Post on 01-Oct-2021
transcript
IS PORCINE PERIWEANING FAILURE-TO-THRIVE SYNDROME AN INFECTIOUS
DISEASE?
A Thesis Submitted to the College of
Graduate Studies and Research
In Partial Fulfillment of the Requirements
For the Degree of Doctor of Philosophy
In the Department of Large Animal Clinical Sciences
Western College of Veterinary Medicine
University of Saskatchewan
Saskatoon
By
Yanyun Huang
Supervisors
Dr. John Harding
Dr. Janet Hill
Copyright Yanyun Huang, December, 2013. All rights reserved
i
PERMISSION TO USE
In presenting this thesis/dissertation in partial fulfillment of the requirements for a Postgraduate
degree from the University of Saskatchewan, I agree that the Libraries of this University may
make it freely available for inspection. I further agree that permission for copying of this
thesis/dissertation in any manner, in whole or in part, for scholarly purposes may be granted by
the professor or professors who supervised my thesis/dissertation work or, in their absence, by
the Head of the Department or the Dean of the College in which my thesis work was done. It is
understood that any copying or publication or use of this thesis/dissertation or parts thereof for
financial gain shall not be allowed without my written permission. It is also understood that due
recognition shall be given to me and to the University of Saskatchewan in any scholarly use
which may be made of any material in my thesis/dissertation.
Requests for permission to copy or to make other uses of materials in this thesis/dissertation in
whole or part should be addressed to:
Head of the Department of Large Animal Clinical Sciences
Western College of Veterinary Medicine
University of Saskatchewan
Saskatoon, Saskatchewan, S7N 5B4
Canada
OR
Dean
College of Graduate Studies and Research
University of Saskatchewan
107 Administration Place
Saskatoon, Saskatchewan, S7N 5A2
Canada
ii
Abstract
Porcine Periweaning Failure-to-Thrive syndrome (PFTS) is a clinical syndrome of newly weaned
pigs with unknown etiology and characterized by anorexia, lethargy and progressive debilitation.
The hypothesis of this thesis is that PFTS is an infectious disease. Investigation in an index farm
affected by PFTS from Saskatchewan Canada ruled out most common swine pathogens as the
etiology and identified several lesions that were consistent across many cases. A larger study
including multiple farms in North America was then undertaken. A total of 8 farms were
investigated, within which 5 met the clinical definition of PFTS. Gross and histological
examinations were performed on 8 case and 4 control pigs on each farm. Detection of relevant
porcine pathogens, complete blood count, serum chemistry, and serum cytokine analysis were
performed on each pig. Thymic atrophy, superficial gastritis and small intestinal villous atrophy
were significantly more prevalent in case pigs compared to control pigs. All case pigs had at least
two of these three lesions. All case and control pigs were negative for porcine reproductive and
respiratory syndrome virus, swine influenza virus and were free of porcine circovirus associated
diseases. Although several pathogens, such as porcine cytomegalovirus, haemagglutinating
encephalomyelitis virus, porcine enteric calicivirus, group A rotavirus, enteroviruses and
Cystoisospora suis were detected in some of the case and control pigs, none were associated with
clinical status. Clinical pathology findings of case pigs was consistent with anorexia and
dehydration, such as increases in haematocrit, blood urea, serum bilirubin, albumin,
beta-hydroxybutyrate and decreases in blood glucose, calcium and phosphorous. Case pigs had
similar levels to IL1-β than control pigs, which suggested that PFTS was not a result of excessive
cytokines. In subsequent experiments, a snatched-farrowed porcine-colostrum-deprived (SF-pCD)
iii
pig model was developed and tissue homogenates were used to inoculate SF-pCD pigs in an
attempt to reproduce the clinical signs of PFTS. The SF-pCD pigs were immunologically
characterized and shown to be suitable for inoculation studies. However, inoculation of tissue
homogenate from PFTS pigs failed to reproduce the clinical signs of PFTS in SF-pCD pigs. All
together, PFTS is a clinical syndrome with consistent pathological and serum analytical changes
among affected pigs. Despite the efforts of this research to establish an infectious etiology, there
is a lack of evidence that PFTS is an infectious disease.
iv
Acknowledgement
I want to first thank my two supervisors, Drs. Harding and Hill. It was a very enjoyable period
during the time of my graduate study to be guided by these two great minds. Under their
mentorship, I was greatly improved in my scientific thinking and skills. I also appreciated my
advisory committee members, Dr. Simko, Ellis, Haines, Waldner and Stookey for their great
advice and suggestion all through my graduate works. Also special thanks to Crissie Aukland,
who graciously offer technical help in my project. The cooperation from Prairie Diagnostic
Services Inc., Kansas State Veterinary Diagnostic Laboratory, Guelph Animal Healthy
Laboratory and Veterinary Diagnostic Services of Manitoba Agriculture, Food and Rural
Initiatives, as well as the help from Animal care Unit, WCVM were vital to the completion of
this work. I thank Dr. Brendan O’Connor for his advice for this project. I thank Drs. Henry,
Gauvreau, Dubois, Megan, Magrath, Kaminski, O'Sullivan and Van Assen for helping me to
identify farms and assisting in the diagnostic investigations. All my fellow graduate students
supported me in many aspects during the past 5 years. The funding provided by Canadian Swine
Health Board, Saskatchewan Agricultural Development Fund and Saskatchewan Pork
Development Board is the necessary element for this study. Last but not least, Interprovincial
Graduate Fellowship provided my stipend for the period of graduate study.
v
To my mother, who is in progressive sickness at the time of writing this thesis;
To my love, Vivi Hui Pan, who continues to love and support me all through the years of our
marriage and my graduate study;
To the God revealed in Jesus Christ, who already loved me when I was still an enemy of Him.
vi
Table of Contents
PERMISSION TO USE ................................................................................................................. i
Abstract .......................................................................................................................................... ii
List of tables................................................................................................................................... x
List of figures .............................................................................................................................. xiv
List of abbreviations .................................................................................................................. xvi
1. Literature review ...................................................................................................................... 1
1.1. Introduction of PFTS ................................................................................................. 1
1.1.1. Brief history: from “starve-outs” to PFTS ............................................................ 1
1.1.2. Clinical presentation ............................................................................................. 3
1.1.3. Possible causes of PFTS ....................................................................................... 3
1.2. Infectious organisms, host and environment factors in the nursery ...................... 4
1.2.1. Overview of common nursery pathogens and PFTS-relevant pathogens ........... 4
1.2.2. Host factors affecting health at weaning ............................................................ 11
1.2.3. Environmental factors affecting early weaning growth and health .................. 14
1.3. Methods of detecting infectious organisms ........................................................ 22
1.3.1. Human eye and microscopy .............................................................................. 22
1.3.2. Culture-based methods...................................................................................... 23
1.3.3. Immunological methods.................................................................................... 24
1.3.4. Methods to detect DNA or RNA sequences of infectious organisms ............... 25
1.4. Establishment of disease causation with emphasis on infectious disease........... 27
1.4.1. Henle-Koch Postulates ...................................................................................... 27
vii
1.4.2. Difficulties in fulfilling Henle-Koch postulates ............................................... 28
1.4.3. Modern guidelines for establishing infectious disease causation ..................... 29
2. Rationale, hypotheses and objectives .................................................................................... 33
3. Clinical presentation, case definition, and diagnostic guidelines for porcine periweaning
failure to thrive syndrome ............................................................................................................. 34
3.1. Obtaining the consensus name “porcine periweaning failure to thrive syndrome
(PFTS)” 35
3.2. Clinical case definition of PFTS ......................................................................... 36
3.3. Clinical signs ....................................................................................................... 36
3.4. Relevant gross and histological observations ..................................................... 37
3.5. Recommendations for herd investigations .......................................................... 38
3.6. Implications......................................................................................................... 40
4. Diagnostic investigation of porcine periweaning failure-to-thrive syndrome in a farm from
Saskatchewan: lack of compelling evidence linking to common porcine pathogens ................... 47
4.1. Introduction ......................................................................................................... 48
4.2. Materials and methods ........................................................................................ 49
4.2.1. Sample collection .............................................................................................. 49
4.2.2. Diagnostic tests ................................................................................................. 50
4.2.3. Statistical analysis ............................................................................................. 52
4.3. Results ................................................................................................................. 52
4.3.1. Gross and histological lesions ........................................................................... 52
4.3.2. Detection of bacteria ......................................................................................... 54
4.3.3. Detection of viruses .......................................................................................... 55
viii
4.3.4. Detection of parasites ........................................................................................ 55
4.4. Discussion ........................................................................................................... 55
5. Pathological features and proposed diagnostic criteria of porcine periweaning failure-to-thrive
syndrome (PFTS) .......................................................................................................................... 83
5.1. Introduction ......................................................................................................... 84
5.2. Methods............................................................................................................... 85
5.2.1. Farm visits and sample collection ..................................................................... 85
5.2.2. Nucleic acid extraction and reverse transcription of RNA ............................... 87
5.2.3. PCR detection of common and relevant swine pathogens ................................ 88
5.2.4. Statistical analyses ............................................................................................ 88
5.3. Results ................................................................................................................. 89
5.4. Discussion ........................................................................................................... 92
6. Clinical pathology, serum cytokines and Vitamin D changes associated with Porcine
Periweaning Failure to Thrive Syndrome (PFTS) ....................................................................... 113
6.1. Introduction ....................................................................................................... 114
6.2. Methods............................................................................................................. 116
6.2.1. Farm visits and sample collection .................................................................... 116
6.2.2. Categorization of farms based on clinical presentation ................................... 116
6.2.3. Haematology and serum chemistry .................................................................. 117
6.2.4. Serum cytokine concentrations ........................................................................ 117
6.2.5. Serum vitamin D .............................................................................................. 118
6.2.6. Statistical analyses ........................................................................................... 119
6.3. Results ............................................................................................................... 119
ix
6.4. Discussion ......................................................................................................... 121
6.5. Conclusions ....................................................................................................... 126
7. Snatch-farrowed, porcine-colostrum-deprived (SF-pCD) pigs as a model for swine infectious
disease research ........................................................................................................................... 130
7.1. Introduction ....................................................................................................... 131
7.2. Material and methods ........................................................................................ 133
7.2.1. Snatch-farrowing, animal care and experimental design ................................ 133
7.2.2. Packed cell volume and plasma total protein .................................................. 136
7.2.3. Histopathological examination of tissues ....................................................... 136
7.2.4. Adjunct tests for porcine pathogens ................................................................ 137
7.2.5. Plasma bovine and porcine immunoglobulin (IgG) concentration ................. 138
7.2.6. Statistical analysis ........................................................................................... 138
7.3. Results ............................................................................................................... 138
7.3.1. Experiment 1 ................................................................................................... 138
7.3.2. Experiment 2 ................................................................................................... 140
7.4. Discussion ......................................................................................................... 141
8. Snatch-farrowed porcine-colostrum-deprived (SF-pCD) pigs possess similar cellular and
humoral immune responses to Mycoplasma hyopneumoniae vaccination compared to their
farm-raised siblings ..................................................................................................................... 151
8.1. Introduction ....................................................................................................... 152
8.2. Methods............................................................................................................. 153
8.2.1. Animal procedures .......................................................................................... 153
8.2.2. IFN- γ ELISPOT assay ................................................................................... 154
x
8.2.3. Serum Mhyo antibody ELISA ........................................................................ 155
8.2.4. Serum porcine and bovine IgG concentration ................................................ 156
8.2.5. Statistical analyses .......................................................................................... 156
8.3. Results ............................................................................................................... 156
8.4. Discussion ......................................................................................................... 157
9. Attempted experimental reproduction of porcine periweaning-failure-to-thrive syndrome
using tissue homogenates ............................................................................................................ 166
9.1. Introduction ....................................................................................................... 167
9.2. Materials and Methods ...................................................................................... 168
9.2.1. Ethics statement ..................................................................................................... 168
9.2.2 Experimental design........................................................................................ 168
9.2.3 Statistical analyses .......................................................................................... 170
9.3 Results ............................................................................................................... 171
9.4 Discussion ......................................................................................................... 172
10. General discussion, conclusions and future directions .......................................... 181
11. Future directions .................................................................................................... 187
12. References .............................................................................................................. 189
List of tables
Tables Page
3.1 Most frequently observed clinical signs and pathological changes
of periweaning failure to thrive syndrome
42
xi
Tables Page
3.2 Potential differential diagnoses based on clinical signs and
pathological changes associated with pigs affected with
periweaning failure to thrive syndrome
43
3.3 Tissues to collect from pigs suspected of having periweaning
failure to thrive syndrome
44
3.4 Ten recommendations for the investigation of farms demonstrating
signs typical of PFTS
46
4.1 Tissues examined histologically from porcine periweaning
failure-to-thrive syndrome (PFTS)-affected (PFTS-SICK),
age-matched healthy (PFTS-HLTHY) pigs from an affected farm,
and healthy pigs selected from 2 unaffected farms (CTRL)
61
4.2 Frequency (prevalence) of positive diagnostic tests performed to
identify common swine pathogens potentially associated with
porcine periweaning failure-to-thrive syndrome (PFTS) from
PFTS-affected (PFTS-SICK), age-matched healthy
(PFTS-HLTHY) pigs from an affected farm, and healthy pigs
selected from 2 unaffected farms (CTRL)
63
4.3 Summary of polymerase chain reaction (PCR) primers and
conditions used in the current study
66
4.4 Summary of the primary antibodies used in the current study 73
4.5 Frequency of lesions found in porcine periweaning
failure-to-thrive syndrome (PFTS)-affected (PFTS-SICK),
74
xii
Tables Page
age-matched healthy (PFTS-HLTHY) pigs from an affected farm,
and healthy pigs selected from 2 unaffected farms (CTRL)
5.1 Historical details of farms included in the PFTS case-control
diagnostic investigation
104
5.2 Prevalence and odds ratios indicating significance of
histopathological lesions observed in PFTS case and control pigs
107
5.3 Measured villous lengths, crypt depths and villi to crypt (V/C)
ratios of pigs in this study
109
5.4 Comparative assessment of the presence of ileal villous atrophy
using microscopic estimation and exact measurements
110
5.5 Prevalence, sensitivity, specificity and predicted values of
accurately diagnosing PFTS cases using at least two or all three
characteristic lesions: superficial gastritis, small intestinal villous
atrophy and thymic atrophy
111
5.6 Prevalence of common swine pathogens in case and control pigs
from each farm included in the investigation
112
6.1 Estimated values of serum parameters with significant interaction
between farm type and pig type
128
6.2 Estimated values of serum parameters with pig type as the only
significant predictor
130
6.3 Frequency of pigs with detectable serum GLDH (> 2 U/L) and 131
xiii
Tables Page
BHB (>0.1mmol/L)
7.1 Ingredients in the liquid diets fed until weaning to
snatch-farrowed, porcine-colostrum-deprived pigs in experiments
1 and 2
147
7.2 Ingredients and nutrient levels in the dry starter diet fed to the pigs
after weaning
148
8.1 Body weights and average daily gains of SF-pCD and FARM pigs 164
8.2 Numbers of IFN-γ-secreting PBMC in response to M. hyo antigen
stimulation in SF-pCD and FARM pigs
165
8.3 Day 40 serum M. hyo titers and porcine IgG concentration in
SF-pCD and FARM pigs
166
9.1 Treatment groups and inoculation schedule for PFTS inoculation
study
179
9.2 Number of days with diarrhea or fever during the two week period
following first inoculation (D15 to D29)
180
9.3 Median body weight (kg) and average daily gain (ADG; kg/d) at
selected time points following inoculation at day 14 and 21
181
xiv
List of figures
Page
3.1 Periweaning failure to thrive syndrome in nursery pigs 41
4.1.A Fundus from a PFTS-SICK pig 76
4.1.B Fundus from a PFTS-HLTHY pig 77
4.2.A Ileum from a PFTS-SICK pig 78
4.2.B Ileum from a PFTS-HLTHY pig 79
4.3.A Colon from a PFTS-SICK pig 80
4.3.B Colon from a CTRL pig 81
4.4 Nasal mucosa from a PFTS-SICK pig 82
4.5 Cerebellum of a PFTS-SICK pig 83
5.1 Gastric fundus; partial-CTRL pig 98
5.2 Gastric fundus; PFTS-CASE pig. 99
5.3 Jejunum; partial-CTRL pig. 100
5.4 Jejunum; PFTS-CASE pig. 101
5.5 Thymus; partial-CTRL pig 102
5.6 Thymus; PFTS-CASE pig 103
7.1 Body temperatures of snatch-farrowed,
porcine-colostrum-deprived (SF-pCD) pigs in experiment 1
150
7.2 Plasma concentrations of bovine and porcine immunoglobulin G
(bIgG and pIgG) in the SF-pCD pigs in experiments 1 and 2
151
8.1 Experimental design 162
xv
Page
8.2 Serum porcine and bovine IgG concentrations in SF-pCD and
FARM pigs
163
xvi
List of abbreviations
ACoV-1 Alphacoronavirus 1
AST Aspartate transaminase
BCoV-1 Betacoronavirus 1
BHB Beta-hydroxybutyrate
CBC Complete blood cell count
CDCD Caesarean-derived colostrum-deprived
CPE Cytopathic effect
CTRL Control
CV Coefficient of variation
DON Deoxynivalenol
E. coli Escherichia coli
ELISA Enzyme-linked immunoassay
FLUAV Influenza A virus
FMIA Fluorescent microsphere immunoassay
GEE Generalized Estimating Equations
GLDH Glutamate dehydrogenase
Hct Haematocrit
HEV Haemagglutinating encephalomyelitis virus
Hgb Haemoglobin
Hh Helicobacter-heilmannii-like organism
Hp Helicobacter-pylori-like organism
xvii
IM Intramuscularly
INOC Inoculation
IP Intraperitoneally
Mhyo Mycoplasma hyopneumoniae
OTA Ochratoxin
PBMC Peripheral blood mononuclear cells
PCR Polymerase chain reaction
PCV Pack cell volume
PCMV Porcine cytomegalovirus
PCV2 Type 2 porcine circovirus
PCVAD Porcine circovirus-associated diseases
PDS Prairie Diagnostic Services
PECV Porcine enteric calicivirus
PEV Porcine enterovirus
PFTS Periweaning failure-to-thrive syndrome
PMWS Porcine post-weaning multisystemic wasting syndrome
PRRS Porcine reproductive and respiratory syndrome
RV-A Group A rotavirus
SF-pCD Snatched-farrowed porcine-colostrum-deprived
SIV Swine influenza virus
SPF Specific pathogen free
SuHV-2 Suid herpesvirus 2
TDS Total dissolved solides
xviii
TGEV Transmissible gastroenteritis virus
TTV Torque Teno virus
1
1. Literature review
1.1. Introduction of PFTS
1.1.1. Brief history: from “starve-outs” to PFTS
After weaning, pigs enter to a new phase of life. Their diet changes from sow’s milk to solid feed.
The abrupt transition from mainly liquid diet to solid feed poses a challenge in that they must
learn to adapt this change. As a result, postweaning anorexia and a postweaning growth check
commonly occur in weaned pigs, but most pigs begin to eat within 24 hours postweaning.17
However, this may or may not happen successfully. It is well recognized that some pigs seem to
transition poorly to solid feed and subsequently die from starvation. A weaned pig with this
condition is called a postweaning “starve-out” and it has been known to occur in the swine
industry for a long time. The exact prevalence of postweaning starve-outs in a batch of nursery
pigs is not known, but understandably it must be lower than typical nursery mortality. Nursery
mortality rates vary among farms, but taking a recent study as an example, nursery mortality
with standard farm management was reported as 3.6% (172440 pigs from 32 sites).147 Thus it can
be estimated that the batch prevalence of starve-outs is lower than 3.6%. It may be that early
weaning (i.e. weaned at 2 weeks of age) is a risk factor for pigs not adapting to solid feed,
however, weaning older pigs does not eliminate starve-outs.59 Starve-outs are visually thin and
hairy with depressed mental status and a gaunt abdomen, demonstrate no activity around a feeder
and are dehydrated.59 Antibiotic treatment is not effective and it has been suggested that the first
30 hours postweaning is critical in identifying stave-outs because most of the pigs should have
consumed solid feed by that time.59 Potential underlying factors that may cause or predispose
pigs to overt postweaning starvation has not been investigated, possibly due to the low
2
prevalence of the condition and that it has been accepted as a “normal” phenomenon in
commercial pork production. This however has changed.
In 2008, two groups independently reported clinical syndromes in pigs which appeared to be
“outbreaks” of postweaning starve-outs affecting up to 15% of nursery pigs.42,57 As a result, the
nursery mortality rate in affected farms was elevated above historical averages. The clinical
syndrome waxed and waned and was not predictable in affected farms. In an affected farm in
western Canada, efforts to resolve the problem including adjustments to ventilation, feed and
water sources, antibiotic medication, adjustment of water nipples and use of electrolytes were
ineffective. Desiccation of the farrowing and nursery rooms with aerosolized hydrated lime
appeared to be the only effective method of reducing mortality, but the evidence was equivocal.
The partial success of aerosolized lime did, however, provide some evidence that an infectious
organism might play a role in these outbreaks.
Since 2008, this syndrome was increasingly recognized and discussed. Different names were
used to describe the syndrome, including “postweaning catabolic syndrome”,42 “postweaning
wasting-catabolic syndrome”,51,57 “failure to thrive syndrome”200 and “postweaning fading
pig-anorexia syndrome”.169 To facilitate investigation and communication, a standardized name
was proposed at the 2010 International Pig Veterinary Society Congress (Vancouver, BC,
Canada). A number of researchers, diagnosticians and swine practitioners from North America
met, discussed and reached the consensus that “Porcine Periweaning Failure-to-Thrive Syndrome
(PFTS)” would be a suitable name for this syndrome, because it reflects the age of onset and
clinical presentation.79 The word “periweaning” was chosen because: 1) the age of onset seemed
to be right at weaning; 2) it should not be confused with Porcine Postweaning Multisystemic
Wasting Syndrome (PMWS) caused by porcine circovirus type 2 (PCV2); and 3) the origin or
3
etiology may begin during the suckling phase.
1.1.2. Clinical presentation
Clinical signs originally reported were mostly non-specific (i.e. anorexia and lethargy) and
consistent with starve-outs at the individual pig level.42,57 Diarrhea was inconsistently present.57
Dehydration, depression, sneezing and standing but not willing to move were later also listed as
most frequent clinical signs. Additionally, Dr. Steven Henry, Abilene, Kansas, who was the
veterinarian for several farms affected by PFTS, made an interesting and important observation
that some affected pigs in all affected farms demonstrated repetitive oral behaviour such as
licking, chewing or chomping, which was subsequently thought to be characteristic of PFTS.79
1.1.3. Possible causes of PFTS
The etiology of PFTS is not presently known but theories have been suggested. PCV2, Porcine
Reproductive and Respiratory Syndrome Virus (PRRSV) and Mycoplasma hyopneumoniae were
thought to be unlikely causative agents of PFTS.57 Calicivirus was observed in feces of some
affected pigs by electron microscopy in one of the original reports, which might be responsible
for small intestinal villous atrophy and diarrhea.57 Haemagglutinating Encephalomyelitis Virus
(HEV), a group 2 coronavirus that causes Vomiting and Wasting Disease was detected in some
PFTS pigs,169 but data showing association between HEV and PFTS was not presented.169 Dr.
Steven Henry, who contributed substantially to the early description of PFTS, suggested that
Porcine Cytomegalovirus (PCMV) might be responsible for the sneezing and suppurative rhinitis
frequently encountered in PFTS pigs (2010, personal communication). He later proposed that
vitamin D deficiency may be the cause of PFTS, but subsequently discovered it to be widespread
in USA swine nurseries (personal communication, 2011). Use of a different breed of boar was
4
associated with the “disappearance” of PFTS in one farm (Pittman, personal communication
2011). When the author presented descriptions of PFTS to different audiences, frequently
encountered suggestions of etiologies also included mycotoxins, genetics and behaviour, which
remain purely speculations.
1.2. Infectious organisms, host and environment factors in the nursery
The working hypothesis in this thesis is that PFTS is an infectious disease. In an infectious
disease, the causative organism is obviously a necessary cause, without which the disease would
not occur. However, host and environmental factors, with differing weights on their contribution
to causality, together with the organism bring about the disease. Together, they are the sufficient
cause. The following section briefly reviews relevant aspects of organisms, host factors and
environmental factors in nursery pigs and contribution to postweaning disease of nursery pigs.
As this is a very broad topic, it is presented in the context of PFTS.
1.2.1. Overview of common nursery pathogens and PFTS-relevant pathogens
1.2.1.1. Porcine circovirus type 2 (PCV2)
PCV2 is an important pathogen that can cause postweaning anorexia and loss of body condition
in pigs, and is a major differential diagnosis for PFTS. PCV2, which belongs to the family
Circoviridae, is a circular single-stranded DNA virus that causes PMWS and other PCVAD.
PCV2 is further divided into 3 genotypes, PCV2a, 2b and 2c, with only 2a and 2b associated
with clinical diseases to date.8 The spectrum of clinical signs associated with PCV2 are wide,
including anorexia, weight loss, icterus, pneumonia, diarrhea and reproduction failure.177
Granulomatous inflammation of the lymphoid organs, lung and kidney, with or without
5
amphophilic botryoid cytoplasmic inclusion bodies in macrophages is the hallmark of PCV2
infection.29 Despite PCV2 being ubiquitous in commercial farms, not all farms or infected pigs
develop clinical disease. Thus, to diagnose PCVAD, the presence of clinical signs, characteristic
histological lesions and viral DNA or antigen within the lesion are all required.23,183 This makes
neither conventional PCR nor quantitative real time PCR a preferred diagnostic tool for
individual animals, but they are sensitive assays used to rule out PCV2 infection, not disease.
That being said, pigs with PCVAD have higher serum loads of PCV2 than pigs without clinical
disease.116 The vaccines currently marketed are effective. Although the commercial vaccines
available globally are based on PCV2a strains, they are effective against both 2a and 2b diseases.
It should be noted that the current vaccines reduce clinical disease and mortality effectively but
do not protect against infection.8
1.2.1.2. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV)
PRRSV, an Arteriviridae family member, is a positive-sense, single-stranded RNA virus. The
highly diverse PRRSV is able to cause reproductive failure in sows and respiratory disease in
suckling, nursery and older pigs. The nursery pig is an important target for clinical disease
caused by PRRSV, because maternally derived antibodies wane during the nursery period, 4-8
weeks postweaning. Nursery pigs affected by PRRSV may demonstrate subclinical infection
without sickness, or may develop clinical signs such as anorexia, lethargy and dyspnea.91 Gross
lesions are not specific but non-collapsed lung and enlarged edematous lymph nodes warrant the
inclusion of PRRS as a differential diagnosis in nursery pigs. Histological changes in
PRRSV-affected nursery pigs may include combinations of the following: interstitial pneumonia
with macrophage necrosis and infiltration, lymphoid depletion to hyperplasia depending on the
stage of infection, vasculitis and myocardial necrosis, and non-suppurative encephalitis.168
6
Prevention of the entry of PRRSV to the farm is crucial, because PRRSV typically persists in the
farm once entered. Farms can be infected with multiple strains simultaneously. However,
eradication of PRSV from a herd with high economical value has been reported.34,36 Commercial
vaccines are available, but satisfactory protection by vaccination is variable and not
guaranteed.211
1.2.1.3. E. coli
E. coli is a cause of postweaning diarrhea. Enterotoxigenic E. coli (ETEC) strains that possess F4
and F18 fimbriae and one or more enterotoxins are most commonly associated with postweaning
diarrhea, while the role of AIDA-bearing ETEC is less clear.47 Enteropathogenic E. coli (EPEC)
associated with attaching and effacing lesions may also be encountered in postweaning pigs with
or without diarrhea. Although disease is most commonly observed in the first week postweaning,
the use of prophylactic antibiotics can delay the onset of clinical signs by weeks.48 Diarrhea and
dehydration are the most common clinical signs, although acute death can occur. Diagnosis of
ETEC can be achieved by observation of clinical signs and bacterial attachment to enterocytes
without obvious cytopathic effect, isolation of characteristic beta-hemolytic bacteria and
subsequent demonstration of frimbrial antigens and toxin genes.47 The diagnosis of EPEC is
more challenging, because EPEC strains are typically non-hemolytic. Thus, EPEC strains cannot
be readily distinguished from the non-pathogenic strains on the basis of hemolysis, making the
downstream testing for virulence factor less feasible.211 The logical steps to diagnose
EPEC-associated diarrhea are the presence of clinical signs, the observation of characteristic
attaching and effacing lesions, and then demonstration of EPEC strains by culture and
subsequent tests.
7
1.2.1.4. Rotaviruses
Rotaviruses belong to the genus Rotavirus, family Reoviridae and are non-enveloped
double-stranded RNA viruses. Four serogroups based on antigenicity of viral protein VP6 are
reported for pigs: Group A, B, C and E.24
Group A rotavirus is a well documented cause of neonatal diarrhea.14,24 Uncomplicated group A
rotavirus infection causes mild diarrhea for 2 to 3 days. Degeneration of small intestinal villous
epithelium and subsequent villous atrophy are the characteristic, but non-specific, histological
changes. Morbidity of neonatal infection is typically less than 20%, within which only less than
15% (i.e. <3% total mortality) die from dehydration.24 Although it can also be detected in
postweaning pigs with diarrhea, the role of group A rotavirus in postweaning diarrhea is less
clear. In a study by Janke, group A rotavirus was detected in 41% of nursery pigs with diarrhea.87
Interestingly, during experimental inoculation of nursery pigs with pathogenic E. coli, it was
demonstrated that pigs infected with one particular strain of pathogenic E. coli did not develop
diarrhea unless fecal shedding of group A rotavirus was co-present, whereas pigs not infected
with E. coli but shedding group A rotavirus did not develop diarrhea.120 These findings suggest
that group A rotavirus in nursery pigs is at least a co-pathogen of diarrhea but infection of
nursery pigs may not lead to clinical disease.
Recent PCR evidence revealed that group B and C rotaviruses are also prevalent in suckling and
nursery pigs.110,111 Single infections of group B and C rotaviruses were present, but mixed
infections of two or three groups were most common. The virulence of group B and C
rotaviruses in separate age groups of pigs, as well as their biological impact in the porcine
industry await further characterization.
8
1.2.1.5. Coccidia
Cystoisospora suis176 (previously Isospora suis) is probably the only coccidian parasite
significant for the North American pig industry. The sporulated oocysts are highly resistant to
most disinfectants.106 Sows do not appear to be the major source of infection.106 Recent research
indicates that maternally derived antibodies do not protect piglets from infection.176 C. suis
mainly causes diarrhea in suckling pigs but can also affect nursery pigs. Increasing age is thought
to be negatively associated with susceptibility to C. suis infection.208 Based on experimental
inoculation of up to 2 x 106 oocysts per pig, pigs inoculated at 4 weeks and 6 weeks of age did
not develop significant gross and histological changes.190 Thus, the true impact of C. suis in the
nursery is not known. Infective dose is also a factor that affects the clinical outcome of C. suis
infection; larger doses induce more severe disease and pathology.190 Following infection,
affected pigs initially have diarrhea of pasty fecal consistency, that becomes more watery with
time.106 Demonstration of characteristic oocysts in clinically affected pigs by fecal flotation,
intestinal smear and histology are all methods used to diagnose C. suis diarrhea.106 Pathological
changes include small intestinal villous atrophy and in more severe cases, necrotizing enteritis
with intra-lesional organisms. Pathology appears initially in the jejunum and as infection
progresses, the ileum becomes more severely affected.131 Totrazuril, which is effective for both
sexual and asexual stages of C. suis, is an effective treatment.211 However, good management
and sanitation to reduce exposure to oocysts is an essential component of control.
1.2.1.6. Haemagglutinating Encephalomyelitis Virus (HEV)
HEV is a Betacoronavirus, which belongs to the family Coronaviridae. It is believed that HEV is
pathogenic to pigs younger than 4 weeks.171 The virus is widespread in the swine industry and
9
capable of causing two conditions, encephalomyelitis and wasting and vomiting disease, and the
two conditions can overlap in one outbreak. Clinical signs occur in naïve pigs and include
anorexia, vomiting, dehydration and central neurological signs such as paddling, muscle tremors,
and hyperesthesia,121 however subclinical infection is common. Older pigs and piglets that suckle
immunized sows are usually free from clinical diseases. However, a recent outbreak in Argentina
suggests that clinical signs continued from the suckling phase as 29% of the nursery pigs from
the affected farrowing site demonstrated wasting.161 Experimental inoculation of
colostrum-deprived neonatal pigs revealed that nasal mucosa, tonsils, lungs, and small intestine
were the sites of primary viral replication.6 Viremia was thought to be of little or no significance
to the clinical disease. Non-suppurative encephalomyelitis and ganglioneuritis of the stomach
wall, particularly in the pylorus, were the reported histological changes.6,161 A PCR assay
designed to detect HEV RNA based on amplification of the spike-like protein gene179 and
immunohistochemistry successfully demonstrated viral RNA and antigen respectively, in situ in
samples collected from the Argentina outbreak.161 It has been suggested that HEV may play a
role in PFTS169, however, solid evidence for this has yet to be presented.
1.2.1.7. Porcine calicivirus
Both norovirus and sapovirus, different genera within the Caliciviridae family, have been
detected in pigs. They are enteric caliciviruses that differ from vesicular stomatitis virus. The
prevalence of norovirus is 20% according to a study conducted in the USA, and were exclusively
detected in asymptomatic finishing pigs.204 In contrast, the prevalence of sapovirus was higher
(62% in pigs of all age groups) and most prevalent in nursery pigs (83%).204 Based on
inoculation studies, it appears that norovirus is less pathogenic compared to wild type
sapovirus.61 Small intestinal villous atrophy induced by experimental challenge is not
10
distinguishable from other viral enteritidis.61 In field situations, the impact of calicivirus in swine
populations has yet to be demonstrated. Besides electron microscopy, PCR assays using either
genus-specific primers or universal calicivirus primers have been described to detect porcine
calicivirus.202 In the farm in western Canada where PFTS was originally described, electron
microscopy revealed the presence of calicivirus-like viral particles.57 Further study of the
relationship between calicivirus and PFTS is needed.
1.2.1.8. Porcine cytomegalovirus (PCMV)
PCMV of the Betaherpesvirinae subfamily is the cause of inclusion body rhinitis. It is thought to
be ubiquitous in swine populations worldwide. PCMV infection is mostly self-limited and
mortality occurs only in neonatal pigs following aberrant systemic infection. Subclinical
infection or mild upper respiratory disease such as sneezing is most common.122,155 Gross lesions,
including catarrhal rhinitis and those indicative of vascular damage including edema and
petechiation in multiple organs are usually seen only in pigs less than 3 weeks of age.122 The
most characteristic histological lesion is the presence of basophilic, large intranuclear inclusion
bodies in the nasal glands, salivary glandular epithelium and lesser renal tubular epithelium. Dr.
Steve Henry, (Abilene, Kansas) observed a high prevalence of suppurative rhinitis in the PFTS
pigs associated with PCMV infection and proposed an association between PCMV in PFTS.69
Further research is needed to test this hypothesis.
1.2.1.9. Other pathogens in the nursery
Pseudorabies virus that causes respiratory and neurological signs, Streptococcus suis,
Haemophilus parasuis, Actinobacillus suis and Salmonella spp. that cause bacteremia and
septicemia, Mycoplasma hyopneumoniae that causes enzootic pneumonia, transmissible
11
gastroenteritis virus (TGEV) and porcine epidemic diarrhea virus (PEDV) that cause enteritis are
also significant pathogens that can affect postweaning health. Diagnoses of these diseases can be
readily established through the combination of the presence of clinical signs, characteristic
pathological changes and adjunct tests.
1.2.2. Host factors affecting health at weaning
1.2.2.1. Immunity
Host immunity obviously plays an important role in infectious diseases. Unfortunately, pigs at
weaning are vulnerable to infectious diseases largely due to the status of their passive and
adaptive immune systems.
Neonatal pigs receive the majority of their immunoglobulin from colostrum. Maternal
immunoglobulin is absorbed into the blood and is vital to protect neonatal pigs from systemic
diseases such as septicemia. The half life of the maternal immunoglobulin in the pigs’ circulation
is about 12-14 days.166 After gut closure at about 24 hours of life, pigs can no longer absorb
entire immunoglobulin molecules, but the immunoglobulin in sow’s mature milk continues to
provide mucosal immunity at the gut level.173 The relative proportion of IgA in milk increases
and that of IgG decreases during lactation.96 However, it is important to note that the total
immunoglobulin concentration, as well as each individual immunoglobulin (IgG, IgA and IgM),
decreases continuously.56,96 Inevitably, the passively acquired immunoglobulin levels in piglets
decays to a low point at or after weaning.
The immune system of weaned pigs is more developed compared to that of a neonate, but it is
not yet fully mature. The results of an investigation of the numbers of immunoglobulin-secreting
12
cells in various organs of 1-, 4-, 12- and 40-week old pigs demonstrated that numbers of
immunoglobulin-secreting cells in most sites of the intestine gradually increased with age.10
However, in spleen, bone marrow, peripheral and mesenteric lymph nodes, IgG-secreting cell
numbers dropped between 1 to 4 weeks10. Another study evaluating the dynamics of
T-lymphocyte sub-populations in pigs from day 1 to 6 months of age found that at 4 weeks,
T-lymphocyte sub-populations (γδTCR+, CD4+, CD4+CD8+, CD8+CD3+CD4-γδTCR-) had not
reached levels equivalent to adults.187 The biological relevance of these results may not be
immediately clear, but all point to the fact that the immune system of pigs is not yet mature at the
time of weaning.
Thus, as a result of the waning of passive immunity and partially mature adaptive immune
system, nursery pigs are vulnerable to infectious diseases.
1.2.2.2. Gut health
The effect of weaning on the gastrointestinal tract is another biological factor influencing the
health of the nursery pigs.
It has been well demonstrated that after weaning, pigs have reduced small intestinal villous
length and increased crypt depth compared to those at weaning.66,72,158 These morphological
changes are consistent with increased enterocyte turnover. The villous height and crypt depth of
weaned pigs do not return to the level at weaning even after 9 days.66 Interestingly, villous height
measured 5 days postweaning positively correlates to daily dry matter intake and weight gain.158
Transient inflammation of the gastrointestinal tract occurs after weaning. It has been suggested
that reduced feed intake contributes to this inflammation. During the period of postweaning
13
anorexia, small intestinal CD8+ T-cells and matrix metalloproteinase stromelysin increase but
subsequently return to a normal level when feed intake resumes and intestinal morphology
recovers.115 Further, proinflammatory cytokine (e.g. IL-1β, IL-6 and TNF-α) expression spikes
during the first 2 days after weaning and then returns to baseline levels.151
Small intestinal enzymatic activities are also altered after weaning. Affected enzymes that have
been investigated include lactase, glucoamylase, dipeptidyl peptidase, aminopeptidase,
aminopeptidase, γ-glutamyl transpeptidase and alkaline phosphatase.72 These alterations
typically last for 3 to 5 days and then gradually recover.72
Further, various factors including weaning age affect intestinal barrier function after weaning.
Decreased transepithelial electrical resistance and increased serosal-to-mucosal [3H]mannitol
fluxes occur in the intestines of pigs weaned at 19 days,126,127 but not in those weaned at 28
days.126 Feed intake also affects intestinal barrier functions. Pigs with high feed intake did not
develop increased mannitol flux while those with low intake did.206 Further, the degree of stress
at weaning also plays a role in small intestinal barrier function deregulation. Pigs that
experienced transportation stress before entering the nursery room developed increased mannitol
flux but this was not the case when pigs did not experience transportation before weaning.206
The change of intestinal microbiota after weaning has been investigated by some researchers.
Castillo studied the cecal content before and after weaning and found that Lactobacilli decreased
and Enterobacteria increased in numbers which resulted in significant increased
Enterobacteria-to-Lactobacilli ratio.22 However, Montagne reported both of the above increased
after weaned 7 days.129 On the other hand, Swords reported that after weaning, Bacteroides spp.
markedly increased in colon.191 Although there is little doubt that after weaning, bacteria
14
communities in the intestine undergo drastic changes, the effect of these changes on nursery pig
health has not been shown and needs further research.
1.2.3. Environmental factors affecting early weaning growth and health
1.2.3.1. Feed and swine health
Mycotoxin and ergot contamination are significant negative factors impacting swine feed
quality. The most important mycotoxins for pigs are aflatoxins and ochratoxin (OTA) produced
by Aspergillus spp., deoxynivalenol (DON), zearalenone and fumonisin produced by different
Fusarium spp.. Ergot alkaloids are produced by Cleviceps purpurea. Molds that produce
mycotoxins are divided into field and storage fungi.85 Field fungi include Fusarium spp.; they
grow and produce mycotoxins before harvest, but grow poorly in storage conditions. Storage
fungi include Aspergillus spp. and Penicillium spp., which can produce mycotoxins even at low
grain temperature and humidity.145
Although Aspergillus flavus is regarded as a storage fungus, it can produce large amounts of
aflatoxins even before harvest. Thus, grains are at risk of aflatoxin contamination both before
and after harvest.25 Drought and day-night temperature higher than 21°C favour high aflatoxins
contamination in grains.25,207 Thus, it is conceivable that geographic areas characterized by the
above conditions are more affected by aflatoxins (e.g. southern USA)25,207, whereas colder areas
like Canada are at lower risk.3,108 Aflatoxins mostly affect corn, peanuts, cottonseed and milo.145
They can be several fold more concentrated in the dried distillers grains with solubles fraction.
B1 toxin is the most prevalent and toxic among aflatoxins. Aflatoxins are hepatotoxic. Clinical
signs depend on the amount of intake, and can vary from reduced growth (dietary level between
200-400 ppb) to hepatic damage (more than 400 ppb).145 Suppression of cell mediated immunity
15
and phagocytic function has also been described.145
OTA is a nephrotoxin that can cause necrosis of the renal proximal convoluted tubules and in
chronic cases, interstitial fibrosis.145 OTA production is favored at lower temperatures
(12-25°C).145 Thus, it is rare in the USA and more problematic in Europe.145 OTA has been
detected in Canadian feed, but the impact on the swine industry is likely low, if any.3 In a study
conducted in western Canada that quantified mycotoxin levels from 106 feed samples suspected
of compromising animal health, 5 samples contained OTA, but none were from swine feed.3
Clinical signs of OTA toxicity are those of renal failure, including polydipsia and polyuria.
Diarrhea, anorexia and dehydration can also occur.145 The severity of OTA nephrotoxicity is dose
dependent. Dietary levels of 200 ppb can induce mild renal lesions, 1000 ppb can induce
polydipsia, reduced growth and azotemia, and 4000 ppb can cause renal failure.145
Immunosuppression and delayed response to vaccination make pigs prone to infectious diseases
when exposed to OTA.145
DON is a common contaminant of cereal grains (e.g. corn, wheat and barley) that is associated
with feed refusal.108,145 The distribution of DON in grains is worldwide. It is not uncommon for
swine feeds to contain low levels of DON.108 Dietary levels of more than 1 ppm are clinically
significant. There is a linear reduction in feed intake and weight gain from 2 to 8 ppm of
exposure. When the level reaches 20 ppm, complete feed refusal and vomiting can occur.145 The
reported immunological effects of DON are not consistent among studies. For example, feeding
similar levels of DON to pigs either increased152 or decreased170 the immune response to tested
antigens. Thus, the immunological effects of DON need to be further elucidated.
Zearalenone is produced in high moisture and can contaminate corn and wheat.25,209 Optimal
16
temperatures for Zearalenone production are 7-21°C.145 Zearalenone competitively binds to
estrogen receptors. In prepuberal gilts, 1-3 ppm dietary level can induce vulvovaginitis and rectal
prolapse. In cycling sows and gilts, 3-10 ppm may cause retained corpora lutea, anestrous and
pseudopregnancy.145 The effect on piglets is less described, but estrogenic effects have been
observed.145
Fumonisins mainly affect corn and induce pulmonary and hepatic pathology via disruption of
sphingolipid metabolism.124 Fumonisins are stable during grain processing but do not appear to
be a major problem in North America.209 More than 120 ppm of fumonisin in the diet causes
acute pulmonary interlobular edema.145 Acute toxicosis can also cause abortion, which is
assumed to be the result of fetal anoxia. Subacute exposure to a lower dose (50-100 ppm) causes
hepatosis characterized by increase serum hepatic enzymes, increase mitosis and apoptosis of the
hepatocytes.145
Ergot is a parasitic fungus that infects cereal grains (such as oat, wheat and rye) and grasses.145
Ergot alkaloids produced by ergot suppress prolactin and cause agalactia of sows, which
subsequently elevates piglet mortality because of starvation.145 Vasoconstriction and endothelial
damage also occur and lead to peripheral dry gangrene. It is recommended that ergot bodies
should be less than 0.3% prevalent in cereal grains, and ergot alkaloids less than 100 ppb in the
feed to avoid negative effects on pigs.145
The prevention of mycotoxin contamination of swine feeds including nursery diets is very
important for maintaining swine health. Different agents and processing techniques had been
developed to inactivate mycotoxins in feed and grains.25,209 Efforts to control fungal growth
before harvest are the most effective means to reduce the risk of mycotoxin toxicity.25 For
17
example, simply irrigating crops to reduce drought stress was able to substantially reduce (78%
reduction) Aspergillus flavus and hence aflatoxins.38 Early sowing, early maturation and early
harvesting of crops can reduce the time for fungus growth and thus reduce mycotoxin levels.25,107
If pre-harvest methods fail to protect crops from mycotoxin contamination, post-harvest means
are available to reduce the mycotoxin. Moisture control is likely the most important way to
reduced fungi growth and mycotoxin production in storage.25 Pelleting can also reduce fungal
growth because the process includes moisture removal. Mechanically screening the grains can be
used to remove broken kernels and grain dust, which usually contains high levels of
mycotoxins.164 Ammonia and ozone can be employed to treat grains to detoxify mycotoxins.25
Feed additives to absorb or degrade mycotoxins can be used to reduce the effect of mycotoxins.
Absorbing agents such as bentonites, zeolites and hydrated sodium calcium aluminosilicates can
bind mycotoxins (mostly aflatoxins, but also DON and zearalenone).25,145 Yeast and yeast cell
wall components are able to bind a wide range of mycotoxins, such as DON and
zearalenone.25,85,89 Some bacteria enzymes can degrade or alter the structures of mycotoxins (e.g.
DON, aflatoxins and zearalenone).25,89 Several assays are available to evaluate the level of
mycotoxin and ergot contamination in feed.145
Antibiotics and feed additives Antibiotics are probably the most effective feed additive used to
improve nursery growth and protect pigs from respiratory and enteric diseases.32,157 In fact, most
nursery diets in North America are medicated.32,37,162 Several antibiotics are approved for in-feed
use to prevent or treat enteric, respiratory and systemic diseases, as well as to promote growth.84
Antibiotics in starter diets are able to improve average daily gain (ADG) by over 16%.32
Although some antibiotics have been used for decades in the swine industry, their growth
promoting effect is not reduced.32 In-feed antibiotics also prevent morbidity and mortality of
18
young pigs.32 Tetracyclines were shown to be the most often used category of antibiotics in
nursery starter diet in both Canada and the USA.37,162,167 Postweaning diarrhea is an important
health concern for nursery pigs. In-feed antibiotics are effective for preventing and reducing the
incidence and impact of postweaning diarrhea. This can be demonstrated by the increase of
postweaning diarrhea after some European countries banned certain in-feed antimicrobials.72
Concerns about the induction of antimicrobial resistance in bacteria that may be transmitted to
humans have led to a large body of research conducted to explore alternatives to in-feed
antibiotics to promote postweaning growth performance and health, and reduce postweaning
diarrhea.94,156 It has been shown that a reduction of protein levels in feed without antimicrobials
but with supplemental of essential amino acids did not reduce the growth performance of nursery
pigs. This has been thought to be the most efficient way to counter the negative effect of
removing antibiotics from feed.186 Further, low protein diets supplemented with essential amino
acids significantly reduced postweaning diarrhea in an enterotoxigenic E. coli challenge
model.70-72 High levels of ZnO (2500 ppm) have also been shown to reduce postweaning
diarrhea and promote nursery growth.70 However, high dietary ZnO is only beneficial in the early
nursery phase and is recommended to be limited to about 3 weeks after weaning.82 Similarly,
high dietary levels of copper also act as a growth promoter.82 The effects of spray-dried animal
plasma has been extensively studied and reviewed.197 It has been shown that spray-dried animal
plasma, especially that of porcine origin, increases feed efficiency.197 Concerns were raised
whether or not the use of porcine plasma poses a risk for transmission of infectious diseases.
Taking a ubiquitous virus such as PCV2 as an example, it has been shown that although
commercial spray-dried porcine plasma contained a high level of PCV2 DNA, the spray-dried
plasma protein was not infective when fed to pigs.181 Other additives, such as probiotics and
19
prebiotics have also been considered as health and growth promoters.99 A probiotic is “a
preparation of or a product containing viable, defined microorganisms in sufficient numbers,
which alter the microflora (by implantation or colonization) in a compartment of the host and by
that, exert beneficial health effects in this host”. A prebiotic is “a non-digestible food ingredient
that beneficially affects the host by selectively stimulating the growth and/or activity of one or a
limited number of bacteria in the colon”.175 In swine, probiotic bacteria such as Lactobacillus
sobrius, certain strains of E. coli and yeast have been shown to promote growth and counter
postweaning diarrhea in some experiments.99 However, the wide use of probiotics in the swine
industry has not been endorsed because the effects had not been shown convincingly in field
settings.83 Similarly, prebiotics, such as lactose and inulin, have been reported to promote
beneficial bacteria growth, but the growth and health benefit to nursery pigs has yet to be
shown.99
The presentation, ingredients and nutrients of the feed are also obviously important for the
performance and health of the weaned pigs. Starter feed need to be highly digestible in order to
encourage feed intake.149 Crumble starter feed is preferred over pellet form.149 The level of
essential amino acid lysine is recommended to be 1.3% for pigs from weaning to 7 kg. The early
weaning diet should not contain more than 25% soybean meal (weaned between 21-28 days),149
which can cause transient hypersensitivity of the gut.105 Spray-dried porcine plasma, whey
powder, lactose, antibiotics and other growth-promoting additives are all benifitial in starter diet
to ensure performance.149 For older pigs, the diet composition can be simpler to accommodate
cost efficiency.
1.2.3.2. Water quality
20
Water quality is a factor that potentially affects nursery pig performance and health. Microbial
contamination is an important consideration of water quality of pig farms, and the quantity of
coliform bacteria has been used to evaluate the degree of water pollution.211 It was proposed by
the Environmental Protection Agency (1973) that water for livestock usage should not contain
more than 1000/100 ml coliform bacteria. However, it is understandable that pigs in a farm
environment are continuously exposed to much greater numbers of bacteria than indicated in this
guideline. Further, it is doubtful that coliform bacteria are truly representative of the microbial
contamination level of the drinking water. It can be granted that water contaminated with
pathogenic bacteria poses greater health risks to swine than those contaminated with
non-pathogenic bacteria. Surface water is of higher risk of being contaminated by microbes
compared to municipal water, but it has been shown that nursery pigs drinking from surface
water performed as well as those drinking from municipal water.136 Water pH ranging from 6.5 to
8.5 is thought be acceptable to swine.137,150 Alkaline water affects the efficiency of
chlorination.150 It had been shown that alteration of the pH of drinking water caused precipitation
of medication in the water and thus reduced availability of the medication.39 Total dissolved
solids (TDS) is another important water quality parameter, and over 7000 mg total soluble salts
per liter of water is considered unsafe for pigs. McLeese et al. showed that when water was not
medicated, nursery pigs consuming high TDS (4390 mg/L) water had reduced weight gain
compared to those consuming low TDS (217 mg/L) water.118 However, medicated water
eliminated this effect.118 Nitrate and nitrite are important contaminants of water fed to livestock.
The Canadian Water Quality Guidelines for livestock recommend maximum levels of water
nitrate and nitrate to be 100 and 10 ppm, respectively.118 Water high in nitrate and nitrite can
affect vitamin A utilization, reduce growth performance, and increase the prevalence of
21
diarrhea.137,150 The maximum sulfate content in swine drinking water is recommended to be 1000
ppm.150 It was shown in a survey that 25% of the well water sources used in swine farms
exceeded this limit.117 High sulfate levels in water can cause diarrhea in pigs.137 However, it was
demonstrated that nursery pigs could tolerate water sulfates of 1650 ppm without negative
growth and health impacts.148
1.2.3.3. Nursery management
Good management of the nursery room is vital for health of the pigs. Properly designed nursery
pens need to provide adequate space for feeding, comfortable drinking, sleeping, and defecating
areas for the pigs.21,211 Overcrowding facilitates the spread of infectious diseases because of the
increased direct contact among animals. The Canadian National Farm Animal Care Council has
proposed a new Code of Practice for The Care and Handling of Pigs (2013).1 According to this
code, if the heaviest nursery pig at the end of the nursery phase weighs 20 kg, the minimum
space allowance is 0.25 m2/pig.1 Enough feeder space can reduce competition during feeding and
hence less stress for the pigs. Feeder space for each pig that weighs 4-23 kg was recommended to
be 15-18 cm, and 30-35 cm for pigs over 23 kg.211 Not enough water consumption can reduce
feed intake. Water access should not be limited and should be provided at two locations in each
pen. For a nursery pig, water flow should be 0.5-1 L/min. Water nipple height is recommended to
be 35 cm when the drinker angle is 45°, and 30 cm when 90°.1 Temperature of the nursery room
is also important to the health of nursery pigs. Optimal temperature for newly weaned pigs is
27°C (desirable limits 24-30°C) which is gradually reduced to 21°C as pigs grow.1,211 However,
the air temperature may not represent what the pig experiences (effective temperature). Air speed,
type of flooring, humidity and group size, among others, can affect effective temperature.1,211
Nursery pigs should be protected from air speed over 0.25 m/s.1 In practice, the behaviour of the
22
pigs is good indicator of whether they feel comfortable with the temperature. A pig should sleep
on his side exposing the abdomen. Chilled pigs will huddle together and pigs in heat stress
pant.149 The target minimum ventilation rate for 14-23 kg pigs is 0.0014–0.0019 m3/s-pig.211
High humidity also predisposes pigs to diseases such as Streptococcus suis.33 The target relative
humidity of the nursery room is between 40-70%.211 Proper levels of fresh feed in the trough is
important to encourage newly weaned pigs to explore their new food source.59 Regularly adding
new feed to the feeder can trigger pigs to investigate the feeder.149 Sanitation between batches of
nursery pigs can greatly reduce disease transmission between batches and provide a clean
environment for the new pigs. Washing and removing organic matter can remove 90% of the
environmental bacteria, an additional 6 to 7% then can be killed by disinfectants, and a further
1-2% will be killed by fumigation.41,130 Infectious organisms can be protected from disinfectants
in organic materials such as feces, feed and biofilms, thus removing the organic matter is
prerequisite for effective disinfection. All the factors above should be considered together to
ensure successful management of nursery pigs.
1.3. Methods of detecting infectious organisms
An inescapable part of establishing that a disease is of infectious etiology is to identify the
causative organism. This section briefly reviews different methods to detect infectious organisms,
in context of their applications in veterinary diagnostics and research when applicable.
1.3.1. Human eye and microscopy
The human eye is an innate instrument for pathogen detection, and occasions exist where our
eyes can make a definite diagnosis. For example, Haemonchus contortus, a blood-sucking
nematode found in the abomasum of small ruminants where it causes anemia and
23
hypoproteinemia, can be identified with the naked eye by the characteristic barber’s pole
appearance. With the help of light microscopy, many more organisms can be detected with a
reasonable degree of certainty. The microscopic differentiation of parasitic eggs by fecal flotation
falls into this category. Some fungal organisms, such as Blastomyces dermatitidis can be
recognized in histological section by its broad-based budding in the background of
pyogranulomatous inflammation. Histopathology can also reveal the presence of bacteria that
can be categorized by morphology (e.g. rods, cocci, etc.), and can even give a hint of the
presence of viral pathogens if inclusion bodies are observed. Electronic microscopy (EM) affords
the human eye greater resolution. Except for prions, all microorganisms can theoretically be
observed through EM. It should be noted that as magnification increases, the amount of sample
that can be evaluated decreases accordingly. The naked eye can examine an entire animal, while
EM evaluates tissue that is only millimeters wide.146 Thus, selecting the correct sample(s) that
contains the organism is important. This is also true for any other method that is used to evaluate
tissue samples collected from one or more animals. Understandably, sampling from sites with
significant lesions helps to enhance the chance of detecting the causative organisms.
1.3.2. Culture-based methods
Culture on either liquid or solid media is still one of the most important techniques in detecting
and identifying bacteria. For example, for the diagnosis of Johnes’ disease caused by
Mycobacterium avium subspecies paratuberculosis, the widely used gold standard is bacterial
culture, despite the existence of advanced molecular methods.195 In pigs, different culture
techniques had been developed for common pathogenic bacteria. For example, Modified
Semisolid Rappaport Vassiliadis agar culture was found to be more sensitive, specific and
accurate than a commercial PCR method for the detection of Salmonella spp..44 Chocolate agar
24
or blood agar with adjacent Staphylococcus aureus nurse culture are used routinely to culture
Haemophilus parasuis.142
Similarly, the use of tissue culture to isolate viruses is useful in that it is relatively
broad-spectrum (compared to sequence-based methods) and can detect and replicate live viruses,
which can facilitate subsequent characterization of the virus in question. For example, PK15
cells (porcine kidney cell line) contributed to the first isolation of PCV2 from pigs with
PCVAD.43 Thus, virus isolation by tissue culture is still an important tool in investigating new
diseases caused by putative novel viruses, although it is becoming a less frequently used
diagnostic tool.
1.3.3. Immunological methods
Based on antigen-antibody reactions and various detection systems, immunological methods are
widely used in veterinary research and diagnostics to detect either antibody to or antigen of an
organism. Immunohistochemistry and fluorescent antibody techniques can demonstrate the
presence of pathogens in situ and are part of the diagnostic criteria for PCVAD.23 Enzyme-linked
immunoassay (ELISA) is widely used to detect antibodies against pathogens and the throughput
is reasonably high (i.e. tens of samples can be processed at the same time). Immunoperoxidase
monolayer assay (IPMA) is an frequently used method to evaluate PCV2 titer.98
Haemagglutination-inhibition (HI) may also be employed to detect antibodies for
haemagglutinating viruses, such as swine influenza virus.97
Recently, the development of fluorescent microsphere immunoassay (FMIA) greatly advanced
immunological methods by its ability to simultaneously perform up to 100 tests. An FMIA assay
has been developed to detect PRRSV antibodies in both serum and oral fluid.101 Similarly, a
25
multiplex FMIA for simultaneous detection of serum antibodies against PCV2, PRRSV and SIV
has been recently developed by a research group from the Kansas State University.205
1.3.4. Methods to detect DNA or RNA sequences of infectious organisms
The development of PCR172 greatly advanced the ability of scientists to detect microorganisms.
With knowledge of a limited length of the organism’s genome, a pair of short oligonucleotide
primers can be designed and the targeted sequence between the primers amplified enzymatically.
The amplified products can be analyzed by electrophoresis with or without blotting. Further, this
end-point analysis can be replaced by real-time detection of the products by either fluorescent
dyes or probes. The real-time version of PCR not only saves time by eliminating the
electrophoresis, it more importantly enables quantification of the target by the addition of
standards with known target copy numbers. With a mixture of different sets of primers (and
probes), both conventional and real-time PCR can be multiplexed.
Loop-mediated isothermal amplification (LAMP)135 which operates under isothermal conditions
and does not require a specific thermo cycler, makes on-site field detection of nucleic acid
possible.
Hybridization-based techniques, on a macro- or micro- scale can not only confirm the presence
of specific target sequences, but can also detect many microorganisms simultaneously. For
example, the pan-viral microarray contains conserved sequences (probes) of all known viruses
and offers wide spectrum screening of potential viruses in the sample.27 This technique was used
to discover Reston ebolavirus in pigs.7 Although the pan-viral microarray theoretically can detect
all viruses, its applicability for the detection of novel viruses is limited by the similarities
between the viral sequence and the sequence of the probes on the chip.
26
In situ hybridization is used to demonstrate the presence and location of DNA or RNA of a
microorganism on a histological section. With improved signal demonstration techniques (thus
increased analytical sensitivity),5 in situ hybridization is a powerful alternative to
immunohistochemistry with the advantage that no development of specific antibodies is needed.
Methods to detect microorganisms that do not require knowledge of genetic information of the
microorganisms are now available and their use is increasing. Representational difference
analysis (RDA) of cDNA can detect differences in genetic material present in two samples (e.g.
case vs. control),80 and its use led to the discovery of a murine norovirus that caused hepatic
necrosis in STAT1–/– mice.90 Other sequence-independent methods that were used before the
“high-throughput sequencing” era, such as sequence-independent single-primer amplification
and random PCR among others, have been reviewed recently.9,128
Next-generation sequencing technologies, however, are probably the most powerful tools for the
future of pathogen detection and discovery. Various high throughput sequencing platforms
produce up to several orders of magnitude more sequence reads per sample compared to
technologies based on Sanger sequencing.95 Veterinary research has begun to utilize and benefit
from these new technologies. The discovery of an astrovirus associated with shaking mink
syndrome, 13 the characterization of pig fecal virome,180 establishment of causal relationship
between proventricular dilatation disease of psittacine birds and avian borna virus,75 all involved
the application of high-throughput, next-generation sequencing.
Scientific methods are approaching the capability to sequence literally every nucleotide in a
sample. The sequence data, combined with advanced bioinformatics analysis, can theoretically
enable detection of every microorganism in a given sample. However, the problem becomes how
27
to understand the role of these microorganisms – i.e. how do we know whether these organism
cause disease or not?
1.4. Establishment of disease causation with emphasis on infectious disease
Much of the work presented in this thesis is centered on the hypothesis that PFTS is an infectious
disease. Determining the etiology of a disease, even with today’s advanced technology, is not
always an easy task. The kinds of evidence that can establish disease causation has been
extensively discussed and reviewed, especially during the past one hundred years.35,46,50 The
following section aims to provide some background useful for the interpretation of data collected
in the PFTS investigation.
1.4.1. Henle-Koch Postulates
With the improved ability to discover microorganisms, the germ theory of disease gained
popularity in the 19th century.50 However, as larger and larger numbers of unique microorganisms
were identified, investigators were faced with the need to differentiate between pathogenic and
non-pathogenic (commensal) organisms. In this historical scene, Robert Koch (likely under
Jacob Henle’s influence) developed criteria to determine if a microorganism was the cause of a
disease.165 These criteria later became known as “(Henle-) Koch’s postulates” and are as follows
(based on Rivers’ translation)165:
"1. The parasite occurs in every case of the disease in question and under circumstances which
can account for the pathological changes and clinical course of the disease.
2. The parasite occurs in no other disease as a fortuitous and nonpathogenic parasite.
28
3. After being fully isolated from the body and repeatedly grown in pure culture, the parasite can
induce the disease anew.”
If the above can be proved, “then the occurrence of the parasite in the disease can no longer be
accidental, but in this case no other relation between it and the disease except that the parasite is
the cause of the disease can be considered.” (Rivers’ translation 165)
1.4.2. Difficulties in fulfilling Henle-Koch postulates
In Koch’s day, the causative agents of anthrax, tuberculosis, erysipelas, tetanus and most other
infectious animal diseases fulfilled these postulates.46 However, Koch himself and many others
recognized that these criteria cannot be applied rigidly. Organisms that fulfill these criteria are
almost undoubtedly the cause of the disease in question, but those that cannot are not necessarily
excluded as the etiology of the disease in question. That is to say, the Henle-Koch postulates are
sufficient but not necessary evidence for causation. Even neglecting the technical problems with
fulfilling the first criterion (i.e. sensitivity of the detection method and timing of the sampling
among others), the second and third criteria of the postulates can be difficult or impossible to
fulfill.
Obviously, organisms that exhibit a subclinical carrier state or those that act as opportunistic
pathogens will not satisfy the second criterion of the Henle-Koch’s postulates. In the context of
swine diseases, PCV2 is an excellent example of this, in that it is considered to be nearly
ubiquitous in swine populations but not all infected pigs develop PCV2-associated diseases
(PCVAD).177 Thus it was no surprise that the swine community was skeptical about its causal
relationship to the clinical syndrome.177 However, evidence that PCV2 is the pathogen that
causes porcine postweaning multisystemic wasting syndrome (PMWS) (one of the PCVADs)
29
was very strong based on the presence of large amount of antigen in the characteristic lesions30
and that vaccination effectively reduced mortality associated with PCV2 infection.8 Porcine
Reproductive and Respiratory Syndrome (PRRS) is another pertinent example. Despite the claim
in the early 1990s that PRRSV fulfilled the Henle-Koch postulates193, subclinical infection of
PRRSV is common especially when the virus is endemic.134 In this sense, PRRSV actually
cannot be said to have fulfilled the Henle-Koch’s postulates; however, few doubt that it is the
causative agent of PRRS.
The challenge to fulfill the third criterion of the Henle-Koch’s postulates is two-fold, since it
requires both isolating the organism in pure culture, and experimental reproduction of the disease
in question using the isolated organism. The microorganisms that satisfied the postulates in the
early days were bacteria that could be isolated using acellular culture media (the strictest sense of
the original postulates). However, obligate parasitic organisms such as viruses and intracellular
bacteria cannot be cultured in acellular media, thus, it was impossible to fulfill the postulates in a
literal sense. Because of this, Rivers suggested conditions for establishing the causal relationship
of a virus and a disease that did not require culturing the virus (even in modified tissue cultures)
as a criterion.165 In the 1990s, molecular techniques to detect viruses (and other organisms) were
further proposed to replace the requirement for culturing.50
Reproducing the disease experimentally is another problematic requirement to satisfy the
Henle-Koch’s postulates. PCV2 again demonstrates this challenge in that PCV2 inoculation
alone, without manipulating the host immunity, injection of immune stimulants or co-infection
with another organism, is seldom successful in reproducing PCVAD.196
1.4.3. Modern guidelines for establishing infectious disease causation
30
The difficulties described above were indeed recognized by Koch himself.46 Fredericks and
Relman commented that the power of the Henle-Koch’s postulates “comes not from their rigid
application but from the spirit of scientific rigor that they foster”.50 Koch intended to convince
skeptics of his day (1880’s) that bacteria caused diseases such as tuberculosis by setting up very
strict criteria.50 After the germ theory of disease had been firmly established in the scientific
community, new guidelines were proposed for establishing infectious disease causation. From
the 1930s to 70s, different criteria for disease causation were proposed. Especially noteworthy
are Hill’s epidemiological criteria for causation, which are of specific relevance to the current
thesis.73 The first three of Hill’s criteria speak to the association of a putative causal agent or
event to the disease in question: the strength, consistency and specificity of the association.73
Other proposed criteria within this period include Rivers’s conditions for establishing the specific
relationship of a virus to a disease165, Evans’s immunological proof of causation45, and criteria
for establishment of viral causation of cancer, and chronic diseases.88 These emerged in the
context of specific scientific discoveries of infectious agents and diseases. Evans attempted to
take into account the common aspects of these later criteria and proposed ten criteria for
causation 46 as follows:
1. Prevalence of the disease should be significantly higher in those exposed to the putative cause
than in controls not so exposed.
2. Exposure to the putative cause should be present more commonly in those with the disease
than in controls without the disease when all risk factors are held constant.
3. Incidence of the disease should be significantly higher in the exposed to the putative cause
than in those not so exposed as shown in prospective studies.
31
4. Temporally, the disease should follow exposure to the putative agent with a distribution of
incubation periods on a bell shaped curve.
5. A spectrum of host responses should follow exposure to the putative agent along a logical
biologic gradient from mild to severe.
6. A measurable host response following exposure to the putative cause should regularly appear
in those lacking this before exposure (i.e., antibody, cancer cells) or should increase in
magnitude if present before exposure; this pattern should not occur in persons not so exposed.
7. Experimental reproduction of the disease should occur in higher incidence in animals or man
appropriately exposed to the putative cause than in those not so exposed; this exposure may be
deliberate in volunteers, experimentally induced in the laboratory, or demonstrated in a
controlled regulation of natural exposure.
8. Elimination or modification of the putative cause or of the vector carrying it should decrease
the incidence of the disease.
9. Prevention or modification of the host’s response on exposure to the putative cause should
decrease or eliminate the disease.
10. The whole thing should make biologic and epidemiologic sense.
Development of these unified concepts was a milestone for scientists seeking to establish
causation of diseases based on rigorous evidence and sound reasoning, and they are still largely
suitable guidelines to use in present disease investigations. However, one factor not addressed by
these guidelines pertains to quantities of the putative causative organism in diseased and
32
not-diseased groups. It is understandable that in Evans's time, quantitative techniques for
pathogen detection were not yet well developed. Real-time PCR172, has dramatically increased
scientists’ ability to detect and quantify organisms in samples. Fredricks and Relman brought this
scientific advancement into their molecular guidelines of infectious disease causality.50 Many of
Fredricks and Relman’s guidelines were a reaffirmation of Evans's concepts in the context of
sequence-based identification of organisms, but the quantity of an organism’s genome was taken
into consideration. They state in their second guideline: “Fewer, or no, copy numbers of
pathogen-associated nucleic acid sequences should occur in hosts or tissues without disease.”50
Another noteworthy guideline is that efforts should be made to demonstrate that the organisms
reside within lesions (the sixth guideline).50 Obviously, in the same animal(s), demonstrating the
organism or organism’s genome at the site of pathology and not in normal tissue is a powerful
indication that the organism is likely causally related to the disease in question.
Application of both of the above two guidelines (i.e. quantity of the organism and location of the
organism) was well demonstrated in the discovery of PCV2 and PMWS. Although PCV2 was
thought to be ubiquitous, pigs with PMWS have greater quantity of the virus compared to
subclinically infected pigs.116 As mentioned above, PCV2 was detected in large amounts within
lesions30 and this later became one of the diagnostic criteria for PMWS.23 It is noteworthy in the
context of affirming the causal relationship of PCV2 to PCVAD that, after commercial vaccines
were demonstrated to control PCVAD, the ninth of Evan’s criteria had also been fulfilled.
33
2. Rationale, hypotheses and objectives
The etiology of PFTS is not obvious based on the available literature. At the onset of this
research, the only evidence that pointed to an infectious etiology was circumstantial evidence
pertaining to the effect of desiccation of the farrowing and nursery rooms with aerosolized
hydrated lime in one affected farm in Saskatchewan. On the other hand, there was no evidence to
support that management, feed and water quality was associated with PFTS. Thus the author
hypothesized that PFTS is an infectious disease.
The objectives of this thesis are:
1) To develop a clinical definition of PFTS.
2) To determine the pathologic lesions most characteristic of PFTS based on a case-control study
of affected and non-affected pigs from affected farms.
3) To determine whether previously characterized porcine pathogens are associated with PFTS.
4) To determine if any specific serum chemistry is associated with PFTS, and whether this
specific serum chemistry reflects pathology in a specific organ(s) or biological system.
5) To develop a snatch-farrowed porcine colostrum-deprived (SF-pCD) animal model that can be
used for the experimental reproduction of PFTS.
6) To reproduce the clinical signs of PFTS, specifically debilitating weight loss and repetitive
oral behaviour, in SF-pCD pigs by inoculation of tissue homogenates collected from affected
pigs.
34
3. Clinical presentation, case definition, and diagnostic guidelines for porcine periweaning
failure to thrive syndrome
This chapter represents the first step in the scientific investigation of PFTS. In addition to
describing the clinical presentation of PFTS, a clinical case definition is proposed, which serves
as a tool to identify allegedly affected farms in the investigation.
Chapter 3 has been published and is reproduced here with the permission of the copyright owner
(American Association of Swine Veterinarians).
Huang Y, Henry S, Friendship R, Schwartz K and Harding J. Clinical presentation, case
definition, and diagnostic guidelines for porcine periweaning failure to thrive syndrome. J Swine
Health Prod. 2011;19(6):340-344
All authors contributed to proposal of the PFTS clinical definition and writing of the manuscript.
35
Porcine periweaning failure to thrive syndrome (PFTS) presents clinically as moderate but
variable morbidity (range from 1% to 20%) with high case fatality. Individual pigs, affected
within 7 days after weaning, demonstrate anorexia, lethargy, and progressive debilitation. PFTS
has specifically been noted in proceedings and publications from veterinarians and researchers
since 2008,42,57,200 although clinicians have observed weanling pigs with similar clinical signs for
many years. In some farms, the clinical signs of PFTS may have been confused with or masked
by other diseases, including porcine circovirus associated diseases (PCVAD), swine influenza,
and porcine reproductive and respiratory syndrome (PRRS). The recognition of cachectic and
debilitated pigs shortly after weaning that were PRRS virus (PRRSV) and swine influenza virus-
(SIV-) negative and porcine circovirus type 2-immunized, suggested that PFTS is a distinct
clinical entity. The authors are aware of PFTS or clinically similar cases reported in a number of
different regions of North America. Little is known about the cause of PFTS, but infectious
agent(s) and management-related factors need to be ruled out. In this paper, we propose a clinical
case definition for PFTS, describe the characteristic clinical progression and signs and observed
lesions, and make recommendations for the investigation of PFTS-suspected farms.
3.1. Obtaining the consensus name “porcine periweaning failure to thrive syndrome (PFTS)”
PFTS was previously reported as postweaning catabolic syndrome,42 postweaning
wasting/catabolic syndrome,51,64 and failure to thrive syndrome,200 and is possibly the same
disease as postweaning fading pig/anorexia syndrome.169 At the 2010 International Pig
Veterinary Society (IPVS) Congress in Vancouver, a number of researchers, diagnosticians, and
practitioners from North America met and reached consensus that the name “periweaning failure
to thrive syndrome (PFTS)” reflects the age of onset and clinical presentation of the syndrome.
The authors encourage the adoption of this name when describing cases meeting the case
36
definition outlined below, until such time that new knowledge of the etiology and pathogenesis
supports a more specific disease designation. We recommend that “periweaning” is preferable to
“postweaning”, because there may be management or infectious factors both pre- and
postweaning that contribute to the development or risk of PFTS.
3.2. Clinical case definition of PFTS
A proposed case definition for PFTS, revised and rephrased from Friendship et al,51 is as follows:
“PFTS is characterized clinically by the progressive debilitation of weanling (nursery) pigs in the
absence of discernible and detrimental infectious, nutritional, managemental, or environmental
factors that can explain the clinical syndrome. At weaning, affected pigs are of average to above
average body weight, and neither affected pigs nor their cohorts show evidence of residual
illnesses from the suckling phase. Within 7 days of weaning, affected pigs are anorexic and
lethargic. They deteriorate and within 2 to 3 weeks of weaning demonstrate marked muscle
weakness and loss of body condition. Some affected pigs in all affected farms show repetitive
oral behavior such as licking, chewing, or chomping. In affected farms, morbidity and mortality
by batch varies over time, but case fatality is high.”
3.3. Clinical signs
The most frequently observed clinical signs of PFTS are listed in Table 3.1. It is important to
emphasize that affected pigs and their cohorts demonstrate no obvious detrimental clinical
disease at the herd level prior to weaning. At weaning, the pigs that will become affected appear
healthy and of average to above average body weight and condition, and cannot be identified as
“at risk.” Four to 5 days after weaning, the affected pigs have hollow abdomens or flanks,
presumably the result of anorexia. Affected pigs appear hydrated. Frequent sneezing may be
37
heard in the nursery, but coughing and dyspnea are not typically observed. In affected pigs,
abnormal oral behavior of repetitive licking or chewing motions, or a repetitive and intentional
“chomping” activity, during which their heads may be drooped or elevated by resting the jaw on
the back of a penmate may be observed, provided the observer remains motionless and quiet for
a period of time. Such pigs are easily disturbed, making observation difficult. While identifying
PFTS-affected pigs within the first week after weaning requires careful observation, affected pigs
are easily identified by their lethargy, hollow abdomens, and failure to grow (Figure 3.1) by the
second week post weaning. With quiet observation, affected pigs may be observed grouped
together in a side-by-side stance with heads drooped. While this unusual posture may be
maintained for long periods of time, pigs eventually become weak, lie down together, and may
pile as if chilled. By 3 weeks postweaning, most of the affected pigs are severely debilitated
(Figure 3.1), have died, or have been euthanized.
Most management interventions, environmental manipulations, and medical treatments are
ineffective. That said, a critical review of all production practices must be performed to reduce
stress, to prevent the exacerbation of all nursery diseases including PFTS, and to ensure animal
welfare is maintained. Techniques that are consistently effective in reducing PFTS morbidity and
mortality have not been accomplished.
3.4. Relevant gross and histological observations
The definition of PFTS remains currently at the clinical level, but the frequently observed gross
and histological changes found in PFTS-affected pigs are summarized in Table 3.1. Whether or
not these lesions are significant to the pathogenesis of PFTS needs to be determined. Necropsy
examination reveals scant ingesta within the gastrointestinal tract. The small intestines of
38
affected pigs are empty or sometimes fluid-filled. The colon is empty or may contain pasty to
liquid content. At later stages in the disease process, when most sick pigs are typically submitted
for diagnostics, affected pigs have marked thymic atrophy, which is most obvious in the thorax.
If affected pigs in earlier stages are examined, thymic atrophy appears to be less severe grossly,
suggesting that it may be associated with prolonged anorexia or sickness, rather than a primary
lesion. Bronchopneumonia may be observed in some pigs, especially those in later disease stages
but is not a consistent finding. When the head is sectioned on the midline suppurative rhinitis,
characterized by purulent material in the nasal cavity as proximal as the ethmoid conchae, is
frequently observed in affected pigs as well as in some healthy penmates.
Microscopic lesions noted in PFTS-affected pigs include lymphocytic and suppurative rhinitis
with or without cytomegaloviral inclusion bodies, lymphocytic superficial fundic gastritis,
atrophic enteritis, and superficial colitis. Although the reasons for and the significance of these
particular lesions are not clear at this time, they are prevalent in affected pigs and serve as
pathologic indicators of PFTS. It is noteworthy however, that lymphocytic and suppurative
rhinitis with or without cytomegaloviral inclusion bodies and superficial colitis have also been
observed in healthy age-matched penmates of the affected pigs.76
3.5. Recommendations for herd investigations
As the etiology and pathogenesis of PFTS are unknown, the presence of typical clinical
progression, the age of onset, and the elimination by thorough diagnostic investigation of all
other known porcine diseases as primary entities should be used to classify affected farms as
having PFTS. A non-exclusive list of potential differential diagnoses based on clinical signs and
pathology are listed in Table 3.2.
39
Recognizing PFTS-affected pigs in the early stage (ie, 4 to 5 days post weaning) is difficult but is
vital to the proper interpretation of uncomplicated gross and microscopic pathology. Pigs that are
sick for a prolonged period of time are at greater risk of succumbing to secondary infections
which mask the original pathology. In our experience, an encompassing list of tissues must be
evaluated microscopically (Table 3.3), even if they look grossly normal. Failing to collect certain
tissues in suspected cases prevents the effective comparison with other cases, which is critical
when characterizing a new syndrome such as PFTS. It is important to examine nasal turbinate,
fundic stomach, small intestines, large intestine, and thymus histologically but these should not
be the only organs examined. In addition, examining age-matched healthy cohorts from suspect
farms is necessary to correctly interpret the significance of some gross and histologic lesions
observed in sick pigs. For example, if specific lesions are of equivocal prevalence and severity in
both sick pigs and healthy cohorts, the significance of these lesions is less certain. Special
arrangements with the diagnostic laboratory are strongly recommended to reduce the substantial
diagnostic costs associated with the examination of an extensive tissue set and the number of
animals required in a disease investigation compared to routine diagnostic submissions. In our
investigations of PFTS, it has also been useful to examine healthy pigs from unaffected farms in
order to characterize the morphology of normal, healthy age-matched pigs.
Recommendations for the investigation of herds demonstrating signs typical of PFTS are listed
in Table 3.4, which can serve as a checklist of actions to perform during investigation.
40
3.6. Implications
• Porcine PFTS is characterized by anorexia and lethargy of nursery pigs beginning soon
after weaning, and is not associated with porcine circovirus type 2 , PRRSV, or SIV
infection.
• The etiology and pathogenesis are unknown.
• The age of disease onset, presence of characteristic clinical signs, and elimination by
thorough diagnostic investigation of other known porcine diseases as primary entities
should be used to identify farms affected by PFTS.
• A thorough history, clinical examination, clinical pathology, gross and microscopic
evaluation of affected pigs is necessary to work up suspected cases of PFTS. The
pathologic examination should target affected pigs and age-matched healthy cohorts
between weaning and 3 weeks post weaning.
Continued collaboration amongst clinicians, producers and diagnosticians is needed to identify
cause(s), risk factors and prevention strategies for this syndrome.
41
Figure 3.1: Periweaning failure to thrive syndrome in nursery pigs. A: an affected pig showing a
hollow abdomen; B: a severely debilitated pig.
42
Table 3.1. Most frequently observed clinical signs and pathological changes of periweaning
failure to thrive syndrome
Clinical signs Pathological changes
Anorexia Chronic active rhinitis*
Lethargy Lymphocytic superficial fundic gastritis
Standing but unwilling to move Atrophic enteritis
Sneezing Superficial colitis*
Repetitive licking, chewing, or chomping behavior Thymic atrophy
* Lesions that have also been observed in age-matched cohorts.
43
Table 3.2. Potential differential diagnoses based on clinical signs and pathological changes
associated with pigs affected with periweaning failure to thrive syndrome*
Signs and lesions Pathogens
Debilitation, loss of condition PCV2, PRRSV, HEV
Thymic atrophy PCV2, PRRSV
Suppurative rhinitis PCMV, toxigenic Pasteurella multocida strains
Gastritis Helicobacter-like organisms, TGEV, rotavirus
Enteritis Pathogenic Escherichia coli, Salmonella
enterica serovars, TGEV, rotavirus, protozoans
(eg, Isospora suis)
Colitis Pathogenic E coli, Salmonella enterica
serovars, Brachyspira hyodysenteriae,
Brachyspira pilosicoli
* This is not intended to be a complete list of differential diagnoses. Swine diseases and
pathogens exotic to Canada and the United States are excluded.
PCV2 = porcine circovirus 2; PRRSV = porcine reproductive and respiratory syndrome virus;
HEV = haemagglutinating encephalomyelitis virus; PCMV = porcine cytomegalovirus; TGEV =
transmissible gastroenteritis virus.
44
Table 3.3. Tissues to collect from pigs suspected of having periweaning failure to thrive
syndrome*
Tissues with prominent lesions in affected pigs
Tissues Lesions in affected pigs
Gastric fundus Superficial lymphocytic gastritis
Duodenum, jejunum and ileum Atrophic enteritis
Spiral colon Superficial colitis
Nasal turbinate Chronic active rhinitis with or without cytomegalovirus
inclusion bodies
Thoracic thymus Thymic atrophy (grossly and histologically)
Tissues to rule out other potential pathogens or lesions†
Tissues Pathogens or diseases to rule out
Lung PRRSV, SIV, PCV2, Haemophilus hyopneumoniae,
Haemophilus parasuis, etc
Lymph nodes, tonsil and spleen PCV2, septicemia, etc
Kidney PCV2, glomerulonephritis, etc
Whole or half brain Streptococcus suis, H parasuis, nonsuppurative
encephalitis, etc
Pharynx and esophagus Lesions that can compromise the passage of solid food
Gastric pars oesophagea Ulceration and stenosis of the cardiac opening
Gastric pylorus HEV-associated ganglionitis8
Other tissues to collect for evaluation
Tissues Purpose of collecting
Liver, heart, pancreas, skeletal
muscles
Rule out significant lesions; potential diagnostic use
(eg, virus isolation, bacterial culture, PCR); maintain a
thorough postmortem examination
45
* The tissues listed in this table are not exhaustive. Other tissues may be collected if deemed to
provide useful information.
† The differential diagnoses in this table are examples and are by no means complete.
PRRSV = porcine reproductive and respiratory syndrome virus; SIV = swine influenza virus;
PCV2 = porcine circovirus type 2; HEV = haemagglutinating encephalitis virus; PCR =
polymerase chain reaction
46
Table 3.4. Ten recommendations for the investigation of farms demonstrating signs typical of
PFTS
1. Observe each production stage to identify sick pigs or clinical signs indicative of known
infectious and noninfectious diseases, and perform diagnostics to investigate these as
appropriate.
2. Perform a site visit to audit and verify environmental conditions, management practices, feed
and water quality and availability, and feeding practices.
3. Obtain historical and current records of the morbidity and mortality of suckling, nursery and
grower-finisher pigs. Verify temporal trends and confirm mortality levels in the nursery are
elevated.
4. Collect and analyze water and feed samples to rule out toxicities (eg, mycotoxins, herbicides,
pesticides, etc) and potential nutrient imbalances, and to verify nutrient content.
5. Observe nursery pigs when they are in a quiet state. This will allow the recognition of clinical
signs that are hard to identify, such as “chomping.” Systematically observe nursery pigs of
each week, starting with the youngest. Also carefully observe the oldest suckling pigs.
6. Take multiple digital images and videos in different production areas of the farm, especially
in the affected rooms. Look for and capture unusual; oral behaviour such as licking or
chomping.
7. Submit live pigs for thorough work-up including necropsy, histopathology and adjunct tests
on multiple animals including sick and healthy age-matched cohort pigs.
8. Whenever possible, identify pigs in the early disease stages for collecting diagnostic samples.
However, it may also be useful to submit pigs of sequential ages and disease chronicities.
9. Collect internal organs and other tissues for histology (Table 3), even if they lack visible
gross lesions.
10. Store tissues and sera at proper and varied conditions (chilled, -80o Celsius freezer,
formalin-fixed, paraffin-embedded, RNA stabilizer, etc) to facilitate different diagnostic
applications.
47
4. Diagnostic investigation of porcine periweaning failure-to-thrive syndrome in a farm from
Saskatchewan: lack of compelling evidence linking to common porcine pathogens
This chapter presents a diagnostic investigation performed in a farm in Saskatchewan and was
the first PFTS investigation undertaken. Several highly prevalent histological changes were
found in this farm. None of the tested pathogens were clearly associated with PFTS pigs in this
farm.
Chapter 4 has been published and is reproduced here with the permission of the copyright owner
(American Association of Veterinary Laboratory Diagnosticians).
Huang, Y., H. Gauvreau, and J. Harding, Diagnostic investigation of porcine periweaning
failure-to-thrive syndrome lack of compelling evidence linking to common porcine pathogens. J
Vet Diagn Invest, 2012. 24(1): p. 96-106.
Huang and Harding were responsible for the experimental design and necropsies. Huang
contributed to the histological evaluation of tissues. Gauvreau was the veterinarian of the farm
and contributed intellectually of the discussion of potential etiologies of PFTS.
48
4.1. Introduction
“Failure-to-thrive” is a term in the pork industry that refers to pigs that appear not to eat after
weaning, and subsequently lose body condition and die with no other known etiology.
Importantly, failure-to-thrive pigs are not lightweight pigs (i.e., runts) at birth or weaning.
Commonly referred to as “starve-outs” by producers, such pigs have been observed at a low
prevalence (up to 0.5% of total weaned) for many years. In the past, the condition received little
attention since the prevalence and economic loss was low. However, herd outbreaks of
failure-to-thrive pigs, resulting in nursery mortality that has risen well above historical baseline
levels, were recently recognized in a number of North American farms.42,57 The condition was
recently named “periweaning failure-to-thrive syndrome” (PFTS), and a clinical case definition
proposed as follows: “PFTS is characterized clinically by the progressive debilitation of
weanling (nursery) pigs in the absence of discernible and detrimental infectious, nutritional,
managemental, or environmental factors that can explain the clinical syndrome. At weaning,
affected pigs are of average to above average body weight, and neither affected pigs nor their
cohorts show evidence of residual illnesses from the suckling phase. Within 7 days of weaning,
affected pigs are anorexic and lethargic. They deteriorate and within 2–3 weeks of weaning
demonstrate marked muscle weakness and loss of body condition. Some affected pigs in all
affected farms show repetitive oral behavior such as licking, chewing or chomping. In affected
farms, batch morbidity and mortality varies over time, but case fatality is high”.79 The etiology of
PFTS is presently unknown and may include infectious agent(s), noninfectious factors, or both.
A 100-sow farrow-to-finish farm has experienced disease causing fluctuating nursery mortality
beginning early 2007. The clinical presentation of this disease meets the definition of PFTS
quoted above. This farm is historically free of Mycoplasma hyopneumoniae and Porcine
49
reproductive and respiratory syndrome virus (PRRSV). Nursery mortality was elevated by 3.7
fold (7.2% for 2007–2009; 1.9% for 2004–2006), mostly attributable to failure-to-thrive piglets.
Chomping behavior was observed in the failure-to-thrive pigs in this farm. Common mycotoxins
(tested by the Veterinary Diagnostic Laboratory of North Dakota State University, Fargo, North
Dakota) and herbicides (tested by ALS Laboratory Group, Saskatoon, Saskatchewan, Canada) in
feed and water, respectively, were negative. Various managemental and medical interventions to
control PFTS had been attempted, but failed to prevent mortality. The interventions included
ventilation adjustments to prevent piglet chilling, changes in starter feed and water source,
antibiotic treatments, H3N2 swine influenza vaccination of the breeding herd, and Porcine
circovirus-2 (PCV-2) vaccination of piglets at weaning. Although thorough desiccation of the
farrowing and nursery rooms with aerosolized hydrated lime appeared to be beneficial during
periods of elevated PFTS mortality, the cyclical nature of clinical signs and mortality on the farm
made it difficult to evaluate the true impact of this procedure. On the other hand, it supports the
hypothesis that infectious agent(s) may be involved in pathogenesis of PFTS. The objective of
the current study is to report the diagnostic investigation of PFTS on this farm with emphasis on
describing the most prevalent lesions and identifying the infectious agents in PFTS-affected
compared to age-matched, nonaffected pigs.
4.2. Materials and methods
4.2.1. Sample collection
During periods of peak PFTS mortality, sick pigs with characteristic clinical signs (PFTS-SICK;
n = 18), and healthy age-matched cohort pigs selected from the same weaning group and air
space (PFTS-HLTHY; n = 7), ranging in age from 3 to 6 weeks old (1–3 weeks postweaning),
50
were selected on the farm. Although chomping behavior was observed on the farm during
outbreaks of PFTS, the chomping status of the pigs included in the current study was unknown
as the authors failed to recognize the biological importance of this clinical sign at the onset of the
investigation. Four age-matched healthy pigs from each of 2 unaffected farrow-to-finish farms
were handled similarly on separate occasions and included as a comparative group in the
investigation (CTRL; n = 8). PFTS-SICK and PFTS-HLTHY pigs were sedated with azaperone
(Merial Canada Inc., Baie d’Urfé, Quebec, Canada) (2.2 mg/kg intramuscularly) on the farm, and
transported to the necropsy facility at the University of Saskatchewan (Saskatoon, Saskatchewan,
Canada). The CTRL pigs were transported unsedated because the length of time in transit was
shorter, thus aggression during transport was less of a concern. Necropsy examinations were
performed immediately after humane euthanasia using intravenous barbiturate overdose. An
extensive list of tissues (Table 4.1) were collected and processed routinely for bacterial culture,
histology, and adjunct testing for common swine pathogens. Fecal samples were collected from a
subset of PFTS-SICK (n = 5) and PFTS-HLTHY (n = 3) pigs at the time of necropsy. Fecal
samples (n = 5) were collected from age-matched pigs from 1 CTRL farm but on a different day
and not from the necropsied pigs.
4.2.2. Diagnostic tests
Adjunct diagnostic tests were performed on appropriate tissues and samples (Table 4.2) using
published or in-house protocols. The primers and conditions of polymerase chain reaction (PCR)
testing are summarized in Table 4.3. Immunohistochemistry (IHC) was performed using a
streptavidin–biotin complex technique adapted for an automated slide stainer (Fisher Scientific
Co., Edmonton, AB, Canada) as previously described.8 The primary antibodies used for IHC in
the present study are summarized in Table 4.4. Binding of the primary antibodies was detected
51
using biotinylated goat anti-rabbit immunoglobulin (Ig)G and horse anti-mouse IgG, (Vector
Laboratories Inc., Burlingame, CA) and an avidin–biotin immunoperoxidase complex reagent,c
with 3,3’-diaminobenzidine tetrahydrochloride (Electron Microscopy Science, Ft. Washington,
PA) as the chromogen.
Routine aerobic and anaerobic bacterial cultures were performed on the jejunum, colon, and lung.
When hemolytic Escherichia coli was cultured, an agglutination test was applied to detect the
presence of F4 fimbria.
The following pathogens were tested by either PCR or IHC (Table 4.2): PCV-2 (IHC, on
lymphoid organs, stomach, small and large intestine), PRRSV (PCR, on lung), Influenza A virus
(FLUAV; PCR, on lung), Alphacoronavirus 1 (ACoV-1; previously known as Transmissible
gastroenteritis virus; IHC, on stomach, small and large intestine), Rotavirus A (RV-A; IHC, on
stomach, small and large intestine), Porcine enteric calicivirus (PECV; PCR, on small and large
intestine), Betacoronavirus 1 (BCoV-1; previously known as Haemagglutinating
encephalomyelitis virus; PCR, on tonsil, lung, kidney, small and large intestine), Suid
herpesvirus 2 (SuHV-2; previously known as Porcine cytomegalovirus; PCR, on tonsil, lung,
kidney, small and large intestine), Torque teno virus 1 and 2 (TTV-1, -2; PCR, on spleen or bone
marrow), E. coli virulence factors (AEEC, AIDA, Sta, STb, LT, SLT; PCR, on cultured colonies
from small and large intestine), Brachyspira hyodysenteriae and Brachyspira pilosicoli (PCR, on
large intestine). Except for SuHV-2, BCoV-1, and PECV, the above tests were performed by a
commercial diagnostic service (Prairie Diagnostic Services Inc., Saskatoon, Saskatchewan,
Canada). The PCR detection of SuHV-2, BCoV-1, and PECV was performed in-house according
to published methods with minor modifications (Table 4.3).63,179,203 Fecal flotation using
Wisconsin double centrifuge technique31 was performed to detect parasitic oocysts in the feces.
52
4.2.3. Statistical analysis
The frequency of gross and histologic lesions and pathogens in PFTS-SICK, PFTS-HLTHY, and
CTRL pigs were compared using a Fisher exact test. Group differences were statistically
significance if P < 0.05.
4.3. Results
4.3.1. Gross and histological lesions
On gross examination, all of the PFTS-SICK pigs were emaciated with loss of body fat reserves.
The thoracic thymus was severely atrophic and sometimes barely visible. Gastrointestinal (GI)
tracts were empty, and often much smaller in diameter compared to PFTS-HLTHY and CTRL
pigs. Seven of 18 (39%) PFTS-SICK pigs had mild to severe cranioventral consolidation in the
lungs. No gross lesions were observed in the PFTS-HLTHY and CTRL pigs (Table 4.5).
The most frequent histological lesions in PFTS-SICK pigs were thymic atrophy, superficial
lymphoplasmacytic fundic gastritis, villous atrophy of the small intestine (duodenum, jejunum,
and ileum), superficial colitis, lymphocytic and neutrophilic rhinitis, and mild nonsuppurative
meningoencephalitis (Table 4.5). The frequency of these lesions was significantly higher in the
PFTS-SICK than CTRL pigs (Table 4.5). In the thymus, the thickness of the cortex was severely
reduced, yet the remnant of the medulla was still visible. In the stomach, the surface lining
epithelial cells of the fundus were multifocally to diffusely attenuated, and mucus was lost in the
cytoplasm. The glandular epithelial cells were occasionally necrotic. Moderate numbers of
lymphocytes and plasma cells infiltrated the subepithelial lamina propria of the fundic stomach
(Fig. 4.1). In fundus, no ganglionitis was observed. Unfortunately, pylorus was not examined in
53
the current study, where ganglionitis, if present, will be more likely found. The small intestinal
villi were moderately to severely shortened (Fig. 4.2) and covered by low cuboidal to
occasionally squamous epithelial cells. Low to moderate numbers of different stages of coccidia
were present in the small intestinal epithelium of 6 out of 18 (33.3%) PFST-SICK pigs (Table
4.2). The colonic epithelium was disorganized, hyperplastic, or attenuated. Increased numbers of
lymphocytes and plasma cells were present in the colonic lamina propria (Fig. 4.3). In
approximately half of the PFST-SICK pigs, coccobacilli were observed attaching to the colonic
epithelium, leading to rounding, necrosis, and sloughing of the epithelial cells, morphologically
consistent with attaching and effacing E. coli (AEEC) infection (Table 4.2). The nasal mucosa
was infiltrated by moderate to large numbers of lymphocytes, plasma cells, and neutrophils. The
epithelial cells of the submucosal glands were frequently necrotic and attenuated. Large
basophilic intranuclear inclusion bodies were occasionally observed in the glandular epithelium
in a small portion of PFTS-SICK pigs, consistent with SuHV-2 infection, known commonly as
inclusion body rhinitis (Table 4.2, Fig. 4.4). Mild nonsuppurative meningoencephalitis,
characterized by lymphocytic to histiocytic perivascular cuffing around the meningeal and
parenchymal vessels (Fig. 4.5), was observed in 6 of the 13 PFTS-SICK pigs in which the brain
was examined histologically. The frequency of nonsuppurative meningoencephalitis in
PFTS-SICK pigs was significantly higher than in PFTS-HLTHY and CTRL pigs.
Occasionally, other lesions were observed in the PFTS-SICK pigs, including various degrees of
suppurative bronchopneumonia, lymphocytic nephritis, and fatty liver (Table 4.5). In the lung,
bronchopneumonia was characterized by infiltration of neutrophils and consolidation of the
parenchyma. Necrotizing bronchiolitis was not observed. The prevalence of bronchopneumonia
in PFTS-SICK pigs was significantly higher than that in PFTS-HLTHY and CTRL pigs. No other
54
significant lesions were observed in the tissues sampled.
Rhinitis was present in all PFTS-HLTHY pigs and was (16.7%) or was not (83.3%) associated
with cytomegalovirus inclusion bodies (Table 4.5). Atrophic duodenitis (85.7%), jejunitis
(14.3%), and superficial colitis (71.4%) were also present in the PFTS-HLTHY pigs (Table 5).
The prevalence of rhinitis, atrophic duodenitis, and superficial colitis in PFTS-HLTHY pigs was
significantly higher compared to CTRL, but not different from PFTS-SICK pigs (Table 4.5). One
CTRL pig had mild rhinitis and 1 had colitis. No coccidia were observed in the intestines of
PFTS-HLTHY pigs, but 1 single macrogamont was detected in 1 out of 8 (12.5%) CTRL pigs.
No other histological lesions were observed in any PFTS-SICK or CTRL pigs.
4.3.2. Detection of bacteria
No biologically relevant bacteria were consistently cultured from PFTS-SICK pigs (Table 4.2).
No F4-positive E. coli or Salmonella spp., or target DNA of B. hyodysenteriae and B. pilosicoli
were detected from any pigs. Clostridium perfringens was cultured from the intestines of some
PFTS-SICK (22%) and PFTS–HLTHY (29%) pigs, but not CTRL pigs. Two C. perfringens
isolates from PFTS-SICK pigs were tested by PCR for toxin genes (alpha, beta1, beta2, and
epsilon toxin genes). Both isolates were only positive for alpha toxin and classified as C.
perfringens type A (data not shown). Pasteurella multocida, Streptococcus suis, Haemophilus
parasuis, Bordetella bronchiseptica, and Streptococcus equisimilis were isolated once from
different PFTS-SICK pigs (Table 4.2). There were no group differences in the frequency of the
above bacteria (Table 4.2).
55
4.3.3. Detection of viruses
The viral detection results are summarized in Table 4.2. No PCV-2 antigen was detected in
lymphoid tissue, stomach, or small and large intestine of any PFTS-SICK or PFTS-HLTHY pig
by IHC. All PFTS-SICK and PFTS-HLTHY pigs tested negative for PRRSV, FLUAV, and
ACoV-1. A low proportion of PFTS-SICK pigs were positive for RV-A in small intestine by IHC.
Enteric calicivirus was detected in at least 1 pig in each group by PCR, and SuHV-2 was detected
in all pigs except in 1 PFTS-SICK pig. Betacoronavirus 1 was present in the tonsils of one-third
of the PFTS-SICK pigs, but not in any PFTS-HLTHY and CTRL pig. However, the lungs,
kidneys, and small and large intestines were negative for BCoV-1 DNA. Further, when the brain
stems (medulla oblongata) of the BCoV-1 tonsil–positive PFTS-SICK pigs were tested for
BCoV-1 DNA by PCR, all were negative. All of the pigs were negative for TTV-1, and small
numbers of pigs in each group were positive for TTV-2. Despite the identification of these viral
agents, there were no statistical group differences in the detection frequencies among
PFTS-SICK, PFTS-HLTHY, and CTRL pigs (Table 4.2).
4.3.4. Detection of parasites
Nonsporulated coccidia oocysts were detected in all 3 groups (Table 4.2). No other parasitic
oocysts were observed by fecal flotation. No statistical differences in the detection frequencies of
coccidia were identified among PFTS-SICK, PFTS-HLTHY, and CTRL pigs (Table 4.2).
4.4. Discussion
The current study aimed to describe the pathological changes in pigs affected by PFTS, and to
identify common swine pathogens associated with, and possibly the cause of, PFTS. The most
56
prevalent lesions in PFTS-SICK pigs were superficial lymphocytic fundic gastritis, atrophic
enteritis, superficial colitis, lymphocytic and neutrophilic rhinitis, mild nonsuppurative
meningoencephalitis, and thymic atrophy. The GI lesions, especially those present in the stomach,
of the PFTS-SICK pigs may explain the clinical presentation of anorexia and wasting. Gastritis,
enteritis, and colitis together can cause abdominal discomfort and loss of appetite, and thus feed
refusal. However, it is also possible that the GI lesions were secondary to anorexia. Fasting in
rats can cause small intestinal villous atrophy.40 In pigs, Pittman et al. reported that jejunal
atrophic enteritis was induced in 6 out of 6 pigs by 4 days of fasting that began on the day of
weaning.154 In that study, lymphocytic gastritis was observed in 3 out of 6 fasted pigs. The same
lesion however, was also seen in 3 out of 6 healthy pigs necropsied on the day of weaning
(whether these pigs would be affected by PFTS was not known), 2 out of 6 healthy, and 2 out of
6 PFTS-affected pigs all on 4 days postweaning. By contrast, lymphocytic gastritis was not
observed in pigs from a PFTS-free farm 4 days postweaning. The data suggest that in the
PFTS-affected farm that Pittman studied, lymphocytic gastritis is a background lesion, regardless
of treatment group. The same conclusion cannot be drawn in the current study, however, because
superficial lymphocytic fundic gastritis was only observed in PFTS-SICK pigs and not in
PFTS-HLTHY pigs. It should be noted that in the Pittman study, a detailed histological
description of the lymphocytic gastritis is not available, thus comparison of this lesion to the
gastric changes observed in the present study is not possible. The pathogenesis of the thymic
atrophy observed in PFTS-SICK pigs is unknown in that it may either be a primary change
associated with infection by an immunosuppressive pathogen (e.g., PCV265), or secondary to
prolonged sickness or anorexia.60
Mild to severe suppurative bronchopneumonia was present in approximately 40% of the
57
PFTS-SICK pigs. Although bronchopneumonia would have likely contributed to the clinical
progression of the affected pigs, it cannot fully explain the clinical signs in all PFTS-SICK pigs.
It is more likely that the pneumonia developed secondary to debilitation in some sick animals
and was caused by opportunistic bacteria. Due to the difficulty in interpreting the biologic
relevance of lesions observed in chronically debilitated pigs, it is suggested that diagnostic
efforts focus on pigs in the early stages of illness. Thus, future investigations by the current
authors will specifically target clinical pigs within 2 weeks of weaning.
A significant portion of PFTS-SICK pigs had very mild nonsuppurative meningoencephalitis, the
cause of which was not determined by the current investigation. The significance of this lesion is
uncertain. On the one hand, this may be a potential explanation for the chomping behavior,
suspected to be centrally neurological in origin, which was observed in this PFTS-affected farm.
On the other hand, inflammation in the histological sections examined, including 13 serial
sections of brains from each of 3 PFTS-SICK pigs, was very mild, and may not be clinically
relevant. Clinical neurological examination and additional histological examination of brain of
additional PFTS-SICK pigs is underway and will help determine if the oral behavior and other
clinical signs of PFTS are associated with neurological deficits.
It is noteworthy that certain lesions such as atrophic duodenitis, superficial colitis, and rhinitis
were highly prevalent in both PFTS-SICK and PFTS-HLTHY pigs, and the frequencies of these
lesions were not statistically different. The presence of these lesions in both groups leads to 3
possible interpretations: 1) atrophic duodenitis, superficial colitis, and rhinitis may be
background lesions in pigs postweaning in this farm and not associated with PFTS; 2) these
lesions may exist before or at weaning and increase the risk of PFTS; or 3) these lesions may
exist before or at weaning and subsequently trigger PFTS in some but not all pigs. The data of
58
the current investigation does not preferentially point to any of these 3 possibilities.
Several pathogens were only detected in PFTS-SICK pigs including RV-A, BCoV-1, C.
perfringens type A, B. bronchiseptica, Streptococcus spp., H. parasuis, and P. multocida. It is the
opinion of the authors that the clinical presentation of PFTS is not consistent with infection by
these agents. Further, none of the above pathogens were detected more frequently (P > .05 for all)
in PFTS-SICK compared to PFTS-HLTHY or CTRL pigs (Table 4.2). Thus, their causal role in
PFTS is not supported by the results of the current study.
Rotavirus is a well-known cause of diarrhea and atrophic enteritis. Of the 4 rotavirus-positive
pigs, 2 had very mild positive staining and were reportede as “suspicious.” The antibody against
rotavirus used in the current investigation is polyclonal. Although the antibody can react with
group A rotavirus, whether it reacts with groups B and C rotavirus is not known. Polymerase
chain reaction typing of the rotavirus detected in PFTS-SICK pigs may help diagnosticians
understand the role of rotavirus in PFTS. Rotavirus is highly prevalent in swineherds, especially
in nursery pigs,62,100 and the clinical signs of PFTS are not consistent with rotavirus infection (i.e.,
lack of consistent diarrhea in PFTS-SICK pigs). The involvement of Rotavirus B and C in PFTS
needs further clarification.
Betacoronavirus 1 can cause vomiting and wasting disease (VWD) in suckling pigs, can
frequently be found in the brain stem and ganglions of the GI tract of infected pigs, and this
distribution of BCoV-1 can explain the typical GI clinical signs.6 Betacoronavirus 1, however,
was not detected in the GI tract of any PFTS-SICK pig, nor in the brain stem (medulla oblongata)
of PFTS-SICK pigs that were BCoV-1–positive in tonsil. Betacoronavirus 1 is found in tonsil of
acutely infected pigs.133 In the current study, however, the PFTS-SICK pigs were chronically
59
affected at the time of necropsy. Thus, the presence of BCoV-1 in tonsil only and the absence of
histological changes in the tonsil fail to explain clinical signs in PFTS-SICK pigs. Although the
data from the current investigation does not definitely rule out BCoV-1 as the cause of PFTS,
evidence for its causal role is insufficient in the authors’ opinion.
Attaching and effacing E. coli associated with superficial colitis was observed histologically in
both PFTS-SICK and PFTS-HLTHY pigs, and PCR was employed to confirm the presence of
AEEC DNA in affected colon. Surprisingly, AEEC DNA was detected in some pigs in all 3
groups, and group differences were not statistically significant. It has been reported that AEEC
only causes mild disease in pigs and is usually associated with infection by other pathogens.67,86
It is possible that AEEC-associated colitis is a background lesion on this farm with no clinical
significance. Alternatively, the underlying colitis associated with AEEC and/or other unidentified
etiology could predispose pigs to PFTS.
Detection of PECV in all groups of pigs is consistent with the current understanding of the
epidemiology and pathogenesis of PECV infection in swine.202 Porcine enteric calicivirus only
causes diarrhea and small intestinal villous atrophy in gnotobiotic piglets following experimental
infections61 and is not associated with diarrhea in naturally exposed piglets.62 Accordingly, the
role of PECV in PFTS is not determined but unlikely in the authors’ opinion.
Although coccidia oocysts (eggs) were identified in all groups, it was not possible to identify the
genus and species by morphology. Cystoisospora suis and several Eimeria spp. can infect pigs,
but only C. suis can cause prominent disease. C. suis typically causes diarrhea and low mortality
in 1–3-week-old pigs, which does not match the clinical presentation of PFTS.106 Older pigs are
more resistant to C. suis,208 and the PFTS-SICK pigs were at the edge of the susceptible age.
60
However, the histological presence of coccidia in the PFTS-SICK pigs was clearly associated
with enteritis in some cases. Thus, further investigation is needed to not only determine the
species, but to determine whether the PFTS-SICK pigs were infected with a highly pathogenic
strain or dose of coccidia. Moreover, it is necessary to determine whether C. suis/coccidia is a
primary or secondary (i.e., sick pigs are more susceptible to the infection) pathogen.
Suid herpesvirus 2 is highly prevalent in suckling and nursery pigs and is not always associated
with detrimental clinical signs.63 The present study further confirmed the high prevalence of
SuHV-2, as nearly all the pigs, regardless of group, were infected with SuHV-2. Sneezing is the
usual manifestation of SuHV-2 infection, and mortality is usually low.106 Rarely, systemic
infection by the virus can cause death.144 However, SuHV-2 inclusion bodies were not observed
in organs outside the nasal cavity in any PFTS-SICK pigs. Thus, the role of SuHV-2 in the
pathogenesis of PFTS is not clear but unlikely in the authors’ opinion.
In conclusion, the most frequently observed lesions in PFTS-affected pigs were superficial
lymphocytic fundic gastritis, atrophic enteritis, superficial colitis, lymphocytic and neutrophilic
rhinitis, nonsuppurative meningoencephalitis, and thymic atrophy. Although several pathogens
were identified in PFTS-affected pigs, the current diagnostic investigation was not successful in
identifying the definite cause of PFTS. There is a lack of compelling evidence to support the
causal roles of the following pathogens in PFTS: PRRSV, PCV-2, FLUAV, ACoV-1, RV-A,
SuHV-2, PECV, BCoV-1, C. perfringens, pathogenic E. coli, B. hyodysenteriae, B. pilosicoli,
Bordetella spp., Streptococcus spp., H. parasuis, P. multocida, and coccidia.
61
Table 4.1. Tissues examined histologically from porcine periweaning failure-to-thrive syndrome
(PFTS)-affected (PFTS-SICK), age-matched healthy (PFTS-HLTHY) pigs from an affected farm,
and healthy pigs selected from 2 unaffected farms (CTRL).
Tissues
PFTS-SICK
(n = 18)
PFTS-HLTHY
(n = 7)
CTRL
(n = 8)
Respiratory system
Nasal turbinate 16 6 4
Lung (cranial and caudal) 18 7 8
Bronchus 6 4 0
Cardiovascular system
Heart 18 7 8
Digestive system
Tongue 5 3 0
Esophagus 6 4 0
Stomach (fundus) 16 6 8
Duodenum 11 7 8
Jejunum 17 7 8
Ileum 17 7 8
Colon 18 7 8
Pancreas 11 7 8
Liver 18 6 8
Immune system
62
Tissues
PFTS-SICK
(n = 18)
PFTS-HLTHY
(n = 7)
CTRL
(n = 8)
Inguinal lymph node 18 7 8
Mesenteric lymph node 18 7 8
Bronchial lymph node 18 7 8
Spleen 18 7 8
Thymus 17 7 8
Urinary system
Kidney 18 7 8
Nervous system
Cerebrum 13 4 8
Cerebellum 13 4 8
Brain stem 9 4 8
Trigeminal ganglion 6 4 0
Glossopharyngeal nerve 6 4 0
Facial nerve 6 4 0
63
Table 4.2. Frequency (prevalence) of positive diagnostic tests performed to identify common swine pathogens potentially associated
with porcine periweaning failure-to-thrive syndrome (PFTS) from PFTS-affected (PFTS-SICK), age-matched healthy (PFTS-HLTHY)
pigs from an affected farm, and healthy pigs selected from 2 unaffected farms (CTRL).
Pathogen Sample Test
No. positive/No. tested (positive %)
P PFTS-SIC
K (n = 18)
PFTS-HLTH
Y (n = 7)
CTRL
(n = 8)
Bacteria
Clostridium perfringens Colon and/or ileum Culture 4/18 (22.2) 2/7 (28.6) 0/8 (0) NS
Pathogenic Escherichia coli† Colon and/or ileum PCR 8/12‡ (66.7) 2/3 (66.7) 4/7
(50)
NS
Attaching and effacing E. coli Colon Histology 8/18 (44.4) 3/7 (42.9) 0/8 (0) 0.06
Colon PCR 2/12‡ (16.7) 2/3 (66.7) 2/8
(25)
NS
Pasteurella multocida Lung Culture 1/18 (5.6) 0/7 (0) 0/8 (0) NS
Streptococcus suis Lung Culture 1/18 (5.6) 0/7 (0) 0/8 (0) NS
Haemophilus parasuis Lung Culture 1/18 (5.6) 0/7 (0) 0/8 (0) NS
Bordetella bronchiseptica Lung Culture 1/18 (5.6) 0/7 (0) 0/8 (0) NS
Brachyspira hyodysenteriae Colon PCR 0/12‡ (0) 0/3‡ (0) NT NS
Brachyspira pilosicoli Colon PCR 0/12‡ (0) 0/3‡ (0) NT NS
Viruses
Porcine circovirus-2 Lymphoid, GI IHC 0/18 (0) 0/7 (0) NT NS
64
Pathogen Sample Test
No. positive/No. tested (positive %)
P PFTS-SIC
K (n = 18)
PFTS-HLTH
Y (n = 7)
CTRL
(n = 8)
Porcine reproductive and
respiratory syndrome virus
Lung PCR 0/18 (0) 0/7 (0) NT NS
Influenza A virus (H3N2 and
H1N1)
Lung PCR 0/18 (0) 0/7 (0) NT NS
Alphacoronavirus
1(Transmissible gastroenteritis
virus)
GI IHC 0/18 (0) 0/7 (0) NT NS
Rotavirus A GI IHC 4/18 (22.2) 0/7 (0) NT NS
Porcine enteric calicivirus Jejunum, colon PCR 4/18 (22.2) 1/7 (14.3) 1/8
(12.5)
NS
Suid herpesvirus 2 (Porcine
cytomegalovirus)
Nasal turbinate Histology 5/16§ (31.3) 1/6§ (16.7) 0/4§
(0)
NS
Tonsil, jejunum, colon, kidney,
lung
PCR 17/18 (94.4) 7/7 (100) 8/8
(100)
NS
Betacoronavirus
1(Haemagglutinating
encephalomyelitis virus)
Tonsil PCR 6/18 (33.3) 0/7 (0) 0/8 (0) 0.07
Jejunum, colon, kidney, lung PCR 0/18 (0) 0/7 (0) 0/8 (0) NS
Brain (medulla oblongata) PCR 0/6¦ (0) NT NT NA
Torque teno virus 1 Spleen/bone marrow PCR 0/18 (0) 0/7 (0) 0/8 (0) NS
65
Pathogen Sample Test
No. positive/No. tested (positive %)
P PFTS-SIC
K (n = 18)
PFTS-HLTH
Y (n = 7)
CTRL
(n = 8)
Torque teno virus 2 Spleen/bone marrow PCR 3/18 (16.7) 2/7 (28.6) 1/8
(12.5)
NS
Parasites
Coccidia Feces Flotation 3/5 (60) 1/3 (33.3) 3/5#
(60)
NS
Jejunum and/or ileum Histology 6/18 (33.3) 0/7 (0) 1/8
(12.5)
0.17
* GI = gastrointestinal tract (including stomach, small and large intestines); PCR = polymerase chain reaction; IHC =
immunohistochemistry; NT = not tested; NS = not significant (P > 0.2); NA = not applicable.
† Pathogenic E. coli in the current study is defined as isolates that are positive for 1 or more of the virulence factor genes, namely,
AEE, AIDA, Sta, STb, LT, and SLT.
‡ The rest of the pigs in this group were not tested. The same applies to the cells with the same superscript.
§ Nasal turbinate was not sampled in the rest of the pigs in this group. The same applies to the cells with the same superscript.
¦ These 6 medulla oblongata are from the pigs that tested positive for Betacoronavirus 1 in tonsils.
# The 5 fecal samples were collected from age-matched pigs of 1 CTRL farm, and these pigs were not the same as those for
histological evaluation.
66
Table 4.3. Summary of polymerase chain reaction (PCR) primers and conditions used in the current study.*
Virus Primers (5’–3’) PCR cycles PCR reagent References
Suid herpesvirus 2
(Porcine
cytomegalovirus)
CMV-1:
CCCTGATCTTAAATGACGAGGACGTGAC
CMV-2:
ACCGTCTGAGAGACTGAACTTCTCTGAC
AC
95°C 5 min; 15 cycles
of 95°C 1 min, 60°C 1
min, –0.5°C/cycle,
70°C 1 min; 15 cycles
of 94°C 45 sec, 52°C
40 sec, –0.5°/cycle,
70°C 1 min; 10 cycles
of 92°C 45 sec, 50°C
30 sec, 70°C 1 min;
70°C 10 min
Qiagen
HotStarTaq
Plus DNA
polymerase
(catalog no.
203603)
63
67
Virus Primers (5’–3’) PCR cycles PCR reagent References
Betacoronavirus
1(Transmissible
gastroenteritis virus)
Primary forward:
GTTACAGCAAAGGTTAGTCCTGG
Primary reverse:
AATCTGGTGCCACTGAAGATT
Nested forward:
TGGATGTTCACTGGTAGTAGC
Nested reverse:
GGTTGGGTGTCGATGTGTTCAGC
Primary RT-PCR:
50°C 30 min; 95°C 15
min; 40 cycles of
95°C 30 sec, 63°C 30
sec, 72°C 45 sec; 72°C
10 min
Nested PCR:
95°C 5 min; 40 cycles
of 95°C 30 sec,
59.7°C 30 sec, 72°C
30 sec; 72°C 10 min
Primary:
Qiagen OneStep
RT PCR kit
(catalog no.
210212)
Nested: Qiagen
HotStarTaq
Plus DNA
polymerase
(catalog no.
203603)
179
68
Virus Primers (5’–3’) PCR cycles PCR reagent References
Porcine enteric
calicivirus
Forward 1:
GATTACTCCAAGTGGGACTCCAC
Forward 2:
GATTACTCCAGGTGGGACTCCAC
Forward 3:
GATTACTCCAGGTGGGACTCAAC
Forward 4:
GATTACTCCACCTGGGATTCAAC
Forward 5:
GATTACTCCACCTGGGATTCCAC
Reverse 1:
TGACAATGTAATCATCACCATA
Reverse 2:
TGACGATTTCATCATCACCATA
Reverse 3:
TGACGATTTCATCATCCCCGTA
50°C 30 min; 95°C 15
min; 40 cycles of
95°C 30 sec, 59°C 30
sec, 72°C 30 sec; 72°C
10 min
Qiagen OneStep
RT PCR kit
(catalog no.
210212)
203
69
Virus Primers (5’–3’) PCR cycles PCR reagent References
Porcine reproductive
and respiratory
syndrome virus
Refer to user manual Refer to user manual Tetracore
NextGen
NA/EU PRRSV
multiplex
RT-PCR
reagents
(catalog no.
TC-9039-080)
Refer to user
manual
Influenza A virus
(H1N1 and H3N2)
Forward:
AGATGAGTCYTCTAACCGAGGTCG
Reverse:
TGCAAARACAYYTTCMAGTCTCTG
Probe:
FAM-TCAGGCCCCCTCAAAGCCGA-TAM
RA
45°C 10 min, 95°C 10
min; 45 cycles of
94°C 1 sec, 60°C 30
sec
Qiagen OneStep
RT PCR kit
(catalog no.
210212)
184
70
Virus Primers (5’–3’) PCR cycles PCR reagent References
Torque teno virus 1 Primary forward:
TACACTTCCGGGTTCAGGAGGCT
Primary reverse:
ACTCAGCCATTCGGAACCTCAC
Nested forward:
CAATTTGGCTCGCTTCGCTCGC
Nested reverse:
TACTTATATTCGCTTTCGTGGGAAC
For both primary and
nested: 95°C 5 min;
40 cycles of 94°C 30
sec, 52°C 30 sec, 72°C
30 sec; 72°C 10 min
Fermentas Taq
polymerase
(catalog no.
EP0406)
92
Torque teno virus 2 Primary forward:
AGTTACACATAACCACCAAACC
Primary reverse:
ATTACCGCCTGCCCGATAGGC
Nested forward:
CCAAACCACAGGAAACTGTGC
Nested reverse:
CTTGACTCCGCTCTCAGGAG
For both primary and
nested: 95°C 5 min;
40 cycles of 94°C 30
sec, 52°C 30 sec, 72°C
30 sec; 72°C 10 min
Fermentas Taq
polymerase
(catalog no.
EP0406)
92
71
Virus Primers (5’–3’) PCR cycles PCR reagent References
Virulence factors of
Escherichia coli
(Eae, AIDA1, STa,
STb, LT, and SLT)
Eae –Forward:
ATCTTCTGCGTACTGCGTTCA
Eae – Reverse:
CATTATGGAACGGCAGAGGT
AIDA 1—Forward:
ACAGTATCATATGGAGCCA
AIDA 1—Reverse:
TGTGCGCCAGAACTATTA
STa—Forward:
TCCCCTCTTTTAGTCAGTCAACTG
STa—Reverse:
GCACAGGCAGGATTACAACAAAGT
STb—Forward:
GCAATAAGGTTGAGGTGAT
STb—Reverse:
GCCTGCAGTGAGAAATGGAC
LT—Forward:
TTACGGCGTTACTATCCTCTCTA
LT—Reverse:
GGTCTCGGTCAGATATGTGATTC
94°C 3 min; 35 cycles
of 94°C 30 sec, 60°C
30 sec, 72°C 30 sec;
72°C 10 min
Fermentas Taq
polymerase
(catalog no.
EP0406)
PDS Inc.
(Canada)
72
Virus Primers (5’–3’) PCR cycles PCR reagent References
Brachyspira
hyodysenteriae and
Brachyspira
pilosicoli
B. hyodysenteriae—Forward:
TATAAAGGGCGGGCAAATGT
B. hyodysenteriae—Reverse:
TGGAGGAGTGGTAGCTGATAAAA
B. pilosicoli—Forward:
AGAGGAAAGTTTTTTCGCTTC
B. pilosicoli—Reverse:
TCCGCCTACTCACCCTTTAC
94°C 3 min; 35 cycles
of 94°C 30 sec, 62°C
30 sec, 72°C 30 sec;
72°C 10 min
Fermentas Taq
polymerase
(catalog no.
EP0406)
B.
hyodysenteriae: 104;
B.
hyodysenteriae: 132
73
Table 4.4. Summary of the primary antibodies used in the current study
Pathogens Primary antibodies (dilution) Source
Porcine circovirus-2 Rabbit anti-PCV2 (1:1,000) Dr. G. Allan, Belfast,
Northern Ireland
Rotavirus A Rabbit anti-porcine rotavirus (1:1,000) Vaccine and Infectious
Disease Organization
(VIDO), Saskatoon, SK,
Canada
Alphacoronavirus
1(Transmissible
gastroenteritis virus)
Pool of monoclonal antibodies 25H7,
14G9, 14F10 (1:1,000)
Dr. Linda Saif, Ohio
State University,
Columbus, OH
74
Table 4.5. Frequency of lesions found in porcine periweaning failure-to-thrive syndrome
(PFTS)-affected (PFTS-SICK), age-matched healthy (PFTS-HLTHY) pigs from an affected farm,
and healthy pigs selected from 2 unaffected farms (CTRL).*
Lesions PFTS-SICK PFTS-HLTHY CTRL
P value‡ (n = 18) (n = 7) (n = 8)
Rhinitis 14/16† (87.5)a 6/6† (100)a 1/4† (25)b 0.006
Bronchopneumonia 7/18 (38.9)a 0/7 (0)b 0/8 (0)b 0.03
Gastritis 16/16† (100)a 0/6† (0)b 0/8 (0)b <0.0001
Duodenitis 11/11† (100)a 6/7 (85.7)a 0/8 (0)b <0.0001
Jejunitis 17/17† (100)a 1/7 (14.3)b 0/8 (0)b <0.0001
Ileitis 16/17† (94.1)a 0/7 (0)b 0/8 (0)b <0.0001
Colitis 18/18 (100)a 5/7 (71.4)a 1/8 (12.5)b <0.0001
Thymic atrophy 15/17† (88.2)a 0/7 (0)b 0/8 (0)b <0.0001
Nephritis 4/18 (22.2) 0/7 (0) 0/8 (0) 0.22
Fatty liver 5/17† (29.4) 1/6† (16.7) 0/8 (0) 0.23
Meningoencephalitis 6/13† (46)a 0/4† (0)b 0/8 (0)b 0.03
* Numbers in parentheses are percentages.
† When denominators are less than n, the rest of the samples were not available.
‡ Frequency values with different superscripts within a row are statistically different (P < 0.05).
75
Figure 4.1A. Fundus from a PFTS-SICK pig. The superficial epithelial cells are attenuated with a
loss of cytoplasmic secretory material. Moderate numbers of lymphocytes and plasma cells are
infiltrating in the lamina propria. Occasionally, some glandular cells are necrotic (arrow) with the
surviving cells in the same acinus regenerating.
76
Figure 4.1B. Fundus from a PFTS-HLTHY pig showing abundant cytoplasmic secretory material
in the superficial epithelium and limited numbers of immune cells in the lamina propria.
77
Figure 4.2A. Ileum from a PFTS-SICK pig. The villi are severely shortened, with a villi-to-crypt
ratio of less than 1:1. The total thickness of the intestinal wall is also decreased.
78
Figure 4.2B. Ileum from a PFTS-HLTHY pig, taken in the same magnification as A, shows the
normal villi length of a nursery pig.
79
Figure 4.3A. Colon from a PFTS-SICK pig. There is a decreased number of goblet cells.
Multifocally, the superficial epithelial cells are attenuated with a loss of cellular polarity.
Moderate numbers of lymphocytes, plasma cells, and macrophages are infiltrating in the lamina
propria.
80
Figure 4.3B. Colon from a CTRL pig showing normal numbers of goblet cells and polarity of the
superficial epithelial cells.
81
Figure 4.4. Nasal mucosa from a PFTS-SICK pig. Large numbers of inflammatory cells are
infiltrating the lamina propria. Occasionally, the nasal glandular cells contain large, basophilic,
intranuclear inclusion bodies (arrow), consistent with porcine cytomegalovirus.
82
Figure 4.5. Cerebellum of a PFTS-SICK pig. Two lymphocytic perivascular cuffing are shown in
the white matter of the cerebellum.
83
5. Pathological features and proposed diagnostic criteria of porcine periweaning
failure-to-thrive syndrome (PFTS).
The investigation from Chapter 4 revealed several highly prevalent lesions, but whether these are
consistent between different farms affected by PFTS is unknown. This was considered a very
important question. In Chapter 5, a second investigation involving 8 farms is presented. The
results confirmed that the pathological findings among different farms are consistent. This
finding further justifies the proposal of PFTS as a clinical syndrome. Consistent with the results
of the previous study (Chapter 4), there is no evidence that any tested pathogen in Chapter 5 is
causally associated with PFTS.
This Chapter has been submitted for publication. The copyright of this Chapter will belong to the
journal in which it is published.
Huang, Y. and J.C.S. Harding, Pathological features and proposed diagnostic criteria of porcine
periweaning failure-to-thrive syndrome (PFTS). Vet Pathol, 2013. Submitted, under revision.
Huang and Harding performed farm visits, necropsies, data analysis and manuscript writing.
Huang evaluated the histopathology and performed all laboratory tests.
84
5.1. Introduction
Porcine periweaning failure-to-thrive syndrome (PFTS) is a clinical syndrome of anorexia and
progressive debilitation affecting nursery pigs within 2-3 weeks of weaning.79 Although sporadic
“post-weaning starve-outs” have existed in the swine industry for many years, it was not until
2008 that outbreaks of “starve-outs” accompanied by substantial increases in nursery mortality
were first recognized as a distinct clinical syndrome.42,57 Early reports of the syndrome used
various terms such as “postweaning catabolic syndrome”, “postweaning wasting-catabolic
syndrome”, “failure to thrive syndrome” and “postweaning fading pig-anorexia syndrome” 42,64,79
until the consensus name “PFTS” was adopted in 2010.79 Many nutritional, environmental and
medical interventions have been attempted to reduce the impact of PFTS, but none have proven
effective.42,57,79 A recent survey conducted in North America estimated the flow-prevalence of
PFTS to be about 4% and the four most commonly reported clinical signs were anorexia, loss of
body condition, prolonged standing and repetitive oral behavior.138 The current status of PFTS on
other continents is unknown, but a recent report suggests it may be present in Spain.178
At present, PFTS diagnosis is based on fulfillment of the proposed case definition and exclusion
of other common swine diseases. As the etiology is not known, the case definition is mainly
based on clinical presentation paraphrased as follows: PFTS is characterized clinically by the
progressive debilitation of newly weaned pigs within 2 to 3 weeks of weaning, resulting in
variable morbidity but high case fatality, with repetitive oral behaviors such as chomping and
chewing observed in affected pigs, without residual illness from the suckling phase or discernible
and detrimental infectious, nutritional, managemental and environmental factors that can
explain the clinical symptoms.79
85
A number of diagnostic investigations in clinically affected farms have been completed to date
by our group76 and others.154,178 These investigations have identified a number of gross and
histopathological lesions that may be associated with PFTS, including thymic atrophy,
superficial gastritis, small intestinal villous atrophy, superficial colitis, non-suppurative
meningoencephalitis, neutrophilic lymphoplasmacytic rhinitis and bronchopneumonia. In
addition, the involvement of common swine pathogens including porcine reproductive and
respiratory syndrome virus (PRRSV), porcine circovirus-2 (PCV2), influenza A virus (FLUAV),
transmissible gastroenteritis virus, (TGEV), Mycoplasma hyopneumoniae (Mhyo), Brachyspira
hyodysenteriae, and Brachyspira pilosicoli was ruled out. However, a number of swine
pathogens, such as porcine cytomegalovirus (PCMV), porcine enteric calicivirus (PECV), swine
Torque Teno virus 2 (TTV2), pathogenic Escherichia (E.) coli, rotavirus (RV-A),
haemagglutinating encephalomyelitis virus (HEV) and coccidian, were detected in affected pigs,
age-matched unaffected pigs, or both depending on the investigation.76,154 Given that the
investigations completed to date were limited to a few farms, were conducted by different
investigators, and had insufficient experimental power and scope to be conclusive, the objectives
of this study were to characterize the pathology and potential pathogens associated with PFTS
more conclusively using a larger scale case-control investigation involving North American
farms.
5.2. Methods
5.2.1. Farm visits and sample collection
This work was approved by the University of Saskatchewan’s Animal Research Ethics Board and
adhered to the Canadian Council on Animal Care guidelines for humane animal use. Between
86
July 2011 and April 2013, the authors were contacted by a number of swine veterinarians in
Canada and the USA who reported client farms with clinical signs typical of PFTS. Relevant
aspects of the history, clinical signs and health status were obtained, and farms appearing to
fulfill the proposed clinical definition of PFTS79 were investigated further. Recent diagnostic
reports, when available, were reviewed and farms that had undertaken no recent diagnostics were
asked to submit 2-3 characteristic pigs for necropsy examination at their local diagnostic
laboratories to verify that no underlying known diseases were responsible for the clinical
presentation (elevated morbidity/mortality, anorexia, weight loss within 2-3 weeks of weaning).
Eight farms were included in the study (Table 5.1), all having PCV2 vaccination programs in
place. The authors performed farm visits and made clinical observations.
During the visits to the 8 selected farms, it was determined that 5 farms (farm 1-5) completely
fulfilled the proposed PFTS clinical definition.79 These were designated as “PFTS” farms.
However, the CASE pigs in two other farms (farm 6 and 7) did not demonstrate progressive
debilitation (emaciation and wasting) during the farm visits, despite the fact that increased
nursery mortality was reported by the herd veterinarian prior to the visit. CASE pigs from these
two farms were selected on the basis of demonstrating a flat or hollow abdomen, lack of interest
in the available feed and repetitive oral behavior (chomping). In farm 8, necropsy examination
revealed bronchopneumonia of various severities in all CASE but no CTRL pigs. As these latter
three farms did not meet the proposed PFTS case definition fully, specifically the lack of
progressive debilitation in CASE pigs of farms 6 and 7, and the presence of bronchopneumonia
in all CASE pigs from farm 8, they were designated “partial farms” (partially fulfilling the case
definition). As a result, pigs used in this study are further divided into 4 subgroups, 1) affected
pigs from PFTS-farms (PFTS-CASE); 2) non-affected pigs from PFTS-farms (PFTS-CTRL); 3)
87
affected pigs from partial-farm (partial-CASE); and 4) non-affected pigs from partial-farm
(partial-CTRL). The partial-farms were included in the analysis because they might represent
either less severe PFTS or a useful comparison.
Pigs that met the clinical definition (thin to emaciated, presence of repetitive oral behavior, no
other signs of overt disease) most convincingly were identified and assigned as CASE.
Non-affected pigs from the same batch were selected conveniently as controls (CTRL). All pigs
were weaned less than 15 days. From each farm, 8 or 9 CASE and 4 CTRL pigs blocked by
number of days since weaning were identified, transported to the local diagnostic laboratory and
held overnight with feed and water. The following day, animals were humanely euthanized using
intravenous barbiturate and a comprehensive necropsy examination was performed.
Formalin-fixed and fresh tissues were collected for routine histological examination and further
diagnostic tests. Tissues collected included cerebrum, cerebellum, brain stem, trigeminal
ganglion, salivary gland, lung, heart, thoracic thymus, stomach (fundus and pylorus), duodenum,
jejunum, ileum, spiral colon, cecum, pancreas, liver, kidney, adrenal gland, second rib, tonsil,
bronchial lymph node, mesenteric lymph node, superficial inguinal lymph node and spleen.
Fresh tissues were stored at -80°C before further use. Histological examinations were carried out
by the author (YH) while blinded to the identities of the animals. Additionally, the lengths and
depths of10 randomly selected villi and crypts in ileum were measured under 10X microscopic
fields by a micrometer.
5.2.2. Nucleic acid extraction and reverse transcription of RNA
DNA and RNA of tonsil, brain, lung, ileum and stomach were extracted using the Qiagen AllPrep
DNA/RNA Mini Kit (Toronto, ON, Canada) according to the manufacturer’s instruction. Reverse
88
transcription of the extracted RNA was then performed using the Bio-Rad iScriptTM cDNA
Synthesis Kit (Mississauga, ON, Canada) according to the manufacturer’s instruction. DNA,
RNA and cDNA were stored at -80°C before being tested for different pathogens by polymerase
chain reactions (PCR).
5.2.3. PCR detection of common and relevant swine pathogens
Detection of nucleic acid of HEV in tonsil,76,179 porcine enteroviruses CPE group 1, 2 and 3
(PEV-1, 2 and 3) in brain 210, PECV in ileum 76,203, TGEV in ileum 201, PCV2 in tonsil 55, Mhyo
in lung 114, and Helicobacter-pylori-like (Hp) and Helicobacter-heilmannii-like (Hh) in
stomach28 were performed according to previously published assays using the Qiagen
HotStarTaq Plus DNA Polymerase Kit (Toronto, ON, Canada). PCR detection of FLUAV in lung
tissue was performed as previously described 76,184 using the Qiagen QuantiFast Probe PCR Kit
according to the manufacturer’s instructions (Toronto, ON, Canada). Detection of PRRSV RNA
from lung was performed using the Tetracore EZ-PRRSV™ Kit (Rockville, MD, USA)
according to manufacturer’s instructions. PCR detection of RV-A, B and C were performed by
the Veterinary Diagnostic Services Laboratory of Government of Manitoba (Winnipeg, MB,
Canada) using a protocol developed by the Veterinary Diagnostic Laboratory of University of
Minnesota.112
5.2.4. Statistical analyses
Generalized Estimating Equations (GEE) adjusted for clustering effects of farm were employed
to build logistic regression models, in which the outcomes were the presence or absence of
specific lesions and pathogens. The predictors for all models were farm-type (PFTS- or
partial-farms), pig-type (CASE or CTRL) and the interaction of these two factors. Post hoc
89
pairwise comparisons of the estimated means of each combination of farm-type and pig-type
were performed when the interaction term was statistically significant, or when both farm-type
and pig-type were significant (Table 5.2). When the interaction of the initial GEE was significant
(i.e. superficial gastritis, duodenal villous atrophy, jejuna villous atrophy and ileal villous
atrophy), or the prevalence of the lesion was obviously higher in PFTS-CASE pigs than in the
others (i.e. thymic atrophy and colitis), further analyses were completed comparing the odds of
lesions in PFTS-CASE versus all other groups (Table 5.2). When the prevalence of lesions were
obviously higher in pigs from PFTS-farms than in those from partial-farms (i.e. encephalitis and
rhinitis), further analyses were pursued to compare the odds of lesions between PFTS-farms
versus partial-farms (Table 5.2). Linear regressions were built by GEE to predict ileal villous
lengths, crypt depths and villi-to-crypt (V/C) ratios, with the predictors being farm-type, pig-type
and the interaction term. The raw residues of the linear regression models were checked for
normality and homogeneity of the variances (Table 5.3). All statistical analyses were performed
using IBM SPSS Statistics version 21. P values less than 0.05 were regarded as statistically
significant. 95% confidence intervals (CI) of sensitivities and specificities were calculated as
described.194
5.3. Results
The most notable gross lesions in PFTS-case pigs were thymic atrophy and empty
gastrointestinal tracts (GIT). Histological lesions that were more than 60% prevalent in
PFTS-CASE were: superficial gastritis, small intestinal villous atrophy of duodenum, jejunum
and ileum, thymic atrophy and suppurative or lymphoplasmacytic rhinitis (Table 5.2). The
gastritis was mainly observed in fundic stomach. Compared to normal (Figure 5.1), the
superficial foveolar cells of affected fundus lacked or had reduced cytoplasmic mucus, were
90
attenuated, low cuboidal, squamous or multifocally absent (erosion) (Figure 5.2). The same
epithelial changes occasionally extended deeper, affecting the mucous neck cells and upper
glands. Increased numbers of lymphocytes were observed in the lamina propria of some pigs,
without formation of lymphoid follicles. However, at times these changes were subtle and
difficult to distinguish confidently from normal. Small intestinal villous atrophy was defined in
this study by subjective evaluation of the general presence of V/C ratios of less than 1. Whereas
normal nursery pigs generally have small intestinal V/C ratios greater than 1 (Figure 5.3), the
ratios in PFTS affected intestines were usually less than one (Figure 5.4). It should be
emphasized that this was a subjective estimation of the histological image, which means the V/C
ratio cannot be strictly applied to each individual villus. The measured villous lengths and crypt
depths in ileum demonstrated that PFTS-CASE pigs had shorter villi and lower V/C ratios than
all other pigs (Table 5.3). Crypt depths of PFTS-CASE pigs were not increased compared to
other groups (Table 5.3). Further, when compared to the V/C ratios of ileum calculated from
measured villous lengths and crypt depths, the subjective evaluations and judgments of villous
atrophy were highly sensitive and specific (Table 5.4). Epithelial cells on the villous tips were
often cuboidal and occasionally squamous. Coccidia of different life cycle stages were
inconsistently observed in jejunal or ileal epithelium in 3 PFTS-farms (5/8 CASE and 1/4 CTRL
from farm 2, 1/4 CTRL pig from farm 4, 1/8 CASE pig from farm 5) and 1 partial-farm (2/8
CASE from farm 6). Compared to normal thymus (Figure 5.5), thymic cortex of PFTS-CASE
pigs demonstrated markedly reduced numbers of lymphocytes (Figure 5.6). As a result, there was
moderate to severe reduction in thickness of the thymic cortex in PFTS-CASE pigs but the
medulla was relatively unaffected (Figure 5.6).
In the nasal cavities and sinuses of the pigs affected by rhinitis, large numbers of neutrophils
91
were mixed with mucous without observable bacteria. Moderate to large numbers of
lymphocytes and plasma cells infiltrated the submucosa of the nasal turbinate, which was either
diffusely or multifocally surrounding submucosal glands. Characteristic intranuclear
cytomegaloviral inclusion bodies in the submucosal glandular epithelial cells were an
inconsistent finding observed in one PFTS-farm (5/8 CASE from farm 4) and two partial-farms
(1/8 CASE and 1/4 CTRL from farm 7 and 1/4 CASE from farm 8). Less frequently observed
lesions included superficial colitis, bronchopneumonia, hepatic cellular fatty change and
multifocal lymphoplasmacytic nephritis, which ranged in prevalence but were unrelated to
pig-type (Table 5.2).
Lesions that were more than 20% prevalent in PFTS-CASE pigs were subjected to statistical
analyses. PFTS-CASE pigs had significantly higher odds of showing superficial gastritis (OR=
16.7; 95% CI: 6.8-40.6) small intestinal villous atrophy of duodenum (OR=28.7; 95% CI:
7.7-107), jejunum (OR=67.4; 95% CI: 7.0-651), ileum (OR=56.3; 95% CI: 14.1-224), thymic
atrophy (OR=30.1; 95% CI: 6.0-152) and superficial colitis (OR=14.6; 95% CI: 2.0-107) than all
other pig-types (Table 5.2). It is noteworthy that some thymuses from PFTS-CASE pigs were not
available for histological examination. The most likely reason for this was that total thymic
atrophy was apparent on gross examination and hence no tissues were available for
histopathological evaluation. The pathological status of the 31 PFTS-CASE thymuses included
in Table 5.2 represents combined histological and gross examination results. Unfortunately, gross
pathological data on 9 thymuses is missing, thus it is impossible to verify their pathological
status, although they were most likely severely atrophied and not easily visible at necropsy.
Twenty-nine PFTS-CASE and 43 non-PFTS pigs (PFTS-CTRL, partial-CASE, partial-CTRL)
had stomach, small intestine and thymus available for histopatholgical evaluation. Using the
92
presence of at least two of superficial gastritis, small intestinal villous atrophy and thymic
atrophy as a diagnostic criterion (i.e. having 2 or 3 of these 3 lesions), the sensitivity, specificity,
positive predictive value (PPV) and negative predictive value (NPV) of correctly identifying
PFTS-CASE was 100%, 67.4%, 67.4% and 100% (Table 5.5). When using the presence of all
three of the above lesions as a diagnostic criterion, sensitivity and NPV decreased moderately to
85.7% and 90.7, respectively, while the specificity and PPV increased moderately to 84.8% and
77.4%, respectively (Table 5.5).
For rhinitis and encephalitis or trigeminal neuritis, the pig-type x farm-type interactions were not
significant in the initial GEE, and statistical analysis was used to compare PFTS to partial-farms.
All pigs from PFTS-farms had significantly higher odds of having suppurative or
lymphoplasmacytic rhinitis and non-suppurative encephalitis or trigeminitis than all pigs from
partial-farms. (Table 5.2) The odds of pneumonia, liver and renal lesions did not differ by
farm-type or pig-type. (Table 5.2)
RV-A, B and C, HEV, PEV-1, 2 or 3 were detected variably by PCR in both pig-types and
farm-types (Table 5.6). The odds of infection of RV-A and B, HEV, PEV-1, 2 or 3 did not differ
by farm-type or pig-type (P>0.05). RV-C had higher odds of detection in pigs from PFTS-farms
compared to those from partial-farms (P=0.023; OR=3.3 [95% CI: 1.2-9.3]). One PFTS-CASE
(from farm 1) tested positive for PCV2, and all pigs in this study tested negative for PRRSV,
FLUAV, PECV, TGEV, Mhyo, Hp and Hh. The detection of HEV and PEVs were not associated
with the presence of non-suppurative meningoencephalitis or trigeminal neuritis (P>0.05 for all).
5.4. Discussion
The results of the current investigation provide new knowledge on the pathology and
93
microbiology of PFTS. Since a detailed discussion of the significance of the lesions associated
with PFTS was made previously, 76 our goal in this manuscript is to expand understanding rather
than reiterate a similar discussion.
Superficial colitis was highly prevalent in our previously reported investigation in both PFTS
and non-affected groups.76 This suggested colitis was a background lesion in the farm
investigated. In the current study, the overall prevalence of superficial colitis in PFTS-CASE was
lower (31%), but the prevalence varied widely by farm (0 – 67%). This further supports the
observation that colitis is not a consistent finding of PFTS and does not likely contribute
significantly to the pathogenesis.
In our previous diagnostic investigation 76 we also reported that rhinitis and non-suppurative
meningoencephalitis were lesions possibly associated with PFTS. In the present study, rhinitis
and non-suppurative meningoencephalitis or trigeminal neuritis were not related to pig-type
(CASE or CTRL) but these lesions were at higher odds of being present in pigs from
PFTS-farms than partial-farms. Whether they are risk factors for farms developing PFTS is
unknown and needs to be verified in a larger study.
It is noteworthy that the high prevalences of superficial gastritis, small intestinal villous atrophy
and thymic atrophy of PFTS-CASE pigs are largely consistent with those we have previously
reported.76 This indicates that the pigs affected by PFTS were not only clinically similar, but also
shared similar pathological processes.
Thymic atrophy and small intestinal villous atrophy can be caused both by lack of feed
intake,60,154 as well as by infection with an organism causing primary atrophy associated with
apoptosis or necrosis of thymic lymphocytes or intestinal villi. Unfortunately, there is little
94
published data describing the effects of anorexia, fasting or starvation on GIT pathology of pigs.
It had been described that gastric erosion and ulceration occurred in mice and rats after food
deprivation.4,123,140 Interestingly, the locations of lesions differed in these two species, in that
mice developed these lesions in the secretory portion of the stomach (fundus)140, but rats tended
to have the lesions in the non-secretory parts (forestomach of rats, equivalent to pars esophagea
of pigs).4,123 In pigs, gastric ulcers associated with feed disruption almost always developed in
pars esophagea52, but the lesions observed in PFTS pigs were almost exclusively in the fundus.
Further, the erosions described in mice and rats were grossly visible4,123,140, but those in PFTS
pigs were microscopic. Additionally, ulcerations were not a feature in PFTS pigs. Finally,
although the attenuation of foveolar cells in PFTS pigs might represent disuse atrophy by the
anorexia associate with PFTS, the increased lymphoplasmacytic infiltrate cannot be easily
explained by anorexia alone. Taken all together, it is possible that the superficial gastritis may be
the results of anorexia, but there is no clear evidence in the literature to support this hypothesis.
It should be noted that in a previous study based on a small number of pigs, superficial gastritis
was observed in healthy pigs on the day of weaning, in pigs fasted for 4 days and in pigs affected
by PFTS.154 This suggests that superficial gastritis is a background lesion present in healthy pigs
around the time of weaning. It is however not known if the apparently healthy pigs at weaning
with superficial gastritis experienced any degree of anorexia or reduced feed intake before
sampling, nor was it possible to demonstrate prospectively that these pigs would not develop
PFTS following weaning. The difficulty in separating potential causes of anorexia from effect of
anorexia is innate to a case-control design chosen for this study. That being said, a case-control
study was the only practical option to investigate the syndrome since the etiology is not known at
this time. A fasting animal experiment is needed to answer important questions pertaining to the
95
occurrence of gastritis definitively.
Despite our poor understanding of the pathogenesis of the observed lesions, the high prevalence
of superficial gastritis, small intestinal villous atrophy and thymic atrophy helps to characterize
PFTS histologically and demonstrate that PFTS is a clinical syndrome with consistent pathology.
Based on the present results, a presumptive histological diagnosis of PFTS can be made in cases
in which stomach, small intestine and thymus are examined. A highly sensitive diagnostic
criterion involves a pig/carcass having characteristic lesions present in at least two of three
organs (i.e. having at least 2 or 3 of superficial gastritis, small intestinal villous atrophy or thymic
atrophy). This criterion has a high sensitivity (100%) but moderate specificity (67.4%).
Pigs/carcasses not satisfying this criterion can be classified as not having PFTS, but there is a
high likelihood of false positive diagnoses. Alternatively, a moderately sensitive diagnostic
criterion involves a pig/carcass having characteristic lesions present in all three organs. With this
criterion, the false positive rate will decrease considerably, but one may misdiagnose some PFTS
pigs as not having the syndrome (increased false negative rate). Therefore, we suggest this latter
criterion be used when larger groups of animals are examined for herd level diagnosis. It should
be noted that in farm 8 (a PFTS partial-farm), where only 3 CASE pigs but all 4 CTRL pigs had
thymus, fundic stomach and small intestine for evaluation, all CASE pigs, regardless of which of
the above criteria was used, were falsely classified as having PFTS, but all CTRL pigs were
correctly identified as not having PFTS. This emphasizes that regardless of the histological
criterion used, it is paramount that the diagnosis of PFTS is made only if the clinical case
definition is fulfilled, characteristic lesions are present in GIT and thymus (as described above),
and lesions and pathogens that can cause similar clinical presentation (e.g. pneumonia,
polyserositis, PCVAD, PRRS, etc) are not present in the animals examined.
96
The results of the current study do not support a causal role for any of the pathogens investigated,
which is consistent with previous reports76,154. Collectively, the evidence to date demonstrates
convincingly that PFTS is not caused by PCV2, PRRSV, FLUAV, RV-A and B, PECV, TGEV,
Mhyo, Hh and Hp. RV-C is more prevalent in PFTS-farms than partial farms, which may indicate
that RV-C is a risk factor for a farm to have PFTS. However, it should be noted that unlike RV-A
and RV-B, the prevalence of RV-C was higher than 50% in all farms except farm 7. Thus, the
impact of RV-C to nursery pig health is not clear. It is also unlikely that PFTS is caused by HEV
and PEVs, since these viruses are detectable in both PFTS- and partial-farms, and in CASE and
CTRL pigs with no difference in odds ratio.
Neither the presence of HEV nor PEVs was associated with the presence of lesions in the brain
or trigeminal ganglion. Thus, the etiology of non-suppurative meningoencephalitis and
trigeminal neuritis is not known. Furthermore, cytomegaloviral inclusion bodies were not
consistently detected in affected farms. Thus, although HEV, PEV, and PMCV may contribute to
the clinical signs of some PFTS-CASE pigs, they are clearly not a consistent and primary finding
in all PFTS-farms.
Our present hypothesis is that the etiology of PFTS is consistent between farms. On the other
hand, it cannot be ruled out that PFTS is caused by different etiologies on different farms, despite
having consistent clinical presentation and lesions. It should be noted that this does not
disqualify PFTS as a clinical syndrome. Clinical syndromes caused by different etiologies are not
novel in swine medicine, for example, porcine respiratory disease complex. The pathogenesis of
PFTS was not determined in this investigation. At the time of writing, the only peer-reviewed
research on this topic showed that altered intestinal barrier function might be responsible for the
development of PFTS, but the cause of this alteration was not clear.125
97
In conclusion, PFTS-CASE pigs have significantly higher odds of exhibiting superficial gastritis,
small intestinal villous atrophy and thymic atrophy compared to non-PFTS pigs. PFTS can be
ruled out upon gross and histological examination if pigs/carcasses do not have at least 2 of these
3 lesions. PFTS should be suspected if necropsy cases have all three histological lesions,
although ~15% false positive and false negative rates would be expected. Fulfillment of the
clinical case definition, the presence of the above lesions and absence of underlying pathology
and pathogens need to be considered together to diagnose PFTS at the farm level. The etiology of
PFTS is not determined, but current evidence indicates it is not caused by any of the pathogens,
including PCV2, PRRSV, FLUAV, RV-A and B, PECV, TGEV, Mhyo and others, investigated in
this study. Finally, non-suppurative meningoencephalitis, neutrophilic lymphoplasmacytic
rhinitis and RV-C infection may be risk factors for a farm to develop PFTS, but their potential
roles in pathogenesis need further study.
98
Figure 5.1. Gastric fundus; partial-CTRL pig. Note the abundant cytoplasmic mucus of foveolar
cells.
99
Figure 5.2. Gastric fundus; PFTS-CASE pig. Superficial foveolar cells lost cytoplasmic mucus
and are attenuated. There is subtle increase of mononuclear cells underneath the foveolar cells.
100
Figure 5.3. Jejunum; partial-CTRL pig. The villus to crypt ratio is slightly greater than 1.
101
Figure 5.4. Jejunum; PFTS-CASE pig. The villi length and the total thickness are both reduced
compared to that in Figure 5.3, which was taken at the same magnification.
102
Figure 5.5. Thymus; partial-CTRL pig. Note the large numbers of lymphocytes in the cortex.
103
Figure 5.6. Thymus; PFTS-CASE pig. There is markedly reduced numbers of lymphocytes in the
cortex.
104
Table 5.1. Historical details of farms included in the PFTS case-control diagnostic investigation
Farm Location Production type Wean age Brief clinical description of
farm complaint
Pre-visit diagnostic results
(screening) Date of visit
Fulfill
PFTS
definition
on farm
visit?
PFTS-farms*
1 Kansas, US Nursery (1100 head) D21 average nursery mortality 7.71%
during outbreak of chomping and
anorexia; 2.85% 6 months before
outbreak
NA July 2010 Completely
2 Kansas, US Nursery (2100 head) D21-24 up to 12.1% nursery mortality
during outbreak of chomping and
anorexia; average 3.1% 1 year
before and 1 year after
NA April 2011 Completely
3 Missouri, US Nursery (2300 head) D23 up to 5% batch-mortality during
outbreak of chomping and
anorexia; 2% in unaffected
batches
No underlying pathology;
group A rotavirus present in
some pigs by PCR
April 2011 Completely
4 Alberta, Canada Farrow-to-finish (450
sows)
D28 6-7% pigs described as “fading”
noted within a week after
weaning
No underlying pathology; no
bacteria cultured responsible
for clinical signs
February 2012 Completely
5 Alberta, Canada Farrow-to-finish (480
sows)
D22 up to 10% nursery mortality
during outbreak; baseline
mortality 2.5%
No underlying pathology; no
bacteria cultured responsible
for clinical signs; influenza A
and PCV2 PCR negative
February 2012 Completely
Partial-farms†
105
Farm Location Production type Wean age Brief clinical description of
farm complaint
Pre-visit diagnostic results
(screening) Date of visit
Fulfill
PFTS
definition
on farm
visit?
6 Ontario, Canada Nursery (2400 head) D17-21 20% nursery mortality when first
contacted; historical mortality
2-4%
No significant pathology;
PRRSV‡ and PCV2 IHC
negative
April 2012 Partially
(no
progressive
debilitation
observed at
visit)
7 Saskatchewan,
Canada
Farrow-to-finish (660
sows)
D21 History of elevated numbers of
fading, anorexic and chomping
pigs; 2% nursery mortality at the
time of visit
No significant pathology; no
significant bacteria; Mhyo,
PCV2 and influenza A PCR
negative
October 2011 Partially
(no
progressive
debilitation
observed at
visit)
8 Manitoba, Canada 3 sites 2000 head Nursery
(2000 head)
D19-21 8% pigs put into hospital pen on
visit, due to anorexia
No significant pathology; No
significant bacteria; Mhyo,
influenza A virus, PRRSV PCR
negative
October 2011 Partially
(all case
pigs
affected by
bronchopne
umonia)
* PFTS-farms: Farms completely fit PFTS clinical case definition8 on farm visit;
† Partial-farms: Farms partially fit PFTS clinical case definition on farm visit;
‡ Legend: PRRSV=porcine reproductive and respiratory syndrome virus, PCV2=porcine circovirus type 2, IHC=immunohistochemistry, Mhyo=Mycoplasma hyopneumoniae
106
Table5.2. Prevalence and odds ratios indicating significance of histopathological lesions observed in PFTS case and
control pigs
PFTS-farms* Partial-farms† P values Odds ratio (95% CI)
Case
(%) Control (%) Case (%)
Control
(%)
Farm
-type‡
Pig
-type§
Inter-
action
PFTS-CASE׀׀
vs. all other
PFTS-farms
vs.
partial-farms
Superficial
gastritis
33/36**
(91.7) a††
9/20
(45.0) b
10/22
(45.5) b
3/11
(27.3) b <0.0001 <0.0001 0.038
16.7
(6.8-40.6) NA‡‡
Duodenal
villous atrophy
35/36
(97.2) a
6/18
(33.3) b
11/18
(61.1) ab
3/7
(42.9) b <0.0001 <0.0001 0.01
28.7
(7.7-107) NA
Jejunal villous
atrophy
34/35
(97.1) a
6/17
(33.3) b
7/18
(38.9) b
2/8
(25.0) b <0.0001 0.002 0.026
67.4
(7.0-651) NA
Ileal villous
atrophy
35/37a
(94.6) a
5/19
(26.3) b
7/23
(30.4) b
2/11
(18.2) b <0.0001 0.001 0.012
56.3
(14.1-224) NA
Thymic
atrophy
27/31
(87.1) a
3/19
(15.8) b
5/18
(27.8) b
1/12
(8.3) b <0.0001 0.001 0.257
30.1
(6.0-152) NA
Rhinitis 26/38
(72.2)
17/20
(85.0)
11/24
(45.8)
6/12
(50.0) 0.037 0.159 0.36 NA 3.7 (1.1-12.5)
Encephalitis or
trigeminitis
25/40
(62.5) a
11/20
(55.0) a
7/25
(28.0) b
2/12
(16.7) c 0.014 <0.0001 0.16 NA 4.7 (1.4-15.9)
Colitis 10/32
(31.3)
1/17
(5.9)
0/17
(0.0)
0/8
(0.0) NA NA NA
14.6
(2.0-107) NA
Broncho
pneumonia
11/40
(27.5)
2/20
(10.0)
11/25
(44.0)
4/12
(33.3) 0.145 0.33 0.640 NA NA
Hepatic fatty
change
6/40
(15.0)
0/20
(0.0)
0/17
(0.0)
0/8
(0.0) NA NA NA NA NA
Lymphocytic
nephritis
4/40
(10.0)
6/19
(31.6)
1/17
(5.9)
0/8
(0.0) NA NA NA NA NA
*PFTS-farms: Farms completely fulfill the PFTS clinical case definition at farm visit; †Partial-farms: Farms partially fulfill the PFTS clinical case definition at farm visit; ‡Farm-type: PFTS- or partial farms;
107
§Pig-type: case or control pigs; ;PFTS-case pigs: case pigs from PFTS-farms׀׀ ¶The initial GEE analysis was not possible for colitis because of its absence in some groups. However, it was possible to compute an odds ratio between case pigs in PFTS-farms and all other pigs; **Values in bold font if lesion prevalence is >60%. The denominators of the prevalence are not consistent between different tissues because some tissues failed to be collected for histological evaluation; ††In each row, different superscript letters represent difference of post hoc pairwise comparisons; ‡‡NA= Not applicable.
108
Table 5.3. Villous lengths, crypt depths and villi to crypt (V/C) ratios measured in case and control pigs in this study PFTS-farms* Partial-farms† P values
Case
(±SD)
Control
(±SD)
Case
(±SD)
Control
(±SD) Pig-type‡ Farm-type§ Interaction
Villous
lengths (μm) 163±81a 330±89b 327±116b 385±76b <0.0001 <0.0001 0.008
Crypt depths
(μm) 184±32a 213±30b 188±64a 181±37a 0.232 0.021 <0.0001
V/C ratios 0.9±0.4a 1.6±0.5b 1.9±1.0c 2.2±0.7c <0.0001 <0.0001 0.062
*PFTS-farms: Farms completely fulfill the PFTS clinical case definition at farm visit; †Partial-farms: Farms partially fulfill the PFTS clinical case definition at farm visit; ‡Farm-type: PFTS- or partial farms; §Pig-type: case or control pigs; Within each row, different superscript letters represent differences of post hoc pairwise comparisons
109
Table 5.4. Comparative assessment of the presence of ileal villous atrophy using microscopic estimation and exact measurements
Villous atrophy (Yes/No) Using exact V/C ratio* less or equal
to 1 as gold standard
Sensitivity
(%;95% CI)
Specificity
(%;95% CI)
Yes No
Microscopic
estimation
Yes 44 5 100 (92-100) 89 (77-95)
No 0 41
Using exact V/C ratio less or equal
to 1 as gold standard
Yes No
Microscopic
estimation
Yes 46 3 100 (92-100) 93 (82-98)
No 0 41
*V/C ratio = villi to crypt ratio Microscopic estimation: When the general villi to crypt ratio was estimated to be equal or less than 1, villous atrophy was assigned.
110
Table 5.5. Prevalence, sensitivity, specificity and predicted values of accurately diagnosing PFTS cases using at least
two or all three characteristic lesions: superficial gastritis, small intestinal villous atrophy and thymic atrophy
PFTS-farms* Partial-farms† All
non-PFTS
pigs‡
(%)
Sensitivity (%; 95%CI)
Specificity
(%; 95%CI)
Positive
predictive
value (%; 95%CI)
Negative
predictive value (%; 95%CI)
Case
(%)
Control
(%)
Case
(%)
Control
(%)
Having at
least 2 lesions
29/29
(100)
6/18
(30)
6/15
(40)
2/10
(20)
14/43
(32.6)
100 (88-100)
67.4 (53-80)
67.4 (53-80)
100 (88-100)
Having all 3
lesions
24/28
(85.7)
2/18
(11.1)
4/18
(22.2)
1/10
(10)
7/46
(15.2)
85.7 (69-96)
84.8 (65-90)
77.4 (60-89)
90.7 (73-95)
*PFTS-farms: Farms completely fulfill PFTS clinical case definition on farm visit;
†Partial-farms: Farms partially fulfill PFTS clinical case definition on farm visit;
‡Non-PFTS pigs: All pigs in this study except case pigs from PFTS-farms
111
Table 5.6. Prevalence of common swine pathogens in case and control pigs from each farm included in the
investigation
Prevalence (%)
Pathogens
(organ) Farm 1 2 3 4 5 6 7 8
RV-A*
(Ileum)
Case 4/8
(50)
2/8
(25)
6/8
(75)
1/8
(12.5)
0/8
(0)
4/8
(50)
4/9
(44.4)
5/8
(62.5)
Control 1/4
(25)
3/3
(100)
4/4
(100)
0/4
(0)
1/4
(25)
3/4
(75)
2/4
(50)
3/4
(75)
RV-B*
(Ileum)
Case 6/8
(62.5)
1/8
(12.5)
3/8
(37.5)
3/8
(37.5)
1/8
(12.5)
2/8
(25)
2/9
(22.2)
2/8
(25)
Control 3/4
(75)
0/3
(0)
2/4
(50)
1/4
(25)
1/4
(25)
2/4
(50)
1/4
(25)
4/4
(100)
RV-C*
(Ileum)
Case 7/8
(87.5)
8/8
(100)
5/8
(62.5)
7/8
(87.5)
6/8
(75)
5/8
(62.5)
3/9
(33.3)
6/8
(75)
Control 4/4
(100)
2/3
(66.7)
2/4
(50)
3/4
(75)
3/4
(75)
3/4
(75)
1/4
(25)
2/4
(50)
HEV
(Tonsil)
Case 0/8
(0)
3/8
(37.5)
3/8
(37.5)
1/8
(12.5)
0/8
(0)
5/8
(62.5)
1/9
(11.1)
0/8
(0)
Control 1/4
(25)
1/4
(25)
3/4
(75)
0/4
(0)
0/4
(0)
0/4
(0)
0/4
(0)
1/4
(25)
PEV1 Case 4/8 5/8 0/8 0/8 0/8 1/8 9/9 0/8
112
Prevalence (%)
Pathogens
(organ) Farm 1 2 3 4 5 6 7 8
(Brain) (50) (62.5) (0) (0) (0) (12.5) (100) (0)
Control 2/4
(50)
2/4
(50)
1/4
(25)
1/4
(25)
0/4
(0)
0/4
(0)
3/4
(75)
1/4
(25)
PEV2
(Brain)
Case 8/8
(100)
6/8
(75)
2/8
(25)
0/8
(0)
4/8
(50)
1/8
(12.5)
4/9
(44.4)
0/8
(0)
Control 4/4
(100)
2/4
(50)
1/4
(25)
1/4
(25)
0/4
(0)
0/4
(0)
0/4
(0)
1/4
(25)
PEV3
(Brain)
Case 8/8
(100)
7/8
(87.5)
2/8
(25)
0/8
(0)
2/8
(25)
6/8
(75)
1/9
(11.1)
1/8
(12.5)
Control 2/4
(50)
2/4
(50)
3/4
(75)
0/4
(0)
0/4
(0)
3/4
(75)
0/4
(0)
2/4
(50)
* Legend: RV-A = group A rotavirus; RV-B = group B rotavirus; RV-C = group C rotavirus; HEV = haemagglutinating
encephalomyelitis virus; PEV1, 2 and 3 = porcine enteroviruses CPE group 1, 2 and 3
One PFTS-CASE (from farm 1) was positive for porcine type 2 circoviruse (PCV2, tonsil), and all pigs were negative
for porcine reproductive and respiratory syndrome virus (PRRSV, lung), influenza A virus (FLUAV, lung), porcine
enteric calicivirus (PECV, ileum), transmissible gastroenteritis virus (TGEV, ileum), Mycoplasma hyopneumoniae
(Mhyo, lung), Helicobacter-pylori-like (Hp, stomach) and Helicobacter-heilmannii-like (Hh, stomach) organisms.
113
6. Clinical pathology, serum cytokines and Vitamin D changes associated with Porcine
Periweaning Failure to Thrive Syndrome (PFTS)
Chapters 4 and 5 identified several consistent lesions of PFTS. However, no antemortem blood
parameters have been thoroughly evaluated. Yet these may provide important insights in the
diagnosis and pathogenesis of PFTS. Thus, in Chapter 6, clinical pathology and serum cytokines
were characterized in PFTS pigs and compared to non-affected pigs.
This Chapter has been prepared for publication. The copyright of this Chapter will belong to the
journal in which it is published.
Huang, Y. and J.C.S. Harding, Clinical pathology, serum cytokines and Vitamin D changes
associated with Porcine Periweaning Failure to Thrive Syndrome (PFTS). BMC Vet Res, 2013.
Manuscript in preparation.
114
6.1. Introduction
Porcine periweaning failure-to-thrive syndrome (PFTS) is characterized clinically by anorexia
and progressive debilitation of newly weaned pigs. Up to 20% nursery pigs within 2-3 weeks of
weaning can be affected.79 A sporadic condition clinically similar to PFTS at individual pig level
but of lower morbidity and mortality was usually referred to as “post-weaning starve-outs” and
may have existed for decades. However, in 2008 outbreaks of “starve-outs” which caused severe
nursery mortality were recognized as a distinct clinical syndrome in North America.42,57 It has
been estimated that 4.3% of nursery flows in North America were affected, and the within-flow
prevalence of PFTS was most commonly between 1-10%. 139 It is not known whether PFTS is
present in other continents, but a recent report suggests it may be present in Spain.178
The etiology of PFTS is unknown, but a number of swine pathogens have been ruled out
including porcine reproductive and respiratory syndrome virus, porcine circovirus type 2,
influenza A virus, transmissible gastroenteritis virus, Mycoplasma hyopneumoniae, Brachyspira
hyodysenteriae, Brachyspira pilosicoli, Helicobacter-pylori-like and Helicobacter-heilmanii-like
organisms.76,78,154 Additionally, porcine cytomegalovirus, porcine enteric calicivirus, swine
Torque Teno virus 2, pathogenic Escherichia coli, rotavirus, haemagglutinating
encephalomyelitis virus, porcine enterovirus CPE groups 1, 2, 3 and coccidia have been detected
in some affected pigs as well as in age-matched unaffected pigs and the prevalence did not
differ.76,154 Thus, these pathogens are not likely to be the etiology of PFTS.
The diagnosis of PFTS is based on fulfillment of the current case definition79 and exclusion of
other common swine diseases. The PFTS case definition is clinically oriented and was developed
in 2010 prior to understanding the pathological features of the syndrome. It is as follows: PFTS
115
is characterized by anorexia and progressive debilitation of newly weaned pigs with variable
morbidity but high case fatality, with repetitive oral behaviors such as chomping and chewing on
farm level, without residual illness from the suckling phase, and without discernible and
detrimental infectious, nutritional, managemental and environmental factors that can explain the
clinical symptoms.79 Recently, the authors have completed a case-control pathological
investigation of PFTS affected and non-affected pigs from a number of farms across North
America. Additional criteria for the diagnosis of individual animals were proposed which
included 1) satisfying the PFTS clinical definition, 2) the presence of thymic atrophy, superficial
gastritis and small intestinal villous atrophy, and 3) ruling out of all other relevant diseases and
porcine pathogens potentially affecting young nursery pigs.78
Clinical pathology may help to elucidate the pathophysiological mechanism(s) associated with
PFTS, and may also direct future etiological and epidemiological research. At the time of writing,
such data has only been reported in one study investing one affected farm with limited sample
size.153 In another study, unlike age-matched fasted pigs, PFTS pigs failed to exhibit elevated
urine ketone bodies suggesting an abnormal metabolic response underlying PFTS.125 These
results however, need to be verified with a larger, multi-farm study.
It has been conjectured that the progressive debilitation of PFTS may be associated with a
systemic proinflammatory cytokine response.42,125 This hypothesis was supported in porcine
postweaning multisystemic failure syndrome (PMWS),93 but data is not available for PFTS.
Finally, concurrent with the recognition of PFTS in North America, some regions reported
universal vitamin D deficiency in nursery pigs.199 The lack of case-control or experimental data
led to our interest in further clarifying the relationship between serum vitamin D levels and PFTS.
To this end, the objectives of this study are to compare haematology, serum chemistry, cytokine
116
and vitamin D levels in PFTS-affected and age-matched control pigs with the intent of
elucidating any underlying pathophysiological mechanisms associated with the development of
PFTS.
6.2. Methods
6.2.1. Farm visits and sample collection
This work was approved by the University of Saskatchewan’s Animal Research Ethics Board and
adhered to the Canadian Council on Animal Care guidelines for humane animal use. Eight (8) or
9 CASE and 4 CTRL pigs blocked by days postweaning were selected in each of 8 farms which
allegedly fit the PFTS clinical definition identified during a diagnostic investigation as described
previously (Chapter 5). Blood samples were collected from the cranial vena cava vein into EDTA
and plain (non-anticoagulated) tubes for subsequent analyses.
6.2.2. Categorization of farms based on clinical presentation
As described in Chapter 5, 5 farms (farm 1-5) completely fit the PFTS clinical definition79 but
farm 6, 7 and 8 only partially fulfilled this definition. Farms 1-5 were thus designated as “PFTS”
farms and 6-8 as “partial” farms. As a result, there were 4 subgroups in this study: 1) affected
pigs from PFTS-farms (PFTS-CASE); 2) non-affected pigs from PFTS-farms (PFTS-CTRL); 3)
affected pigs from partial-farm (partial-CASE); and 4) non-affected pigs from partial-farm
(partial-CTRL). The partial-farms were included in the analysis because they might be useful for
comparison.
117
6.2.3. Haematology and serum chemistry
Approximately 5 ml of EDTA blood from each pig on all farms except farms 1 and 6 was
submitted to Prairie Diagnostic Services (PDS) Inc. (Saskatoon, SK, Canada) for complete blood
count (CBC) using a Celldyn 3500R Automated Haematology Analyzer (Abbott Laboratories,
Abbott Park, Illinois, USA). CBC for samples from farm 6 was performed at the Animal Healthy
Laboratory (AHL), University of Guelph using an ADVIA 2010i automated haematology
analyzer (Siemens Healthcare Diagnostics Ltd., Mississauga, ON, Canada). Differential counts
were performed by manually counting 100 cells. A CBC was not performed for farm 1 pigs.
Serum chemistry was performed at PDS Inc. using Cobas c311 analyzer (Roche Diagnostics,
Mannheim, Germany). Beta hydroxybutyrate (BHB) levels were tested using a Ranbut reagent
kit (Randox Laboratories Limited, County Antrim, UK). Results were compared to previously
described reference values of “weaner pigs”.53 The above tests were not performed in samples
from farm 1.
6.2.4. Serum cytokine concentrations
Sera were obtained by centrifugation of approximately 10 ml non-anticoagulated blood and
stored at -80°C before testing for IL-1β, IL-4, IFN-α, IL-10, IL-12, CCL2 and IL-8 using a
7-plex fluorescent microbead immunoassay (FMIA) as previously described103 with minor
modifications. TNFα and IFN-γ were not included in the panel, and CCL2 monoclonal antibody
was provided by Dr. Joan Lunny, Beltsville Agricultural Research Center (Beltsville, MD USA).
Standards and samples were tested in duplicate, and the observed concentrations of of standards
were within 20% of expected concentrations. The dynamic ranges of each analyte were: IL-1β:
8-5000 pg/ml; IL-4: 3-2000 pg/ml; IFN-α: 3-5000 pg/ml; IL-10: 3-2000 pg/ml; IL-12: 20-5000
118
pg/ml; CCL2: 50-5000 pg/ml and IL-8: 20-2000 pg/ml. Three 96 well plates were used to test
samples. Duplicates exhibiting more than 30% coefficient of variation (CV) were re-tested.
Aliquots of quality control sera which contained known concentrations of each analyte were
included on each plate. All quality control samples had CV less than 10%.
Serum IFN-γ concentration was tested using the Swine IFN-g Antibody Pair ELISA kit (Life
Technology Inc. Burlington, ON, Canada) according to the manufacturer’s instructions, except
that the color substrate employed was KPL SureBlue Reserve TMB Microwell Substrate
(Mandel Scientific Company Inc., Guelph, ON, Canada). After adding color substrate, the plates
were incubated in the dark for 25 minutes before the absorbance of each well was measured at
650 nm on a Vmax microplate reader (Molecular Devices, LLC., Sunnyvale, CA, USA). All sera
were diluted 1:3 in negative sera and tested in duplicate.
6.2.5. Serum vitamin D
Sera 25-OH vitamin D assay was performed by Heartland Assays, LLC (Ames, Iowa, USA)
using a two-step procedure.74 The first involved a rapid extraction of 25-OH vitamin D and other
hydroxylated metabolites from sera with acetonitrile. Following extraction, the treated samples
were then assayed using an equilibrium radial immunoassay (RIA) procedure. The RIA method
is based on an antibody that is co-specific for 25-OH vitamin D2 and 25-OH vitamin D3. The
samples, antibody and tracer were incubated for 120 minutes at 20-25°C. Phase separation was
accomplished after a 20 minute incubation at 20-25°C with a second antibody precipitating
complex. A non-specific binding (NSB)/addition buffer was added after this incubation prior to
centrifugation to aid in reducing non-specific binding. 25-OH vitamin D equivalent values were
calculated directly by the γ-radiation counting system with use of a smooth-spline method. The
119
results were expressed in terms of 25-OH vitamin D equivalents. The assay has a range of
2.5-100 ng/ml and intra- and inter-assay CV of 8.0% and 10.0% respectively.
6.2.6. Statistical analyses
Generalized Estimating Equations (GEE) accounting for clustering by farm were used to build
linear regression models, in which the outcomes were parameters of serum chemistry or
haematology and the predictors farm-type (PFTS-farms or partial-farms), pig-type (CASE or
CTRL) and the interaction term of these two factors. All models used an exchangeable
correlation matrix with a robust variance estimator. The normality and homoscedasticity of the
raw residuals of each final model were evaluated. In models where the assumptions of normality
or homoscedasticity were violated, the specific parameters were transformed (natural log [ln],
log10 or square root) and re-analyzed. Pairwise post hoc comparisons of the estimated means of
each combination of farm-type and pig-type were performed when the interaction term was
statistically significant, or when both farm-type and pig-type were significant. If the transformed
models still violated the above two assumptions, the data were then categorized, and a binary or
ordinal logistic regression by GEE was used to re-analyze the data. In the case of dichotomized
data that could not be analysed using GEE, a Fisher’s exact test was used. All statistical analyses
were performed using IBM SPSS Statistics version 21 (IBM Corp., New York). To reduce the
risk of type 1 error associated with testing multiple potentially related parameters in the same
samples, P values less than 0.01 were regarded as statistically significant.
6.3. Results
The results are presented in three tables: Table 6.1 for parameters in which the interaction terms
of farm-type and pig-type were significant (except for urea which is also included in this table);
120
Table 6.2 in which only pig-type was significant, and Table 6.3 in which data was dichotomized.
Compared to all other pigs, PFTS-CASE pigs had significantly higher red blood cell count
(RBC), hemoglobin concentration (Hgb), haematocrit (Hct), mean corpuscular hemoglobin
concentration (MCHC), urea, and total, direct and indirect bilirubin than CTRL (P < 0.0001 for
all) (Table 6.1). The predicted Hct, total and indirect bilirubin levels of PFTS-CASE pigs were
higher than the reference ranges.53 The predicted RBC, Hgb, urea, direct bilirubin, and albumin
of all groups were within the reference ranges.53 The predicted MCHC of all groups were lower
than the reference range (Table 6.1).53
Calcium, phosphorous, glucose, aspartate transaminase (AST) and vitamin D levels were
significantly lower in CASE versus CTRL pigs regardless of farm-type (P<0.01 for all) (Table
6.2). The predicted calcium, phosphorus, glucose and AST were within reference ranges.53
Serum vitamin D concentrations of both CASE and CTRL pigs were lower than the published
values (Table 6.2).2
The values for glutamate dehydrogenase (GLDH) and beta hydroxybutyrate (BHB) were
dichotomized and analyzed by Fisher’s exact test. The negative cut-offs for GLDH and BHB
were 2U/L and 0.1mmol/L, respectively. PFTS-CASE pigs were compared to all other pigs. Half
(20/40, 50%) of PFTS-CASE pigs had serum GLDH higher than the cut-off, compared to zero in
any other group. Most (29/40, 76.3%) PFTS-CASE pigs had serum BHB higher than the cut-off,
compared to only 4/57 (7%) non PFTS-CASE pig. Both variables were significantly higher in
PFTS-CASE pigs than CTRL (P<0.0001; Table 3).
There were no significant group differences for total white blood cells, eosinophils, basophils,
monocytes, mean corpuscular volume (MCV), mean corpuscular haemoglobin (MCH), sodium,
121
potassium, chloride, bicarbonate, anion gap, magnesium, creatinine, gamma-glutamyltransferase
(GGT), creatine kinase (CK), total protein or globulin.
The pig-type*farm-type interaction terms were not significant in all GEE models used to analyze
serum cytokines. Pig-type significantly predicted serum IL-12 concentration, with CASE pigs
having higher predicted levels (110.4 ±21.8 pg/ml) than that CTRL pigs (36.7 ±9.7 pg/ml),
regardless of farm-type. Farm-type and pig-type were not associated with the serum
concentrations of IL-1β, IL-4, IL-10, CCL2, IL-8, IFN-α or IFN-γ (data not shown).
6.4. Discussion
The results of this study revealed significant haematological and serum biochemical differences
in pigs affected by PFTS compared to controls, including higher levels of RBC, Hgb, Hct,
MCHC, urea, bilirubin, albumin, AST, GLDH and BHB, as well as lower levels of calcium,
phosphorus, glucose and vitamin D. Although there are a number of differential diagnoses for the
observed differences in each individual analyte, reduced feed and water intake are the most likely
cause of all of these differences.
The higher levels of RBC, Hgb, Hct, MCHC are consistent with erythrocytosis. These
haematological parameters, which collectively reflect the quantities of RBC and hemoglobin, are
closely related mathematically and their values usually move in the same direction as observed in
the current study. The most common causes for their increase are hemoconcentration (i.e.
dehydration) and splenic contraction in response to excitement or fighting associated with
epinephrine release.188 Whether or not splenic contraction was present in the PFTS-CASE pigs
was not evaluated, but these pigs appeared depressed rather than excited, therefore erythrocytosis
due to splenic contraction is unlikely. Conditions causing sustained hypoxia, such as pulmonary
122
disease and congenital cardiac vascular shunts (right to left), can also cause erythrocytosis due to
increased bone marrow RBC production in respond to increase renal erythropoietin
production.188 However, pneumonia was not a consistent feature of PFTS-CASE pigs and cardiac
shunts were not observed.
The haematological findings in the current study agreed with those found in other studies
investigating clinical pathology of PFTS and of unthrifty nursery pigs. Pittman and Moeser
investigated pigs on the day of weaning, fasted pigs 4 days post-weaning, PFTS pigs 4 and 11
days postweaning, and control pigs 4 and 11 days post-weaning.153 Pack cell volume (PCV) was
significantly higher in PFTS and fasted compared to control pigs. Pittman’s finding confirmed
that 4-day fasting can induce increased PCV to the same magnitude as PFTS does in nursery pigs.
Thus it is reasonable to conclude that the differences in PCV/Hct in PFTS pigs in the present
study were likely due to anorexia. Buzzard et al. investigated blood parameters in unthrifty
nursery pigs (n=32) compared to healthy controls (n=26).19 They reported significantly higher
Hct and Hgb in the unthrifty pigs and concluded that these were indicative of dehydration and
anorexia. Furthermore, Buzzard implied that the so-called unthrifty pigs could represent early
stages of PFTS,19 but the authors of the present study remain neutral regarding Buzzard’s
supposition about the relationship between unthrifty and PFTS pigs.
The elevated blood urea in PFTS-CASE pigs also suggests anorexia or dehydration in PFTS pigs.
Urea is converted from tissue or intestinal ammonium (NH4+) in hepatocytes. Increased serum
urea can be the result of reduced urinary excretion by a pre-renal process such as dehydration or
shock, renal diseases, or urinary tract obstruction.188 There was no evidence of shock, renal and
urinary tract diseases in PFTS-CASE pigs. Increased urea production due to intestinal
hemorrhage or increased protein catabolism can also account for increased blood urea. No
123
intestinal hemorrhage was observed in the current investigation, however increased protein
catabolism is possible considering PFTS-CASE pigs experienced anorexia and alternative energy
sources (e.g. fat and muscle mass) would be required for maintenance. Thus, the elevated blood
urea was likely due to the combined effect of dehydration, anorexia and protein catabolism.
However, it should be noted that urea concentration in PFTS-CASE pigs remained within the
normal reference range, thus, it was more likely a physiological adaptation than pathological
event. In the Pittman study, blood urea levels in PFTS and fasted pigs were higher than those in
control pigs, but were not statistically different between groups.153 Blood urea was not measured
in the Buzzard study.19
In anorexia, hepatocellular uptake of bilirubin decreases, followed by an increase in indirect
bilirubin in blood.188 Other causes of hyperbilirubinemia include hemolysis, primary hepatic
disease and cholestasis. As there was no evidence of overt hemolysis or hepatic pathology in the
current investigation, the elevated total bilirubin (mainly due to indirect (unconjugated) bilirubin
over the reference range) was most likely the result of anorexia. Although the patency of bile
ducts was not examined in this study, hyperbilirubinemia caused by cholestasis is usually
dominated by direct bilirubin, which was not the case in PFTS-CASE pigs. Consistent with our
interpretation, the fasted pigs in the Pittman study demonstrated hyperbilirubinemia.154 However,
whether this was due to indirect bilirubin was not reported.
Elevated serum albumin in pigs is almost always the result of dehydration and no compelling
differential diagnoses for these results in PFTS-CASE pigs were noted.188
The high BHB levels in a large proportion of PFTS-CASE pigs indicate increased fat metabolism.
Ketone bodies include acetone, acetoacetate and BHB, with BHB being most stable.188 Thus, the
124
measurement of BHB should most reliably reflect the ketone status of an animal. Anorexia and
diabetes mellitus are two of the most common reasons for increased BHB in the blood.188 In the
absence of pancreatic lesions, diabetes mellitus is unlikely, and anorexia is the most reasonable
explanation for the increased BHB observed in this study. The BHB reference value for pigs is
not available to the best of the authors’ knowledge. But as a general rule, blood BHB
concentration of greater than 1.4 mmol/L is reflective of ketosis in animals.188 Accordingly, none
of the pigs in the current study should be diagnosed as ketotic and the elevated BHB likely
reflects anorexia but may not have contributed significantly to the clinical sickness. In Pittman
and Moeser’s clinical pathological investigation of PFTS and fasted pigs, fasted pigs exhibited
ketonurea, but PFTS pigs did not.125,153 It was suggested that PFTS pigs might have a unique
metabolic disorder.125 The Pittman study however, did not measure blood ketone levels, and the
specific ketone metabolite measured in urine was not specified.153
The homeostasis of serum calcium and phosphorus are tightly connected and regulated by
vitamin D. The major source of calcium, phosphorus and vitamin D for commercial pigs raised
indoors is their diet.188,199 The current study revealed that the serum calcium, phosphorus and
vitamin D levels were significantly lower in CASE than in CTRL pigs. There has been a
resurgence of research interest in vitamin D in pigs because it has been recognized that nursery
pigs in modern swine production systems have a high prevalence of hypovitaminosis D.199
Although this finding was confirmed in this study, none of the pigs in this study demonstrated
lesions of rickets. Since none of the pigs were exposed to sunlight, reduced feed intake was
likely responsible for the lower serum vitamin D levels in CASE pigs compared to CTRL pigs.
Reduced vitamin D consumption followed by reduced intestinal absorption of calcium and
phosphorus is the most plausible explanation why CASE pigs had lower serum calcium and
125
phosphorus than CTRL. Other differential causes for low calcium and phosphorus, such as
chronic renal disease and acute pancreatitis were not observed in any pig. Similarly, in the
Pittman study, PFTS and fasted pigs had lower serum calcium and phosphorus than the control
pigs.153 It should be noted that although not significantly different, sodium and chloride were
also lower in CASE compared to CTRL pigs in the present study (0.01<P<0.05 for both, data not
shown) and were most likely caused by anorexia as well.
The lower serum glucose levels in CASE pigs were most likely the result of energy deprivation
due to anorexia. The Pittman and Buzzard studies also revealed similar findings.19,153 However,
in a study of mini-pigs, a 24 hour period of fasting did not cause significant changes in serum
chemistry including glucose.192 Thus, consistent with the clinical observation, the CASE pigs had
likely experienced prolonged anorexia at the time of sample collection.
Elevated GLDH and AST are indicative of hepatocellular damage. Serum GLDH is mainly
derived from hepatocytes, whereas skeletal and myocardial muscle damage can also contribute to
increased AST. In the absence of increased CK and no cardiac lesions in CASE pigs, the
increased AST is most likely hepatic in origin. However, the predicted mean of AST in CASE
pigs was within the normal reference range, which indicates that the hepatocellular damage was
mild and unlikely to have caused the clinical signs associated with PFTS. In human patients with
anorexia nervosa, acute hepatic damage occurs due to the poor nutritional status.163 The same
may also apply to PFTS. Unfortunately, the reference range of GLDH in pigs is not available.
No differences in IL-1β, a proinflammatory cytokine, were detected among groups.
Unfortunately the reagents needed for measuring TNF-α and IL-6, two other proinflammatory
cytokines, were not available for the FMIA assay used in this experiment, and insufficient serum
126
was available to enable testing by other methods. It should be noted that the normal leukogram in
this study does not support an overt inflammatory condition in PFTS-CASE pigs. Thus, although
an association between PFTS and high proinflammatory cytokines cannot be absolutely ruled out,
it is not likely based on the results of this study. CASE pigs from both farm-types had higher
serum IL-12 (a Th1 cytokine) than CTRL, which suggests a stimulated cellular immune response
in CASE pigs.
6.5. Conclusions
In conclusion, differences in clinical pathology findings of PFTS-CASE compared to other pigs
in the current study were most likely caused by prolonged anorexia and dehydration, and no
other underlying anatomical pathology was indicated except for mild hepatocellular damage,
which could also be the result of anorexia. Additionally, PFTS was not associated with high
systemic IL-1β, a hallmark of a systemic proinflammatory reaction, but was associated with
elevated IL-12, one indicator of a stimulated Th1 response.
127
Table 6.1. Estimated values of serum parameters with significant interaction between farm type and pig type
PFTS farms
(Est. mean±SE)
Partial farms
(Est. mean±SE) P values
Reference ranges
CASE CTRL CASE CTRL Farm
Type
Pig
Type Interact
RBC 7.7±0.1 a 6.5±0.2 b 6.1±0.2 bc 5.9±0.2 c <0.0001 <0.0001 <0.0001 5.3-8.0 1012/L
Hgb 136.2±3.6 a 109.7±5.0 b 103.2±5.8 b 102.2±6.0 bc 0.005 <0.0001 <0.0001 90-140 g/L
Hct 0.44±0.01 a 0.36±0.02 b 0.35±0.02 b 0.35±0.02 b 0.025 <0.0001 <0.0001 0.26-0.41 L/L
MCHC 308.0±1.0 a 297.4±1.0 b 291.4±1.0 b 291.9±1.0 b 0.145 <0.0001 <0.0001 320-360 g/L
Urea 7.6±1.1 a 5.0±1.2 b 4.1±1.1 b 3.3±1.2 b 0.002 <0.0001 0.219 2.9-8.9 mmol/L
Total Bilirubin 9.8±1.2 a 1.9±1.3 b 3.2±1.2 b 2.4±1.2 b <0.0001 0.05 <0.0001 0.9-3.4 g/L
Direct Bilirubin 1.7±1.2 a 0.6±1.3 b 1.1±1.1 c 1.0±1.1 b 0.794 <0.0001 <0.0001 0.0-3.4 g/L
Indirect Bilirubin 7.9±1.2 a 1.4±1.3 b 2.2±1.1 b 1.4±1.3 bc <0.0001 0.008 <0.0001 0.0-3.4 g/L
Albumin 36.7±1.0 a 33.2±0.9 b 32.3±2.1 b 33.2±1.8 b 0.302 <0.0001 <0.0001 19-39 g/L
Est.=estimated; RBC=red blood cell; Hgb=hemoglobin; Hct=hematocrit; MCHC= mean corpuscular hemoglobin concentration
Within row, different letter superscripts represent the results of post hoc pairwise comparison (P<0.01)
For case pigs from PFTS farms, control pigs from PFTS farms, case pigs from partial farms and control pigs from partial farms, n=32, 16, 25 and 12 respectively for hematological
parameters; n=40, 20, 25 and 12 for all other parameters.
128
Table 6.2. Estimated values of serum parameters with pig type as the only significant predictor
Case pigs (n=65) Control pigs (n=32)
Reference Units P
values Estimated
Mean SE
Estimated
Mean SE
Calcium 2.5 0.0 2.7 0.1 2.02-3.21 mmol/L 0.002
Phosphorus 2.4 1.0 3.0 1.0 1.46-3.45 mmol/L <0.0001
Glucose 4.7 0.3 5.8 0.3 3.5-7.4 mmol/L <0.0001
AST 54.5 1.1 46.2 1.1 21-94 U/L 0.009
Vitamin D 6.5 1.2 14.2 1.1 25-30 mg/L <0.0001
AST= aspartate transaminase
129
Table 6.3. Frequency of pigs with detectable serum GLDH (> 2 U/L) and BHB (>0.1mmol/L)
PFTS-CASE (%)
n=40
All other pigs (%)
n=57
Fisher’s exact P
values
GLDH (>2U/L) 20 (50) 0 (0) <0.0001
BHB (>0.1mmol/L) 29 (76.3) 4 (7) <0.0001
GLDH= glutamate dehydrogenase; BHB=beta hydroxybutyrate
In each role, values with different letter suffixes are statistically different by post hoc pairwise
comparison (P<0.01)
130
7. Snatch-farrowed, porcine-colostrum-deprived (SF-pCD) pigs as a model for swine infectious
disease research
In the works presented in Chapters 4 to 6, the clinical and anatomical pathology of PFTS were
characterized, and the relevant pathogens tested were determined to not be the likely etiology of
PFTS. Reproducing PFTS in susceptible pigs will be a powerful and unequivocal way of proving
it is an infectious disease, even without identification of the causative agent. However, a reliable
pig model needs to be first developed prior to inoculation studies. In Chapter 7, efforts were put
into developing a snatch-farrowed, porcine-colostrum-deprived pig model in preparation for a
PFTS inoculation study.
Chapter 7 has been published and is reproduced here with the permission of the copyright owner
(Canadian Veterinary Medical Association).
Huang, Y., D.M. Haines, and J. Harding, Snatch-farrowed, porcine-colostrum-deprived (SF-pCD)
pigs as a model for swine infectious disease research. Can J Vet Res, 2013. 77(2): p. 81-88.
All authors contributed to the manuscript writing. Huang, with assistance from Harding,
performed the experiment and analyzed the data. Haines assisted in the design of the
composition of the preweaning liquid formula and quantification of the bovine immunoglobulin
concentrations.
131
7.1. Introduction
In porcine research, especially that investigating infectious diseases, obtaining pigs that are free
of porcine pathogens is essential. Currently, three main methods are used to obtain such pigs:
conventional pigs tested free for antigen and antibodies of certain specific pathogens (SPF),
cesarean-derived colostrum-deprived (CDCD), and the gnotobiotic or germ-free technique. The
conventional SPF method chooses pigs that are tested negative for the pathogen of interest. The
advantage of this method is its convenience, low requirement for techniques and cost efficiency.
However, when the research requires freedom of infection with pathogens that are highly
prevalent in pig populations, for instance porcine cirvovirus type 2 (PCV2), the conventional
SPF method may be inadequate, as most pigs have antibodies against these pathogens, either
maternal or acquired or are actively infected with the pathogen of interest. As a result,
researchers may have to screen a large number of farms and pigs to obtain reliable pig source and
select pigs after the waning of maternally-derived antibodies. The CDCD and gnotobiotic
methods have been used to successfully obtain pigs for infectious disease studies. Both methods
use a Cesarean-section to derive term piglets from pregnant sows. CDCD pigs are raised in
sterile compartments for several days and then in a clean room.189 Gnotobiotic pigs are raised
entirely in sterile compartments. Although CDCD and gnotobiotic derivation are reliable
methods of obtaining pathogen-free pigs, they have several disadvantages including the need for
surgery, specialized facilities, sterile compartments, and are more costly than the SPF method. In
addition, the duration of gnotobiotic experiments is limited to only a few weeks, after which the
pigs out-grow the sterile compartments. There is also a risk that cesarean-derived pigs, especially
if delivered prior to full term, do not fully experience the prenatal serum cortisol surge that
occurs in vaginally delivered pigs.174 The prenatal cortisol surge plays an important role in tissue
132
maturation, immunoglobulin absorption, surfactant production and the deposition of glycogen in
muscles and liver.49 This helps to explain why caesarian-derived piglets experience higher
morbidity and mortality than in naturally born cohorts. Further, there is debate as to whether
gnotobiotic pigs have the same immunological responses as natural-born pigs, because they are
not exposed to microbial programming as are piglets reared in natural environments.18
Recent attempts to raise snatch-farrowed, porcine-colostrum-deprived (SF-pCD) pigs using
bovine colostrum provided an alternative method for obtaining susceptible pigs for infective
disease experiments.12,141 In this method, pigs are fed bovine colostrum for 3 days, a porridge
of milk replacer and dry feed from day 4 to 14, and weaned on to dry diet on day 15. The
advantages of this method are that the pigs experience natural vaginal delivery and that their
intestines are colonized by bacteria, thus the piglets are more representative of conventional pigs
compared to CDCD or gnotobiotic pigs. However, survival rates in these studies were at most 80%
due mostly to mortality from E. coli- or Staphylococcal-septicemia.12,141 A further disadvantage
was that pigs were weaned at 15 days of age, much younger age than in the commercial industry
and at an age when there may not be enough digestive enzymes to efficiently cope with solid
feed.
In this paper, a method of raising SF-pCD pigs using commercially available bovine colostrum
products (HeadSTARTTM and Calf’s Choice TotalTM HiCal, The Saskatoon Colostrum Company
Ltd., Saskatoon Canada) is described. This method allows pigs to be weaned at 21 days of age
with 100% survival, and produces pigs free of major porcine pathogens and maternal antibodies
such that they are fully susceptible to infectious pathogen challenge or receptive to vaccination at
a young age. This method is an alternative to Cesarean-derived methods to produce
colostrum-deprived pigs for purposes of infectious disease research.
133
7.2. Material and methods
7.2.1. Snatch-farrowing, animal care and experimental design
This work was approved by the University of Saskatchewan’s Animal Research Ethics Board
and adhered to the Canadian Council on Animal Care guidelines for humane animal use.
Pregnant sows at the Prairie Swine Center (PSC) Inc., Saskatoon, SK. were used as the source of
SF-pCD pigs. Parturition was induced by intramuscular injection of a commercial prostaglandin
analogue (Planate, Schering Canada Inc., Pointe-Claire, Quebec, Canada) on day 115 of
pregnancy. The perivulvar area of the sows and the pens in which the sows were housed were
washed twice on the day before expected parturition with warm water and sprayed with an iodine
disinfectant (Prepodyne, West Penetone Inc., Ville d’Anjou, Quebec, Canada). Before parturition,
a clean drape was placed behind the sow to reduce the risk of environmental contamination of
the piglets. During parturition, piglets were snatched before contacting the floor, farrowing
equipment or barn facilities. The umbilical cords were clamped and disinfected with Prepodyne.
Piglets were, within 1 minute of birth, placed into sealed plastic containers fitted with a
High-Efficiency Particulate Air (HEPA) filter allowing the provision of filtered fresh air while
transported to a biosecurity level 2 animal care room with positive pressure ventilation at the
University of Saskatchewan. The animal room was disinfected twice at 24 hour intervals before
pig entry: first with 7% hydrogen peroxide solution (Peroxigard, Bayer Inc., Toronto, Ontario,
Canada) and followed with 1% Virkon solution (Antec International Limited., Lavaltrie, Quebec,
Canada). Piglets were raised in groups of 2 (experiment 2) or 3 (experiment 1) per pen on
elevated plastic floor. The concrete floor beneath the plastic flooring was washed 2 to 3 times
each week in experiment 1, and daily in experiment 2. The room temperature was set at 30⁰C
134
from day 1 to 21, and decreased by 1⁰C weekly thereafter. Before weaning, a heat lamp was
provided for each pen and the height of the lamps was adjusted according to the pigs’ comfort
level (i.e. pigs sleep comfortably on their sides under the heat lamp exposing their abdomen).
After entry, piglets were fed a liquid diet (Table 7.1) hourly for the first 6 hours, every 2 hours
from 6 to 24 hours of age, and 4 times per day (8:00 am, 12:00 am, 4:00 pm and 10:00 pm)
thereafter until weaning. The pigs were initially bottled-fed, while the liquid diet was also
provided in a liquid feeder (Miller Manufacturing Company, Eagan, MN; product number:
BPW4) in the pen to encourage drinking from the feeder. Once a pig was observed to be
drinking from the feeder, bottle-feeding was discontinued for that pig. All pigs began to drink
from the feeder within 48 hours of age. The liquid diets contained combinations of the following
ingredients: spray-dried bovine colostrum powder containing at least 25% bovine IgG
(HeadSTARTTM, The Saskatoon Colostrum Company, Saskatoon, SK, Canada), spray-dried
bovine colostrum powder containing at least 14% bovine IgG (Calf’s Choice TotalTM HiCal,
Saskatoon Colostrum Company, Saskatoon, SK, Canada), commercial pig milk replacer
(WetNurse, Prairie Micro-Tech Inc, Regina, SK, Canada), K88 E. coli hyperimmuned egg yolk
protein (Hyper-egg; J. H. Hare & Associates Ltd, Winnipeg, MB, Canada) and an oral iron
supplement (Enfamil® Fer-In-Sol® syrup, Mead Johnson & Company, Canada; 30 mg elemental
iron per 5 ml). The targeted dry matter fed to each pig in the liquid diet gradually increased from
66 g/day on day 1 to 500 g/day on day 20, and the feeding volume increased from 150 ml/d to
3300 ml/d. The exact feeding amount and volume varied somewhat based on appetite. Pigs were
weaned on day 24 (experiment 1) or day 21 (experiment 2) to a custom starter diet absent of
porcine by-products (Table 7.2), with the exception of bovine colostrum fed to the treatment
group in experiment 2.
135
No prophylactic antibiotic treatment was employed before the pigs enter the animal rooms, nor
before weaning. No antibiotics were supplemented in the starter feeds used in these experiments.
In experiment 1, when pigs developed fever higher than 40°C, oxytetracycline (Bio-mycin,
Boehringer Ingelheim, Burlington, ON, Canada) was given intramuscularly (1ml, 20 mg/ml) to
release the clinical symptoms of septicemia.
Experiment 1 aimed to compare the effects of two different liquid diet formulations on the health
of SF-pCD pigs. The 12 SF-pCD pigs used in this experiment were conveniently placed (3 per
pen) in the order they arrived at the facility into 4 feet x 6 feet (1.23m x 1.85m) pens equipped
with one liquid feeder. Unlimited access to water was provided by a nipple drinker. All pigs were
housed in the same room throughout the experiment. Two systematically selected pens (pens 1
and 2; 3 pigs per pen) (RPL; n=6 pigs) were fed a liquid diet comprised mainly of bovine
colostrum for the first 10 days, then the colostrum was gradually replaced with milk replacer
until leaving 5% (w/v) bovine colostrum in the diet (Table 7.1). The remaining 2 pens (pens 3
and 4; 3 pigs per pen) (COL; n=6 pigs) were fed a liquid diet comprised mainly of bovine
colostrum throughout days 1 to 20 (Table 7.1). Starter diet was introduced to all the pigs on day
20 and the pigs were fully weaned on day 24. Blood samples were drawn into EDTA tubes
from the cranial vena cava 24 hours after the initial bovine colostrum feeding and weekly
thereafter from half of the pigs of each group. Rectal temperatures were measured daily from
entry to day 33. The experiment was terminated on day 35 when all the surviving animals were
euthanized with intravenous barbiturate and necropsied.
Experiment 2 aimed to evaluate the potential benefits of adding bovine colostrum powder to the
dry starter diet fed after weaning. Twelve SF-pCD pigs were used in this experiment. Two
conveniently selected pigs were placed in each pen. All pigs were kept in the same animal room
136
throughout the experiment. Before weaning on day 21, all pigs were fed a liquid diet comprised
mainly of bovine colostrum (Table 7.1). At weaning, the pens were systematically allocated into
2 groups. Three pens (pens 2, 4 and 6; 2 pigs per pen) (STARTER-COL; n=6 pigs) were fed a
dry starter diet devoid of all animal byproducts except 20% (w/w) colostrum (Calf’s Choice
Total HiCalTM, The Saskatoon Colostrum Co. Ltd., Saskatoon SK, Canada). The remaining three
pens (pens 1, 3 and 5; 2 pigs per pen) (STARTER-CTRL; n=6) were fed the same starter diet as
was used in experiment 1 (Table 7.2) without additional colostrum. Blood samples were drawn
from all pigs into EDTA tubes from the cranial vena cava 24 hours after the initial bovine
colostrum feeding and weekly thereafter. Rectal temperatures were measured daily until day 30,
and twice weekly thereafter. Half of the pigs from each group were euthanized by intravenous
barbiturate on day 42 and the remaining on day 49. Necropsy examination was performed
immediately after euthanasia.
7.2.2. Packed cell volume and plasma total protein
In both experiments, packed cell volume (PCV) was determined in the whole blood samples by
the capillary tube method and the plasma total protein concentration was determined by
refractometry.
7.2.3. Histopathological examination of tissues
Internal organs were collected at necropsy, preserved in 10% formalin and processed for
histopathological examination. Tissues examined included brain, nasal turbinate, salivary gland,
tonsil, thymus, lung, heart, bronchial lymph node, stomach (fundus and pylorus), duodenum,
jejunum, ileum, spiral colon, cecum, mesenteric lymph node, adrenal gland, kidney and
superficial inguinal lymph node.
137
7.2.4. Adjunct tests for porcine pathogens
In both experiments, the presence of pathogen-specific antibodies was examined in plasma
collected immediately prior to necropsy by ELISA using commercial kits employed according to
the manufacturer’s instructions by Prairie Diagnostic Services Inc. (PDS, Saskatoon, Canada).
The samples were tested for antibodies to swine influenza virus (SIV; Swine Influenza Virus
Antibody Test Kit H1N1 [Part number: 99-06731] and Swine Influenza Virus Antibody Test Kit
H3N2 [Part number: 99-09332], IDEXX Laboratories, Inc., Westbrook, Maine, USA) and
porcine reproductive and respiratory syndrome virus (PRRSV; PPRS X3 HerdChek, Porcine
Reproductive and Respiratory Virus Antibody Test Kit [Part number: 99-18070], IDEXX
Laboratories, Inc., Westbrook, Maine, USA Porcine parvovirus (PPV) antibody was tested by
PDS Inc. using an in-house haemagglutinating inhibition assay adapted from a previously
described protocol.20 Briefly, porcine parvovirus propagated in the laboratory from a diagnostic
isolate was used for the haemagglutinating antigen, which was incubated at a concentration of 6
HA units with two fold dilutions of serum starting with an initial dilution of
1:20. Haemagglutinating activity was assessed using chicken red blood cells. An antibody test
for porcine circovirus type 2 (PCV2) by immunoperoxidase monolayer assay (IPMA) was
performed using a previously described in-house assay.119 In both experiments, the presence of
PCV2 DNA in plasma collected at all time points, and in spleen, superficial inguinal lymph node,
and tonsil collected at termination was tested by the polymerase chain reaction (PCR).116
Additionally in experiment 2, the presence of DNA of Torque Teno virus (TTV) genogroups 1
and 2 in bone marrow was tested by PCR.92 For pigs that died or were euthanized for humane
reasons before the termination of the experiment, aerobic and anaerobic bacterial cultures were
performed on lung, spleen, and joint fluid or abdominal fluid.
138
7.2.5. Plasma bovine and porcine immunoglobulin (IgG) concentration
The concentration of bovine (b)IgG in plasma was determined by radial immunodiffusion (RID)
as previous described.26 The plasma half life of bIgG was calculated using the following formula,
T1/2=(T*log2)/log 𝐶𝑜𝑛𝐵𝐶𝑜𝑛𝐸
, where T1/2 is the half live, T is the total time period, ConB is the
beginning bIgG concentration and ConE the ending bIgG concentration. All plasma collected
in experiment 2 was also tested for porcine (p)IgG by RID as previous described.143 The plasma
pIgG concentrations between groups were not compared by statistic methods because the half of
the pigs in each group were euthanized on d42 and the remaining on d49, which substantially
reduced the statistical power (n=3).
7.2.6. Statistical analysis
Differences in frequencies of lesions between groups were compared by Fisher’s exact test.
The group difference of plasma bIgG concentration on day 1 was compared by Mann-Whitney U
test. The fever-days, defined as total number of days that individual pigs had body temperature
greater than (including) 39.5⁰C, were compared between groups by generalized linear models
using a Poisson regression using Predictive Analytics SoftWare (PASW) Statistics 18.
Probabilities of less than 0.05 were considered statistically significant.
7.3. Results
7.3.1. Experiment 1
All pigs learned to drink from the liquid feeder within 48 hours of entry. Four of six RPL pigs
and all COL pigs survived until the termination of the experiment (day 35). One RPL pig was
observed to have atresia ani on day 2 and defecated by way of a rectovaginal fistula. On day 16,
139
it developed lethargy, anorexia, fever (40.4⁰C) and was euthanized by intravenous barbiturate.
Acute fibrinous polyserositis and renal petechiation were noted grossly. Histopathological
changes were consistent with acute septicemia and E. coli was cultured from lung, spleen and
joint fluid. A second pig developed lethargy, anorexia and fever (41.4⁰C) on day 22. Gross and
histological lesions were indicative of acute septicemia and E. coli was also cultured from lung,
spleen and abdominal fluid. The E. coli isolates from both pigs were not further characterized.
The RPL pigs had significantly more fever-days than COL pigs from day 11 to day 20 (16
fever-days / 50 total pig-days in RPL versus 5/54 in COL, P = 0.009) but not from day 1 to 10 or
from day 21 to 33 (P > 0.05)(Figure 7.1). Two of 4 RPL pigs and 4 of 6 COL pigs had mild
neutrophilic infiltration in the mesenteric lymph nodes on histology, but the frequencies were not
statistically different (P > 0.05). No other pathological changes were observed pigs that survived
until the termination on day 35.
RPL pigs had marginally but significantly higher levels bovine IgG in plasma at day 1 and 7 (P =
0.0495) even though both groups were on the same diet during this time. Plasma concentrations
of bovine IgG were highest 24 h after initial colostrum intake, and decayed rapidly within the
first two weeks of life to insignificant levels (Figure 7.2). The half-life of bovine IgG in
experiment 1 was 9.2 days. PCV and plasma total protein concentrations remained within normal
range throughout experiment 1 (data not shown).
At termination, all the pigs were negative for antibodies to SIV (H1N1 and H3N2), PRRSV and
PPV. However, one COL pig was positive for PCV2 antibody at termination. PCV2 DNA was
detected in the plasma of this pig from day 21 to day 35, and in spleen and superficial inguinal
lymph node collected at necropsy. PCV2 DNA was also detected by PCR in the spleen and
140
superficial inguinal lymph node collected from one other COL pig, reared in the same pen,
although this pig remained negative for PCV2 antibody.
7.3.2. Experiment 2
All pigs learned to drink from the liquid feeder by 48 hours. All pigs in both groups survived
until the end of the experiment. The feces of all STARTER-CTRL pigs were of normal
consistency throughout the experiment. Four of six STARTER-COL pigs developed semi-liquid
diarrhea beginning day 27 (6 days post weaning) which persisted until the end of the experiment.
The diarrheic pigs, however, remained alert and healthy otherwise. On necropsy, these pigs had
dilated colons and caeca that contained unformed feces. The large intestinal mucosa was
reddened and mesocolonic vessels were congested. Histological examination of the colon and
cecum of these pigs revealed typhlocolitis with combinations of the following changes: bacterial
attachment on the mucosa, degeneration and necrosis of the epithelial cells, congestion, edema
and mixed inflammatory cell infiltration of the lamina propria. No adjunct tests were carried out
to characterize the etiology of the typhlocolitis. In addition, the pancreases of all
STARTER-COL pigs were firm and had a nodular appearance on gross examination. Pancreatic
glandular epithelial degeneration and necrosis with regeneration and fibrosis was evident
microscopically. The pancreases of the STARTER-CTRL pigs were normal macro- and
microscopically, except in one STARTER-CTRL pigs that had mild microscopic pancreatic
degeneration. Both groups had only 2 fever-days in total.
Similar to experiment 1, plasma concentrations of bovine IgG were highest 1 day after initial
colostrum intake, then decreased rapidly within the first two weeks to insignificant levels (Figure
2). The half-life of bovine IgG in experiment 2 was 5.5 days. Porcine IgG was not detectable in
141
the plasma until day 21 and gradually increased to 5 g/L on day 49 (Figure 7.2). PCV and
plasma total protein concentrations of all pigs remained within normal range at all time points
(data not shown).
All pigs were negative at termination for antibodies to SIV (H1N1 and H3N2), PRRSV, PPV and
PCV2. The absence of PCV2 infection was confirmed by PCR test in terminal plasma and tonsils.
TTV1 DNA was detected by PCR in 1/6 STARTER-COL pig and 4/6 STARTER-CTRL pigs.
TTV2 DNA was detected by PCR in 1 STARTER-CTRL pig that was also positive for TTV1.
7.4. Discussion
In the current experiments, neonatal SF-pCD pigs were successfully raised on a bovine
colostrum-based liquid diet, achieving a survival rate of 100% while remaining serologically
negative for PRRS and SIV. Moreover, all but 1 pig remained serologically negative for PCV2
and only 2 pigs had detectable PCV2 DNA detected in serum or tissues in the first of the two
experiments.
The bovine colostrum fed in the liquid diet of SF-pCD pigs is likely the main factor contributing
to the high survival rate in the current studies. It is well known that the epitheliochorial
placentation in pigs and other farm mammals prevent macromolecule transportation from dam to
fetuses. Thus, pigs are born hypogammaglobulinemic (e.g. only trace amounts of
immunoglobulin in the blood). As a result, it has been shown that neonatal pigs have a low
survival rate when neither sow colostrum nor immunological supplements derived from other
sources (e.g. bovine colostrum) were fed, in spite of intensive treatment with antibiotics.58 In
other studies employing bovine colostrum in neonatal pigs, colostrum was fed for only several
days,12,58,141 and the survival rates of the pigs were at most 80%.12,58 In the present experiments,
142
the use of commercially available spray-dried bovine colostrum powder allows more protracted
use of the colostrum and enables this SF-pCD technique to be easily adopted by other
laboratories. It is clear from our results that providing bovine colostrum to pigs after gut closure
provided health benefits up to weaning at 3 weeks of age. Although immunoglobulins cannot
be absorbed in significant quantity after gut closure and the blood half lives of bovine IgG in
these experiments are shorter than that of porcine IgG (at least 12 – 14 days),166 they and the
other antimicrobial substances present in colostrum may provide local immunity in the
gastrointestinal tract (GIT).
It is noteworthy however, that bovine colostrum fed after weaning to SF-pCD pigs was
associated with persistent diarrhea, typhlocolitis and pancreatic degeneration in experiment 2.
The mechanism behind this phenomenon was not determined in this experiment. The level of fat
in the diet supplemented with the colostrum was 8.4 % compared with 1.5 % in the diet without
the supplementation (Table 7.2). The additional colostrum powder in the diet after weaning
without consideration of the fat levels in the diet may exceed the capacity of the pancreatic
enzymes and caused maldigestion and diarrhea (likely osmotic). Irrespective of the reason, the
finding that there was no benefit to supplementation of SF-pCD pigs after weaning with bovine
colostrum substantially reduces the cost of raising these pigs.
The normal PCV of the SF-pCD pigs indicate that oral iron supplementation was sufficient to
prevent anemia. The industry-standard practice of parenteral iron dextran administration was not
used in this experiment, since there was a concern that any injection to these colostrum-deprived
pigs would increase the risk of septicemia. For the same reason, only half of the pigs were bled
in experiment 1. However, in experiment 2, when all the pigs were bled weekly, no septicemia
occurred in any pigs. Thus, injections and bleeding can be performed in SP-pCD pigs without
143
any health compromise, provided these activities are performed hygienically. Indeed, in a
subsequent SF-pCD experiment that our laboratory has undertaken iron dextran administration
was performed intramuscularly in the neck without any ill effects (data not shown).
The roles of IgY-K88, which reportedly prevented K88 (F4)-E. coli diarrhea,109 were not
characterized in this experiment. The inclusion of this component in the diet was to help avoid
potential illness due to K88-E. coli. F4 colibacillosis is a common disease of young pigs in the
commercial swine industry, and vaccination of dams prior to farrowing is routinely performed.
It is noteworthy that in experiment 2, pyrexia was rare, in contrast to experiment 1. This may be
due to a higher level of sanitation during experiment 2 as the concrete under the plastic floor was
cleaned more frequently (daily) than in experiment 1 (2 to 3 times weekly), discouraging the
accumulation of fecal micro-organisms in the environment. The benefit of high sanitation is
further emphasized by the fact that when SF-pCD pigs were raised on a concrete floor bedded
with straw 4/9 pigs developed E. coli-diarrhea and -septicemia.141 Thus, good hygiene practices
are strongly recommended for the health of SF-pCD pigs.
The results of this experiment demonstrate that it is possible to raise SF-pCD pigs that remain
free of porcine pathogens including PRRS, SIV, PPV and PCV2. The source farm in this
experiment was serologically free of PRRS virus, but positive for PCV2, SIV and PPV.
Snatch-farrowing, preventing contact with barn facilities, minimizing exposure to barn air, and
disinfection of the sows and piglets are likely all critical in preventing horizontal transmission of
these pathogens to SF-pCD pigs. While the source of PCV2 infection in two experiment 1 pigs
was not definitively identified, a retrospective evaluation of our biosecurity protocols guiding
entry into the animal care room and the timing of infection suggest the introduction of a bottle of
144
antibiotic that had been previously used in a PCV2 positive farm could be implicated. It should
be noted that, in experiment 1, all the pigs remained PCV2 negative before day 21, which
indicates that vertical transmission of PCV2 was unlikely. All pigs remained PCV2 negative in
experiment 2 after biosecurity measures were improved. Thus, it is possible, although not
guaranteed, to obtain PCV2-negative pigs from a PCV2-positive farm using the SF-pCD method
provided piglets are not infected prenatally. A recent study showed that 39.9% of the piglets in
5 North America farms were born PCV2-viremic.182 Although most of the piglets were born
from gilts in that experiment, which may be more likely to vertically infect their progeny in utero,
the putatively high rate of viremia at birth on some farms highlights that PCV2-free status is not
guaranteed. The authors recommend excluding PCV2-viremic sows to increase the probability of
obtaining PCV2-free piglets.
Similarly, the presence of TTV1 and TTV2 in some SF-pCD pigs was not unexpected since
vertical transmission of TTV had been reported.113,159 In this regard, even gnotobiotic derivation
cannot guarantee freedom of TTV infection, or that of other vertically transmitted pathogens.
The SF-pCD method has advantages over the conventional SPF method in obtaining
pathogen-free pigs, and is less technically demanding than CDCD and gnotobiotic models.
Since conventional SPF pigs have suckled their dams and remain on farm prior to their inclusion
in an experiment, there is a high risk of exposure and possibly infection with organisms
circulating on the farm. Moreover, the presence of maternally-derived antibodies against
endemic pathogens means SPF piglets cannot be used for experiments until after the decay of
passive immunity. Unlike both CDCD and gnotobiotic derivation, SF-pCD derivation requires
neither surgery nor sterile compartments. Thus, the technical requirements of this model are low
and easily adapted to any laboratory. The natural birth of SF-pCD pigs allows them to be
145
exposed to the vaginal flora, which may cause exposure and potential infection by the vaginal
microbiota and pathogens if present. The technique is also animal welfare friendly, without need
to sacrifice donor sows post-surgery.
In conclusion, this experiment established a method to raise SF-pCD pigs with high health and
survival that balances convenience, freedom of major pathogens, animal welfare, cost and
pathogen susceptibility. The SF-pCD model is a good alternative to current methods for
producing pigs for infectious disease research. The main disadvantages of raising SF-pCD pigs
are the intensive labour associated with bottle feeding piglets during the first 48 hours, the risk of
contamination by vaginal microbiota and the risk of septicemia if the environment is not
hygienic.
146
Table 7.1. Ingredients in the liquid diets fed until weaning to snatch-farrowed, porcine-colostrum-deprived pigs
in experiments 1 and 2
Ingredienta
Experiment 1 Experiment 2
Days 1 to 3 Days 4 to 10 Days 11 to 15 Days 16 to 23 Days 1 to 3 Days 4 to 21
RPL COL RPL COL RPL COL RPL COL
Colostrum A
(%, w/v) 20 20 0 0 0 0 0 0 20 0
Colostrum B
(%, w/v) 0 0 15 15 Reduce to 5 15 5 15 0 15
Milk replacer
(%, w/v) 0 0 0 0 Increase to 13 0 13 0 0 0
Iron (mg/kg milk solids) 250 250 250 250 250 250 250 250 250 250
IgY K88
(g/pig/d) 2 2 2 2 2 2 2 2 2 2
Warm water
(L/pig/d) 0.3–0.53 0.67–1.67 1.84–2.5 2.67–3.33 0.3–0.53 0.67–3.33
a Colostrum A — HeadSTART, The Saskatoon Colostrum Company, Saskatoon, Saskatchewan; Colostrum B — Calf’s Choice Total HiCal, The Saskatoon Colostrum Company;
milk replacer — WetNurse, Prairie Micro-Tech, Regina, Saskatchewan; iron — Enfamil Fer-In-Sol syrup (30 mg of elemental iron per 5 mL), Mead Johnson & Company, Ottawa,
Ontario; IgY K88 — Hyper-Egg K88; J.H. Hare & Associates, Winnipeg, Manitoba.
RPL — Replacement: dietary colostrum was gradually replaced with milk replacer from day 11 until 5% colostrum remained in the diet; COL — Colostrum: the diet consisted
mainly of bovine colostrum until day 20.
147
Table 7.2. Ingredients and nutrient levels in the dry starter diet fed to the pigs after
weaning
Ingredients
Experiment 1 Experiment 2
(%) STARTER-COL (%)
STARTER-CTRL
(%)
Wheat 30.90 44.80 30.90
Colostrum B 0 20.00 0
White fish meal 8.61 0 8.61
Oat groat 15.00 15.00 15.00
Whey permeate 20.00 11.40 20.00
Soybean meal 15.00 3.60 15.00
NuProa 5.00 0 5.00
Canola oil 3.00 2.00 3.00
Limestone 0.43 0.90 0.43
Salt 0.44 0.63 0.44
Monocalcium phosphate 0 0.63 0
Zinc oxide 0.40 0.40 0.40
Lysine 0.47 0.36 0.47
Starter microbial phytase 0.20 0.20 0.20
Choline chloride 0.08 0.08 0.08
Methionine 0.25 0.03 0.25
Threonine 0.20 0 0.20
L-tryptophan 0.03 0 0.03
Nutrientsb
Crude protein 21.7 21.5 21.7
Crude fat 1.5 8.4 1.5
Crude fibre 5.6 1.6 5.6
Digestible energy
(Mcal/kg) 3.69 3.76 3.69
Net energy (Mcal/kg) 2.62 2.76 2.62
148
Ingredients
Experiment 1 Experiment 2
(%) STARTER-COL (%)
STARTER-CTRL
(%)
Calcium 0.9 0.9 0.9
Available phosphorus 0.8 0.7 0.8
Sodium 0.47 0.45 0.47
Total lysine 1.58 1.64 1.58
Total threonine:lysine 0.64 0.77 0.64
Total
methionine+cystine:lysine 0.58 0.61 0.58
Total tryptophan:lysine 0.17 0.20 0.17 a Alltech Canada, Guelph, ON b As-fed basis; estimated 90% dry matter.
STARTER-COL — Diet devoid of all animal by-products except 20% (w/v) colostrum B;
STARTER-CTRL — Same starter diet as used in experiment 1.
149
Figure 7.1. Body temperatures of snatch-farrowed, porcine-colostrum-deprived (SF-pCD) pigs in
experiment 1. Between days 11 and 20 of life the pigs fed bovine colostrum as the main
component of their diet (left panel) had significantly fewer days of fever (P = 0.009) than the
pigs for which the colostrum was gradually replaced with milk replacer from day 11 (right panel)
before weaning to a dry feed.
150
Figure 7.2. Plasma concentrations of bovine and porcine immunoglobulin G (bIgG and pIgG) in
the SF-pCD pigs in experiments 1 and 2. Squares indicate mean values for experiment 1.
Triangles indicate mean values for bIgG and diamonds mean values for pIgG in experiment 2.
The vertical lines represent standard deviations.
151
8. Snatch-farrowed porcine-colostrum-deprived (SF-pCD) pigs possess similar cellular and
humoral immune responses to Mycoplasma hyopneumoniae vaccination compared to their
farm-raised siblings
Chapter 7 successfully established a reliable protocol to raise SF-pCD pigs. Since these pigs are
porcine-colostrum-deprived, they are free of antibodies to porcine pathogens, and thus, should
be susceptible to inoculation with these agents. If it can be further shown that SF-pCD pigs grow
and have the same level of immunity as siblings raised on farm, it will support that SF-pCD pigs
are suitable for use as in pathogen inoculation studies. The experiments in Chapter 8 were
designed to address this rationale.
This Chapter has been prepared for publication. The copyright of this Chapter will belong to the
journal in which it is published.
Huang, Y., D.M. Haines, and J. Harding. Snatch-farrowed porcine-colostrum-deprived (SF-pCD)
pigs possess similar cellular and humoral immune responses to Mycoplasma hyopneumoniae
vaccination compared to their farm-raised siblings. Journal to be determined, 2013. Manuscript
in preparation.
152
8.1. Introduction
A reliable animal model is critical to the success of research that attempts to reproduce infectious
disease in experimental settings. In pigs, there are currently three types of models frequently
used in such studies: the conventional specific pathogen free (SPF) model, the cesarean-derived
colostrum-deprived (CDCD) model, and the gnotobiotic model. However, conventional SPF pigs
are not suitable for studies of diseases caused by highly prevalent pathogens, since one needs to
test large numbers of pigs to identify adequate numbers of SPF pigs, and the presence of
maternal antibodies precludes challenge of young pigs with pathogens. Both CDCD and
gnotobiotic models require surgery to deliver piglets and sterile compartments to raise them. In
the case of gnotobiotic pigs, they are raised entirely in sterile compartments. Thus, the duration
of experiments is limited because pigs may outgrow the space of the compartments. It was in this
context that we optimized a previously published snatch-farrowed porcine colostrum-deprived
(SF-pCD) pig model12,141 to achieve 100% survival and provided an alternative model for
infectious disease research in pigs.77 SF-pCD pigs were raised on a bovine-colostrum-based
liquid diet before weaning, and a post-weaning diet that was free of porcine byproduct.77
Knowledge about the immunity of pigs raised for experimental use is limited. It has been
demonstrated that gnotobiotic pigs not colonized by any bacteria failed to produce serum IgG
and IgM to T cell dependent and type-2 T cell independent antigens, but those colonized even by
one single strain of Escherichia coli did.18 This showed that gnotobiotic pigs differ from
conventional pigs immunologically. This raises questions regarding the extent to which
knowledge generated through the use of gnotobiotic pigs is applicable to field situations.
Similarly, it is also unknown whether SF-pCD pigs are representative of conventional,
farm-raised pigs in terms of their immunological responses. The objective of the current
153
experiment was to compare the growth performance, and cellular and humeral immune responses
to Mycoplasma hyopneumoniae (Mhyo) vaccination between SF-pCD pigs and their farm-raised
siblings.
8.2. Methods
8.2.1. Animal procedures
Twenty five neonatal pigs were hygienically snatch-farrowed from four sows at the Prairie Swine
Center (PSC) Inc. as previously described.77 PSC Inc. is historically negative for Mhyo and pigs
were not vaccinated against this agent. As soon as all pigs were collected, twelve pigs (SF-pCD)
were transferred to the Animal Care Unit (ACU) at the Western College of Veterinary Medicine
(WCVM), University of Saskatchewan and raised according to a previously developed protocol
in which commercial bovine colostrum was used as the main diet before weaning.77 Thirteen
siblings, blocked by dam, sex and subjective birth sizes remained on-farm to be raised by their
biological sows (FARM). Piglets not involved in this study were fostered on to the experimental
dams as required so that the litter sizes were 10-12 at farrowing. On day (D)2, 200 mg
parenteral iron dextran (Ferroforte, Bimeda-MTC Animal Health Inc., Cambridge ON) were
given to each pig. On D20, all pigs were weaned and fed a dry starter diet free of porcine
byproducts until termination of the study on D44. The SF-pCD pigs were raised in groups of two
throughout the study in 1.23 m x 1.85 m pens equipped with one liquid feeder per pen. The
FARM pigs were weaned into two 2.5 m x 1.04 m nursery pens in groups of 6 and 7. All pigs
were weighed on D1 (day of birth was recorded as D0) and then twice weekly before weaning,
and once weekly after weaning.
On D7, pigs were injected intramuscularly with 2 ml of Mhyo bacterin (RespiSure, Zoetis
154
Animal Health, Inc. Kirkland, QC, Canada). On D26, a booster vaccination was administrated in
the same manner. Blood samples were taken from the cranial vena cava on D1 and then weekly
after (D7, 13, 20, 26, 33 and 40). The main events in this experiment are shown in Figure 8.1.
This work was approved by the University of Saskatchewan’s Animal Research Ethics Board and
adhered to the Canadian Council on Animal Care guidelines for humane animal use.
8.2.2. IFN- γ ELISPOT assay
Peripheral blood mononuclear cells (PBMC) were isolated from D26 and D40 blood samples.
Whole blood was collected in a sodium-heparin blood collection tube, diluted 1:1 with PBS
(pH=7.4) and was overlaid on to Ficoll-paque Plus (GE Healthcare Bio-Sciences Corp.
Piscataway, NJ, USA). PBMC were then separated by differential centrifugation at 400 × g at
20°C for 30 minutes. After hypotonic lysis of red blood cells, the PBMC were washed once in
PBS and once in culture medium (Gibco® RPMI Media 1640, Life Technologies Inc.,
Burlington, ON, Canada) with 10% (v/v) fetal bovine serum and 1% (w/v)
penicillin-streptomycin. Cells were stained with Trypan blue and counted on a hemocytometer.
MultiScreenHTS filter plates (EMD Millipore Corporation, Billerica, MA, USA) were coated with
10 µg/ml mouse anti-porcine INF-γ monoclonal antibodies (Mabtech Inc. Mariemont, OH, USA)
and incubated overnight at 4°C. Subsequently, plates were washed 3 times with PBS and blocked
with RPMI media containing 10% fetal bovine serum and 1% penicillin-streptomycin at 37°C for
1 hour. PBMC (8 × 105) cells were then dispensed into each well and incubated with 10 µg/ml
Mhyo antigen (courtesy of M. Raymond, Iowa State University), 5 µg/ml ConA or media alone
for 40 hours at 37°C in the presence of 5% CO2. Each sample was assayed in triplicate. Cells
were removed and the plates washed twice with distilled water and 3 times with PBS with 0.01%
155
Tween 20 (PBST) before being incubated with 1 µg/ml biotinylated mouse anti-bovine IFN-γ
mAb (Mabtech Inc. Mariemont, OH, USA) for 1 hour at room temperature. The plates were
washed 4 times with PBST and incubated with 0.5 ng/ml streptavidin alkaline solution (Jackson
ImmunoResearch Laboratires Inc. West Grove, PA, USA) in PBST with 1% bovine serum
albumin (BSA) at room temperature for 45 minutes. The plates were then washed 3 times with
PBST and twice with PBS. Spots were developed by adding SIGMAFAST™ BCIP®/NBT
(Sigma-Aldrich Corporation, St. Louis, MO, USA) to each well according to the manufacturer's
instructions. The number of spots each in each well were counted by AID Elispot Reader
ELRIFL07 (Autoimmun Diagnostika GMBH, Strasbourg, Germany). Numbers of
Mhyo-stimulated IFN- γ-secreting cells were calculated by subtracting the numbers of spots in
media wells from those in Mhyo wells and expressed as numbers of IFN- γ-secreting cells per
million PBMC.
8.2.3. Serum Mhyo antibody ELISA
Serum Mhyo antibody titers were determined using the IDEXX Mhyo Ab ELISA Test kit
(IDEXX Laboratories, Inc., ME, USA) according to manufacturer’s instructions. Testing was
conducted at Biovet Inc. (Saint-Hyacinthe, QC, Canada). Briefly, a strong positive swine control
serum was serially diluted in phosphate buffered saline (PBS) from 1:40 (working dilution) to
1:5,120 and tested using the IDEXX Mhyo Ab ELISA. By convention it was attributed a titer of
2,560 corresponding to its final ELISA positive dilution (sample to positive ratio (S/P) = 0.4).
The serum samples were tested at a dilution 1:40 along with the positive control serum dilutions.
The S/P ratios of the positive control serum dilutions were plotted against their theoretical
antibody titers using curve-fitting software for ELISA analysis (MasterPlex® ReaderFit, Hitachi
Solutions America Ltd, CA, USA). The S/P ratios of the samples were plotted the same way and
156
their titers were automatically generated by the MasterPlex® ReaderFit software.
8.2.4. Serum porcine and bovine IgG concentration
Serum bovine IgG concentrations were determined by radial immunodiffusion (RID) as
previously described.77 The porcine IgG RID assay was adopted from the bovine assay with a
few changes: the antibody used was 3.0% goat anti-swine IgG (H+L) antibody (Jackson
ImmunoResearch Laboratories Inc., West Grove, PA, USA), and the standard was purified swine
IgG (Bethyl Laboratories Inc., Montgomery, TX, USA). Half life of bovine IgG in SF-pCD pigs
was calculated as described previously.77
8.2.5. Statistical analyses
Body weights (D1, D20 and D40), Average daily gain (ADG) (overall, pre- and post-weaning),
numbers of PBMC secreting IFN-γ (D26 and D40), serum Mhyo IgG levels (D40) and serum
porcine IgG concentration (D40) were compared between groups using Generalized Estimation
Equations (GEE) accounting for clustering of litters. All models used an exchangeable
correlation matrix with a robust variance estimator. Normality and homogeneity of the residues
were evaluated. All the analyses were performed by IBM SPSS Statistics version 21. P value less
than 0.05 were considered statistically significant.
8.3. Results
Results of analysis of weight and ADG are summarized in Table 8.1. Body weights of SF-pCD
and FARM pigs did not differ on D1 or at weaning on D20 (P>0.05). Similarly, pre-weaning
ADG did not differ between groups (P>0.05). However, after weaning SF-pCD pigs exhibited
superior ADG (P<0.0001) and their final body weight was significantly higher than FARM pigs
157
(P<0.0001). As a result, the overall ADG of SF-pCD pigs was significantly higher than FARM
pigs (P<0.0001).
On D26, 19 days after the initial vaccination, the number of IFNg secreting PBMC trended
higher in SF-pCD pigs compared to FARM pigs. On D40, 33 days after the initial and 14 days
after the booster vaccination, SF-pCD pigs demonstrated significantly greater response than
FARM pigs (Table 8.2). Similarly, SF-pCD pigs had significantly higher Mhyo serum IgG
antibody levels than FARM pigs on D40 (Table 8.3).
RID assays confirmed the absence of detectable bovine IgG in FARM pigs and minimal
(0.3±0.04 mg/ml) porcine IgG in SF-pCD pigs in D1 sera (Figure 8.1). High concentrations of
bovine IgG were present in D1 sera of SF-pCD pigs and decayed rapidly over time, with a
calculated half-life of 6 days. Similarly, porcine IgG was present in abundance (35.7±7.5 mg/ml)
in D1 sera of FARM pigs and decayed over time but remained above 4 mg/ml for the duration of
the study. Porcine IgG in SF-pCD pigs began to rise at D13 and gradually increased to
approximately 3 mg/ml on D40 (Figure 8.1). The D40 serum porcine IgG concentration of
FARM pigs was significantly higher than that of SF-pCD pigs (Table 8.3).
8.4. Discussion
This study yielded some unexpected results. The fact that the pre-weaning growth performance
of SF-pCD pigs did not differ to that of FARM pigs is noteworthy (Table 8.1). SF-pCD pigs were
bottle-fed for a short period (usually less than 48 hours) before they learned to drink from a
liquid feeder from which they were fed four times per day. This frequency is drastically different
than conventionally reared pigs which typically suckle more than 20 times per day.160
Accordingly, it was a concern whether SF-pCD pigs would be capable of achieving growth rates
158
consistent with pigs raised on commercial farms. However, the results described here
demonstrate that this goal is achievable using the established management protocol of SF-pCD
pigs.77 Further, the ADG of SF-pCD pigs surpassed that of FARM pigs after weaning, which is
likely because SF-pCD pigs had less competition for food than their on-farm siblings (SF-pCD
pigs: 2 pigs per pen with one feeder in each pen; FARM pigs: 6 or 7 per pen with one feeder in
each pen).
The reason that cellular and humoral immune responses to Mhyo vaccination were quantitatively
higher in SF-pCD pigs than FARM pigs in this experiment is not fully understood, however,
differences in the intestinal microbiota of the groups is a possible contributor. It is reasonable to
speculate that the intestinal microbial community structures between the two groups in this
experiment are substantially different due to the different environments and pre-weaning diets.
There is evidence in human medicine indicating that the neonatal intestinal microbial community
regulates systemic immunity.11 Further, pigs raised in environments with different hygiene levels
and with different intestinal microbial compositions were shown to exhibit different mucosal
immunity characteristics.81 It is not clear whether these factors may have affected the systemic
immune responses of pigs used in this experiment. Results of this experiment however, suggest
that environmental factors affect the systemic immune response. Whether or not this is due to
differences in the intestinal microbiota is of interest but beyond the scope of the current study.
Another possible explanation for the stronger immune responses in SF-pCD pigs is that FARM
pigs experienced higher postweaning stress. It is well known that pigs experience considerable
stress shortly after weaning, demonstrated by a delay of weight gain and an increase in serum
cortisol concentration.54 Increased serum cortisol is considered to be immunosuppressive. It is
reasonable to speculate that SF-pCD pigs in this experiment experienced less postweaning stress
159
because pen density and feeding competition was lower than experienced by FARM pigs.
Although this may potentially explain the stronger immune responses observed in this study, it
should be noted that the increased cortisol levels in postweaning farm pigs are reported to return
to normal within 6 days,54 and the timing of vaccinations in this experiment (D7 and D26 of age),
were beyond this postweaning stress period. Thus, if postweaning stress contributed significantly
to the findings in the current study, the period of postweaning stress is likely to have extended
beyond 6 days postweaning in the FARM pigs.
Differences in the composition of the suckling (milk) diets may have also contributed to the
observed differences in the immune response between SF-pCD and FARM pigs. SF-pCD pigs
were mainly fed bovine colostrum while FARM pigs suckled sow colostrum and milk before
weaning. A large number of bioactive substances had been identified in bovine colostrum, such
as immunoglobulin, insulin-like growth factor (IGF)-I and –II, epidermal growth factor (EGF),
and lactoferrin among others.15 Both bovine and porcine colostrum are rich in immunoglobulin.
However, the mature bovine and porcine milk contains a much lower concentration of
immunoglobulin.16,56 Thus, it is clear that SF-pCD pigs, when consuming bovine colostrum
throughout the entire preweaning phase receive quantitatively more immunoglobulin than FARM
pigs. Similarly, bovine and porcine colostrum contain similar levels of IGF-I, but the mature
milks have about 10-fold less. Thus, SF-pCD pigs should also have received more IGF-I
throughout the suckling phase. Thus, greater consumption of immunoglobulin and IGF-I may
have contributed to the higher immune response of SF-pCD pigs to the Mhyo vaccine relative to
FARM pigs.
The differences in immune responses observed in this study need not discourage the use SF-pCD
for research purposes. Although the intestinal microbial community composition of SF-pCD pigs
160
is likely different than that of FARM pigs, the fact that SF-pCD pigs are colonized by bacteria is
probably more important. It has been demonstrated that gnotobiotic pigs which are not colonized
by any bacteria, do respond to certain antigens, and thus have impaired immune function.18 In
light of this phenomenon, SF-pCD pigs should process similar immunity to conventional pigs in
a qualitative sense. It is also unknown whether the magnitude of the difference in immune
response observed between groups in this study is biologically relevant, i.e. that one group would
be more or less susceptible to Mhyo challenge. Interestingly, it has been reported that increased
serum Mhyo antibody titers but decreased IFN-γ production by PBMC were associated with
superior protection against Mhyo challenge. (SF-pCD pigs had higher IFN-γ response and
antibody titers).185
In conclusion, SF-pCD pigs had superior growth performance and higher cellular and humoral
immune responses to Mhyo vaccination compared to their siblings reared commercially using
industry standard procedures. The fact that SF-pCD pigs possess qualitatively similar immune
response as FARM pigs suggests that SF-pCD pigs have immune functions that resemble those
of conventional pigs, and are thus suitable for swine infectious disease research.
161
Figure 8.1. Experimental design. The times (days of age) of major events the experiment are
noted in this figure.
162
Figure 8.2. Mean serum porcine and bovine IgG concentrations in SF-pCD (n=12) and FARM
pigs (n=14). The vertical bars represent standard deviations.
163
Table 8.1. Body weights and average daily gains of SF-pCD and FARM pigs
SF-pCD (n=12) (kg) FARM (n=13) (kg) P value
Mean SD Mean SD
Body weights
D1 1.45 0.28 1.39 0.19 ns
D20 6.58 0.70 6.71 0.88 ns
D40 17.14 1.57 12.45 1.77 <0.0001
Average daily
gains
Pre-weaning* 0.27 0.03 0.28 0.05 >0.05
Post-weaning* 0.53 0.05 0.29 0.08 <0.0001
Overall 0.40 0.04 0.28 0.04 <0.0001
All pigs were weaned 20 days of age.
164
Table 8.2. Numbers of IFN-γ-secreting PBMC in response to Mycoplasma hyopneumoniae
antigen stimulation in SF-pCD and FARM pigs
SF-pCD (n=11)
(#/106 cells)
FARM (n=12)
(#/106 cells) P value
Mean SD Mean SD
D26 578.98 205.70 314.30 275.03 0.07
D40 684.69 360.13 312.23 255.64 <0.0001
165
Table 8.3. Day 40 serum Mycoplasma hyopneumoniae titers and porcine IgG concentration in
SF-pCD and FARM pigs
SF-pCD (n=12) FARM (n=13) P value
Mean SD Mean SD
M.hyo titers 447.9 208.3 336.8 290.5 0.03
Porcine IgG
(mg/ml) 2.9 1.2 4.6 0.8 0.05
166
9. Attempted experimental reproduction of porcine periweaning-failure-to-thrive syndrome
using tissue homogenates
The results from Chapter 7 and 8 showed that SF-pCD is a suitable model for swine infectious
disease research. Finally, in Chapter 9, an attempt was made to reproduce PFTS in SF-pCD pigs
by inoculation of tissue homogenates from PFTS pigs. This experiment is important for the final
conclusion as to whether PFTS is an infectious disease.
This Chapter has been submitted for publication. The copyright of this Chapter will belong to the
journal in which it is published.
Huang, Y and J. Harding. Attempted experimental reproduction of porcine
periweaning-failure-to-thrive syndrome using tissue homogenates. PLOS ONE, 2013. Submitted,
under revision.
Huang, with Harding’s assistance, designed and performed the experiment, analyzed the data and
contributed to manuscript writing.
167
9.1. Introduction
Porcine periweaning failure-to-thrive syndrome (PFTS) is typified by newly weaned pigs,
apparently healthy at weaning and without residual sickness from the suckling phase, that
develop anorexia, lethargy and progressive debilitation within a week after weaning. The crude
flow prevalence of PFTS in North America was recently estimated to be approximately 4%.138 A
portion of affected pigs show repetitive oral behaviour such as chomping and licking, which is
regarded as an important characteristic of PFTS.79 The most frequent lesions of diagnostic
relevance are superficial gastritis, small intestinal villous atrophy and thymic atrophy, all of
which are observed with higher odds in PFTS-affected versus non-affected animals76 (and
Chapter 5). The etiology of PFTS is unknown. To date, common porcine pathogens, specifically
type 2 porcine circovirus (PCV2), porcine reproductive and respiratory syndrome virus (PRRSV),
influenza A virus, transmissible gastroenteritis virus (TGEV) and Mycoplasma hyopneumoniae
have been shown conclusively not to be associated with PFTS76,154 (and Chapter 5), whereas
haemagglutinating encephalomyelitis virus (HEV), porcine enterovirus CPE groups 1, 2 and 3,
rotavirus groups A, B and C, porcine enteric calicivirus (PECV), porcine cytomegalovirus
(PCMV) and coccidia (likely Cystoisospora suis) may be detected in PFTS pigs but detection is
not consistent across cases, and the presence is not associated with clinical status76,154 (and
Chapter 5).
A critical step in testing the hypothesis that PFTS is an infectious disease is to determine if it can
be transmitted to susceptible animals from affected animals. The ability to conduct these
experiments is dependent upon having a reliable animal model based on experimental pigs that
are immunologically naïve to the presumptive infectious agent(s). Commonly used models for
studying swine diseases include the specific pathogen free (SPF), caesarean-derived
168
colostrum-deprived (CDCD) and gnotobiotic models. Each model has advantages and limitations
which have been previously reviewed.77 We have previously developed a snatch-farrowed,
porcine colostrum-deprived (SF-pCD) pig model for infectious disease research.77 SF-pCD pigs
experience the advantages of natural birth, are raised on bovine colostrum until weaning at 20
days, can be inoculated during the suckling phase and are raised in conventional biocontainment
level 2 (BCL2) facilities. Further, SF-pCD pigs are able to mount immune responses similar to
conventional pigs but are free of maternally derived antibodies to diseases endemic to the source
farm (Chapter 8).
The objective of this study was to determine if the clinical signs of PFTS, specifically repetitive
oral behaviour and progressive loss of weight and body condition, could be reproduced by
inoculating SF-pCD pigs with tissue homogenates derived from pooled organs of PFTS-affected
pigs.
9.2. Materials and Methods
9.2.1. Ethics statement
This work was approved by the University of Saskatchewan’s Animal Research Ethics Board and
adhered to the Canadian Council on Animal Care guidelines for humane animal use (permit
#20110059).
9.2.2 Experimental design
Twelve SF-pCD pigs were born at the Prairie Swine Centre Inc. (Saskatoon, SK, Canada), and
raised at the animal care unit (ACU) at the University of Saskatchewan (Saskatoon, SK, Canada)
as described previously.77 Briefly, the pigs were snatched-farrowed, disinfected and placed in
169
HEPA-filtered containers without contacting any farm equipment. Upon arrival at the ACU (day
(D)0), pigs were bottle fed for 1-2 days, then transitioned as soon as possible to self-feeders until
weaning at D21. For the first 21 days, a liquid diet consisting mainly of bovine colostrum was
fed. At D21, all pigs were weaned on to an appropriately formulated dry starter diet free of all
swine by-products including spray-dried porcine plasma.
On D14, piglets were conveniently allocated to two inoculated (INOC1, n=4; INOC2, n=4) and
two control (CTRL1, n=2; CTRL2, n=2) groups. The control groups were relocated to a separate
isolation room and appropriate biosecurity measures implemented to prevent cross contamination
between rooms. A 20% w/v tissue homogenate consisting of equal amounts of tonsil, brain, lung,
spleen, stomach, small and large intestines collected from 3 PFTS-affected pigs76 was prepared
in minimum essential media (MEM, Life technologies Inc. Burlington, ON, Canada). The tissues
had been stored for 8 months at -80°C and thawed immediately before preparation of the
homogenate. The homogenate was prepared fresh on each day of inoculation. On D14, INOC1
received 20 ml of the tissue homogenate orally via a gastric tube, while INOC2 received the
same dose of homogenate orally as well as 2 ml of 0.2 µm-filtered homogenate both
intramuscularly (IM) and intraperitoneally (IP) (Table 9.1). CTRL1 received 20 ml MEM orally.
CTRL2 received 20ml MEM orally, 2ml MEM IM and 2ml MEM IP. On D21, the IM and IP
inoculations were re-administered to all pigs.
To determine the pathogens present in the inocula, a sample of the filtered homogenate was
cultured on blood agar aerobically at 37°C overnight. The filtered and non-filtered homogenates
were tested for PCV255, PRRSV (Tetracore EZ-PRRSV™ Kit; Rockville, MD, USA), influenza
A virus,184 group A rotavirus (Chapter 5), HEV,179 TGE,201 PEV 1, 2, and 3,210 PCMV,63
PECV,203 Helicobacter-pylori-like organism and Helicobacter-heilmannii-like organism28 and M.
170
hyopneumoniae114 by PCR.
All piglets were monitored twice daily for any clinical signs including repetitive oral behaviour
and weight loss. Rectal temperature and body weights were measured daily until D37 of age.
Pre-inoculation sera were tested by PCR as previously described116 to confirm the absence of
PCV2 viremia. Pre-inoculation PRRSV testing was not undertaken since the barn of origin was
known to be negative.
Piglets were euthanized and necropsied when clinical signs progressed to the point where animal
welfare was compromised. Routine aerobic and anaerobic bacterial cultures were performed by
Prairie Diagnostic Services (PDS) Inc. (Saskatoon, SK, Canada) on appropriate samples from
pigs that developed progressive dyspnea, fever, anorexia and lethargy. All remaining pigs,
including controls, were euthanized on D49 (35 days after the first inoculation, 28 days after the
second inoculation). For all pigs, a necropsy was performed and multiple tissues collected for
routine histological examination.
9.2.3 Statistical analyses
Body weights were compared on D14 (day of first inoculation), D29 (15 days after first and 8
days after second inoculation) and D49 (termination) using Mann Whitney’s U test. Linear
regression models were used to compare average daily gain (ADG) from D14 to 29 (ADG
14-29), ADG 30-49 and ADG 14-49, while accounting for body weight at the start of the period.
All final models were checked for linearity, normality and homoscedasticity of residuals. Pigs
euthanized prior to D49 (n=3) were excluded from the weight and ADG analyses. Fever-days
(total days of a pig with rectal temperature ≥40°C) and diarrhea-days (total days of a pig having
diarrhea) from D14 to 29 of age were compared between groups by Mann Whitney’s U test.
171
Since there were no obvious differences in the frequency of fever and diarrhea, or in body
weights between INOC1 and INOC2, CTRL1 and CTRL2, the two INOC groups and two CTRL
groups were combined for statistical analyses. Further, because no significant clinical signs were
observed after D29, the statistical analyses for fever and diarrhea were only performed on data
from D14 to D29. All statistical analyses were performed using IBM SPSS Statistics version 21
(Armonk, NY, USA). P values less than 0.05 were regarded as statistically significant and values
between 0.5 and 0.1 were considered indicative of a trend.
9.3 Results
The filtered and non-filtered homogenates tested negative for PCV2, TGE, influenza A virus,
PRRSV, group A rotavirus, PECV, M. hyopneumoniae and Helicobacter-pylori-like organism,
while positive for PCMV, PEV CPE groups 1, 2 and 3. Helicobacter-heilmannii-like organism
was detected in the non-filtered but not the filtered homogenate. There was no bacterial growth
from the filtered homogenate under aerobic conditions on blood agar.
All pigs grew at acceptable rates and appeared in good body condition before the first
inoculation at D14. One pig in INOC1 (oral only) and two pigs in INOC2 (oral+IM+IP)
developed progressive dyspnea, fever, anorexia and lethargy after the first inoculation and were
humanely euthanized before the second inoculation. The first evidence of illness was observed
on D15, D15 and D17 respectively in these three pigs, which were euthanized on D18, D16 and
D20 respectively. Postmortem and histological examination revealed bronchopneumonia (2/3),
pericarditis (3/3), pleuritis (3/3), and peritonitis (2/3) associated with mixed infections of lung,
spleen and synovium with E. coli, Streptococcus suis, Fusobacterium spp. and Staphylococcus
spp.. Two additional INOC1 and two INOC2 pigs developed transient fever of 1 to 2 days
duration between the first and second inoculation but remained otherwise healthy. One pig in
172
each CTRL group developed fever for one day each, on D23 and D20 respectively, but also
remained otherwise healthy. When all pigs, including those euthanized, were included in the
analysis, the numbers of fever-days were not significantly different between INOC and CTRL
(Table 9.2) during the 2 weeks period following the first inoculation. No INOC pigs developed
illness or fever after the second inoculation.
Between D14 and D29, transient diarrhea characterized by small to moderate amounts of watery
feces for 1 to 2 days developed in all but one INOC pig. Diarrhea was also observed in 3/4
CTRL pigs during this period. The numbers of diarrhea-days were not significantly different
between INOC and CTRL (Table 9.2) during the 2 weeks period following the first inoculation.
No diarrhea was noted following the second inoculation.
Body weights of surviving animals did not differ between groups on D14, D29 or D49 (Table
9.3). The ADG 14-29 of surviving pigs trended higher in CTRL than INOC, and ADG 29-49 was
significantly higher in INOC than CTRL (Table 9.3). Body weight at D29 was positively related
with ADG 29-49 (P=0.001, beta=0.044 kg/d). ADG14_49 did not differ between groups (Table
9.3).
All pigs regardless of treatment showed repetitive chomping and licking behaviour typical of
PFTS after weaning. This oral behaviour was noted for a brief period of time from 24 to 48 hours
after weaning from liquid diet on D21, and before the pigs learned to eat dry starter diet from the
feeder. The behaviour ceased abruptly as soon as solid feed was consumed.
9.4 Discussion
The current study represents the first attempt to experimentally reproduce PFTS using tissue
homogenates from PFTS-affected pigs and the SF-pCD model. Although chomping was
173
observed in both groups, it is clear that the current approach failed to reproduce the progressive
loss of weight and body condition within 2 weeks of weaning that is characteristic of the
syndrome. Nevertheless, the results of this study provide important and novel insights.
The inoculation strategy of this experiment aimed to maximize the likelihood of reproducing
PFTS. Firstly, two inoculations were performed: one week before and on the day of weaning.
Though typical clinical signs of PFTS are by definition observed shortly after weaning, it is
possible that if caused by infective agent(s), the initial exposure occurs during the suckling phase.
For this reason, the first inoculation was performed before weaning. The second inoculation was
on the weaning day, when pigs experience stresses associated with a change of diet and a
reduction in oral immunoglobulin consumption. Secondly, the combination of different
inoculation routes mimicked both gastrointestinal and systemic exposure. Although the most
frequently observed lesions of PFTS suggest the gastrointestinal tract to be a primary organ
associated with the pathogenesis (Chapters 4 and 5), it is also possible that a systemic infection
causes anorexia that induces secondary lesions of lymphocytic gastritis and small intestinal villus
atrophy. The application of oral, IM and IP inoculation was an attempt to reproduce all these
possible paths to the pathogenesis of the disease. Thirdly, the combination of multiple tissues in
the homogenate accounted for the possibility that infectious agent associated with the etiology of
PFTS might reside in non-gastrointestinal tissues such as brain, lung and spleen. However, using
multiple tissues in the inocula increased the risk of diluting a presumptive infectious agent if that
agent was localized in some but not other tissues. With these uncertainties in mind, our
inoculation strategy for this first attempt was designed to ensure early and broad exposure.
Following the first inoculation it was clear that oral inoculation of non-filtered homogenate
caused bacterial septicemia, which is not a feature of PFTS. It was for this reason that the second
174
inoculation used only filtered inoculum.
The failure to reproduce progressive loss of weight and body condition characteristic of PFTS in
this experiment suggests the etiology of PFTS may not be infectious, although a definite
conclusion cannot be made based on a single experiment. Although unlikely, it is also possible
that the causative agent of PFTS (if any) in the inoculum was not in sufficient concentration to
cause clinical sickness. Further, the non-filtered tissue homogenate was only inoculated into the
pigs once, since after the first oral inoculation of non-filtered tissue homogenate, some pigs
developed septicemia and the others not affected by septicemia failed to develop progressive loss
of weight and body condition. However, this approach potentially weakened the possibility of
demonstrating a bacterial etiology.
It was clear that the clinical signs in the three INOC pigs euthanized following first inoculation
were associated with septicemia of mixed bacterial origin, demonstrating that the SF-pCD pigs
were susceptible to “opportunistic” bacterial pathogens. The polyserositis however, observed in
these three 3 INOC pigs was not consistent with PFTS (polyserositis is not a primary lesion of
PFTS).
A number of other potential pig pathogens were retrospectively identified in the inoculum
including PCMV, PEV and Helicobacter-heilmannii-like organism. In spite of this, no
histological findings consistent with Helicobacter-heilmannii-like organism (also known as
Candidatus Helicobacter suis),68 PEV210 or PCMV were observed indicating these potential
pathogens failed to induce characteristic lesions or disease in this experimental model. In
agreement with other studies76 (and Chapter 5), these data provide additional evidence that these
organisms are not the cause of PFTS.
175
Most INOC pigs developed diarrhea and fever between D14 and D29. However, diarrhea and
fever was also observed in some CTRL pigs that remained otherwise healthy, and the
diarrhea-days and fever-days were not significantly different between INOC and CTRL pigs
(Table 9.2). In our experience, pre-weaning diarrhea is frequently observed in SF-pCD pigs and
although the mechanism is not fully understood, the diarrhea resolves soon after weaning. The
diarrhea in CTRL therefore was not unexpected, and the diarrhea observed in the INOC pigs may
be a combination of “physiological”, nutritional and pathological diarrhea.
An interesting finding in this experiment was that repetitive oral behaviour (chewing and
chomping) was observed in all pigs (INOC and CTRL) shortly after weaning and before the pigs
ate solid feed. Although the presence of excessive, repetitive oral behaviour is clearly associated
with PFTS, chomping was not induced by inoculation in this study. This observation led to the
suspicion that chomping may be a behaviour associated with hunger or abdominal discomfort.
Indeed, when sows are feed restricted, repetitive sham chewing is a well recognized stereotypic
behaviour.102 Moreover, our group has also documented repetitive oral behaviour in a small
proportion of commercial nursery pigs 1 and 4 weeks post weaning in the absence of any
obvious disease (unpublished data). Collectively, these findings indicate that the repetitive oral
behaviour is not specific to PFTS.
A recent experiment conducted at the University of Minnesota attempted to reproduce PFTS by
inoculating pigs with HEV, group A rotavirus, or a combination of HEV, group A rotavirus and
PRRSV. It was reported that clinical signs of PFTS were observed in all inoculation groups as
well as in a sham-control group. Unfortunately, the observed clinical signs were not specified,
nor did body weights differ among groups.198 It is obvious that that experiment also did not
reproduce progressive loss of weight and body condition, which is an important feature of PFTS
176
and a fundamental part of the clinical case definition.79 Further, no histological changes
characteristic of PFTS76 were observed in the experiment.198
The current experiment also serves to verify that the SF-pCD pig is a valid model for study of
infectious diseases. Although specific pathogen free (SPF), Caesarian-derived,
colostrum-deprived (CDCD) and gnotobiotic pig models are commonly used for swine infectious
disease studies, these models have disadvantages. SPF pigs are typically conventional pigs that
have diminished levels of maternal antibodies after weaning. Despite its convenience and
economical nature, one cannot use younger SPF pigs due to the high levels of maternal
antibodies. Thus, this model is not suitable to study the effect of pathogens on suckling pigs,
especially when the pathogen of interest is prevalent making it difficult to locate a seronegative
farm. CDCD and gnotobiotic pigs do not experience natural birth. It is well documented that
before natural birth, pigs and other livestock species experience a pre-parturient cortisol surge174
that is important for tissue maturation, immunoglobulin absorption and glycogen deposition in
muscle and liver.49 This may explain why Caesarean-derived pigs typically have higher mortality
than naturally delivered pigs even if delivered at term. An additional drawback of gnotobiotic
pigs is that they exhibit a distorted immune response because they lack bacterial colonization in
the gut.18 This indicates the gnotobiotic model is not always a satisfactory model although it has
undoubtedly served as a powerful tool for swine infectious disease research in the past.
The development of the SF-pCD model addresses the weaknesses of other swine models.
Previous efforts to raise SF-pCD pigs by other researchers resulted in survival rates of 80% or
less.12,141 After some modification, we have consistently raised (non-inoculated) SF-pCD pigs
with 100% survival.77 Further, it has been shown that SF-pCD pigs were able to mount an
immune response similar to that of conventional pigs (Chapter 8). The use of SF-pCD pigs in this
177
present experiment, despite the failure of reproducing the body weight loss associated with PFTS,
demonstrates that these pigs are susceptible to systemic bacterial infection. This study thus
provides additional verification that SF-pCD is a valid model for infectious disease research.
Although susceptibility to viral pathogens has not yet been demonstrated, SF-pCD pigs are
presumably susceptible.
In conclusion, the progressive loss of weight and body condition, a key feature of PFTS and part
of the clinical case definition, was not reproduced by inoculating SF-pCD pigs with tissue
homogenates from PFTS-affected pigs. This study therefore provides further evidence that PFTS
is not caused by an infectious etiology.
178
Table 9.1. Treatment groups and inoculation schedule for PFTS inoculation study
Groups Day 14 Day 21
Oral IM+IP Oral IM+IP
INOC1
(n=4)
20 ml
non-filtered
NA NA 2 ml filtered each
route
INOC2
(n=4)
20 ml
non-filtered
2 ml filtered each
route
NA 2 ml filtered each
route
CTRL1
(n=2)
20 ml MEM NA NA 2 ml MEM each
route
CTRL2
(n=2)
20 ml MEM 2ml MEM each
route
NA 2ml MEM each
route
IM = intramuscularly, IP= intraperitoneally, MEM = minimum essential media
179
Table 9.2. Number of days with diarrhea or fever during the two week period following first
inoculation (D15 to D29)
INOC
(n=8)
CTRL
(n=4) P*
Diarrhea 15/88 4/60 0.368
Fever (>=40°C) 8/87 2/60 0.368
* P values of Mann Whitney’s U test.
180
Table 9.3. Median body weight (kg) and average daily gain (ADG; kg/d) at selected time points
following inoculation at day 14 and 21
INOC* (IQR)† CTRL (IQR) P
Weight D14 (pre-inoculation) 3.1 (1.4) 2.5 (1.1) 0.683
Weight D29 (14d post inoculation 1) 5.8 (2.2) 5.6 (3.0) 1
Weight D49 (termination) 15.5 (4.3) 13.6 (5.8) 0.556
ADG D14 to D29 0.17 (0.07) 0.20 (0.13) 0.1
ADG D29 to D49 0.49 (0.10) 0.40 (0.16) 0.03
ADG D14 to D49 0.35 (0.06) 0.32 (0.13) 1
*INOC, n=5; CTRL, n=4; Euthanized (septicemic) pigs were excluded from analyses
† IQR = Interquartile range
181
10. General discussion, conclusions and future directions
This section does not aim to restate the discussions of previous research chapters, but to consider
the findings of all the chapters and discuss points that have not been sufficiently addressed in the
discussion section of each chapter. Finally, several overall conclusions of the research will be
drawn and future directions for investigation of PFTS suggested.
Although Chapter 2, which has been published in the Journal of Swine Health and Production79,
was not based on a well-controlled experimental study, it was foundational to the investigation
presented in this thesis since it established a clinical definition of PFTS, without which the
subsequent studies were not possible. It should be emphasized that the case definition is at a
clinical level, and thus may not be highly specific and sensitive. The definition was the beginning,
not the result, of the investigation so future modification based on scientific evidence is
anticipated. Further, proposing PFTS as a clinical syndrome does not imply that the author is
committed to there being one single, common etiology. It was the clinical similarities that
justified grouping all of the herd outbreaks of “starve-out” pigs together and the assignment of a
name that facilitated the investigation.
As it turned out, the investigation demonstrated that similarities in gross, histopathological and
serum parameter observations, between affected and unaffected pigs, were largely consistent
among pigs and farms (Chapter 4, 5 and 6). These findings are important, not because they
served to elucidate an infectious etiology (with exception of the superficial gastritis, see
discussion below), but that they demonstrate further similarities between PFTS-affected pigs and
farms, which provide evidence that these farms and pigs were affected by the same clinical
syndrome or pathogenesis. The changes of histology and clinical pathology were strongly
182
associated with PFTS, which satisfied the first of Hill’s epidemiological criteria for causation (i.e.
the strength of the association).73 Further, the consistency of the association among farms
satisfied Hill’s second epidemiologic criterion.73 It should be clear that there are different levels
of causation. The infectious organism causes histological lesions in an infectious disease, and the
lesions cause the clinical expression of the disease. Thus, these lesions may remain in the causal
chain of PFTS and are useful to investigators for the development of etiological hypotheses. The
screening for rotavirus A in chapters 4 and 5, for example, was largely driven by the presence of
villous atrophy. On the other hand, as discussed in chapters 4 and 5, in a case-control study, the
inability to demonstrate events in temporal sequence (Evan’s fourth criteria46) makes it
impossible to know whether the histological changes were the cause or the result of the clinical
disease. Further, except for the superficial gastritis, the other highly prevalent lesions (small
villous atrophy and thymic atrophy) lack specificity to PFTS, and could be caused by any
etiology that induces anorexia or reduced feed intake. This does not fulfill Hill’s third criterion.73
As discussed in chapter 5, it is possible that the superficial gastritis observed in PFTS pigs was a
direct result of anorexia or starvation. This is based on literature demonstrating that in mice and
rats, gastric erosions could be induced by starvation. However, it is also notable that the current
evidence relating gastric lesions with starvation cannot be directly extrapolated to conclude that
the gastritis observed in PFTS pigs is caused by anorexia or starvation. Thus, it is important to
investigate the etiology of the gastritis, which, if not caused by starvation alone, may be the key
lesion that may elucidate the etiology of PFTS.
Although an etiology was not identified in this research, significant progress was made that will
assist in the diagnosis of PFTS. As demonstrated in Chapter 5, the lack of at least two of the
three lesions, namely, thymic atrophy, superficial gastritis and small intestinal villous atrophy,
183
can be used to rule out PFTS with confidence. Obtaining a positive diagnosis of PFTS is more
complex and requires the fulfillment of the clinical case definition, presence of characteristic
lesions, and the absence of other known pathogens and associated lesions that can explain the
clinical signs. Because the prevalence of PFTS is thought to be low, it is more likely for a
diagnostic lab to receive a submission that is actually not PFTS. Thus, having a simple and
confident rule out criterion at the histological level is helpful.
In this study, the search for pathogens was mostly targeted at viruses. Although the author is
justified not intensively searching for bacterial pathogens because of the absence of indicative
lesions, this is one limitation of the current study. The major lesions observed in PFTS pigs lack
neutrophilic infiltration, a hallmark of bacterial disease. However, not all bacteria cause
neutrophilic reaction, with Lawsonia intracellularis which cause hyperplasia of intestinal crypts
being a good example. Thus, although not likely, the author cannot conclude with great certainty
that PFTS is not associated with one or more less characterized bacteria.
The exact weaning age and its association with PFTS is another factor that could not be
investigated in this study. It is understandable that in the production system, that all pigs weaned
on the same day were not born the same day. Thus, the same batch of nursery pigs may have an
age variation of up to 7 days. If early weaning is a risk factor of postweaning starve-outs, and if
one batch of nursery pig contains many that were prematurely weaned, an “outbreak” of
starve-out (hence PFTS) may occur and then appear to wane in subsequent weeks as the number
of prematurely weaned pigs decreases.
The age of the onset is another important factor that needs to be considered when investigating
an etiology for PFTS. Does PFTS begin at weaning, or does it begin sometime during the
184
suckling phase? The results presented in this thesis alone cannot answer this question. However,
an incidental observation from one control pig in Chapter 8 sheds some light on the temporal
origin of PFTS. This pig suckled its biological dam on farm, but was noticed to be lethargic,
anorexic, thin and continually lost weight after weaning. The pig was excluded from the
experiment, and was euthanized 13 days after weaning. Interestingly, the only gross and
histological changes for this pig were thymic atrophy, superficial gastritis and small intestinal
villous atrophy. No further diagnostics were performed on this pig. This pig's condition was
consistent with those of a postweaning starve-out. On review of this pig’s body weight record, it
was interesting to note that it was growing above the average of other sibling piglets until it
experienced a growth arrest approximately one week before weaning. Taken together, these
observations support the possibility that the onset of PFTS may be before weaning. If true, the
PFTS-affected pigs selected for diagnostic workup in the current investigation may have been in
a chronic stage, which could reduce the chance of successfully identifying the infectious
organisms involved in the initiation of the disease process.
Chapters 7 and 8 described the development of the SF-pCD pig model in preparation for the
inoculation study presented in Chapter 9. These works are significant because they demonstrated
that SF-pCD pigs represent those raised in conventional farms, so that the future experimental
results generated from SF-pCD pigs should mimic those in the field situation. Further, the
development of SF-pCD pigs is a significant contribution to swine infectious disease research.
The advantages of SF-pCD pig had been well discussed in these chapters and those discussions
will not be reproduced here.
Chapter 9 showed that inoculation of tissue homogenates from PFTS pigs into SF-pCD pigs
failed to reproduce PFTS. This is an indication that PFTS is a non-infectious disease, and it
185
agreed with the findings that no pathogens were identified as the etiology of PFTS from the
investigation in Chapters 4 and 5. However, it should be clear that the absence of evidence is not
(at least not always) evidence of absence. The author is fully aware of potential weakness in the
inoculation study presented in Chapter 9. The dose of the inoculation was not evaluated nor
optimized, even though the quantity of a putative infectious organism in the inoculum is
understandably a very important factor for successful reproduction of the disease. The same
applies when considering the inoculation route. Additionally, the tissues for the inoculum were
stored in -80°C for about 8 months before the study. This may further lower or even inactivate
the potential infectiousness of the organisms in the inoculum. Finally, the SF-pCD pigs consume
large volumes of bovine colostrum, which contain large amounts of immunoglobulin. If there is a
cross-protective immunoglobulin in the diet, it will potentially protect against the pathogen and
prevent the reproduction of PFTS even if it is an infectious disease. Thus, it is overstated to
conclude that PFTS is not an infectious disease based on the available evidence, but this is
certainly less likely based on the results of this research. Moreover, the failure to reproduce
PFTS in Chapter 9 discouraged the further pursuit of additional inoculation trials using tissue
homogenates. It is the author’s opinion that efforts put into identifying potential infectious
organisms by molecular methods would be more rewarding. If a putative organism is discovered,
one should attempt to isolate and culture the organism and then perform inoculation studies using
pure culture.
All together, the author concludes that:
1. PFTS is a clinical syndrome with consistent pathological and serum analytical changes in
affected pigs.
186
2. There is a lack of evidence that PFTS is an infectious disease. Based on the efforts of this
research to establish an infectious etiology, this lack of evidence swings the pendulum in favour
of PFTS being a non-infectious disease.
187
11. Future directions
The investigation of PFTS is not completed. The author suggests some future directions for the
investigation.
Firstly, a fasting trial should be performed. A common suggestion the author received from
conference audience and manuscript reviewers was that PFTS is simply the result of pigs that
failed to “learn to eat” after weaning (i.e. PFTS is the same as “starve-outs”). And it might be
that if pigs are fasted for a certain period of time, they will enter a non-reversible state such that
reintroduction of feed is not possible. The author is inclined to agree with this suggestion, but
solid evidence should be obtained by experimentation. A fasting and re-feeding trial of newly
weaned pigs is a powerful way to answer this question (Will prolonged fasting result in a
non-reversible feed refusal state that leads to PFTS?). It was the author’s observation that even
with feed placed in front of PFTS pigs, they were not interested in the feed. Thus, if in a fasting
trial, fasted pigs readily eat solid feed after re-feeding, it will suggest that fasting alone does not
lead to PFTS, but other factors must be involved in the pathogenesis (i.e. it was not because the
PFTS pigs did not find the feed, but something makes them not want to eat). Further, if fasted
pigs do not have the same lesions (especially superficial gastritis) as identified in PFTS pigs, an
additional etiology must be sought to explain the presence of these characteristic lesions.
Secondly, a more detailed investigation targeting suckling pigs on PFTS-affected farms should
be performed. As discussed above, if the initiation of PFTS begins in the suckling phase,
sampling only weaned pigs may reduce the chance of identifying the etiology, regardless of
whether it is infectious or non-infectious.
188
Thirdly, a prospective study in farms affected with PFTS can be helpful to identify individual
risk factors associated with PFTS, such as weaning age. Cortisol levels could also be measured
in such a study to elucidate whether PFTS is associated with increase level of stress.
Fourthly, more powerful techniques to reveal novel infectious organism should be employed.
Indeed, high throughput sequencing of stomachs and brains from PFTS pigs is underway. The
author is looking forward to obtaining these results as they may provide additional evidence of
whether or not PFTS has an infectious etiology.
189
12. References
1 Code of practice for the care and handling of pigs (draft): Canadian National Farm Animal
Care Council; 2013.
2 Abbott J, Madson D. 2012, Survey of vitamin D levels in swine serum across different
stages of production. In: Proc Amer Assoc Swine Vet Conf, pp. 113-115. Perry, Iowa.
3 Abramson D, Mills J, Marquardt R, et al. Mycotoxins in fungal contaminated samples of
animal feed from western Canada, 1982-1994. Can J Vet Res. 1997;61(1):49.
4 Ackerman SH, Hofer MA, Weiner H. Age at maternal separation and gastric erosion
susceptibility in the rat. Psychosom Med. 1975;37(2):180-184.
5 Amann R, Fuchs BM. Single-cell identification in microbial communities by improved
fluorescence in situ hybridization techniques. Nature Rev Microbiol. 2008;6(5):339-348.
6 Andries K, Pensaert MB. Immunoflurorescence studies on the pathogenesis of
hemagglutinating encephalomyelitis virus infection in pigs after oronasal inoculation. Am
J Vet Res. 1980;41(9):1372-1378.
7 Barrette RW, Metwally SA, Rowland JM, et al. Discovery of swine as a host for the Reston
ebolavirus. Science. 2009;325(5937):204-206.
8 Beach NM, Meng X-J. Efficacy and future prospects of commercially available and
experimental vaccines against porcine circovirus type 2 (PCV2). Virus Res.
2012;164(1):33-42.
9 Bexfield N, Kellam P. Metagenomics and the molecular identification of novel viruses. Vet J.
2011;190(2):191-198.
10 Bianchi AT, Scholten J-W, Moonen Leusen BH, et al. Development of the natural response
of immunoglobulin secreting cells in the pig as a function of organ, age and housing. Dev
190
Comp Immunol. 1999;23(6):511-520.
11 Björkstén B, Sepp E, Julge K, et al. Allergy development and the intestinal microflora
during the first year of life. J Allergy Clin Immunol. 2001;108(4):516-520.
12 Blanco I, Galina-Pantoja L, Oliveira S, et al. Comparison between Haemophilus parasuis
infection in colostrums-deprived and sow-reared piglets. Vet Microbiol.
2004;103(1-2):21-27.
13 Blomström A-L, Widén F, Hammer A-S, et al. Detection of a novel astrovirus in brain tissue
of mink suffering from shaking mink syndrome by use of viral metagenomics. J Clin
Microbiol. 2010;48(12):4392-4396.
14 Bohl E, Kohler E, Saif LJ, et al. Rotavirus as a cause of diarrhea in pigs. J Am Vet Med
Assoc. 1978;172(4):458.
15 Boudry C, Dehoux J-P, Portetelle D, et al. Bovine colostrum as a natural growth promoter
for newly weaned piglets: a review. Biotechnol Agron Soc Environ. 2008;12(2).
16 Boudry C, Dehoux J, Wavreille J, et al. Effect of a bovine colostrum whey supplementation
on growth performance, faecal Escherichia coli population and systemic immune
response of piglets at weaning. Animal. 2008;2(5):730.
17 Bruininx E, Van Der Peet-Schwering C, Schrama J, et al. Individually measured feed intake
characteristics and growth performance of group-housed weanling pigs: effects of sex,
initial body weight, and body weight distribution within groups. J Anim Sci.
2001;79(2):301-308.
18 Butler JE, Weber P, Sinkora M, et al. Antibody Repertoire Development in Fetal and
Neonatal Piglets. VIII. Colonization Is Required for Newborn Piglets to Make Serum
Antibodies to T-Dependent and Type 2 T-Independent Antigens. J Immunol.
191
2002;169(12):6822-6830.
19 Buzzard B, Edwards-Callaway L, Engle T, et al. Evaluation of blood parameters as an early
assessment of healthy status in nursery pigs. J Swine Health Prod. 2013;21(3):148-151.
20 Carmichael LE, J. C. Joubert, Pollock RV. Hemagglutination by canine parvovirus:
serologic studies and diagnostic applications. Am J Vet Res. 1980;41(5):784-791.
21 Carr J, David’s S. Management as the basis of disease control. Int Pig Top. 2011;26(3):7-8.
22 Castillo M, Martín-Orúe SM, Nofrarías M, et al. Changes in caecal microbiota and mucosal
morphology of weaned pigs. Vet Microbiol. 2007;124(3):239-247.
23 Chae C. Postweaning multisystemic wasting syndrome: a review of aetiology, diagnosis and
pathology. Vet J. 2004;168(1):41-49.
24 Chang K-O, Saif LJ, Kim Y: Reoviruses (Rotaviruses and Reoviruses). In: Zimmerman J,
Karriker L, Ramirez A, Schwartz K, Stevenson G, eds. Diseases of Swine. 10th ed.: John
Wiley & Sons, Inc.; 2012: 621-634.
25 Chaytor AC, Hansen JA, van Heugten E, et al. Occurrence and decontamination of
mycotoxins in swine feed. Asian-Aust J Anim Sci. 2011;24:723-738.
26 Chelack BJ, Morley PS, Haines DM. Evaluation of methods for dehydration of bovine
colostrum for total replacement of normal colostrum in calves. Can Vet J.
1993;34(7):407.
27 Chen EC, Miller SA, DeRisi JL, et al. Using a pan-viral microarray assay (Virochip) to
screen clinical samples for viral pathogens. Journal of visualized experiments: JoVE.
2011(50).
28 Chisholm SA, Owen RJ. Development and application of a novel screening PCR assay for
direct detection of 'Helicobacter heilmannii’-like organisms in human gastric biopsies in
192
Southeast England. Diag Microbio Infect Disease. 2003;46(1):1-7.
29 Clark EG. 1996, Pathology of the post-weaning multisystemic wasting syndrome of pigs.
In: Proc West Can Assoc Swine Vet Conf, pp. 22-25.
30 Clark EG. 1997, Post-weaning multisystemic wasting syndrom. In: Proc Amer Assoc
Swine Vet Conf, pp. 499-501.
31 Cox DD, Todd AC. Survey of gastrointestinal parasitism in Wisconsin dairy cattle. J Am Vet
Med Assoc. 1962;141:706.
32 Cromwell GL. Why and how antibiotics are used in swine production. Anim Biotechnol.
2002;13(1):7-27.
33 Dee S, Carlson A, Winkelman N, et al. Effect of management practices on the Streptococcus
suis carrier rate in nursery swine. J Am Vet Med Assoc. 1993;203(2):295.
34 Dee S, Morrison R, Joo H. Eradicating porcine reproductive and respiratory syndrome
(PRRS) virus using two-site production and nursery depopulation. J Swine Health Prod.
1993;1(5):20-23.
35 Desnues B, Al Moussawi K, Raoult D. Defining causality in emerging agents of acute
bacterial diarrheas: a step beyond the Koch's postulates. Future Microbiol.
2010;5(12):1787-1797.
36 Desrosiers R, Boutin M. An attempt to eradicate porcine reproductive and respiratory
syndrome virus (PRRSV) after an outbreak in a breeding herd: eradication strategy and
persistence of antibody titers in sows. J Swine Health Prod. 2002;10(1):23-26.
37 Dewey CE, Cox BD, Straw BE, et al. Use of antimicrobials in swine feeds in the United
States. J Swine Health Prod. 1999;7:19-28.
38 Diener UL, Cole RJ, Sanders T, et al. Epidemiology of Aflatoxin Formation by Aspergillus
193
Flavus. Annu Rev Phytopathol. 1987;25(1):249-270.
39 Dorr PM, Madson D, Wayne S, et al. Impact of pH modifiers and drug exposure on the
solubility of pharmaceutical products commonly administered through water delivery
systems. J Swine Health Prod. 2009;17(4):217-222.
40 Dou Y, Gregersen S, Zhao J, et al. Effect of re-feeding after starvation on biomechanical
properties in rat small intestine. Med Eng Phys. 2001;23(8):557-566.
41 Dritz S. 2002, Nursery Management Update. In: Proc Manitoba Swine Seminar, p. 1.
Winnipeg, MB, Canada.
42 Dufresne L, Fangman TJ, Henry S. 2008, Post-weaning catabolic syndrome: complexities
and perspectives. In: Proc Allen D. Leman Swine Conf, pp. 79-85. St. Paul, MN.
43 Ellis J, Hassard L, Clark E, et al. Isolation of circovirus from lesions of pigs with
postweaning multisystemic wasting syndrome. Can Vet J. 1998;39(1):44.
44 Eriksson E, Aspan A. Comparison of culture, ELISA and PCR techniques for salmonella
detection in faecal samples for cattle, pig and poultry. BMC Vet Res. 2007;3(1):21.
45 Evans A. New discoveries in infectious mononucleosis. Mod Med. 1974;1:18-24.
46 Evans AS. Causation and disease: the Henle-Koch postulates revisited. Yale J Bio Med.
1976;49(2):175.
47 Fairbrother JM, Gyles CL: Colibacillosis. In: Zimmerman J, Karriker L, Ramirez A,
Schwartz K, Stevenson G, eds. Diseases of Swine. 10th ed.: John Wiley & Sons, Inc.;
2012: 723-749.
48 Fairbrother JM, Nadeau É, Gyles CL. Escherichia coli in postweaning diarrhea in pigs: an
update on bacterial types, pathogenesis, and prevention strategies. Anim Health Res Rev.
2005;6(01):17-39.
194
49 Fowden AL, Li J, Forhead AJ. Glucocorticoids and the preparation for life after birth: are
there long-term consequences of the life insurance? Proc Nutr Soc. 1998;57(01):113-122.
50 Fredericks D, Relman DA. Sequence-based identification of microbial pathogens: a
reconsideration of Koch's postulates. Clin Microbiol Rev. 1996;9(1):18-33.
51 Friendship B, Harding J, Henry S. 2010, Periweaning Failure to Thrive Syndrome (PFTS)
- difficulties of investigating an emerging clinical problem. In: Proc Allen D. Leman
Swine Conf, pp. 73-78. St. Paul, MN.
52 Friendship RM. Gastric ulceration in swine. J Swine Health Prod. 2004;12(1):34-36.
53 Friendship RM, Lumsden JH, McMillan I, et al. Hematology and biochemistry reference
values for Ontario swine. Can J Comp Med. 1984;48(4):390-393.
54 Funderburke D, Seerley R. The effects of postweaning stressors on pig weight change,
blood, liver and digestive tract characteristics. J Anim Sci. 1990;68(1):155-162.
55 Gagnon CA, del Castillo JR, Music N, et al. Development and use of a multiplex real-time
quantitative polymerase chain reaction assay for detection and differentiation of Porcine
circovirus-2 genotypes 2a and 2b in an epidemiological survey. J Vet Diagn Invest.
2008;20(5):545-558.
56 Gallagher DP, Cotter PF, Mulvihill DM. Porcine milk proteins: A review. Int Dairy J.
1997;7(2):99-118.
57 Gauvreau H, Harding J. 2008, Why are these nursery pigs dying? An ongoing field
investigation into a farm with elevated nursery mortality associated with
non-PRRS/PCV2 post weaning starvation. In: Proc West Can Assoc Swine Vet Conf.
Saskatoon, SK.
58 Gomez GG, Phillips O, Goforth RA. Effect of immunoglobulin source on survival, growth,
195
and hematological and immunological variables in pigs. J Anim Sci. 1998;76(1):1.
59 Goodband B, De Rouchey J, Tokach M, et al. 2006, Strategies for feeding weaned pigs.
In: Proc London Swine Conf, pp. 75-85. London, ON, Canada.
60 Gruver AL, Sempowski GD. Cytokines, leptin, and stress-induced thymic atrophy. J Leukoc
Biol. 2008;84(4):915-923.
61 Guo M, Hayes J, Cho K, et al. Comparative pathogenesis of tissue culture-adapted and
wild-type Cowden porcine enteric calicivirus (PEC) in gnotobiotic pigs and induction of
diarrhea by intravenous inoculation of wild-type PEC. J Virol. 2001;75(19):9239-9251.
62 Halaihel N, Masía R, M F-J, et al. Enteric calicivirus and rotavirus infections in domestic
pigs. Epidemiol Infect. 2010;138(04):542-548.
63 Hamel AL, Lin L, Sachvie C, et al. PCR assay for detecting porcine cytomegalovirus. J Clin
Microbiol. 1999;37(11):3767-3768.
64 Harding J, Huang Y. 2010, Postweaning Wasting/Catabolic Syndrome (PWCS): a new
disease causing severe nursery mortality. In: Proc Manitoba Pork Seminar, pp. 127-129.
Winnipeg, MB, Canada.
65 Harding JC, Baker CD, Tumber A, et al. Porcine circovirus-2 DNA concentration
distinguishes wasting from nonwasting pigs and is correlated with lesion distribution,
severity, and nucleocapsid staining intensity. J Vet Diagn Invest. 2008;20(3):274-282.
66 Hedemann MS, Højsgaard S, Jensen BB. Small intestinal morphology and activity of
intestinal peptidases in piglets around weaning. J Anim Physiol Anim Nutr.
2003;87(1-2):32-41.
67 Helie P, Morin M, Jacques M, et al. Experimental infection of newborn pigs with an
attaching and effacing Escherichia coli O45:K"E65" strain. Infect Immun.
196
1991;59(3):814-821.
68 Hellemans A, Chiers K, Decostere A, et al. Experimental Infection of Pigs with ‘Candidatus
Helicobacter suis’. Vet Res Commun. 2007;31(4):385-395.
69 Henry S. 2011, Periweaning failure to thrive syndrom (PFTS). In: Proc Am Assoc Swine
Vet Conf. Phoenix, AZ, USA.
70 Heo J, Kim J, Hansen CF, et al. Effects of dietary protein level and zinc oxide
supplementation on the incidence of post-weaning diarrhoea in weaner pigs challenged
with an enterotoxigenic strain of Escherichia coli. Livest Sci. 2010;133(1):210-213.
71 Heo J, Kim J, Hansen CF, et al. Feeding a diet with decreased protein content reduces
indices of protein fermentation and the incidence of postweaning diarrhea in weaned pigs
challenged with an enterotoxigenic strain of Escherichia coli. J Anim Sci.
2009;87(9):2833-2843.
72 Heo J, Opapeju F, Pluske J, et al. Gastrointestinal health and function in weaned pigs: a
review of feeding strategies to control post‐weaning diarrhoea without using in‐feed
antimicrobial compounds. J Anim Physiol Anim Nutr. 2012.
73 Hill AB. The environment and disease: association or causation? Proc R Soc Med.
1965;58(5):295.
74 Hollis B, Kamerud J, Selvaag S, et al. Determination of vitamin D status by
radioimmunoassay with an 125I-labeled tracer. Clin Chem. 1993;39(3):529-533.
75 Honkavuori KS, Shivaprasad H, Williams BL, et al. Novel borna virus in psittacine birds
with proventricular dilatation disease. Emerg Infect Dis. 2008;14(12):1883.
76 Huang Y, Gauvreau H, Harding J. Diagnostic investigation of porcine periweaning
failure-to-thrive syndrome lack of compelling evidence linking to common porcine
197
pathogens. J Vet Diagn Invest. 2012;24(1):96-106.
77 Huang Y, Haines DM, Harding JCS. Snatch-farrowed, porcine-colostrum-deprived (SF-pCD)
pigs as a model for swine infectious disease research. Can J Vet Res. 2013;77(2):81-88.
78 Huang Y, Harding JCS. Pathological features and proposed diagnostic criteria of porcine
periweaning failure-to-thrive syndrome (PFTS). Vet Pathol. 2013;Submitted.
79 Huang Y, Henry S, Friendship R, et al. Clinical presentation, case definition, and diagnostic
guidelines for porcine periweaning failure to thrive syndrome J Swine Health Prod.
2011;19(6):340-344.
80 Hubank M, Schatz D. Identifying differences in mRNA expression by representational
difference analysis of cDNA. Nucleic Acids Res. 1994;22(25):5640-5648.
81 Inman C, Haverson K, Konstantinov S, et al. Rearing environment affects development of
the immune system in neonates. Clin Exp Immunol. 2010;160(3):431-439.
82 Jacela JY, DeRouchey JM, Tokach MD. Feed additives for swine: Fact sheets – high dietary
levels of copper and zinc for young pigs, and phytase. J Swine Health Prod.
2010;18(2):87-91.
83 Jacela JY, DeRouchey JM, Tokach MD. Feed additives for swine: Fact sheets – prebiotics
and probiotics, and phytogenics. J Swine Health Prod. 2010;18(3):132-136.
84 Jacela JY, DeRouchey JM, Tokach MD, et al. Feed additives for swine: Fact
sheets–acidifiers and antibiotics. J Swine Health Prod. 2012;17(5):270-275.
85 Jacela JY, DeRouchey JM, Tokach MD, et al. Feed additives for swine: Fact sheets–flavors
and mold inhibitors, mycotoxin binders, and antioxidants. J Swine Health Prod.
2012;18(1):27-32.
86 Janke BH, Francis DH, Collins JE, et al. Attaching and effacing Escherichia coli infections
198
in calves, pigs, lambs, and dogs. J Vet Diagn Invest. 1989;1(1):6-11.
87 Janke BH, Nelson JK, Benfield DA, et al. Relative prevalence of typical and atypical strains
among rotaviruses from diarrheic pigs in conventional swine herds. J Vet Diagn Invest.
1990;2(4):308-311.
88 Johnson RT, Gibbs Jr CJ. Koch's postulates and slow infections of the nervous system. Arch
Neurol. 1974;30(1):36.
89 Jouany JP. Methods for preventing, decontaminating and minimizing the toxicity of
mycotoxins in feeds. Anim Feed Sci Technol. 2007;137(3):342-362.
90 Karst SM, Wobus CE, Lay M, et al. STAT1-dependent innate immunity to a Norwalk-like
virus. Science. 2003;299(5612):1575-1578.
91 Keffaber K. Reproductive failure of unknown etiology. Am Assoc Swine Pract Newsl.
1989;1(2):1-9.
92 Kekarainen T, Sibila M, Segales J. Prevalence of swine Torque teno virus in post-weaning
multisystemic wasting syndrome (PMWS)-affected and non-PMWS-affected pigs in
Spain. J Gen Virol. 2006;87(4):833.
93 Kim J, Ha Y, Chae C. Potentiation of porcine circovirus 2-induced postweaning
multisystemic wasting syndrome by porcine parvovirus is associated with excessive
production of tumor necrosis factor-α. Vet Pathol. 2006;43(5):718-725.
94 Kim J, Hansen CF, Mullan B, et al. Nutrition and pathology of weaner pigs: nutritional
strategies to support barrier function in the gastrointestinal tract. Anim Feed Sci Technol.
2012;173(1):3-16.
95 Kircher M, Kelso J. High‐throughput DNA sequencing–concepts and limitations.
Bioessays. 2010;32(6):524-536.
199
96 Klobasa F, Butler J. Absolute and relative concentrations of immunoglobulins G, M, and A,
and albumin in the lacteal secretion of sows of different lactation numbers. Am J Vet Res.
1987;48(2):176-182.
97 Kothalawala H, Toussaint M, Gruys E. An overview of swine influenza. Vet Q.
2006;28(2):45-53.
98 Ladekjær-Mikkelsen A-S, Nielsen J, Stadejek T, et al. Reproduction of postweaning
multisystemic wasting syndrome (PMWS) in immunostimulated and
non-immunostimulated 3-week-old piglets experimentally infected with porcine
circovirus type 2 (PCV2). Vet Microbiol. 2002;89(2):97-114.
99 Lalles J-P, Bosi P, Smidt H, et al. Nutritional management of gut health in pigs around
weaning. Proc Nutr Soc. 2007;66(2):260-268.
100 Lamhoujeb S, Cook A, Pollari F, et al. Rotaviruses from Canadian farm samples. Arch
Virol. 2010;155(7):1127-1137.
101 Langenhorst RJ, Lawson S, Kittawornrat A, et al. Development of a fluorescent
microsphere immunoassay for detection of antibodies against porcine reproductive and
respiratory syndrome virus using oral fluid samples as an alternative to serum-based
assays. Clin Vaccine Immunol. 2012;19(2):180-189.
102 Lawrence AB, Terlouw E. A review of behavioral factors involved in the development and
continued performance of stereotypic behaviors in pigs. J Anim Sci.
1993;71(10):2815-2825.
103 Lawson S, Lunney J, Zuckermann F, et al. Development of an 8-plex Luminex assay to
detect swine cytokines for vaccine development: assessment of immunity after porcine
reproductive and respiratory syndrome virus (PRRSV) vaccination. Vaccine.
200
2010;28(32):5356-5364.
104 Leser TD, Møller K, Jensen TK, et al. Specific detection of Serpulina hyodysenteriae and
potentially pathogenic weakly β-haemolytic porcine intestinal spirochetes by polymerase
chain reaction targeting 23S rDNA. Mol Cell Probes. 1997;11(5):363-372.
105 Li D, Nelssen J, Reddy P, et al. Transient hypersensitivity to soybean meal in the
early-weaned pig. J Anim Sci. 1990;68(6):1790-1799.
106 Lindsay DS, Dubey JP, Santín-Durán M, et al.: Coccidia and Other Protozoa. In:
Zimmerman J, Karriker L, Ramirez A, Schwartz K, Stevenson G, eds. Diseases of Swine.
10th ed.: John Wiley & Sons, Inc.; 2012: 895-907.
107 Magan N, Aldred D. Post-harvest control strategies: Minimizing mycotoxins in the food
chain. Int J Food Microbiol. 2007;119(1):131-139.
108 Marquardt RR. Effects of molds and their toxins on livestock performance: a western
Canadian perspective. Anim Feed Sci Technol. 1996;58(1):77-89.
109 Marquardt RR, Jin LZ, Kim JW, et al. Passive protective effect of egg yolk antibodies
against enterotoxigenic Escherichia coli K88+ infection in neonatal and early weaned
piglets. FEMS Immunol Med Microbiol. 1999;23(4):283-288.
110 Marthaler D, Rossow K, Culhane M, et al. Identification, phylogenetic analysis and
classification of porcine group C rotavirus VP7 sequences from the United States and
Canada. Virology. 2013;446(1):189-198.
111 Marthaler D, Rossow K, Gramer M, et al. Detection of substantial porcine group B
rotavirus genetic diversity in the United States, resulting in a modified classification
proposal for G genotypes. Virology. 2012.
112 Marthaler D, Russow K, Gramer M, et al.: Detection and prevalence of swine rotavirus A,
201
B and C in United States European Rotavirus Biology Meeting. Valencia, Spain; 2013.
113 Martinez-Guino L, Kekarainen T, Segales J. Evidence of Torque teno virus (TTV) vertical
transmission in swine. Theriogenology. 2009;71(9):1390-1395.
114 Mattsson JG, Bergström K, Wallgren P, et al. Detection of Mycoplasma hyopneumoniae in
nose swabs from pigs by in vitro amplification of the 16S rRNA gene. J Clin Microbial.
1995;33(4):893-897.
115 McCracken B, Spurlock M, Roos M, et al. Weaning anorexia may contribute to local
inflammation in the piglet small intestine. J Nutr. 1999;129(3):613-619.
116 McIntosh KA, Tumber A, Harding J, et al. Development and validation of a SYBR green
real-time PCR for the quantification of porcine circovirus type 2 in serum, buffy coat,
feces, and multiple tissues. Vet Microbiol. 2009;133(1):23-33.
117 McLeese J, Patience J, Christison G, et al. Evaluation of the quality of ground water
supplies used on Saskatchewan swine farms. Can J Anim Sci. 1991;71(1):191-203.
118 McLeese J, Tremblay M, Patience J, et al. Water intake patterns in the weanling pig: effect
of water quality, antibiotics and probiotics. Anim Prod. 1992;54(01):135-142.
119 McNair I, Marshall M, McNeilly F, et al. Interlaboratory testing of porcine sera for
antibodies to porcine circovirus type 2. J Vet Diagn Invest. 2004;16(2):164.
120 Melin L, Mattsson S, Katouli M, et al. Development of Post‐weaning Diarrhoea in
Piglets. Relation to Presence of Escherichia coli Strains and Rotavirus. J Vet Med B.
2004;51(1):12-22.
121 Mengeling W, Cutlip R. Pathogenicity of field isolants of hemagglutinating
encephalomyelitis virus for neonatal pigs. J Am Vet Med Assoc. 1976;168(3):236-239.
122 Mettenleiter TC, Ehlers B, Müller T, et al.: Herpesviruses. In: Zimmerman J, Karriker L,
202
Ramirez A, Schwartz K, Stevenson G, eds. Diseases of Swine. 10th ed.: John Wiley &
Sons, Inc.; 2012: 554-556.
123 Mikhail A, Hirschberg J. Ulceration in the rat's forestomach: Its reduction by non-nutritive
bulky substances. Physiol Behav. 1972;8(4):769-770.
124 Miller JD. Fungi and mycotoxins in grain: implications for stored product research. J
Stored Prod Res. 1995;31(1):1-16.
125 Moeser AJ, Borst LB, Overman BL, et al. Defects in small intestinal epithelial barrier
function and morphology associated with peri-weaning failure to thrive syndrome (PFTS)
in swine. Res Vet Sci. 2012;93(2):975-982.
126 Moeser AJ, Ryan KA, Nighot PK, et al. Gastrointestinal dysfunction induced by early
weaning is attenuated by delayed weaning and mast cell blockade in pigs. Am J Physiol -
Gastr L. 2007;293(2):G413-G421.
127 Moeser AJ, Vander Klok C, Ryan KA, et al. Stress signaling pathways activated by
weaning mediate intestinal dysfunction in the pig. Am J Physiol - Gastr L.
2007;292(1):G173-G181.
128 Mokili JL, Rohwer F, Dutilh BE. Metagenomics and future perspectives in virus discovery.
Curr Opin Virol. 2012;2(1):63-77.
129 Montagne L, Boudry G, Favier C, et al. Main intestinal markers associated with the
changes in gut architecture and function in piglets after weaning. Br J Nutr.
2007;97(1):45-57.
130 Morgan-Jones S: Practical aspects of disinfection and infection control. In: Linton AH,
Hugo WB, Russell AD, eds. Disinfection in veterinary and farm animal practice:
Blackwell Scientific Publications; 1987.
203
131 Mundt H, Joachim A, Becka M, et al. Isospora suis: an experimental model for mammalian
intestinal coccidiosis. Parasitol Res. 2006;98(2):167-175.
132 Muniappa N, Mathiesen MR, Duhamel GE. Laboratory identification and
enteropathogenicity testing of Serpulina pilosicoli associated with porcine colonic
spirochetosis. J Vet Diagn Invest. 1997;9(2):165-171.
133 Narita M, Kawamura H, Tsuboi T, et al. Immunopathological and ultrastructural studies on
the tonsil of gnotobiotic pigs infected with strain 67N of haemagglutinating
encephalomyelitis virus. J Comp Pathol. 1989;100(3):305-312.
134 Nodelijk G. Porcine reproductive and respiratory syndrome (PRRS) with special reference
to clinical aspects and diagnosis: a review. Vet Q. 2002;24(2):95-100.
135 Notomi T, Okayama H, Masubuchi H, et al. Loop-mediated isothermal amplification of
DNA. Nucleic Acids Res. 2000;28(12):e63.
136 Nyachoti C, Patience J, Seddon I. Effect of water source (ground versus surface) and
treatment on nursery pig performance. Can J Anim Sci. 2005;85(3):405-407.
137 Nyachoti M, Kiarie E. 2010, Water in swine production: A review of its significance and
conservation strategies. In: Manitoba Swine seminar, pp. 217-232. Winnipeg MB,
Canada.
138 O'Sullivan T, Harding J, Friendship B, et al. 2012, Crude prevalence of porcine
periweaning failure-to-thrive syndrome (PFTS): a survey of swine veterinarians in
Canada and North America. In: Proc Int Pig Vet Soc Congr, p. 180. Jeju, Korea.
139 O'Sullivan T, Harding J, Friendship B, et al. Estimated prevalence and impact of
periweaning failure-to-thrive syndrome in Canada and the United States of America. J
Swine Health Prod. 2013;In press.
204
140 Ogawa T, Chiles T, Necheles H. Starvation ulcer in the mouse. Am J Physiol.
1960;198(3):619-620.
141 Oliveira S, Galina L, Blanco I, et al. Naturally-farrowed, artificially-reared pigs as an
alternative model for experimental infection by Haemophilus parasuis. Can J Vet Res.
2003;67(2):146.
142 Oliveira S, Pijoan C. Haemophilus parasuis: new trends on diagnosis, epidemiology and
control. Vet Microbiol. 2004;99(1):1-12.
143 Olson GL, Robine L, Rosengren LB, et al. Parturition induction two days prior to term
decreases birth weight and lactational growth, but not piglet maturity, health or
post-weaning growth. Can J Anim Sci. 2009;89(2):219-228.
144 Orr JP, Althouse E, Dulac GC, et al. Epizootic infection of a minimal disease swine herd
with a herpesvirus. Can Vet J. 1988;29(1):45.
145 Osweiler GD, Ensley SM: Mycotoxinx in grains and feeds. In: Zimmerman J, Karriker L,
Ramirez A, Schwartz K, Stevenson G, eds. Diseases of swine. 10th ed.: John Wiley &
Sons, Inc.; 2012: 938-952.
146 Palade GE. A study of fixation for electron microscopy. J Exp Med. 1952;95(3):285-298.
147 Pantoja LG, Kuhn M, Hoover T, et al. Impact of a Husbandry Education Program on
nursery pig mortality, productivity, and treatment cost. J Swine Health Prod.
2013;21(4):188-194.
148 Patience J, Beaulieu AD, Gillis DA. The impact of ground water high in sulfates on the
growth performance, nutrient utilization, and tissue mineral levels of pigs housed under
commercial conditions. J Swine Health Prod. 2004;12:228-235.
149 Patience J, Thacker P, de Lange C: Feeding the weaned pig Swine Nutrition Guide. 2nd ed.
205
Saskatoon, SK, Canada: Pairie Swine Center Inc.; 1995.
150 Patience J, Thacker P, de Lange C: Water Swine Nutrition Guide. 2nd ed. Saskatoon, SK,
Canada: Pairie Swine Center Inc.; 1995.
151 Pié S, Lallès JP, Blazy F, et al. Weaning Is Associated with an Upregulation of Expression
of Inflammatory Cytokines in the Intestine of Piglets. J Nutr. 2004;134(3):641-647.
152 Pinton P, Accensi F, Beauchamp E, et al. Ingestion of deoxynivalenol (DON) contaminated
feed alters the pig vaccinal immune responses. Toxicol Lett. 2008;177(3):215-222.
153 Pittman JS, J.Moeser A. 2011, Porcine peri-weaning failure to thrive syndrome (PFTS),
Part I: Epidemiological studies and ante-mortem diagnostics. In: Proc Am Assoc of
Swine Vet Conf, pp. 365-366. Phoenix, AZ, USA.
154 Pittman JS, J.Moeser A, Rovira A. 2011, Porcine peri-weaning failure to thrive syndrome
(PFTS), Part II: Gross lesions, histopathology and diagnostic analysis. In: Proc Am
Assoc of Swine Vet Conf, pp. 367-368. Phoenix, AZ, USA.
155 Plowright W, Edington N, Watt R. The behaviour of porcine cytomegalovirus in
commercial pig herds. J Hyg (Lond). 1976;76(01):125-135.
156 Pluske J: Physiology of feed efficiency in the pig: emphasis on the gastrointestinal tract
and specific dietary examples. In: Patience JF, ed. Feed efficiency in swine: Springer;
2012: 239-257.
157 Pluske JR. Feed-and feed additives-related aspects of gut health and development in
weanling pigs. J Anim Sci Biotechnol. 2013;4(1).
158 Pluske JR, Hampson DJ, Williams IH. Factors influencing the structure and function of the
small intestine in the weaned pig: a review. Livest Prod Sci. 1997;51(1):215-236.
159 Pozzuto T, Mueller B, Meehan B, et al. In utero transmission of porcine torque teno
206
viruses. Vet Microbiol. 2009;137(3-4):375-379.
160 Puppe B, Tuchscherer A. The development of suckling frequency in pigs from birth to
weaning of their piglets: a sociobiological approach. Anim Sci. 2000;71(2):273-280.
161 Quiroga MA, Cappuccio J, Piñeyro P, et al. Hemagglutinating encephalomyelitis
coronavirus infection in pigs, Argentina. Emerg Infect Dis. 2008;14(3):484.
162 Rajić A, Reid-Smith R, Deckert AE, et al. Reported antibiotic use in 90 swine farms in
Alberta. Can Vet J. 2006;47(5):446.
163 Rautou PE, Cazals–Hatem D, Moreau R, et al. Acute liver cell damage in patients with
anorexia nervosa: a possible role of starvation-induced hepatocyte autophagy.
Gastroenterol. 2008;135(3):840-848. e843.
164 Richard JL. Some major mycotoxins and their mycotoxicoses—an overview. Int J Food
Microbiol. 2007;119(1):3-10.
165 Rivers TM. Viruses and Koch's postulates. J Bacteriol. 1937;33(1):1.
166 Rooke J, Carranca C, Bland I, et al. Relationships between passive absorption of
immunoglobulin G by the piglet and plasma concentrations of immunoglobulin G at
weaning. Livest Prod Sci. 2003;81(2):223-234.
167 Rosengren LB, Waldner CL, Reid-Smith RJ, et al. Antimicrobial use through feed, water,
and injection in 20 swine farms in Alberta and Saskatchewan. Can J Vet Res.
2008;72(2):143.
168 Rossow K. Porcine reproductive and respiratory syndrome. Vet Pathol. 1998;35(1):1-20.
169 Rossow K: Postweaning "fading pig/anorexia syndrome",
http://nationalhogfarmer.com/weekly-preview/0628-postweaning-fading-pig-anorexia/;
2010.
207
170 Rotter BA. Toxicology of deoxynivalenol (vomitoxin). J Toxicol Environ Health A.
1996;48(1):1-34.
171 Saif LJ, Pensaert MB, Sestak K, et al.: Coronaviruses. In: Zimmerman J, Karriker L,
Ramirez A, Schwartz K, Stevenson G, eds. Diseases of Swine. 10th ed.: John Wiley &
Sons, Inc.; 2012: 501-524.
172 Saiki RK, Scharf S, Faloona F, et al. Enzymatic amplification of beta-globin genomic
sequences and restriction site analysis for diagnosis of sickle cell anemia. Science.
1985;230(4732):1350-1354.
173 Salmon H, Berri M, Gerdts V, et al. Humoral and cellular factors of maternal immunity in
swine. Dev Comp Immunol. 2009;33(3):384-393.
174 Sangild PT, Holtug K, Diernaes L, et al. Birth and prematurity influence intestinal function
in the newborn pig. Comp Biochem Physiol A: Mol Integr Physiol. 1997;118(2):359-361.
175 Schrezenmeir J, de Vrese M. Probiotics, prebiotics, and synbiotics—approaching a
definition. Am J Clin Nutr. 2001;73(2):361s-364s.
176 Schwarz L, Joachim A, Worliczek HL. Transfer of Cystoisospora suis-specific colostral
antibodies and their correlation with the course of neonatal porcine cystoisosporosis. Vet
Parasitol. 2013.
177 Segalés J. Porcine circovirus type 2 (PCV2) infections: clinical signs, pathology and
laboratory diagnosis. Virus Res. 2012;164(1):10-19.
178 Segalés J, Martínez J, Vidal E, et al. Periweaning failure to thrive in pigs in Spain. Vet Rec.
2012;170(19):499.
179 Sekiguchi Y, Shirai J, Taniguchi T, et al. Development of reverse transcriptase PCR and
nested PCR to detect porcine hemagglutinating encephalomyelitis virus. J Vet Med Sci.
208
2004;66(4):367-372.
180 Shan T, Li L, Simmonds P, et al. The fecal virome of pigs on a high-density farm. J Virol.
2011;85(22):11697-11708.
181 Shen H, Schalk S, Halbur P, et al. Commercially produced spray-dried porcine plasma
contains increased concentrations of porcine circovirus type 2 DNA but does not transmit
porcine circovirus type 2 when fed to naïve pigs. J Anim Sci. 2011;89(6):1930-1938.
182 Shen H, Wang C, Madson DM, et al. High prevalence of porcine circovirus viremia in
newborn piglets in five clinically normal swine breeding herds in North America. Prev
Vet Med. 2010;97:228-236.
183 Sorden SD. Update on porcine circovirus and postweaning multisystemic wasting
syndrome (PMWS). J Swine Health Prod. 2000;8(3):133-136.
184 Spackman E, Senne DA, Myers T, et al. Development of a real-time reverse transcriptase
PCR assay for type A influenza virus and the avian H5 and H7 hemagglutinin subtypes. J
Clin Microbial. 2002;40(9):3256-3260.
185 Steenhard NR, Jungersen G, Kokotovic B, et al. Ascaris suum infection negatively affects
the response to a Mycoplasma hyopneumoniae vaccination and subsequent challenge
infection in pigs. Vaccine. 2009;27(37):5161-5169.
186 Stein HH. Experience of feeding pigs without antibiotics: a European perspective. Anim
Biotechnol. 2002;13(1):85-95.
187 Stepanova H, Samankova P, Leva L, et al. Early postnatal development of the immune
system in piglets: the redistribution of T lymphocyte subsets. Cell Immunol.
2007;249(2):73-79.
188 Stockham SL, Scott MA: Fundamentals of Veterinary Clinical Pathology: Blackwell,
209
2008.
189 Struve R. 1999, A source of CDCD swine for research. In: Proc Am Assoc Swine Vet
Conf, p. 117.
190 Stuart B, Gosser H, Allen C, et al. Coccidiosis in swine: dose and age response to Isospora
suis. Can J Comp Med. 1982;46(3):317.
191 Swords W, Wu C-C, Champlin F, et al. Postnatal changes in selected bacterial groups of
the pig colonic microflora. Neonatology. 1993;63(3):191-200.
192 Tanaka H, Igarashi T, Lefor AT, et al. The effects of fasting and general anesthesia on
serum chemistries in KCG miniature pigs. J Am Assoc Lab Anim Sci. 2009;48(1):33.
193 Terpstra C, Wensvoort G, Pol J. Experimental reproduction of porcine epidemic abortion
and respiratory syndrome (mystery swine disease) by infection with Lelystad vims:
Koch's postulates fulfilled. Vet Q. 1991;13(3):131-136.
194 Thrusfield M: Diagnostic testing. In: Thrusfield M, ed. Veterinary epidemiology. 3rd ed.:
Blackwell Science Ltd.; 2008: 305-330.
195 Tiwari A, VanLeeuwen JA, McKenna SL, et al. Johne’s disease in Canada: Part I: Clinical
symptoms, pathophysiology, diagnosis, and prevalence in dairy herds. Can Vet J.
2006;47(9):874.
196 Tomás A, Fernandes LT, Valero O, et al. A meta-analysis on experimental infections with
porcine circovirus type 2 (PCV2). Vet Microbiol. 2008;132(3):260-273.
197 Torrallardona D. Spray dried animal plasma as an alternative to antibiotics in weanling
pigs—A review. Asian-australas J Anim Sci. 2010;23:131-148.
198 Tousignant S, Rovira A, Morrison B. 2013, Reproduction of peri-weaning failure to
thrive syndrome in experimentally infected weaned pigs. In: Proc Am Assoc Swine Vet
210
Conf, p. 421. San Diego, CA, USA.
199 Tousignant SJP, Henry SC, Rovira A, et al. Effect of oral vitamin D3 supplementation on
growth and serum 25-hydroxy vitamin D levels of pigs up to 7 weeks of age. J Swine
Health Prod. 2013;21(2):94-98.
200 Vansickle J: Researchers scramble to solve failure to thrive syndrome,
http://nationalhogfarmer.com/health-diseases/0915-researchers-trying-solve-syndrome/;
2008.
201 Vemulapalli R, Gulani J, Santrich C. A real-time TaqMan RT-PCR assay with an internal
amplification control for rapid detection of transmissible gastroenteritis virus in swine
fecal samples. J Viol Methods. 2009;162(1):231-235.
202 Wang Q, Costantini V, Saif LJ. Porcine enteric caliciviruses: genetic and antigenic
relatedness to human caliciviruses, diagnosis and epidemiology. Vaccine.
2007;25(30):5453-5466.
203 Wang Q, Han MG, Cheetham S, et al. Porcine noroviruses related to human noroviruses.
Emerg Infect Dis. 2005;11(12):1874-1881.
204 Wang Q, Souza M, Funk JA, et al. Prevalence of noroviruses and sapoviruses in swine of
various ages determined by reverse transcription-PCR and microwell hybridization
assays. J Clin Microbiol. 2006;44(6):2057-2062.
205 Wang Y: Development of a multiplex fluorescent immunoassay for the simultaneous
detection of serum antibodies to multiple swine pathogens Department of Diagnostic
Medicine and Pathobiology, College of Veterinary Medicine Manhattan, Kansas: Kansas
State University; 2013: 43.
206 Wijtten PJ, Meulen Jvd, Verstegen MW. Intestinal barrier function and absorption in pigs
211
after weaning: a review. Br J Nutr. 2011;105(7):967.
207 Wood G. Mycotoxins in foods and feeds in the United States. J Anim Sci.
1992;70(12):3941-3949.
208 Worliczek HL, Mundt HC, Ruttkowski B, et al. Age, not infection dose, determines the
outcome of Isospora suis infections in suckling piglets. Parasitol Res. 2009;105(1
Suppl):157-162.
209 Zaki MM, El-Midany S, Shaheen H, et al. Mycotoxins in animals: Occurrence, effects,
prevention and management. J Toxicol Environ Health. 2012;4:13-28.
210 Zell R, Krumbholz A, Henke A, et al. Detection of porcine enteroviruses by nRT–PCR:
differentiation of CPE groups I–III with specific primer sets. J Viol Methods.
2000;88(2):205-218.
211 Zulovich JM: Effect of the Environment on Health. In: Zimmerman J, Karriker L, Ramirez
A, Schwartz K, Stevenson G, eds. Diseases of Swine. 10th ed.: John Wiley & Sons, Inc.;
2012: 60-66.