microbiol. 73(4), 1146-1152.
Kalakoutskii, L.V. and Agre, N.S. 1976. Comparative Aspects of
Development and Differentiation in Actinomycetes. Bacteriol. Rev. 40(2),
469-524.
84
Kim, T.K., Garson, M.J. and Fuerst, J.A. 2005. Marine Actinomycetes related
to the Salinispora group from the Great Barrier Reef sponge Pseudoceratina
clavata. Environ. Microbiol. 7, 509-518.
Kim, T.K., Hewavitharana, A.K., Shaw, P.N. and Fuerst, J.A. 2006.
Discovery of a New Source of Rifamycin Antibiotics in the Marine Sponge
Actinobacteria by Phylogenetic Prediction. Appl. Environ. Microbiol. 72(3),
2118-2125.
Korostelev, A., Trakhanov, S., Laurberg, M. and Noller, H.F. 2006. Crystal
structure of a 70S ribosome-tRNA complex reveals functional interactions
and rearrangements. Cell. 126(6), 1065-1077.
Kumar, S. and Gadagkar, S.R. 2000. Efficiency of the Neighbor-Joining
Method in Reconstructing Deep and Shallow Evolutionary Relationships in
Large Phylogenies. J. Mol .Evol. 51, 544-553.
Kwon, H.C., Kauffman, C.A., Jensen, P.R. and Fenical, W. 2006.
Marinomycins A-D, Antitumor-Antibiotics of a New Structure Class from a
Marine Actinomycete of the Recently Discovered Genus Marinispora. J. Am.
Chem. Soc. 128, 1622 – 1632.
Kwon, H.C., Kauffman, C.A., Jensen, R.P. and Fenical, W. 2009.
Marinisporolides, Polyene-Polyol Macrolides from a Marine Actinomycete of
the New Genus Marinispora. J. Org. Chem. 74, 675–684.
Lam, K.S. 2006. Discovery of novel metabolites from marine actinomycetes.
Curr. Opin. Microbiol. 9, 245-251.
Lawrence, J.G. 1997. Selfish operons and speciation by gene transfer. In
Jensen, P.R., Williams, P.G., Oh, D., Zeigler, L. and Fenical, W. 2007.
Species-specific Secondary Metabolite Production in Marine Actinomycetes
of the Genus Salinispora. Appl. Environ. Microbiol. 73(4), 1146-1152.
85
Lee, H.K., Lee, D.S., Lim, J., Kim, J.S., Im, K.S. and Jung, J.H. 1998.
Topoisomerase I inhibitors from the Streptomyces sp. strain KM86-9B
isolated from a marine sponge. Arch. Pharm. Res. 21, 729-733.
Lepock, J.R. 2005. How do cells respond to their thermal environment? Int. J.
Hyperthermia. 21(8), 681-687.
Liu, R., Cui, C.B., Duan, L., Gu, Q.Q. and Zhu, W.M. 2005. Potent in vitro
anticancer activity of metacycloprodigiosin and undecylprodigiosin from a
sponge derived actinomycete Saccharopolyspora sp. nov. Arch. Pham. Res.
28, 1341-1344.
Lord, C.E.C. and Tirimanna, A.S.L. 1976. A Qualitative study of the
Carotenoid Pigments of Sri Lankan Chillies (Capsicum annum). Microchim.
Acta. 1, 469-476.
Lough, W.J. and Wainer, I.W. 1996. Modes of Chromatography in High
Performance Liquid Chromatography; Fundamental Principles and Practice.
In Touchstone, J.C. and Dobbins, M.F., 1983. Practice of Thin layer
Chromatography, 2nd Edition. John Wiley and Sons, New York, USA. pp
290-300.
Maddison, W.P. and Maddison, D.R. 2011. Mesquite: A modular system
for evolutionary analysis. Version 2.75. Retrieved June 2010 from
http://mesquiteproject.org
Magarvey, N.A., Keller, J.M., Bernan, V., Dworkin, M. and Sherman, D.H.
2004. Isolation and characterization of Novel Marine-Derived Actinomycetes
Taxa Rich in Bioactive Metabolites. Appl. Environ. Microbiol. 70(12), 7520-
7529.
Maldonado, L.A., Fenical, W., Jensen, P.R., Kauffman, C.A., Mincer, T.J.,
Ward, A.C., Bull, A.T. and Goodfellow, M. 2005. Salinispora arenicola gen.
nov. sp. nov and Salinispora tropica sp. nov., obligate marine actinomycete
belonging to the family Micromonosporaceae. Inter. J. Syst. Evol. Microbiol.
55, 1759-1766.
86
Marmur, J. 1961. A Procedure for the isolation of Deoxyribonucleic acid
from micro-organisms. J. Mol. Biol. 3(2), 208-218.
Martin. D.A., Tan, L.T., Jensen, P.R., Dimayuga, R.E., Fairchild, C.R.,
Raventos-Suarez, C. and Fenical, W. 2007. Marmycins A and B, Cytotoxic
Pentacyclic C-Glycosides from a Marine Sediment- Derived Actinomycete
Related to the Genus Streptomyces. J. Nat. Prod. 70, 1406-1409.
McNally, D.J., Wurms, K.V., Labbe, C., Quideau, S. and Belanger, R.R.
2003. Complex C-Glycosyl Flavonoid Phytoalexins from Cucumis sativus. J.
Nat. Prod. 66, 1280-1283.
Material and Safety data sheet Dimethyl Sulfoxide (DMSO). 2004. Gaylord
Chemical Corporation.
Mercadante, A.Z., Britton, G. and Rodriguez-Amaya, D.B. 1998. Carotenoids
from Yellow Passion Fruit (Passiflora edulis). J. Agric. Food Chem. 46,
4102-4141.
Meyers, E. and Smith, D. 1964. In Choma, I. 2005. The Use of Thin-Layer
Chromatography with Direct Bioautography for Antimicrobial Analysis.
LCGC. 18(9). Retrieved, August 5, 2010, from http://www.chromatography
online.com.
Montalvo, N.F., Mohamed, N.M., Enticknap, J.J. and Hill, R.T. 2005. Novel
actinobacteria from marine sponges. Antonie Van Leeuwenhoek. 87, 29-36.
Moritz, C. and Hills, D.M. 1996. Molecular Systematics: Context and
Controversies. In Hills, D.M., Moritz, C. and Mable, B.K. Molecular
Systematics 2nd Edition, Massachusetts, USA: Sinauer Associates, Inc, 1996.
pp 1-11.
Mincer, T.J., Jensen, P.R., Kauffman, C.A. and Fenical, W. 2002.
Widespread and persistent populations of a major new actinomycete taxon in
ocean sediments. Appl. Environ. Microbiol. 68, 5005-5011.
87
Mincer, T.J., Fenical, W. and Jensen, P.R. 2005. Culture-dependent and
culture-independent diversity within the obligate marine actinomycete genus
Salinispora. Appl. Environ. Microbiol. 71, 7019-7028.
Miyamoto, M.M. and Cracraft, J. 1991. Phylogenetic inference, DNA
sequencing and the future of molecular systematics. In Miyamoto, M.M., and
Cracraft, J. Phylogenetic analysis of DNA sequences. New York, USA:
Oxford University Press, 1991. pp. 3-17.
Nei, M. and Kumar, S. 2000. Phylogenetic Inference: Maximum Parsimony
Methods in Molecular Evolution and Phylogenetics. Oxford University Press,
New York, USA. pp 115-164.
Nei, M., Stephens, J.C. and Saitou, N. 1985. Methods for computing the
standard errors of branching points in and evolutionary tree and their
applications to molecular data from humans to apes. Mol. Biol. Evol. 2, 66-
85.
Nicolaou, K.C. and Harrison, S.T. 2006. Total Synthesis of Abyssomicin C,
Atrop-abyssomicin C, and Abyssomicin D: Implications for Natural Origins
of Atrop-abyssomicin C. J. Am. Chem. Soc. 129 (2), 429-440.
Niner, B.N., Brandt, J.P., Villegas, M., Marshall, C.R., Hirsch, A. M. and
Valde´s, M. 1996. Analysis of partial sequences of genes coding for 16S
rRNA of actinomycetes isolated from Casuarina equisetifolia nodules in
Mexico. Appl. Environ. Microbiol. 62, 3034-3036.
Nostro, A., Germanoa, M.P., D'Angelo, V., Marino, A. and Cannatelli, M.A.
2000. Extraction methods and bioautography for evaluation of medicinal
plant antimicrobial activity. Lett. Appl. Microbiol. 30, 379-384.
Pelaez, F. 2006. The historical delivery of antibiotics from microbial natural
products—Can history repeat? Biochem. Pharmacol. 71, 981-990.
Penn, K., Jenkins, C., Nett, M., Udwary, D.W., Gontang, E.A., McGlinchey,
R.P., Fosters, B., Lapidus, A., Podell, S., Allen, E.E., Moore, B.S. and
88
Jensen, P.R. 2009. Genomic islands link secondary metabolism to functional
adaptation in marine Actinobacteria. The ISME Journal. 3, 1193-1203.
Pevsner, J. 2003. Molecular Phylogeny and Evolution in Bioinformatics and
Functional Genomics. John Wiley and Sons Inc, New Jersey, USA. pp 357-
389.
Poole, C.F. and Dias, N.C. 2000. Practitioner's guide to method development
in thin-layer chromatography. J. Chromatogr. A. 893, 123-142.
Prosek, M. and Vovk, I. 2003. Basic Principles of Optical Quatification in
TLC. In Sherma, J. and Fried, B. Hand Book of Thin Layer Chromatography.
Third Edition, Revised and Expanded. Chromatographic Science Series. Vol
89, pp 380-396.
Rahalison, I., Hamburger, M., Hostettmann, K. Monod, M. and Frenk, E.
1991. A Bioautographic Agar Overlay Method for the Detection of
Antifungal Compounds from Higher Plants. Phytochem. Analysis. 2, 199-203.
Reed, K.A., Manam, R.R., Mitchell, S.S., Xu, J., Teisan, S., Chao, T.,
Gordafaried D., Neuteboom, S.T.C., Lam, K.S. and Potts, B.C.M. 2007.
Salinosporamides D-J from the Marine Actinomycete Salinispora tropica,
Bromosalinosporamide, and Thioester Derivatives Are Potent Inhibitors of
the 20S Proteosome. J. Nat. Prod. 70, 269-276.
Rheims, H., Sproer, C., Rainey, F.A. and Stackebrandt, E. 1996. Molecular
biological evidence for the occurrence of uncultured members of the
actinomycete line of descent in different environments and geographical
locations. Microbiol. 142, 2863–2870.
Riedlinger, J., Reicke, A., Zahner, H., Krismer, B., Bull, A.T., Maldonado,
L.A., Ward, A.C., Goodfellow, M., Bister, B. and Bischoff, D. 2004.
Abyssomycins, inhibitors of the para – aminobenzoic acid pathway produced
by the marine Verrucosispora strain AB-18-032. J. Antibiot. 57, 271 – 279.
89
Roslev, P. and King, G.R. 1993. Application of a Tetrazolium Salt with a
water soluble Formazan as an indicator of viability in respiring bacteria. Appl.
Environ. Microbiol. 59(9), 2891-2896.
Runyoro, D.K.B., Matee, M.I., Ngassapa, O.D., Joseph, C.C. and Mbwambo,
Z.H. 2006. Screening for Tanzanian Medicinal Plants for Anti-Candida
activity. BMC Complement. Altern. Med. 6(11), 1-10.
Saito, N. and Nei, M. 1986. The number of nucleotides required to determine
the branching order of three species with special reference to the human-
chimpanzee-gorilla divergence. J. Mol. Evol. 24, 189-204.
Saitou, N. and Nei, M. 1987. The neighbour-joining method: A new method
for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406-425.
Scheuer, P.J. 1995. Marine Natural Products Research: A look into the dive
bag. J. Nat. Prod. 58(3), 335-343.
Seto, Y., Kogami, Y., Shimanuki, T., Takahashi, K., Matsuura, H. and
Yoshihara, T. 2005. Production of Phleichrome by Cladosporium phlei as
stimulated by diketopiperadines of Epichloe typhina. Biosci. Biotech. Bioch.
69(8), 1515-1519.
Shick, J.M. and Dunlap, W.C. 2002. Mycosporine-like amino acids and
related gradusols: biosynthesis, accumulation, and UV-protective functions in
aquatic organisms. Ann. Rev. Physiol. 64, 223-262.
Schmidt, E.W., Obraztsova, A.Y., Davidson, S.K., Faulkner, D.J. and
Haygood, M.G. 2000. Identification of the antifungal peptide-containing
symbiont of the marine sponge Theonella swinhoei as a novel delta-
proteobacterium, "Candidatus Entotheonella palauensis". Mar. Biol. 136,
969-977.
Smith, I. and Feinberg, J.G. 1972. Paper Chromatography. In Paper and Thin
Layer Chromatography and Electrophoresis 2nd Edition, London: Longman
Group. pp 1-31.
90
Soczewinski, E., Hawryl, M.A. and Hawryl, A. 2001. Retention behavior of
some flavonoids in 2D-TLC systems on cyano bonded polar phases.
Chromatographia. 54, 789-794.
Stach, J.E.M., Maldonado, L.A., Masson, D.G., Ward, A.C., Goodfellow, M.
and Bull, A.T. 2003. Statistical Approaches for Estimating Actinobacterial
Diversity in Marine Sediments. In Maldonado, L.A., Fenical, W., Jensen,
P.R., Kauffman, C.A., Mincer, T.J., Ward, A.C., Bull, A.T. and Goodfellow,
M. 2005. Salinispora arenicola gen. nov. sp. nov and Salinispora tropica sp.
nov., obligate marine actinomycete belonging to the family
Micromonosporaceae. Int. J. Syst. Evol. Microbiol. 55, 1759-1766.
Stackebrandt, E., Rainey, F.A. and Ward-Rainey, N.L. 1997. Proposal for a
new hierarchic classification system, Actinobacteria classis nov. Inter. J. Syst.
Evol. Microbiol. 47, 479-491.
Staley, J.T. and Gosink, J.J. 1999. Poles apart. Biodiversity and biogeography
of sea ice bacteria. Ann. Rev. Microbiol. 53, 189-215.
Stent, G.S. Genotypic characters. 1981. In Logan, N.A. 1994. Bacterial
Systematics. Cambridge, Massachusetts, USA: Blackwell Scientific
publications. pp 44-45.
Stierle, A., Strobel, G. and Stierle, D. 1993. Taxol and Taxane Production by
Taxomyces andreanae, an Endophytic Fungus of Pacific Yew. Science 60,
214-216.
Swofford, D.L. 2002. Phylogenetic Analysis using Parsimony and Other
Methods (4.10 Beta). Sinauer Associates, Inc. Publishers, Massechusetts,
USA.
Swofford, D.L., Olsen, G.J., Waddell, P.J. and Hillis, D.M. 1996.
Phylogenetic Inference. In Hillis, D.M., Moritz, C. and Mable, B.K.
Molecular Systematics 2nd Edition, Massachusetts, USA: Sinauer Associates,
Inc, 1996. pp 407-509.
91
Takezaki, N. 1998. Tie trees generated by distance methods of phylogenetic
reconstruction. Mol. Biol. Evol. 15, 727-737.
Takizawa, M., Colwell, R.R. and Hill, R.T. 1993. Isolation and Diversity of
Actinomycetes in the Chesapeake Bay. Appl. Environ. Microbiol. 59(4), 997-
1002.
Tirimanna, A.S.L. 1981. Study of Carotenoid Pigments of Bixa orellana L
seeds by Thin Layer Chromatography. Microchim. Acta. 2, 11-16.
Thoms, C., Horn, M., Wagner, W., Hentschel, U. and Proksch, P. 2003.
Monitoring microbial diversity and natural products profiles of the sponge
Aplysina cavernicola following transplantation. In Gandhimathi, R.,
Arunkumar, M., Selvin, J., Thangavelu, T., Sivaramakrishnan, S., Kiran,
G.S., Shanmughapriya, S. and Natarajaseenivasan, K. 2008. Antimicrobial
potential of sponge associated marine actinomycetes. J. Mycol. Med. 18, 16—
22.
Thorne, J. L., Kishino, H. and Painter, I. S. 1998. Estimating the rate of
molecular evolution. Mol. Biol. Evol. 15, 1647–1657.
Touchstone, J.C. and Dobbins, M.F. 1983. Practice of Thin layer
Chromatography. 2nd Edition, New York: John Wiley and Sons. pp 3-15.
Tseung, G. and Lam, K.S. 2008. A low-sodium formulations for the
determination of salinosporamides by Salinispora tropica strain NPS1184.
Appl. Microbiol. Biotechnol. 78, 821-826.
Udwary, D.W., Zeigler, L., Asolkar, R.N., Singan, V., Fenical, W., Jensen,
P.R. and Moore, B.S. 2007. Genome sequencing reveals complex secondary
metabolite in the marine actinomycete Salinispora tropica. Proceedings of the
National Academy of Sciences of the United States of America. 104, 10376-
10381.
Wang, J., Soisson, S.M., Young, K., Shoop, W., Kodali, S., Galgoci, S.,
Painter, R Parthasarathy, G., Tang, Y.S., Cummings, R., Ha, S., Dorso, K.,
92
Motyl, M., Jayasuriya, H., Ondeyka, J., Herath, K., Zhang, C., Hernandez, L.,
Allocco, J., Basilio1, A., Tormo, J., Genilloud, O., Vicente, F., Pelaez, F.,
Colwell, L., Lee, S.H., Michael, B., Felcetto, T., Gill, C., Silver, L.S.,
Hermes, J.D., Bartizal, K., Barrett, J., Schmatz, D., Becker, J.W, Cully, D.
and Singh, S.D. 2006. Platensimycin is a selective FabF inhibitor with potent
antibiotic properties. Nature. 441, 358 – 361.
Watve, M.G., Tickoo, R., Jog, M.M. and Bhole, B.D. 2001. How many
antibiotics are produced by the genus streptomyces? In Pelaez, F. 2006. The
historical delivery of antibiotics from microbial natural products—Can
history repeat? Biochem. Pharmacol. 71, 981 – 990.
Wedge, D.E. and Nagle, D.G. 2000. A New 2D-TLC for the Discovery of
Novel Antifungal Agents to Control Plant Pathogens. J. Nat. Prod. 63, 1050-
1054.
Weins, J.J. 2000. Phylogenetic Analysis of Morphological Data. Washington,
USA: Smithsonian Institution. pp 5-10.
Wilkinson, C.R. 1978. Microbial associations in sponges. I. Ecology,
physiology and microbial populations of coral reef sponges. Mar. Biol. 49,
161-167.
Williams, P.G., Asolkar, R.N., Kondratyuk, T., Pezzuto, J.M., Jensen, P.R.
and Fenical, W. 2007. Saliniketals A and B, Bicyclic Polyketides from the
Marine Actinomycete Salinispora arenicola. J. Nat. Prod. 70, 83-88.
Williams, P.G., Buchanan, G.O., Feling, R.H., Kauffman, C.A., Jensen, P.R.
and Fenical, W. 2005. New Cytotoxic Salinosporamides from the Marine
Actinomycete Salinispora tropica. J. Org. Chem. 70, 6196-6203. Woese, C.R. 1987. Bacterial evolution. Microbiol. Rev. 51, 221–271.
Zhang, H., Wang, Y. and Pfeifer, B.A. 2008. Bacterial Hosts for Natural
Product Production. Mol. Pharm. 5(2), 212-225.
93
Appendices
Appendix 1
Figure 19. HPLC chromatogram of fermented extracts First injection of crude above was eluted in a 50:50 MeOH/H2O v/v solvent system,
flow rate set at 1mL/min. [CNS205] was 100µg/µL.
Figure 20. HPLC chromatogram of crude extracted from DMSO dissolved samples
MeOH
MeOH
94
Appendix 2
Figure 21. LC-MS spectral data of rifampicin (sigma) in positive ion mode
Appendix 3 Table 10. Morphological data, BSA results, sampling locations and taxa assignment. Readings
showing >250 have not been carried forward to higher concentration for testing.
No
Strain ID
BSA
Profiles drawn from TLC and bioactivity tests
Appearance and morphology
Sample source and collection site
1 720 31 New* Beige outer, orange dark centre
Sediment from Beqa lagoon
2 1052 222 New * Smooth shiny orange black spores
Sediment from Ovalau
3 1299 >250 S. arenicola Light orange, centre black brown
Sediment from Yasawa (Octopus Resort)
4 1301 >250 S. arenicola Orange black centre Sediment from Yasawa (Octopus Resort)
5 1302 48 S. arenicola Pale orange, black inner smooth
Sediment from Yasawa (Octopus Resort)
6 1287 >250 S. arenicola Peach black centre Sediment from Yasawa (Octopus Resort)
7 1300 48 New* Beige, black inner smooth Sediment from Yasawa (Octopus Resort)
8 1306 >250 S. arenicola Light orange smooth Sediment from Coral Coast 9 1308 >250 New* Black centre smooth, outer
white spores Sediment from Coral Coast
10 1312 >250 S. arenicola Black flaky Sediment from Central Lau (Tuvuca)
11 1431 63 S. pacifica Orange black flaky Sediment from Central Lau 12 824 47 S. arenicola Dark orange, centre black
flaky Sediment from Beqa lagoon
13 652 76 New* Orange flaky with black Sediment from Beqa lagoon
Rifamycin
95
spores 14 753 25 S. arenicola L. orange, black flaky
centre Sediment from Ono island, Kadavu
15 992 <8 New* Black centre flaky orange Sediment from Ovalau 16 545 2.5 S. arenicola Orange with black centre Sediment from Dravuni,
Kadavu 17 602 20 S. arenicola Dark orange black centre
shiny Sediment from Astrolab reef, kadavu
18 785 47 New* Dark orange flaky Sediment from Astrolab reef, kadavu
19 1275 >250 New* Dark orange, brown centre Sediment from Yasawa (Octopus Resort)
20 559 250 New* Light orange black centre shiny
Sediment from Beqa lagoon
21 1448 >250 S. pacifica Orange flaky Sediment from Nadi 22 1115 39 S. pacifica-N Pale orange outer black
inner Sediment from Kadavu
23 1176 42 S. arenicola Orange and black flaky Sediment from Yasawa (Octopus Resort)
24 1260 >250 S. pacifica Brown centre, pale orange Sediment from Yasawa (Octopus Resort)
25 1263 18 New* Orange Sediment from Yasawa (Octopus Resort)
26 1314 42 S. arenicola Orange with black center Sediment from Coral Coast 27 1315 48 S. arenicola Black flaky Sediment from Central Lau
(Tuvuca) 28 1332 >250 S. pacifica Dark orange centre Sediment from Yasawa
(Octopus Resort) 29 1377 94 New* Beige brown centre Sediment from Central Lau 30 1364 >250 S. arenicola Yellow smooth Sediment from Taveuni 31 1209 >250 S. arenicola Sediment from Yasawa
(Octopus Resort) 32 1246 42 New* Beige outer, black centre Sediment from Yasawa
(Octopus Resort) 33 1262 48 New* Pale yellow smooth Sediment from Yasawa
(Octopus Resort) 34 1291 48 S. arenicola Yellow small Sediment from Coral coast 35 1256 >250 New* Pale orange black centre Sediment from Yasawa
(Octopus Resort) 36 1375 >250 S. pacifica Dark orange with black
centre Sediment from Central Lau (Cicia)
37 1292 >250 S. pacifica Dark orange flaky Sediment from Coral coast 38 1200 >250 S. arenicola Orange with black centre Sediment from Yasawa
(Octopus Resort) 39 1072 >250 New* Brown flaky Sediment from Ovalau 40 1070 <8 New* Brown flaky Sediment from Ovalau 41 1406 >250 New* Black smooth Sediment from Taveuni 42 1305 >250 New* Orange, black centre flaky Sediment from Coral coast 43 870 >250 S. arenicola Orange shiny outer black
centre Sediment from Nukulau Island
44 1392 >250 S. arenicola Black centre brown outer Sediment from Central Lau 45 1223 >250 S. pacifica Red/orange flaky Sediment from Yasawa 46 1295 <8 New* Grey black centre Sediment from Coral coast 47 1293 94 New* Orange with black outer
centre Sediment from Yasawa (Octopus Resort)
48 1300 48 New* Beige black inner smooth Sediment from Coral coast 49 1242 >250 S. arenicola Orange black centre Sediment from Kadavu 50 1446 >250 S. pacifica Light orange flaky Sediment from Taveuni 51 1334 >250 S. pacifica Orange smooth Sediment from Coral coast 52 1391 >250 S. arenicola Dark brown smooth Sediment from Central Lau 53 1367 48 S. pacifica-N Dark brown Sediment from Taveuni 54 1287 >250 S. arenicola Peach black centre Sediment from Yasawa
(Octopus Resort) 55 1353 >250 S. pacifica Orange flaky Sediment from Taveuni
96
56 1329 48 S. arenicola Black smooth Sediment from Yasawa (Octopus Resort)
57 1112 41 S. arenicola Black outer dark brown centre flaky
Sediment from Vanua balavu, central lau
58 1288 39 New* Dark brown flaky Sediment from Yasawa (Octopus Resort)
59 1294 48 New* Peach with black outer centre
Sediment from Yasawa (Octopus Resort)
60 1435 >250 S. arenicola Dark orange outer, centre black flaky
Sediment from Rabuka gym, Suva shoreline
61 1289 215 S. arenicola Orange black smooth Sediment from Yasawa (Octopus Resort)
62 1365 48 S. arenicola Brown light orange Sediment from Central Lau 63 1360 65 S. pacifica-N Orange flaky Sediment from Central Lau,
Lakeba 64 1380 >250 New* Dark orange smooth shiny Sediment from Lakeba,
Central Lau 65 1075 250 New* Beige flaky Sediment from Ovalau 66 1379 >250 S. pacifica Beige smooth Sediment from Central Lau 67 1185 >250 S. arenicola Beige black centre Sediment from Yasawa
(Octopus Resort) 68 1298 >250 S. arenicola Orange smooth Sediment from Yasawa
(Octopus Resort) 69 1430 50 S. arenicola Black beige smooth Sediment from Lau 70 1321 188 S. arenicola Black smooth Sediment from Coral coast 71 1378 188 S. pacifica-N Dark orange black centre Sediment from Central Lau 72 1389 31 S. arenicola Black centre outer beige Sediment from Central Lau 73 1352 42 S. pacifica-N Black centre orange Sediment from Taveuni 74 1382 22 S. arenicola Black centre outer cream Sediment from Central Lau 75 1416 219 New* Orange, dark orange centre Sediment from Nayau west,
Central Lau 76 1424 125 New* Orange black Sediment from Nayau, Central
Lau 77 971 <8 S. arenicola Light orange smooth and
shiny Sediment from Ovalau
78 1432 >250 S. pacifica Orange flaky filamentous Sediment from Nayau, Central Lau
79 1437 >250 S. arenicola Orange black flaky Sediment from Komo, Central Lau
80 1419 245 S. pacifica-N Large orange smooth Sediment from Cicia, Central Lau
81 1303 >250 S. arenicola Orange smooth Sediment from Yasawa (octopus resort)
82 1405 48 S. arenicola Dark orange flaky Sediment from Taveuni 83 1409 94 S. arenicola Beige black centre Sediment from Taveuni 84 1420 63 S. pacifica-N Orange black centre Sediment from Cicia, Central
Lau 85 1415 250 S. pacifica Dark orange black centre Sediment from Nayau, Central
Lau 86 1383 188 S. arenicola Brown flaky centre Sediment from Olorua, Central
Lau 87 1390 48 S. arenicola Brown flaky Sediment from Taveuni 88 1349 >250 S. pacifica Brown centre black outer Sediment from Nayau north,
Central Lau 89 1400 >250 S. arenicola Grey black Sediment from Cicia, Central
Lau 90 1403 85 New* Dark brown flaky Sediment from Nayau west,
Central Lau 91 587 8 New* Shiny bright orange Sediment from Beqa Lagoon 92 1417 >250 S. arenicola Light orange black centre Sediment from Nayau, Central
Lau 93 1234 >250 S. pacifica Black outer, brown centre
flaky Sediment from Kadavu
94 1456 63 S. pacifica-N Black smooth Sediment from Olorua, Central
97
Lau 95 1410 >250 S. arenicola Beige smooth Sediment from Nayau north,
Central Lau 96 1203 >250 S. arenicola Yellow orange smooth
shiny Sediment from Yasawa (Octopus Resort)
97 1436 177 S. arenicola Brown black flaky Sediment from Komo, Central Lau
98 1457 >250 S. arenicola Orange brown Sediment from Nayau north, Central Lau
99 1429 85 S. arenicola Grey black, centre brown Sediment from Nayau west, Central Lau
100 1422 37 S. arenicola Black smooth Sediment from Komo, Central Lau
* - Strains chosen for DNA analysis New - Strains with new spots that are not visible in the standards on TLC plates
Appendix 4 Figure 22. 16S rRNA sequences aligned from MUSCLE EBI >992 GTGAGTAACACGTGAGTAA-CCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCT AATACCGGATATGACCATCTGTCG-CATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGA TGGGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTA GCCGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGG AGGCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAG GGATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTAC CTGCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAG CGTTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAA AACCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGA GACTGGAATTCCTGGTGTAGCGGTGAAATGCGCA------- >1262 GTGAGTAACACGTGAGTAA-CCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCT AATACCGGATATGACCATCTGTCG-CATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGA TGGGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTA GCCGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGG AGGCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAG GGATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTAC CTGCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAG CGTTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAA AACCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGA GACTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCA >YIM Micromonospora sp. GTGAGTAACACGTGAGCAACCTGCCCTAGGCTTTGGGATAACCCTCGGAAACGGGGGCTA ATACCGAATATGACCTCGCATCGCATGGTGTGTGGTGGAAAG-TTTTTCGGCCTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGACGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATATTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTAAGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCGAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACCGTGAAAA CCTGGGGCTCAACCCCAGGCCTGCGGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGTGGGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNJ878 Micromonospora sp. GTGAGTAACACGTGAGCAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATTACATGCTGCCGCATGGTGGTGTGTGGAAAG-TTTTTCGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGACGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG
98
GCAGCAGTGGGGAATATTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTAAGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCGAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCACAGCTCAACTGTGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >UMM543 Solwaraspora sp. GTGAGTAACACGTGAGCAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATTACATGCTGCCGCATGGTGGTGTGTGGAAAG-TTTTTCGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGACGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATATTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTAAGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCGAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCACAGCTCAACTGTGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >13674N Salinispora arenicola GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGGCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >NPS-14034 Salinispora arenicola GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGGCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNH941 Salinispora arenicola GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGGCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNH963 Salinispora arenicola GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT
99
GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGGCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1300 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >MV0004 Salinispora sp. GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >559 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >587 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >NPS-14320 Salinispora arenicola GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA
100
CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >NPS-11684 Salinispora arenicola GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNT-088 Salinispora arenicola GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNH643 Salinispora sp. GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >AQ1M05 Salinispora arenicola GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >652 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG
101
GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNH646 Salinispora sp. GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1295 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNP152 Salinispora arenicola GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCTGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >NPS-14803 Salinispora arenicola GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >YKPC3 Salinispora sp. GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC-
102
>CNH732 Salinispora pacifica GTGAGTAACACGTGAGTAACCTGCCCTAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACTGGCTGCCGCATGGTGGTTGGTGGAAAGATTTTTCGGCTTGGGATG GACTCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCGAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNR114 Salinispora pacifica GTGAGTAACACGTGAGTAACCTGCCCTAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACTGGCTGCCGCATGGTGGTTGGTGGAAAGATTTTTCGGCTTGGGATG GACTCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCGAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNS103 Salinispora pacifica GTGAGTAACACGTGAGTAACCTGCCCTAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACTGGCTGCCGCATGGTGGTTGGTGGAAAGATTTTTCGGCTTGGGATG GACTCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCGAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNB536 Salinispora sp. GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACTGGCTGCCGCATGGTGGTTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNH898 Salinispora sp. GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACTGGCTGCCGCATGGTGGTTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNB440 Salinispora tropica GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA
103
ATACCGGATATGACTGGCTGCCGCATGGTGGTTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNS-237 Salinispora pacifica GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACTGGCTGCCGCATGGTGGTTGGTGGAAAGATTTTTCGGCTTGGGATG GACTCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNS055 Salinispora pacifica GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATTACTGGCTGCCGCATGGTGGTTGGTGGAAAGATTTTTCGGCTTGGGATG GACTCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCGAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >YKPC1 Salinispora sp. GTGAGTAACACGTGAGTAACCTGCCCTAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACTGGCTGCCGCATGGTGGTTGGTGGAAAGATTTTTCGGCTTGGGATG GACTCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCGAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1403 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1406 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC
104
CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1070 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1416 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1293 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1263 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1308 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG
105
ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAC GCGGGTCTCTGGGCCGATACTGACGCTGA-GAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >785 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1431 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAA- GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1075 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1072 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCA-GAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNR-647 Salinispora arenicola GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG
106
TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >CNS-325 Salinispora arenicola GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1294 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1377 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1256 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1052 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA
107
CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1305 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1246 GTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACCATCTGTCGCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATG GGCTCGCGGCCTATCAGCTTGTTGGTGGGGTGATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCAAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1380 GTGAGTAACACGTGAGTAACCTGCCCTAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACTGGCTGCCGCATGGTGGTTGGTGGAAAGATTTTTCGGCTTGGGATG GACTCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCGAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCA-GAGGAACACCGGTGGCGAAA GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >1424 GTGAGTAACACGTGAGTAACCTGCCCTAGGCTTTGGGATAACCCCGGGAAACCGGGGCTA ATACCGGATATGACTGGCTGCCGCATGGTGGTTGGTGGAAAGATTTTTCGGCTTGGGATG GACTCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGGCGACGGGTAGC CGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGG ATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCT GCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCGAGCG TTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAA CCCGTGGCTCAACTGCGGGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGA CTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAG GCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGT-GGGGAGCGAACAGGATT AGATACCCTGGTAGTCCACGCTGTAAAC- >NH13C Salinispora arenicola ------------------------------------------------------------------------------------------------------------------------ ------------------------------------------------------------------------------------------------------------------------ --------------------------------------ATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAA ACCTCTTTCAGCAGGGACGAAGCGTTTGTGACGGTACCTGCAGAAGAAGCGCCGGCCAACT ACGTGCCAGCAGCCGCGGTAAGACGTAGGGCGCGAGCGTTGTCCGGATTTATTGGGCGTA AAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAACCCGTGGCTCAACTGCGGGCTTG CAGTCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGACTGGAATTCCTGGTGTAGCGGTGAA ATGCGCAGATATCAGGAGGAACACCGGTGGCGAAGGCGGGTCTCTGGGCCGATACTGACGCT GAGGAGCGAAAGCGT-GGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAAC-
108
>1288 TGCAAGTCGAGCGGAAGGCCCTTCGGGGTACTCGAGCGGCGAACGGGTGAGTAACACGTGAGTAACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTAATACCGGATATGACCATCTGTC GCATGGTGGGTGGTGGAAAGATTTTTTGGCTTGGGATGGGCTCGCGGCCTATCAGCTTGTTGG TGGGGTGATGGCCTACCAAGGCGGCAACTGGTAGCCGGTCCGAGAGGGCGACCGGCCACACTG GGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCCGTGGGGAA >720 GTCGAGCGGAAGGCCCTTCGGGGTACTCGAGCGGCGAACGGGTGAGTAACACGTGAGTAACCTGCCCCA GGCTTTGGGATAACCCCGGGAAACCGGGGCTAATACCGGATATGACCATCTGTCGCATG GTGGGTGGTGGAAAGATTTTTTGGCTTGGGATGGGCTCGCGGCCTATCAGCTTGTTGGTGGGGT GATGGCCTACCAAGGCGGCGACGGGTAGCCGGCCTGAGAGGGCGACCGGCCACACTGGGACT GAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATCTTGCACAATGGGCGGAAGCC TGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGAC GAAGCGTTTGTGACGGTACCTGCAGAAGAAGCGCCGGCCAACTACGTGCCAGCAGCCGCGGTAA GACGTAGGGCGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGG >1275 TGCAAGTCGAGCGGAAAGGCCCTTCGGGGTACTCGAGCGGCGAACGGGTGAGTAACACGTGAGT AACCTGCCCCAGGCTTTGGGATAACCCCGGGAAACCGGGGCTAATACCGGATATGACCATCTGT CGCATGGTGGGTGGTGGAAAGA
109
Appendix 5
Figure 23. Memorandom of understanding between collaborators from Geogia Institute of
Technology (GIT) and the provincial office of Lau.
110
Appendix 6 The calculation of the LD50 values for strain 1416 is given below as an example for
the calculation of an LD50 value. Table 11. Strain 1416 BSA results Concentrations 250ppm 125ppm 62.5ppm
Replicates 1 2 3 1 2 3 1 2 3
Readings
6/9 1/7 3/7 3/7 2/8 3/9 3/7 1/7 0/8
% Dead 43 33 18 Table 12. BSA results for calculation of LD50
Dose (ppm) Dosage (log dose) % Dead % Alive Acc Dead Acc alive
500 2.69897 100 0 143 0
250 2.39794 43 57 76 57
125 2.09691 33 67 51 124
62.5 1.79588 18 82 18 206
31.3 1.495544 0 100 0 306
111
Figure 24. LD50 Calculation from logarithmic graph Anti-log of 2.338 log dose is 217ppm which is the LD50 concentration of strain 1416
extract in BSA.
Appendix 7 Table 13. Results from exploratory the TLC of the 29 strains Cluster group 1 2 3 4 Strains
1075 1070 1380 1052 1263 1262 1424 1072 1293 1308 559 1256 1403 1305 992 1416 1377 1406 1431 1294 785 1246 1288 1275 1295 652 1300 720 587
Key:
2.32
52.32
102.32
152.32
202.32
252.32
302.32
352.32
2.3 2.32 2.34 2.36 2.38 2.4
Acc
u D
ead
and
Acc
aliv
e
Log Dose
LD50 of accumulative dead and accumulative alive vs log dose
Acc Dead
Acc alive
1
Same Rf with Rif new <0.8
2 High λUV compd detected at Rf=0.3-0.4 3 Compd spot detected at Rf=0.8-0.9 4 Compd spot detected at Rf= >0.9
2.338
112
Appendix 8 Media, Buffer and Solutions TAE gel running buffer (10X) per litre Tris base 48.4g Glacial Acetic Acid 11.4mL Na2EDTA 20mL of 0.5M EDTA (pH 0.8) DDW 1L TE buffer (10:1) pH 8 10mM Tris pH 8.0 [1.211g/L] 403mg per 250mL 1mM EDTA (Na Salt) [372mg/L] 93mg per 250mL DDW 250mL M1A agar per litre Starch 10g Yeast Extract 4g Peptone 2g Agar 18g FSW 1L Appendix 9 Table 14. TLC Rf results for 100 extracts and activities against MRSA and WTSA
bioautography assays. “Caterqory” indicates which standard the TLC corresponded to. “New”
indicates the 29 strains with additional spots and “ID” indicates collection identity number. The
standard retention factors are given in Appendix 10.
RETENTION FACTORS
# ID Category 1 2 3 4 5 6 7 8 Plate #
1 720 New* 0.04 0.24 0.32 0.45 0.66 0.97
P1
2 1052 New* 0.03 0.24 0.395 0.565 0.62 0.96 P16
3 1299 CNS205 0.08 0.12 0.32 0.50 0.64 0.75 0.95 P10
4 1301 CNS205 0.05 0.13 0.53 0.61 0.74 0.91
P18
5 1302 CNS205 0.02 0.21 0.47 0.58 0.69 0.9 P18
6 1368 CNS205 0.04 0.12 0.4 0.80 0.85 0.91 P17
7 1300 New* 0.05 0.15 0.2 0.45 0.63 0.94 P5
8 1306 CNS205 0.15 0.29 0.39 0.4 0.59 0.78 0.89 P18
113
9 1308 New* 0.12 0.28 0.38 0.49 0.61 0.91
P18
10 1312 CNS205 0.09 0.25 0.43 0.55 0.64 0.96 P10
11 1431 New* 0.03 0.21 0.3 0.41 0.50 0.61 0.82 P19
12 824 CNS205 0.10 0.17 0.24 0.48 0.84 0.9
P1
13 652 New* 0.04 0.1 0.24 0.29 0.50 0.95 P1
14 753 CNS205 0.06 0.1 0.24 0.34 0.50 0.94
P2
15 992 New* 0.01 0.03 0.08 0.31 0.66 0.91 P2
16 545 CNS205 0.08 0.18 0.47 0.605 0.74 0.9 P2
17 602 CNS205 0.05 0.17 0.20 0.35 0.59 0.84 P19
18 785 New* 0.09 0.17 0.29 0.53 0.86 0.95 P2
19 1275 New* 0.1 0.21 0.3 0.45 0.89 0.93 P5
20 559 New* 0.04 0.13 0.52 0.58 0.71 0.94 P7
21 1448 CNB440 0.05 0.19 0.3 0.47 0.54 0.73 0.82 0.91 P19
22 1115 CNR114 0.06 0.2 0.65 0.7 0.82 0.94 P19
23 1176 CNS205 0.25 0.32 0.47 0.49 0.78 0.94
P1
24 1260 CNR114 0.03 0.21 0.34 0.5 0.62
P9
25 1263 New* 0.08 0.25 0.55 0.62 0.79 0.93
P20
26 1314 CNS205 0.08 0.21 0.34 0.49 0.61 0.9
P9
27 1315 CNS205 0.05 0.13 0.39 0.59 0.69 0.92
P20
28 1332 CNR114 0.07 0.21 0.32 0.61 0.91 P7
29 1377 New* 0.06 0.14 0.54 0.71 0.94 P16
30 1364 CNS205 0.09 0.2 0.32 0.52 0.66 0.96 P8
31 1209 CNS205 0.11 0.17 0.3 0.36 0.46 0.62 0.84 P6
32 1246 New* 0.05 0.17 0.33 0.91
P3
33 1262 New* 0.13 0.24 0.34 0.65
P3
34 1291 CNS205 0.04 0.18 0.27 0.37 0.62
P3
114
35 1256 New* 0.09 0.19 0.36 0.58 0.65 0.92 P4
36 1375 CNB440 0.08 0.18 0.31 0.41 0.62 0.95 P4
37 1292 CNR114 0.03 0.12 0.36 0.51 0.63 0.91 0.96 P4
38 1200 CNS205 0.09 0.17 0.32 0.47 0.63 0.95 P4
39 1072 New* 0.03 0.08 0.16 0.27 0.37 0.55 0.97 P20
40 1070 New* 0.07 0.16 0.52 0.81 0.91
P21
41 1406 New* 0.05 0.18 0.32 0.37 0.41 0.47 0.89 0.94 P21
42 1305 New* 0.03 0.08 0.16 0.32 0.41 0.59 0.96 P21
43 870 CNS205 0.06 0.3 0.59 0.79 0.93
P11
44 1392 CNS205 0.05 0.11 0.25 0.34 0.59 0.93
P11
45 1223 CNB440 0.07 0.33 0.41 0.47 0.59 0.91 P11
46 1295 New* 0.05 0.38 0.46 0.53 0.96 P11
47 1293 New* 0.04
0.14
0.26
0.79
0.96 P5
48 1258 CNS205 0.05 0.19 0.38 0.73 0.93
P6
49 1242 CNS205 0.05 0.14 0.28 0.47 0.89 0.94 P5
50 1446 CNB440 0.05 0.13 0.33 0.43 0.57 0.82 0.93 P21
51 1334 CNB440 0.03 0.28 0.46 0.73 0.82 0.92
P17
52 1391 CNS205 0.22 0.4 0.41 0.52 0.62 0.92
P8
53 1367 CNR114 0.1 0.32 0.44 0.69 0.74 0.85
P22
54 1287 CNS205 0.08 0.15 0.29 0.44 0.84 0.93
P3
55 1353 CNB440 0.15 0.41 0.56 0.61 0.85 0.97
P12
56 1329 CNS205 0.03 0.12 0.42 0.71 0.92
P12
57 1112 CNS205 0.07 0.17 0.45 0.52 0.74 0.95 P22
58 1288 New* 0.05 0.23 0.45 0.56 0.72 0.92 P22
59 1294 New* 0.04 0.14 0.24 0.45 0.53 0.9 P9
60 1435 CNS205 0.05 0.23 0.48 0.62 0.83 0.95 P22
61 1289 CNS205 0.03 0.24 0.43 0.55 0.72 0.94 P6
115
62 1365 CNS205 0.03 0.14 0.28 0.4 0.53 0.88 0.94 P15
63 1360 CNB440 0.09 0.19 0.37 0.48 0.92 0.96
P15
64 1380 New* 0.06 0.13 0.58 0.79 0.96
P15
65 1075 New* 0.15 0.5 0.61 0.85 0.98
P23
66 1379 CNB440 0.19 0.31 0.41 0.57 0.93 P13
67 1185 CNS205 0.05 0.24 0.52 0.63 0.91 P13
68 1298 CNS205 0.06 0.29 0.5 0.59 0.96 P13
69 1430 CNS205 0.07 0.16 0.42 0.59 0.67 0.75 0.87 P23
70 1321 CNS205 0.13 0.2 0.21 0.4 0.48 0.69 P6
71 1378 CNR114 0.03 0.18 0.23 0.33 0.46 0.92
P14
72 1389 CNS205 0.07 0.11 0.15 0.3 0.57 0.81 0.91
P16
73 1352 CNR114 0.06 0.21 0.51 0.58 0.67 0.74 P16
74 1382 CNS205 0.05 0.11 0.22 0.38 0.51 0.91 0.96 P14
75 1416 New* 0.1 0.15 0.31 0.43 0.51 0.83 0.96 P23
76 1424 New* 0.08 0.32 0.49 0.58 0.66 0.88 P23
77 971 CNS205 0.04 0.28 0.36 0.56 0.94 P24
78 1432 CNR114 0.1 0.26 0.45 0.63 0.92 P24
79 1437 CNS205 0.095 0.215 0.275 0.375 0.65 0.905 P24
80 1419 CNR114 0.05 0.13 0.34 0.6 0.8 0.92 P24
81 1303 CNS205 0.05 0.11 0.28 0.37 0.75 0.89 0.91 P10
82 1405 CNS205 0.14 0.2 0.35 0.47 0.64 0.91 0.96 P25
83 1409 CNS205 0.15 0.25 0.37 0.46 0.71 0.94 P25
84 1420 CNR114 0.05 0.28 0.51 0.62 0.91 0.94 P25
85 1415 CNR114 0.05 0.28 0.49 0.69 0.92 0.97 P25
86 1383 CNS205 0.1 0.17 0.25 0.36 0.45 0.95 P17
87 1390 CNS205 0.08 0.21 0.24 0.36 0.46 0.90 P17
88 1349 CNB440 0.05 0.31 0.5 0.64 0.94 P15
116
89 1400 CNS205 0.07 0.29 0.38 0.68 0.84 P14
90 1403 New* 0.1 0.42 0.57 0.61 0.7 P14
91 587 New* 0.04 0.14 0.22 0.56 0.49 0.58 0.76 0.95 P12
92 1417 CNS205 0.06 0.25 0.36 0.45 0.68 0.87 0.94 P12
93 1234 CNR114 0.03 0.05 0.25 0.47 0.68 0.92 P8
94 1456 CNR114 0.17 0.46 0.69 0.89 0.95 P13
95 1410 CNS205 0.09 0.18 0.29 0.42 0.62 0.92 P7
96 1203 CNS205 0.11 0.20 0.31 0.39 0.61 0.91 P10
97 1436 CNS205 0.04 0.1 0.24 0.35 0.51 0.90 P7
98 1457 CNS205 0.03 0.08 0.18 0.32 0.44 0.62 0.91 P8
99 1429 CNS205 0.09 0.14 0.25 0.52 0.6 0.72 0.93 P20
100 1422 CNS205 0.11 0.32 0.43 0.51 0.74 0.95 P9
Key: - WTSA and MRSA with VREF activity * - DNA analysis
- WTSA and MRSA activity
The results from Table 10 represent the average values of duplicate readings. Items
that are highlighted in bold on the right side of the table are TLC plate numbers.
Appendix 10 Table 15. Retention factors for the three Salinispora species and plate numbers Plate #
Strain Retention Factors 1 2 3 4 5 6 7 8
1 CNS205 0.04 0.10 0.32 0.40 0.57 0.89 0.97
CNB440 0.04 0.40 0.56 0.85 0.96
CNR114 0.10 0.21 0.46 0.77 0.84 0.91
2 CNS205 0.05 0.13 0.23 0.31 0.50 0.55 0.94
CNB440 0.05 0.11 0.33 0.50 0.93
CNR114 0.1 0.21 0.46 0.77 0.81 0.92
3 CNS205 0.05 0.12 0.30 0.57 0.88 0.95
CNB440 0.05 0.12 0.25 0.31 0.43 0.57 0.95
117
CNR114 0.04 0.13 0.30 0.45 0.60 0.93
4 CNS205 0.09 0.23 0.37 0.68 0.83 0.90
CNB440 0.11 0.19 0.35 0.45 0.74 0.93
CNR114 0.1 0.29 0.35 0.69 0.95
5 CNS205 0.09 0.16 0.30 0.62 0.85 0.92
CNB440 0.10 0.17 0.29 0.66 0.78 0.94
CNR114 0.08 0.11 0.31 0.71 0.96
6 CNS205 0.01 0.17 0.50 0.58 0.83 0.90
CNB440 0.08 0.46 0.56 0.67 0.80 0.89
CNR114 0.10 0.28 0.45 0.78 0.88 0.92
7 CNS205 0.11 0.22 0.27 0.35 0.49 0.69 0.95
CNB440 0.09 0.20 0.51 0.69 0.95
CNR114 0.21 0.29 0.37 0.71 0.83 0.88 0.96
8 CNS205 0.05 0.23 0.28 0.43 0.70 0.87 0.95
CNB440 0.03 0.10 0.15 0.46 0.57 0.95
CNR114 0.10 0.28 0.42 0.53 0.78 0.88 0.93
9 CNS205 0.02 0.08 0.19 0.36 0.45 0.70 0.92
CNB440 0.10 0.19 0.29 0.37 0.64 0.90
CNR114 0.04 0.21 0.40 0.67 0.85 0.93
10 CNS205 0.05 0.18 0.47 0.59 0.77 0.96
CNB440 0.05 0.44 0.59 0.72 0.91 0.92
CNR114 0.05 0.18 0.44 0.59 0.71 0.98
11 CNS205 0.07 0.13 0.25 0.30 0.56 0.88 0.95
CNB440 0.05 0.12 0.25 0.35 0.58 0.95
CNR114 0.10 0.17 0.22 0.45 0.57 0.63 0.96
12 CNS205 0.06 0.19 0.37 0.45 0.81 0.91
CNB440 0.05 0.19 0.44 0.64 0.84 0.90
CNR114 0.04 0.21 0.37 0.48 0.55 0.93
13 CNS205 0.08 0.16 0.29 0.57 0.79 0.87 0.92
CNB440 0.07 0.15 0.24 0.37 0.56 0.77 0.91
CNR114 0.07 0.17 0.32 0.57 0.87 0.93
118
14 CNS205 0.04 0.12 0.27 0.31 0.52 0.85 0.92
CNB440 0.08 0.12 0.28 0.32 0.55 0.93
CNR114 0.15 0.25 0.31 0.55 0.88 0.94
15 CNS205 0.06 0.21 0.32 0.51 0.75 0.82 0.90
CNB440 0.06 0.12 0.26 0.31 0.49 0.94
CNR114 0.12 0.16 0.34 0.56 0.82 0.89
16 CNS205 0.06 0.13 0.23 0.31 0.52 0.77 0.85 0.91
CNB440 0.06 0.12 0.20 0.27 0.54 0.92
CNR114 0.12 0.25 0.30 0.54 0.88 0.95
17 CNS205 0.05 0.13 0.29 0.43 0.83 0.87
CNB440 0.04 0.11 0.22 0.41 0.84
CNR114 0.05 0.24 0.41 0.52 0.79 0.90
18 CNS205 0.03 0.23 0.39 0.68 0.77 0.87 0.94
CNB440 0.05 0.14 0.21 0.33 0.57 0.92
CNR114 0.10 0.22 0.29 0.51 0.87 0.95
19 CNS205 0.04 0.17 0.24 0.33 0.63 0.88
CNB440 0.1 0.22 0.37 0.51 0.59 0.74 0.83 0.91
CNR114 0.09 0.23 0.39 0.54 0.85 0.96
20 CNS205 0.08 0.17 0.42 0.62 0.74 0.91
CNB440 0.1 0.25 0.40 0.51 0.63 0.80 0.92
CNR114 0.10 0.19 0.34 0.50 0.81 0.93
21 CNS205 0.04 0.09 0.16 0.33 0.42 0.61 0.92
CNB440 0.06 0.14 0.32 0.45 0.57 0.86 0.95
CNR114 0.09 0.23 0.38 0.47 0.82 0.94
22 CNS205 0.07 0.16 0.43 0.51 0.72 0.93
CNB440 0.07 0.15 0.36 0.49 0.60 0.89 0.93
CNR114 0.11 0.20 0.30 0. 45 0.71 0.87 0.94
23 CNS205 0.06 0.13 0.40 0.56 0.64 0.71 0.83
CNB440 0.08 0.14 0.27 0.34 0.51 0.79 0.90
CNR114 0.09 0.19 0.27 0.42 0.68 0.82 0.91
24 CNS205 0.10 0.22 0.26 0.35 0.64 0.91
119
CNB440 0.10 0.21 0.38 0.37 0.57 0.82 0.93
CNR114 0.09 0.15 0.36 0.65 0.87 0.94
25 CNS205 0.15 0.22 0.38 0.50 0.69 0.96
CNB440 0.13 0.24 0.40 0.43 0.62 0.8 0.95
CNR114 0.06 0.29 0.52 0.73 0.92 0.97
120
Appendix 11 Sampling Isolation in selective media Purification Selection of Salinispora colonies and morphological characterization Sea water requirement and 3% KOH tests TLC optimization and diluents trials Liquid broth seed fermentation mass fermentation (MIA + FSW) (MIA + FSW) Solvent Extraction (EtOAc), drying and reconstitution in AEM (1:1:1 v/v/v) Bioactivity testing and Brine shrimp assay Thin Layer Chromatography Bioautography Identification of new spots and possible new strains (Assumptive) DNA extraction and PCR Amplification 16S rRNA sequencing Sequence Formatting and Editing Sequence Alignment BLAST search on NCBI database Identification and assignment of strains Figure 25. Schematic diagram of the experimental process
121
Appendix 12 Table 16. Correlation coefficient tables of the TLC Rf values for Salinispora standard extracts
vs sample extracts.
P1 652 720 1176 824 CNS205 CNB440 CNR114 652 1 720 0.976866 1 1176 0.936843 0.970235 1 824 0.926916 0.965525 0.960583 1 CNS205 0.468768 0.384261 0.205445 0.366513 1 CNB440 0.989151 0.989623 0.962412 0.970261 0.449688 1 CNR114 0.863147 0.93325 0.931778 0.945779 0.273048 0.908481 1 P2 753 992 545 785 CNS205 CNB440 CNR114 753 1 992 0.966782 1 545 0.928857 0.91058 1 785 0.94091 0.972039 0.968975 1 CNS205 0.166921 0.263419 0.057448 0.13275 1 CNB440 0.962947 0.969853 0.982774 0.992662 0.155278 1 CNR114 0.889766 0.884431 0.988853 0.957919 0.032104 0.961922 1 P3 1291 1287 1262 1246 CNS205 CNB440 CNR114 1291 1 1287 0.424619 1 1262 0.281088 -0.18684 1 1246 0.327239 -0.05964 0.971779 1 CNS205 -0.0687 0.225646 -0.42929 -0.24486 1 CNB440 0.199546 0.96802 -0.23144 -0.11562 0.237262 1 CNR114 0.273524 0.971332 -0.09277 0.032186 0.222027 0.988444 1 P4
1200 1292 1375 1256 CNS205 CNB440 CNR114
1200 1
1292 0.437401 1
1375 0.997716 0.441769 1
1256 0.991233 0.408045 0.981057 1
CNS205 0.265284 0.976648 0.277219 0.227259 1
CNB440 0.991418 0.410269 0.991274 0.981307 0.24523 1
CNR114 0.99182 0.37511 0.990564 0.987841 0.20866 0.989445 1
122
P5
1242 1293 1300 1275 CNS205 CNB440 CNR114
1242 1
1293 0.490339 1
1300 0.464982 0.990537 1
1275 0.997321 0.476716 0.455162 1
CNS205 0.411487 -0.05054 -0.10605 0.364208 1
CNB440 0.973489 0.51543 0.480222 0.964831 0.362494 1
CNR114 0.983779 0.372214 0.347979 0.979028 0.42452 0.97574 1
P6
1289 1321 1209 1258 CNS205 CNB440 CNR114
1289 1
1321 0.968823 1
1209 0.178373 0.115749 1
1258 0.42433 0.332841 -0.15518 1
CNS205 0.377946 0.312113 0.976632 -0.08008 1
CNB440 0.967057 0.918421 0.004455 0.534788 0.211166 1
CNR114 0.971421 0.946083 0.09694 0.596721 0.28663 0.963904 1
P7
559 1332 1410 1436 CNS205 CNB440 CNR114
559 1
1332 0.415506 1
1410 0.958216 0.291565 1
1436 0.946535 0.198126 0.993463 1
CNS205 0.137106 -0.21925 0.183645 0.254558 1
CNB440 0.983073 0.391531 0.985562 0.97161 0.132005 1
CNR114 0.435248 0.149296 0.452365 0.49239 0.899806 0.443155 1
P8
1234 1391 1364 1457 CNS205 CNB440 CNR114
1234 1
1391 0.923868 1
1364 0.989046 0.968579 1
1457 0.272793 -0.03048 0.177719 1
CNS205 0.484071 0.209559 0.401157 0.962764 1
CNB440 0.985148 0.934247 0.986597 0.285154 0.491682 1
CNR114 0.539938 0.260853 0.455997 0.938364 0.990124 0.529281 1
123
P9
1422 1260 1314 1294 CNS205 CNB440 CNR114
1422 1
1260 0.369736 1
1314 0.99019 0.306084 1
1294 0.96901 0.220921 0.992739 1
CNS205 0.153917 -0.23909 0.226501 0.306022 1
CNB440 0.984023 0.247453 0.986846 0.982056 0.248673 1
CNR114 0.971799 0.503967 0.972506 0.95278 0.217084 0.949305 1
P10
1303 1299 1312 1203 CNS205 CNB440 CNR114
1303 1
1299 0.972757 1
1312 0.394048 0.298034 1
1203 0.45512 0.32903 0.982707 1
CNS205 0.959594 0.985218 0.375207 0.387368 1
CNB440 0.291973 0.209762 0.944805 0.900754 0.323745 1
CNR114 0.441264 0.355391 0.994606 0.974923 0.435528 0.949403 1
P11
870 1392 1223 1295 CNS205 CNB440 CNR114
870 1
1392 0.172676 1
1223 0.282684 0.95895 1
1295 0.956453 0.189008 0.285649 1
CNS205 -0.3 0.439627 0.266104 -0.26935 1
CNB440 0.158259 0.999644 0.961391 0.171946 0.438571 1
CNR114 -0.15389 0.242625 0.076211 -0.15022 0.943386 0.239562 1
P12
1353 1329 587 1417 CNS205 CNB440 CNR114
1353 1
1329 0.489578 1
587 0.154183 0.026313 1
1417 0.259932 -0.00877 0.96472 1
CNS205 0.972603 0.460101 0.317108 0.419086 1
CNB440 0.972816 0.568289 0.311344 0.377112 0.980763 1
CNR114 0.957586 0.297539 0.317163 0.404561 0.957817 0.950899 1
124
P13
1379 1185 1298 1456 CNS205 CNB440 CNR114
1379 1
1185 0.974611 1
1298 0.985176 0.99572 1
1456 0.943292 0.96919 0.958285 1
CNS205 -0.03401 0.047696 0.038466 -0.13665 1
CNB440 -0.26319 -0.1808 -0.18642 -0.35879 0.964997 1
CNR114 0.428744 0.466328 0.464093 0.350644 0.512839 0.327014 1
P14
1378 1382 1403 1400 CNS205 CNB440 CNR114
1378 1
1382 0.440057 1
1403 -0.00725 -0.46635 1
1400 0.092482 -0.28217 0.942795 1
CNS205 0.427332 0.994637 -0.44293 -0.27525 1
CNB440 0.988494 0.42778 0.028073 0.139188 0.422031 1
CNR114 0.916748 0.294433 0.292103 0.439727 0.285307 0.940101 1
P15
1365 1360 1380 1349 CNS205 CNB440 CNR114
1365 1
1360 0.348756 1
1380 -0.16929 0.451163 1
1349 -0.23122 0.443528 0.972288 1
CNS205 0.9635 0.467853 0.068205 0.021312 1
CNB440 0.450561 0.925216 0.127266 0.098447 0.470472 1
CNR114 0.327836 0.990431 0.482665 0.453862 0.446588 0.920192 1
P16
1052 1377 1389 1352 CNS205 CNB440 CNR114
1052 1
1377 0.343987 1
1389 0.301733 -0.18464 1
1352 0.956029 0.581807 0.16541 1
CNS205 0.274425 -0.19399 0.993825 0.147593 1
CNB440 0.943354 0.143233 0.446071 0.843243 0.402273 1
CNR114 0.951106 0.443319 0.320833 0.923839 0.268005 0.940953 1
125
P17
1383 1390 1368 1334 CNS205 CNB440 CNR114
1383 1
1390 0.997236 1
1368 0.845172 0.856516 1
1334 0.871122 0.889835 0.984415 1
CNS205 0.899696 0.911091 0.942157 0.947714 1
CNB440 0.13112 0.168481 0.571374 0.540243 0.535977 1
CNR114 0.913275 0.928501 0.957466 0.980952 0.984788 0.50557 1
P18
1301 1302 1306 1308 CNS205 CNB440 CNR114
1301 1
1302 0.99265 1
1306 0.278403 0.285529 1
1308 0.956436 0.977654 0.248368 1
CNS205 0.472658 0.472821 0.930692 0.396175 1
CNB440 0.914181 0.934464 0.399073 0.973587 0.499685 1
CNR114 0.940487 0.952008 0.310168 0.960761 0.477223 0.963735 1
P19
1431 602 1448 1115 CNS205 CNB440 CNR114
1431 1
602 0.426614 1
1448 0.439351 0.135205 1
1115 0.378163 0.905447 0.005619 1
CNS205 0.963805 0.547572 0.496217 0.412439 1
CNB440 0.995138 0.475036 0.40791 0.432021 0.966343 1
CNR114 0.402854 0.979949 0.05578 0.960758 0.490433 0.453626 1
P20
1263 1315 1072 1429 CNS205 CNB440 CNR114
1263 1
1315 0.98485 1
1072 -0.05168 0.048119 1
1429 0.22358 0.326218 0.948061 1
CNS205 0.398108 0.476437 0.874016 0.973637 1
CNB440 0.299715 0.381986 0.934288 0.981252 0.978015 1
CNR114 0.970136 0.9802 0.032283 0.303726 0.445033 0.357195 1
126
P21
1070 1406 1305 1446 CNS205 CNB440 CNR114
1070 1
1406 -0.29638 1
1305 -0.06455 0.452598 1
1446 0.06058 0.337286 0.963892 1
CNS205 -0.05103 0.431373 0.998909 0.972941 1
CNB440 0.043853 0.331486 0.963383 0.999369 0.973202 1
CNR114 0.480165 -0.2649 0.22752 0.462811 0.2691 0.465819 1
P22
1367 1112 1288 1435 CNS205 CNB440 CNR114
1367 1
1112 0.35307 1
1288 0.371742 0.997347 1
1435 0.3403 0.994321 0.997409 1
CNS205 0.361497 0.999458 0.997758 0.993575 1
CNB440 0.98633 0.395685 0.422706 0.39077 0.406324 1
CNR114 0.974895 0.382722 0.413908 0.390699 0.393164 0.981524 1
P23
1057 1430 1416 1424 CNS205 CNB440 CNR114
1057 1
1430 -0.07388 1
1416 -0.39278 0.943276 1
1424 0.370586 0.330968 0.177024 1
CNS205 -0.06938 0.999771 0.940417 0.328813 1
CNB440 -0.39819 0.932743 0.99589 0.182951 0.929583 1
CNR114 -0.25197 0.954271 0.973321 0.262668 0.95118 0.982724 1
P24
971 1432 1437 1419 CNS205 CNB440 CNR114
971 1
1432 0.991226 1
1437 0.301623 0.263914 1
1419 0.468982 0.448394 0.961729 1
CNS205 0.277374 0.236689 0.999086 0.951046 1
CNB440 -0.17149 -0.22827 0.334366 0.325044 0.337804 1
CNR114 0.503241 0.483626 0.953352 0.998624 0.942305 0.292444 1
127
P25
1405 1409 1420 1415 CNS205 CNB440 CNR114
1405 1
1409 0.339843 1
1420 0.315454 0.965657 1
1415 0.32105 0.963483 0.997721 1
CNS205 0.350544 0.997614 0.963669 0.964475 1
CNB440 0.99006 0.257133 0.254663 0.255332 0.26472 1
CNR114 0.30142 0.956184 0.995824 0.99918 0.958966 0.236096 1