Post on 02-Jan-2017
transcript
Kcnq1ot1/Lit1 noncoding RNA mediates transcriptional silencing by targeting to the perinucleolar region
Faizaan Mohammad1# Radha Raman Pandey
1# Takshi Nagano
3,
Lyubomira Chakalova3, Tanmoy Mondal
1, Peter Fraser
3 and
Chandrasekhar Kanduri1, 2,
*
1Department of Genetics and Pathology, Dag Hammarskölds Väg 20, 75185
Rudbeck Laboratory, Uppsala University, Uppsala, Sweden 2
Department of Genetics and Development, Norbyvägen18A, S-75236, Uppsala
University, Uppsala, Sweden 3 Laboratory of Chromatin and Gene Expression, Babraham Institute, Babraham
Research Campus, Cambridge, CB2243AT , United Kingdom
* = Address for correspondence
Email: Kanduri.Chandrasekhar@genpat.uu.se
Telephone: 0046739600450
Fax: 004618558931
# = These authors have contributed equally to this manuscript
Running title: An antisense RNA mediates Perinucleolar localization
ACCEPTED
Copyright © 2008, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Mol. Cell. Biol. doi:10.1128/MCB.02263-07 MCB Accepts, published online ahead of print on 25 February 2008
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Abstract 1
2
The Kcnq1ot1 antisense non-coding RNA has been implicated in long-range bidirectional 3
silencing, but the underlying mechanisms remain enigmatic. Here we characterize a 4
domain at the 5’ end of the Kcnq1ot1 RNA that carries out transcriptional silencing of 5
linked genes using an episomal vector system. The bidirectional silencing property of 6
Kcnq1ot1 maps to a highly conserved repeat motif within the silencing domain, which 7
directs transcriptional silencing by interaction with chromatin resulting in histone H3 8
lysine9-trimethylation. Intriguingly, the silencing domain is also required to target the 9
episomal vector to the perinucleolar compartment, during mid S phase. Collectively, our 10
data unfold a novel mechanism by which an antisense RNA mediates transcriptional gene 11
silencing of chromosomal domains by targeting them to distinct nuclear compartments, 12
known to be rich in heterochromatic machinery. 13
14
15
16
17
18
19
20
21
22
Keywords: Antisense RNA/Chromatin/Epigenetics/Gene silencing/Kcnq1ot1 23
24
25
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Introduction 26
Recent in silico-based analyses of the mammalian genome have predicted that 27
approximately 60- 70% of the genome is transcribed. However, only ∼1.5% of the 28
genome encodes protein, but the rest of the mammalian genome appears to be 29
transcribing non-protein-coding RNAs (19). Interestingly, a detailed analysis of the 30
mouse transcriptome by the FANTOM3 consortium indicated that more than 72% of all 31
43,553 genome-mapped transcription units overlap transcripts encoded from the opposite 32
strand, with the majority of transcripts being noncoding. This suggests that antisense 33
transcription is extremely widespread in mammals (14). 34
An accumulating weight of new evidence from a variety of model systems indicates that 35
noncoding RNAs play an important role in epigenetically controlled gene expression (2, 36
25, 28, 36). Noncoding RNAs can be classified into two groups: housekeeping and 37
regulatory noncoding RNAs. Housekeeping noncoding RNAs, which include tRNAs, 38
rRNAs and snRNAs, have a range of functions that are necessary for cell viability. 39
Regulatory noncoding RNAs have been implicated in phenomena that have an impact on 40
cellular differentiation and development in both plants and animals. 41
Based on size, regulatory noncoding RNAs can be further grouped into two classes: short 42
and long regulatory noncoding RNAs. Short regulatory noncoding RNAs are specifically 43
21 to 31 nucleotides and include miRNAs siRNAs and piRNAs, which regulate gene 44
silencing at the transcriptional and/or post-transcriptional level (2). Long regulatory 45
noncoding RNAs, whose lengths range in size from 100 bp to several hundred kilobases, 46
have been shown to participate in several important biological functions. Among the long 47
noncoding RNAs, Xist, an X-inactivation-specific transcript, and Tsix, its antisense 48
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
counterpart, have been well studied for their functional role in mammalian dosage 49
compensation, an epigenetic process by which levels of X-linked gene products are 50
maintained at an equal ratio between the sexes (11, 15). During early embryonic 51
development, the X-inactivation process is initiated with the onset of Xist gene 52
transcription, followed by coating of this RNA all along the future inactive X-53
chromosome. This triggers step-wise recruitment of the heterochromatin machinery, 54
which leads to silencing of the chromosome in cis. However, on the future active X-55
chromosome, Tsix antagonize Xist-mediated X-chromosome inactivation by 56
epigenetically regulating the Xist locus (21, 27, 30). 57
One of the salient features of the gene clusters exhibiting parent of origin-specific 58
expression patterns is the prevalence of noncoding RNAs at these clusters (22). Of 59
particular interest is that the noncoding antisense RNAs encoded from the differentially 60
methylated imprinting control regions (ICR) are generally long, ranging in size from 50 61
kb to several hundred kilo bases, and are reciprocally imprinted to their sense 62
counterparts. These long antisense transcripts have been functionally implicated in long-63
range bidirectional control of gene expression at imprinted clusters (18, 26, 29, 33). This 64
unique bidirectional control of the expression of flanking genes by the long antisense 65
RNAs raises the important question of how these RNAs differ in their execution of 66
silencing mechanisms, as compared to the antisense RNAs, such as Tsix, whose effects 67
are primarily restricted to overlapping genes. 68
In this investigation to address the functional role of long antisense noncoding RNAs, we 69
have exploited an imprinted cluster located at the distal end of mouse chromosome 7. 70
This cluster is divided into two sub-expression domains: the H19/Igf2 domain and the 71
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Kcnq1 domain. Imprinting in the H19/Igf2 domain is primarily regulated by a chromatin 72
insulator located at the 5´end of the H19 gene (1, 9, 12, 31). Imprinted gene regulation in 73
the Kcnq1 imprinted domain seems to require the presence of a long noncoding antisense 74
transcript, Kcnq1ot1, whose expression on the paternal chromosome has been linked to 75
the bidirectional repression in cis of eight maternally expressed genes spread over a 76
mega-base region (8, 18, 23, 33). The promoter of the Kcnq1ot1 transcript maps to the 77
Kcnq1 imprinting control region (ICR) in intron 10 of the Kcnq1 gene. The Kcnq1 ICR is 78
methylated on the maternal chromosome, but is unmethylated on the paternal 79
chromosome, which encodes the Kcnq1ot1 antisense transcript. It has been recently 80
documented that the imprinted silencing of the Kcnq1 domain involves histone 81
modifications (13, 16, 34). However, the specific mechanisms underlying the Kcnq1ot1-82
mediated transcriptional silencing are yet unclear. 83
Previously, we have shown that a 3.6 kb Kcnq1 ICR fragment, containing the Kcnq1ot1 84
antisense promoter and 1.7 kb of downstream sequence, is sufficient to silence flanking 85
genes, and more importantly, that the transcriptional elongation of the 1.7 kb sequence 86
results in the efficient silencing of flanking genes in an episome-based system (13, 32). 87
Based on these observations, we posit that the 1.7 kb Kcnq1ot1 sequence may harbor the 88
crucial information required for bidirectional silencing, and that this region silences 89
flanking genes more efficiently when it is part of long transcripts than it does as part of 90
short antisense transcripts. In this investigation, we sought to address the mechanisms by 91
which Kcnq1ot1 executes long-range bidirectional silencing. The data presented here 92
document that Kcnq1ot1 harbors a silencing domain that carries out transcriptional 93
silencing in an orientation-dependent and position independent manner downstream of 94
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
the antisense promoter, through promoting its interaction with the chromatin. 95
Interestingly, this domain also targets the flanking sequences to the perinucleolar 96
compartment, a distinct nuclear space enriched with factors involved in replication and 97
heterochromatin formation. These results unfold a mechanism by which the silencing 98
domain of Kcnq1ot1 initiates transcriptional silencing by recruiting repressive chromatin 99
machinery and spreading it bidrectionally over flanking chromosomal regions. This is 100
clonally maintained through subsequent cell divisions by targeting the flanking sequences 101
to the perinucleolar compartment. 102
Results 103
Functional characterization of a silencing domain at the 5´end of the Kcnq1ot1 104
antisense RNA 105
Previous investigations from our lab have implicated a 1.7 kb sequence (1897-3625, 106
Kcnq1ot1 transcription start site at 1897), downstream of the Kcnq1ot1 promoter in the 107
3.6 kb Kcnq1 ICR, in bidirectional silencing of flanking reporter genes. To define the 108
sequences that are critical for bidirectional silencing, we initially generated serial 109
deletions encompassing the region that encodes the 1.7 kb antisense transcription unit in 110
the 3.6 Kb Kcnq1 ICR using a PCR-based strategy (Figure 1A). We inserted all these 111
modified ICRs between the H19 and Hygromycin reporter genes in the PH19 episome. 112
In all of these constructs, the ICR is oriented in such a way that the Kcnq1ot1 antisense 113
promoter faces the H19 promoter, thus the H19 and Hygromycin gene promoters become 114
overlapping and nonoverlapping promoters, respectively, to the Kcnq1ot1 promoter 115
(Figure 1A). We transfected all of the episomal constructs into the human placenta-116
derived JEG-3 cell line and analyzed the activity of Kcnq1ot1, H19 and Hygromycin 117
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
genes using an RNase protection assay (RPA). The Hygromycin gene activity was also 118
measured by counting the Hygromycin resistant colonies obtained after selection with 119
hygromycin. 120
Analysis of the serial deletions indicated that a fragment encompassing the antisense 121
promoter and downstream 600 bp region (see PS1050 in Figure 1A) could not silence the 122
Hygromycin reporter gene. However, Hygromycin gene silencing was detected with a 123
fragment encompassing both the antisense promoter and downstream 1.7 kb region (see 124
PS1947 in Figure 1A), suggesting that a 1.1 kb region (2479-3625; Kcnq1ot1 125
transcription start site at 1897) may play an important role in silencing (Figure 1B & 126
Figure S1A). 127
When we analyzed the fragments that harbored serial deletions for their ability to support 128
promoter activity in a promoter-less Luciferase construct, we detected significant 129
Luciferase activity from the fragments that did not encompass the 1.1 kb region, but not 130
from the fragment that included it (compare PGL_Basic742 and PGL_Basic1050 with 131
PGL_basic1947 in Figure 1C). Interestingly, however, all of these serial deletions could 132
produce RNA in the episomal context (Figure S1B) as well as in the Luciferase 133
constructs (Figure S1C). Lack of Luciferase activity in PGL_Basic1947 could be due to 134
retention of the fused transcript (contains the 1.1 kb portion of Kcnq1ot1+Luciferase 135
gene) in the nuclear compartment and/or interference in the translation of the fused 136
transcript due to occupancy of bulky heterochromatin complex in the 1.1 kb portion of 137
the fused transcript. We presume that these results collectively indicate that the 1.1 kb 138
region in the 1.7 kb Kcnq1ot1 sequence holds crucial information required for 139
bidirectional silencing. 140
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
To further define the minimal region required for bidirectional silencing, we created 141
selective internal deletions in the 1.1 kb Kcnq1ot1 sequence using an approach as 142
described in the experimental procedures. To incorporate internal deletions into the 1.1 143
kb sequence, we used a larger version of the Kcnq1 ICR that contained a 3.9 kb Kcnq1ot1 144
sequence (PS6 in Figure 2A). In the PS6 episome, the Kcnq1ot1 transcript encoded from 145
the ICR runs on through the H19 coding gene and is truncated at the SV40 polyA 146
sequence inserted 11.4 kb downstream of the Kcnq1ot1 start site (Figure 2A, data not 147
shown). We inserted each of the modified ICRs, carrying various internal deletions, 148
between the H19 and Hygromycin reporter genes in the PH19 episome (Figure 1A & 2A) 149
and performed silencing assay as described above. 150
Selective deletion of an 890 bp sequence (2514-3402, PS6A1 in Figure 2A) from the 151
fine-mapped 1.1 kb region, 617 bp downstream of the antisense transcription start site, 152
resulted in incomplete silencing of the H19 gene, whereas Hygromycin gene was 153
significantly increased. We observed a slight increase in the activity of the Kcnq1ot1 154
promoter in PS6A1 (Figure S2A). We have further narrowed down the 890 bp silencing 155
domain to 450 bp by creating several deletions of 150 bp starting from 5’ end of the 890 156
bp fragment (PS6A2-PS6A4 in Figure 2A & S2A) and found no discernible differences 157
between PS6A1 and PS6A2-PS6A4, as the Hygromycin, H19 and Kcnq1ot1 gene 158
activities more or less remained the same between these constructs (Figure 2A & S2A). 159
If the 890 bp fragment was a silencing domain, one would expect a complete activation 160
of the H19 and Hygromycin genes on deletion of this fragment rather than the complete 161
activation only of the Hygromycin gene. Previously, by analyzing the kinetics of 162
silencing and heterochromatin formation on the H19 and Hygromycin genes in relation to 163
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Kcnq1ot1 transcription, we have shown that the silencing of the nonoverlapping 164
Hygromycin gene occurs primarily due to Kcnq1ot1-mediated heterochromatin 165
formation, whereas the overlapping H19 gene silencing occurs by both the Kcnq1ot1 166
transcription-mediated occlusion of the basal transcription machinery and by 167
heterochromatin formation (13). So we presume that specific activation of the 168
Hygromycin gene in the 890 bp deletion could be due to the loss of the Kcnq1ot1-169
mediated heterochromatin formation, while the incomplete silencing of the H19 gene 170
could be as a result of partial occlusion of the basal transcription machinery due to 171
Kcnq1ot1 transcription. 172
To further confirm these observations, we have deleted the 890 bp Kcnq1ot1 silencing 173
domain (henceforth the 890 bp Kcnq1ot1 silencing domain is known as Kcnqot1 SD) in 174
the PS4polyA4.9 construct (contains 4.9 kb Kcnq1ot1 sequence followed by SV40 PolyA 175
sequence), wherein we have previously shown that the 4.9 kb long episome encoded 176
Kcnq1ot1 transcript is capable of inducing moderate silencing of H19 and Hygromycin 177
genes. In this construct the Kcnq1ot1 transcript does not overlap with the H19 Gene (13). 178
Interestingly, we did not see silencing of the H19 as well as Hygromycin genes in 179
PS4polyA4.9A1 when compared to PS4polyA4.9, suggesting that the incomplete 180
silencing of the H19 gene in PSA1-PSA4 is mainly due to occlusion of basal transcription 181
machinery (see PS4polyA4.9A1 and PS4polyA4.9 in Fig.2A & S2A). 182
To further reinforce this statement, we used chromatin immunoprecipitation (ChIP) 183
assays to determine the levels of the major constituents of the pre-initiation complex, 184
RNA PolII and TFIIB, on both the H19 and the Hygromycin promoters. As shown in 185
Figure S3A, we found significant reduction of both RNA PolII and TFIIB on the H19 186
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
promoter, but not on the Hygromycin promoter, in PS6A1. This suggests that moderate 187
silencing of the H19 gene in PS6A1 is primarily due to occlusion of the pre-initiation 188
complex from its promoter by the antisense transcription machinery. In addition, we have 189
analyzed two positions in the H19 coding regions (H19c1 and H19c2) to check for the 190
loading efficiency of basal transcription machinery over the non-promoter regions, which 191
revealed that the basal transcription machinery is specifically loaded over the promoters 192
(Fig. S3B). 193
The Kcnqot1 SD induces gene silencing in an orientation and transcription-dependent, 194
but position-independent manner downstream of the Kcnq1ot1 promoter 195
We next addressed whether change in position and/or orientation of the Kcnqot1 SD 196
relative to the Kcnq1ot1 promoter affects its bidirectional silencing property. First, we 197
wanted to investigate whether transcription through the Kcnqot1 SD is a prerequisite for 198
the silencing process. To address this issue, we moved the Kcnqot1 SD from its natural 199
position to 1.9 kb upstream of the antisense promoter. In this configuration, the Kcnqot1 200
SD is not transcribed by the Kcnq1ot1 promoter (PS6A11 & PS6A12 in Figure 2B). As 201
can be seen from Figure 2B & S2B, the Kcnq1 ICR in this configuration could not silence 202
the Hygromycin gene, suggesting that transcription through the Kcnqot1 SD is crucial for 203
bidirectional silencing. However, when we moved the Kcnqot1 SD from its natural 204
position to 3.3 kb downstream of the antisense promoter in correct orientation, we 205
observed significant silencing of both the H19 and Hygromycin genes, indicating that the 206
Kcnqot1 SD has all the information required for bidirectional silencing and that it carries 207
out silencing in a distance-independent manner, when present downstream of the 208
antisense promoter (PS6A7 in Figure 2B & S2B). 209
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
We next addressed the effect of the orientation of the Kcnqot1 SD on bidirectional 210
silencing, by inverting the Kcnqot1 SD at its native position, as well as at other positions. 211
The Kcnq1ICR with the inverted Kcnqot1 SD no longer brought about silencing of the 212
Hygromycin gene as compared to the wild type Kcnq1 ICR, suggesting that the sequence 213
of the transcribed Kcnqot1 SD is crucial for bidirectional silencing (see PS6A5 & PS6A6 214
in Figure 2A-B & S2A-B). Moreover, when we placed the Kcnqot1 SD in both 215
orientations 3.3 kb downstream of the Kcnq1ot1 transcription start site in PS6A5, we 216
observed bidirectional silencing only with its native orientation but not with the opposite 217
orientation (see PS6A5, PS6A8 & PS6A9 in Figure 2A & 2B). In addition, when we 218
replaced the Kcnqot1 SD with a neutral fragment in the Kcnq1 ICR, we could not detect 219
any silencing by the Kcnq1 ICR (PS6A10 in Figure 2B & S2B). Taken together, these 220
experiments provide a strong support for the functional role of the Kcnq1ot1 antisense 221
RNA in bidirectional silencing. 222
We next wanted to investigate whether the loss of bidirectional silencing upon Kcnqot1 223
SD deletion could be due to disturbance in its localization or stability of the transcript. To 224
this end, we first characterized the localization of episome-encoded Kcnq1ot1 transcript 225
with respect to nuclear and cytoplasmic compartments. We found that the Kcnq1ot1 226
transcript is exclusively localized in the nuclear compartment. We, however, noted that 227
the deletion of the Kcnqot1 SD had no effect on its nuclear localization as well as 228
stability of the transcript (Figure 2D-F), suggesting that the lack of bidirectional silencing 229
in the PS6A1 construct is not due to change in the half-life or nuclear specific 230
localization of the PS6A1 episome-encoded Kcnq1ot1 transcript. 231
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Functional role of conserved sequence motifs in the Kcnq1ot1 antisense RNA 232
We next sought to address the functional role of specific sequences within the Kcnqot1 233
SD that are critical for bidirectional silencing. A previous bioinformatic study identified 234
five evolutionarily conserved 30 bp repeats sequences (MD1 repeats) at the 5’ end of the 235
Kcnq1ot1 transcript (17). Interestingly, these repeat sequences map between the 236
Kcnq1ot1 promoter and the Kcnqot1 SD identified in this study. Although PS6A1 has all 237
the five 30 bp repeats intact, there was no detectable silencing of the Hygromycin gene, 238
suggesting that these repeats do not play any functional role in the silencing process. This 239
observation is consistent with a recently published report that targeted deletion of these 240
conserved repeats from the Kcnq1 ICR in the mouse had no effect on the imprinting of 241
flanking genes (18). 242
In another recent bioinformatic study, several evolutionarily conserved motifs were 243
identified in the Kcnq1 ICR (24). Interestingly, the A1 (TCCGAGTY) & A2 244
(YGYGGTTCYGAG) conserved motifs identified in this study map to the 3´end of the 245
Kcnqot1 SD. We thought to explore the functional role of A1 and A2 motifs in the 246
Kcnq1ot1-mediated bidirectional silencing. When we mutated 5 conserved residues in the 247
A2 motif, we observed moderate loss of silencing of the Hygromycin gene (PS6 & 248
PS6A15 in Figure 2C & S2C). However, when we introduced mutations into the 249
conserved residues of the A1 motif (PS6A16 in Figure 2C), we could not detect any loss 250
of silencing. To gain further insights into the functional role of the A2 motif in the 251
bidirectional silencing, we generated episome constructs by inserting Kcnq1ot1 252
sequences with (PS6A13) and without (PS6A14) A2 motif into PS6A1. As can be seen 253
from figure 2C & S2C, we noticed significant activation of Hygromycin gene in PS6A14 254
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
but not in PS6A13, implicating a critical role for the A2 motif in long-range 255
transcriptional silencing. 256
Preliminary results from our lab indicated that Kcnq1ot1 antisense RNA spans more than 257
90 kb in length in vivo. A search for the sequence motifs that show homology to the A2 258
motif in the 90 kb long Kcnq1ot1 transcription unit revealed none, indicating that A2 259
could represent the most important functional sequence in the antisense RNA. To 260
address this issue further, we have PCR amplified overlapping Kcnq1ot1 sequences 261
spanning about 52 kb region of Kcnq1ot1 (each fragment ranging in size from 3 to 5 kb 262
in length) and cloned into PS6A1 (Figure 3A). We have analyzed the effect of these 263
fragments on the silencing by measuring the Hygromycin gene activity. Interestingly, 264
none of the fragments encompassing the 52 kb Kcnq1ot1 transcription unit showed 265
silencing activity that is comparable to the Kcnqot1 SD, indicating that the 890 bp 266
sequence could be one of the main functional sequences mediating the long-range 267
transcriptional gene silencing (Figure 3B). We did not see any significant effect on the 268
Kcnq1ot1 promoter activity due to insertion of these fragments in PS6A1 (Figure S4) 269
Flanking the Kcnqot1 SD with the Xist chromatin attachment region increases the 270
efficiency of bidirectional silencing 271
Previously, by selectively incorporating deletions into Xist in an ES cell model system, it 272
has been shown that the chromatin localizing property of the Xist maps to several regions 273
in a functionally redundant fashion ((35); Figure 4A). Here, we test whether the 274
efficiency of silencing by the Kcnqot1 SD increases if it is flanked with a region of Xist 275
that shows high chromatin localizing activity. We constructed an episomal plasmid, 276
wherein a chromatin localizing region of Xist was inserted flanking the Kcnqot1 SD, and 277
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
the SV40 PolyA sequence (PS6xc4.4) was inserted at the end of Xist chromatin localizing 278
region such that the length of the encoded transcript was around 6.25 kb. Similarly, we 279
also constructed an episomal plasmid containing only Xist chromatin localizing region 280
and the SV40 polyA at the end, but lacking the Kcnqot1 SD (PS6A1xc4.4). In both 281
PS6xc4.4 and PS6A1xc4.4 episomes, Kcnq1ot1 does not overlap the overlapping H19 282
reporter gene. We compared the reporter gene activity in the PS6xc4.4 with a control 283
episomal plasmid, PS4∆H19polyA9.2 that encodes a similar length of Kcnq1ot1 as in 284
PS6xc4.4 (see (13) for details). As can be seen from Figure 4A-B & S5A, the efficiency 285
of bidirectional silencing by the Kcnq1ot1 silencing domain was significantly enhanced 286
when it is flanked with chromatin localizing region (compare PS6xc4.4 with 287
PS4∆H19polyA9.2 in Fig. 4B). However, we could not detect any silencing if the 288
chromatin localizing region was transcribed in the absence of the Kcnqot1 SD (compare 289
PS6A1xc4.4 with PS6xc4.4 in Figure 4B) or it was transcribed along with the Kcnqot1 290
SD positioned in an inverted orientation (data not shown), suggesting that the Kcnqot1 291
SD is a critical regulator of bidirectional silencing and its efficiency of silencing 292
significantly increases with the inclusion of the chromatin localizing regions of Xist. This 293
can be compared to the previously demonstrated effect of a 950 bp Xist silencing domain, 294
an A-rich repeat sequence located at the 5´end of Xist transcript, which displayed similar 295
functional features in our episome-based system i.e., it induces bidirectional silencing in 296
an orientation-dependent manner (Figure 4C & S5B). 297
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
The Kcnqot1 SD silences the flanking reporter genes by spreading repressive 298
epigenetic modifications 299
Previously we have documented that Kcnq1ot1 silences the flanking reporter genes 300
through spreading epigenetic modifications in cis (13). In this investigation, we addressed 301
whether the acquisition of epigenetic modifications by the flanking chromatin due to the 302
antisense RNA involves the functional role of the Kcnqot1 SD. To this end, we 303
investigated the chromatin structure on both the H19 and Hygromycin promoters by 304
analyzing the levels of histone H3 with trimethylated (H3K9me3) and acetylated 305
(H3K9ac) lysine 9, using ChIP assay on JEG-3 cells transfected with PS6 and PS6A1. 306
Strikingly, both the H19 and Hygromycin promoters were enriched in H3K9me3 when 307
fully silenced (PS6; Figure 5), but not when silencing is lost due to deletion of the 308
Kcnqot1 SD (PS6A1; Figure 5). Interestingly, we observed marked increase in the levels 309
of H3K9ac on both the H19 and Hygromycin promoters in PS6A1 (PS6A1; Figure 5), 310
suggesting that the Kcnqot1 SD silences the flanking genes by spreading epigenetic 311
modifications specific to inactive chromatin. 312
The Kcnq1ot1 mediates transcriptional silencing by targeting the episomes to 313
perinucleolar region 314
The above observations clearly indicate that the Kcnqot1 SD mediates transcriptional 315
silencing of flanking genes by regulating chromatin structure, probably through recruiting 316
heterochromatic machinery. Several studies have found a link between gene silencing and 317
recruitment to nuclear heterochromatin compartments (3, 4, 6, 7, 10). We were therefore 318
keen to examine whether Kcnqot1 SD-mediated transcriptional silencing correlates with 319
positioning of the episomal sequences in distinct nuclear compartments. We first wanted 320
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
to confirm that episome-encoded Kcnq1ot1 RNA can be detected in the vicinity of 321
episomal DNA sequences. To this end, we performed combined RNA/DNA fluorescent 322
in situ hybridization (FISH) with a Kcnq1ot1 RNA probe and an episomal DNA probe on 323
JEG-3 cells, transfected transiently with PS6A13 (with A2 motif) for four days. We 324
found that RNA signals colocalize with DNA signals indicating that episomal sequences 325
can be visualized by either RNA or DNA FISH (Figure S6A-B). We then evaluated the 326
nuclear localization of episomal sequences in JEG-3 cells, propagated with the PS6, 327
PS6A1, PS6A5, PS6A13 and PS6A14 (without A2 motif) episomes by RNA and DNA 328
FISH (Figure 6). We noted that four days after transfection with PS6A13, many 329
transfected cells displayed clusters of episomal signals either surrounding nucleoli or 330
enriched near the nuclear periphery (Figure 6A). Similarly, after 30 days under 331
hygromycin selection, in many cells carrying the PS6 construct, episomal signals were 332
located in close proximity to nucleoli or the nuclear periphery (Figure 6B). We scored the 333
number of cells (n=104) displaying different types of distribution of RNA FISH signals 334
in JEG-3 cells, transiently transfected with PS6A13. We found that in 34% of nuclei, the 335
Kcnq1ot1 signals were surrounding nucleoli (Figure 6A). Further 17% of the nuclei 336
showed RNA signals dispersed at the nuclear periphery. We also assessed the nuclear 337
positioning of the DNA FISH signals in JEG-3cells, stably propagated with PS6 and 338
PS6A1. PS6 episomes were located in the vicinity of nucleoli in 43% of the nuclei in the 339
cellular population (n= 101, Figure 6B), or localized at the nuclear periphery in other 340
29% of nuclei (Figure 6B). By contrast, in the vast majority of JEG-3 cells, stably 341
propagated with PS6A1, the episomal FISH signals did not occupy perinucleolar or 342
perinuclear positions (Figure 6C). In these cells, association with nucleoli and perinuclear 343
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
distribution was found only in 11% and 8% of all nuclei, respectively. These results show 344
that silencing of the episomal genes is indeed associated with positioning of the episomes 345
in close proximity to heterochromatin. Importantly, we did not detect specific enrichment 346
of PS6A5 (having the silencing domain in reverse orientation) episomes at the nucleolar 347
periphery (data not shown). This observation indicates that the silencing domain in the 348
Kcnq1ot1 transcript, rather than the DNA sequence, is crucial for nucleolar targeting. 349
We wanted to examine the association of Kcnq1ot1 RNA transcripts with the nucleolus in 350
more detail. We analyzed JEG-3 cells stably propagated with the PS6A13 and PS6A14 351
episomes. We performed RNA FISH, in combination with immunostaining for a 352
nucleolar marker, nucleophosmin. Consistent with our earlier findings, we demonstrated 353
that PS6A13-encoded Kcnq1ot1 RNA is in direct contact with nucleophosmin-stained 354
nucleoli (Figure 6D-E) and the percentage of cells that show nucleolar contact in 355
nucleophosmin stained cells is more than 40% and is similar to what has been obtained 356
with RNA-FISH. We next performed combined RNA/DNA immuno FISH on PS6A13 357
stably propagated JEG-3 cells, to check whether RNA and DNA signals that are in 358
contact with nucleoli colocalize with each other. In combined RNA/DNA immuno FISH, 359
following hybridization with a digoxigenin-labeled Kcnq1ot1 probe overnight, the RNA 360
FISH signals were visualized by immunodetection of digoxigenin with fluorescent 361
antibodies. After that, the cells are re-fixed and treated with RNase. The RNA FISH 362
signals survive the RNase treatment because the Kcnq1ot1 RNA is protected by the probe 363
and additional layers of antibodies. Chromatin is then denatured followed by a second 364
round of hybridization with a biotin-labeled episome probe. This probe hybridizes to 365
episomal DNA sequences and is subsequently visualized by fluorescent detection of 366
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
biotin. These experiments confirmed that nucleoli-associated DNA and RNA FISH 367
signals colocalize with each other (Figure 6F). In combination, our results show that the 368
Kcnqot1 SD plays a crucial role in targeting the episomes to the vicinity of nucleolus. 369
In a recent investigation, using BrdU labeling and PCNA immunostaining, it has been 370
documented that Xist–mediated inactive X-chromosome contact with the nucleolus 371
occurs predominantly during mid-to-late S phase (37). Using the same methodology, we 372
wanted to investigate whether localization of Kcnq1ot1 DNA FISH signals in the 373
nucleolar periphery correspond to any particular phase of the cell cycle. Interestingly, we 374
found that 41% of Kcnq1ot1 RNA-FISH signals were localized in the vicinity of 375
nucleolus around mid S phase of the cell cycle. Although we do see nucleolar localization 376
during early (8%) and late (14%) S phase but lower than that of mid S phase (41%), 377
implying that the silencing domain mediated nucleolar contact is dependent on the phase 378
of the cell cycle (Figure 7A-B). 379
The Kcnq1ot1 SD mediates the chromatin interaction of the Kcnq1ot1 antisense 380
transcript 381
Our combined RNA/DNA FISH indicated that the RNA and DNA signals were co-382
localized with each other, giving an indication that the transcribed Kcnq1ot1 RNA might 383
be in direct contact with chromatin. To address whether Kcnq1ot1 RNA is in direct 384
contact with chromatin, we have used chromatin-associated RNA immunoprecipitation 385
(ChRIP). In this technique, we immunopurified the chromatin using a histone H3 386
antibody and extracted RNA from the immunopurified chromatin, followed by DNase I 387
treatment and reverse transcription of the purified RNA. We found that chromatin 388
purified from cells transfected with the PS6xc4.4, showed 5-6 fold enrichment of 389
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Kcnq1ot1 in comparison to the chromatin purified from the cells transfected with the 390
PS6. This suggests that the Kcnq1ot1 encoded from the PS6 associates with chromatin, 391
albeit with lower affinity than the Kcnq1ot1 containing chromatin-localizing signals from 392
Xist (compare PS6 with PS6xc4.4 in Figure 7C). Surprisingly, we found that the 393
chromatin association of the Kcnq1ot1 encoded from PS6 was dependent on the Kcnqot1 394
SD, as the loss of this region from the transcript resulted in a significant decrease in the 395
level of its association with chromatin (compare PS6A1 with PS6 in Figure 7C). 396
Moreover, when we truncated Kcnq1ot1 to 1.7 kb length, we also found a significant 397
decrease of the Kcnq1ot1 RNA levels in the purified chromatin, suggesting that the 398
length of the Kcnq1ot1 determines its association with the chromatin (compare 399
PS4polyA1.7 with PS6 in Figure 7C). 400
Discussion 401
Several models have been proposed to explain the mode of action of long noncoding 402
RNAs. For example, in Drosophila it has been documented that expression of noncoding 403
transcripts from TRE elements has been linked to the recruitment of Trithorax protein 404
Ash1 to the downstream cis regulatory elements (28). Similarly, onset of Xist expression, 405
followed by its coating on one of the two X-chromosomes, during early female 406
embryonic development, coincides with the recruitment of transcriptional repressors and 407
inactivation of the X-chromosome. It has been shown that A repeat-rich silencing domain 408
at the 5’ end of Xist, and chromatin localizing domains, spread in a redundant fashion all 409
over the gene body of Xist, play a crucial role in the Xist-mediated X-chromosome 410
inactivation (35). On the other hand, mechanisms underlying the antisense noncoding 411
RNAs functions have not been investigated in greater detail. It is yet unclear as to 412
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
whether antisense RNA itself or its transcriptional process as such plays an important role 413
in the transcriptional silencing. However, recent studies on Tsix have provided some 414
important insights into antisense RNA-mediated transcriptional silencing. It has been 415
shown that the production of Tsix antisense RNA has been linked to Xist promoter 416
regulation on the future active X-chromosome. Using RNA immunoprecipitation and 417
chromatin immunoprecipitation experiments, it has been demonstrated that Tsix 418
associates with DNMT-3B and that the promoter region of Xist is also enriched with 419
DNMT3B, indicating that Tsix may be involved in Xist promoter regulation through 420
DNMT3B deposition (30). Interestingly, Tsix antisense RNA effects are restricted to its 421
overlapping sense counter part, Xist. Unlike Tsix, the other long functional antisense 422
RNAs, such as Kcnq1ot1 and Air, are implicated in the transcriptional silencing of not 423
only overlapping genes but also nonoverlapping genes. However, the mechanisms 424
underlying the mode of action of these RNAs have so far not been investigated in greater 425
detail. We discuss the possible implications of our findings in understanding the 426
mechanisms underlying the Kcnq1ot1-mediated long-range transcriptional silencing. 427
One of the most important observations of the present investigation is the identification 428
of a Kcnq1ot1 silencing domain (Kcnq1ot1 SD) at the 5´end of the Kcnq1ot1 antisense 429
transcript. This domain silences genes in an orientation-dependent and position-430
independent manner only when it is located downstream of the antisense promoter but 431
not when it is placed upstream of the antisense promoter. Lack of silencing by the 432
Kcnq1ot1SD upstream of the antisense promoter rules out the possibility that the cis 433
acting DNA sequences of the Kcnq1ot1SD, independently and/or in coordination with the 434
antisense promoter, may take part in silencing, and confirm that antisense transcription 435
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
through the Kcnq1ot1 SD is prerequisite to inducing long-range bidirectional silencing. 436
The orientation-dependent and position-independent silencing by the Kcnq1ot1 SD 437
downstream of the antisense promoter suggests that the primary sequence of the 438
transcribed RNA is crucial for the silencing process and that it has all the information 439
required for inducing the silencing process. Interestingly, a scan for sequences over 52 kb 440
of the more than 90 kb long Kcnq1ot1, revealed no sequences that show silencing activity 441
in a manner similar to the Kcnq1ot1 SD. Based on our observations, we rule out the 442
possible role of transcriptional interference in the Kcnq1ot1 mediated silencing pathway 443
in the episomal context, as we found significant activation of the Hygromycin gene 444
despite an increased expression of mutant Kcnq1ot1 in the PS6A1 when compared to the 445
PS6. In addition, the latter data also rules out the functional role of dsRNA-mediated 446
RNA interference in the bidirectional silencing pathway. To our knowledge, uncovering 447
of functional sequences in Kcnq1ot1 represents first characterization of functional 448
sequences in an antisense RNA. 449
Another important observation that we provide in these investigations is the Kcnq1ot1 450
SD-mediated localization of the episomal DNA sequences in the vicinity of the nucleolar 451
compartment. Perinuclear and perinucleolar compartments have long been suggested to 452
harbor protein factors involved in repressive chromatin formation. Interestingly, the 453
perinucleolar localization of the episomes by the silencing domain occurs as early as 4-5 454
days after transient transfection and their co-localization with the nucleolus increased in 455
the cell lines containing stably propagated episomes, suggesting that the perinucleolar 456
localization of the episomes may be crucial for both establishment and maintenance of 457
Kcnq1ot1 silencing domain-mediated transcriptional silencing. The observations that I) 458
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
RNA and DNA signals colocalize in the perinucleolar region, II) the silencing domain 459
mediates transcriptional silencing through spreading repressive chromatin structures by 460
promoting chromatin interaction, and III) lack of perinucleolar contacts of the episomes 461
as well as loss of repressive chromatin structures over neighboring chromatin regions of 462
the episomes, when Kcnq1ot1 was transcribed in the absence of the Kcnq1ot1 SD, 463
suggest that the Kcnq1ot1 SD establishes the transcriptional silencing through recruiting 464
ribonucleoprotein (RNP) complexes and promoting chromatin interaction, and it 465
maintains the repressive chromatin further through successive cell divisions by 466
translocating the linked episomal sequences to the nucleolar periphery. This specific 467
localization of the episomes by the Kcnq1ot1 SD occurs during mid S phase, indicating 468
that the Kcnq1ot1 SD contact with the nucleolus is regulated in a cell cycle-dependent 469
manner. 470
Interestingly, however, the functional features of the Kcnq1ot1 SD resembles closely that 471
of Xist silencing domain (Xist SD), which was shown to mediate transcriptional silencing 472
on the inactive X-chromosome in an orientation and position-independent manner in an 473
ex vivo ES cell model system (35). Moreover, the Xist SD also displays similar silencing 474
features in the episome-based system, documenting the specificity and reliability of using 475
an episomal-based system in addressing the intricate molecular pathways underlying the 476
function of long antisense noncoding RNAs. Most importantly, perinucleolar targeting of 477
episomal sequences by the Kcnq1ot1 SD is reminiscent of Xist-mediated perinucleolar 478
localization of the inactive X-chromosome. It has been shown that the Xic transgenes 479
maintains the transcriptional silencing of flanking autosomal genes by targeting them to 480
the nucleolar periphery (37). It is yet not clear whether the Xist SD has any functional 481
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
role in perinucleolar targeting of the inactive X-chromosome. However, it has been 482
shown that the Xist SD is required for relocating the linked genes into Xist RNA silent 483
domain (5), indicating that the Xist SD may also have a functional role in perinucleolar 484
targeting of X-linked genes. Both Xist and Kcnq1ot1 silencing domains hardly show any 485
homology at the primary sequence level, indicating similarity at the functional level 486
and/or target-specific interactions. 487
Yet another interesting observation of the current investigation is the characterization of 488
the functional role of conserved motifs in the Kcnq1ot1-mediated silencing process. 489
Mutation or selective exclusion of the previously characterized highly conserved motif 490
A2 results in a relaxation of the silencing of flanking genes, indicating that the A2 motif 491
plays a critical role in the Kcnq1ot1-mediated silencing. More importantly, sequences 492
encompassing the 12 bp A2 motif also play a crucial role in targeting the linked episomes 493
to the nucleolar periphery. M-fold predictions on a sequence containing the wild type A2 494
motif revealed a putative stem loop structure, with the stem mainly formed by the A2 495
motif. However, we did not observe proper stem loop structure with the sequence 496
containing the mutant A2 motif, indicating that secondary structure attained by the A2 497
motif may play a crucial role in the silencing process (data not shown). Although in 498
silico-based m-fold predictions emphasize the functional role of RNA secondary 499
structures in the silencing process, we cannot exclude the possibility that the crucial cis 500
acting elements within the A2 motif may be involved in the formation of repressive 501
chromatin through recruiting transcription factors. We could not, however, detect any 502
sequence motif that shows homology with the A2 motif in the 90 kb long Kcnq1ot1 503
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
transcript, suggesting that the A2 motif itself may be playing a crucial role in the 504
Kcnq1ot1-mediated transcriptional silencing. 505
It is interesting to note that when we flanked the Kcnq1ot1 SD with a chromatin-506
localizing region of Xist, we not only observed a significant increase in the silencing 507
activity, but also increased chromatin interaction of Kcnq1ot1. These observations will 508
have implications in understanding why Xist transcript mediated transcriptional silencing 509
on the inactive X-chromosome is spread over most of the chromosome, in comparison to 510
Kcnq1ot1-mediated silencing, whose effects are restricted only to a 900 kb region. We 511
presume that the limited silencing by Kcnq1ot1 could be due to the lack of high affinity 512
chromatin localizing regions, such as those seen in Xist. Although the Kcnq1ot1 SD 513
mediates chromatin localization, it seems that the affinity is insufficient for chromosome-514
wide silencing. The Xist SD, on the other hand, mediates chromosome-wide 515
transcriptional silencing with the help of chromatin localizing regions which are 516
distributed throughout the transcript in a functionally redundant fashion (35). 517
From the above observations, it appears that the transcriptional silencing that we see in 518
the PS6 episome is mediated by the antisense RNA per se and that in part it mimics the 519
mode of action of Xist. In this model, the Kcnq1ot1 antisense RNA is expressed and coats 520
the chromatin of flanking sequences in cis, followed by the recruitment of 521
heterochromatinization machinery, which in turn targets the linked chromosomal regions 522
to perinucleolar vicinity in order to maintain the repressive chromatin through successive 523
cell divisions (Figure 8). Although, we have shown that repressive chromatin marks over 524
the flanking sequences correlate with its chromatin localizing activity, the ChRIP 525
methodology can not resolve whether the RNA localizes the entire episome in cis or if it 526
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
remain attached at the site of antisense transcription through the Kcnq1ot1 SD. 527
Interestingly, a recent report using high-resolution fiber RNA-FISH and RNA-TRAP 528
demonstrated that the human KCNQOT1/LIT1 transcript coats the neighboring regions of 529
chromatin containing the SLC22A18/IMPT1 and CDKN1C/p57KIP2 genes (20). Taken 530
together, these results show that Kcnq1ot1 mediated transcriptional silencing mimics in 531
part the Xist-mediated X-chromosome inactivation. 532
Taken together, here we provide evidence that demonstrate a critical role for the antisense 533
RNA itself. In sum, mechanistic insights provided in this study represent a first step in 534
understanding the multilayered silencing pathway mediated by the long noncoding 535
antisense RNAs. 536
Experimental Procedures 537
Cell culture, transfection and transcriptional inhibitors: The human placenta derived 538
JEG-3 cells and the human liver-derived Hep-3B cells were maintained in MEM 539
(Invitrogen) as previously described (13). The transfection of plasmid DNA into the JEG-540
3 and Hep-3B cells was performed using a standard CaCl2 method. 541
Please see supplementary information for other experimental procedures. 542
Acknowledgements 543
544
We gratefully acknowledge Prof Wolf Reik for providing the Kcnq1ot1 RNA probe for 545
our studies. We greatly appreciate Dr Joanne Whitehead for critical review of the 546
manuscript. We thank Prof Rolf Ohlsson, Dept of Development and Genetics, Uppsala 547
University, Sweden; Johan Ericsson, Ludwig Institute for Cancer Research, Uppsala, 548
Sweden, and Thierry Grange, Institut Jacques Monod, Paris for help and suggestions. 549
This work was supported by the grants from Swedish Research Council (VR-NT) and the 550
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Swedish Cancer Research foundation (Cancerfonden) to CK. CK is a Senior Research 551
Fellow supported by Swedish Medical Research Council (VR-M). 552
References 553
1. Bell, A. C., and G. Felsenfeld. 2000. Methylation of a CTCF-dependent 554
boundary controls imprinted expression of the Igf2 gene. Nature 405: 482-5. 555
2. Bernstein, E., and C. D. Allis. 2005. RNA meets chromatin. Genes Dev 556
19:1635-55. 557
3. Brown, K. E., S. Amoils, J. M. Horn, V. J. Buckle, D. R. Higgs, M. 558
Merkenschlager, and A. G. Fisher. 2001. Expression of alpha- and beta-globin 559
genes occurs within different nuclear domains in haemopoietic cells. Nat Cell 560
Biol 3:602-6. 561
4. Brown, K. E., J. Baxter, D. Graf, M. Merkenschlager, and A. G. Fisher. 1999. 562
Dynamic repositioning of genes in the nucleus of lymphocytes preparing for cell 563
division. Mol Cell 3:207-17. 564
5. Chaumeil, J., P. Le Baccon, A. Wutz, and E. Heard. 2006. A novel role for 565
Xist RNA in the formation of a repressive nuclear compartment into which genes 566
are recruited when silenced. Genes Dev 20:2223-37. 567
6. Csink, A. K., and S. Henikoff. 1996. Genetic modification of heterochromatic 568
association and nuclear organization in Drosophila. Nature 381:529-31. 569
7. Dernburg, A. F., J. W. Sedat, and R. S. Hawley. 1996. Direct evidence of a role 570
for heterochromatin in meiotic chromosome segregation. Cell 86:135-46. 571
8. Fitzpatrick GV, S. P., Higgins MJ. 2002. Reginal loss of imprinting and growth 572
deficiency in mice with targeted deletion of KvDMR1. Nat Genet 32:426-431. 573
9. Hark, A. T., C. J. Schoenherr, D. J. Katz, R. S. Ingram, J. M. Levorse, and S. 574
M. Tilghman. 2000. CTCF mediates methylation-sensitive enhancer-blocking 575
activity at the H19/Igf2 locus. Nature 405:486-9. 576
10. Harmon, B., and J. Sedat. 2005. Cell-by-cell dissection of gene expression and 577
chromosomal interactions reveals consequences of nuclear reorganization. PLoS 578
Biol 3:e67. 579
11. Heard, E., P. Clerc, and P. Avner. 1997. X-chromosome inactivation in 580
mammals. Annu Rev Genet 31:571-610. 581
12. Kanduri, C., V. Pant, D. Loukinov, E. Pugacheva, C.-F. Qi, A. Wolffe, R. 582
Ohlsson, and A. Lobanenkov. 2000. Functional interaction of CTCF with the 583
insulator upstream of the H19 gene is parent of origin-specific and methylation-584
sensitive. Curr Biol 10:853-856. 585
13. Kanduri, C., N. Thakur, and R. R. Pandey. 2006. The length of the transcript 586
encoded from the Kcnq1ot1 antisense promoter determines the degree of 587
silencing. Embo J 25:2096-106. 588
14. Katayama, S., Y. Tomaru, T. Kasukawa, K. Waki, M. Nakanishi, M. 589
Nakamura, H. Nishida, C. C. Yap, M. Suzuki, J. Kawai, H. Suzuki, P. 590
Carninci, Y. Hayashizaki, C. Wells, M. Frith, T. Ravasi, K. C. Pang, J. 591
Hallinan, J. Mattick, D. A. Hume, L. Lipovich, S. Batalov, P. G. Engstrom, 592
Y. Mizuno, M. A. Faghihi, A. Sandelin, A. M. Chalk, S. Mottagui-Tabar, Z. 593
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Liang, B. Lenhard, and C. Wahlestedt. 2005. Antisense transcription in the 594
mammalian transcriptome. Science 309:1564-6. 595
15. Lee, J. 2003. Molecular Links between X-Inactivation and Autosomal Imprinting: 596
X-Inactivation as a Driving Force for the Evolution of Imprinting? Curr. Biol. 597
13:R242-54. 598
16. Lewis, A., K. Mitsuya, D. Umlauf, P. Smith, W. Dean, J. Walter, M. Higgins, 599
R. Feil, and W. Reik. 2004. Imprinting on distal chromosome 7 in the placenta 600
involves repressive histone methylation independent of DNA methylation. Nat 601
Genet 36:1291-5. 602
17. Mancini-DiNardo, D., S. J. Steele, R. S. Ingram, and S. M. Tilghman. 2003. A 603
differentially methylated region within the gene Kcnq1 functions as an imprinted 604
promoter and silencer. Hum Mol Genet 12:283-94. 605
18. Mancini-Dinardo, D., S. J. Steele, J. M. Levorse, R. S. Ingram, and S. M. 606
Tilghman. 2006. Elongation of the Kcnq1ot1 transcript is required for genomic 607
imprinting of neighboring genes. Genes Dev 20:1268-82. 608
19. Mattick, J. S., and I. V. Makunin. 2006. Non-coding RNA. Hum Mol Genet 15 609
Spec No 1:R17-29. 610
20. Murakami, K., M. Oshimura, and H. Kugoh. 2007. Suggestive evidence for 611
chromosomal localization of non-coding RNA from imprinted LIT1. J Hum 612
Genet. 613
21. Navarro, P., S. Pichard, C. Ciaudo, P. Avner, and C. Rougeulle. 2005. Tsix 614
transcription across the Xist gene alters chromatin conformation without affecting 615
Xist transcription: implications for X-chromosome inactivation. Genes Dev 616
19:1474-84. 617
22. O'Neill, M. J. 2005. The influence of non-coding RNAs on allele-specific gene 618
expression in mammals. Hum Mol Genet 14 Spec No 1:R113-20. 619
23. Pandey, R. R., M. Ceribelli, P. B. Singh, J. Ericsson, R. Mantovani, and C. 620
Kanduri. 2004. NF-Y regulates the antisense promoter, bidirectional silencing, 621
and differential epigenetic marks of the Kcnq1 imprinting control region. J Biol 622
Chem 279:52685-93. . 623
24. Paulsen, M., T. Khare, C. Burgard, S. Tierling, and J. Walter. 2005. 624
Evolution of the Beckwith-Wiedemann syndrome region in vertebrates. Genome 625
Res 15:146-53. 626
25. Prasanth, K. V., and D. L. Spector. 2007. Eukaryotic regulatory RNAs: an 627
answer to the 'genome complexity' conundrum. Genes Dev 21:11-42. 628
26. Rougeulle, C., and E. Heard. 2002. Antisense RNA in imprinting: spreading 629
silence through Air. Trends Genet 18:434-7. 630
27. Sado, T., Y. Hoki, and H. Sasaki. 2005. Tsix silences Xist through modification 631
of chromatin structure. Dev Cell 9:159-65. 632
28. Sanchez-Elsner, T., D. Gou, E. Kremmer, and F. Sauer. 2006. Noncoding 633
RNAs of trithorax response elements recruit Drosophila Ash1 to Ultrabithorax. 634
Science 311:1118-23. 635
29. Sleutels, F., R. Zwart, and D. P. Barlow. 2002. The non-coding Air RNA is 636
required for silencing autosomal imprinted genes. Nature 415:810-3. 637
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
30. Sun, B. K., A. M. Deaton, and J. T. Lee. 2006. A transient heterochromatic state 638
in Xist preempts X inactivation choice without RNA stabilization. Mol Cell 639
21:617-28. 640
31. Szabó, P., S.-H. Tang, A. Rentsendorj, G. Pfeifer, and J. Mann. 2000. 641
Maternal-specific footprints at putative CTCF sites in the H19 imprinting control 642
region give evidence for insulator function. Curr Biol 10:607-610. 643
32. Thakur, N., M. Kanduri, C. Holmgren, R. Mukhopadhyay, and C. Kanduri. 644
2003. Bidirectional silencing and DNA methylation sensitive methylation 645
spreading properties of the KcnqI ICR map to the same regions within the KcnqI 646
imprinting control region. J. Biol. Chem. 273:9514-9. 647
33. Thakur, N., V. K. Tiwari, H. Thomassin, R. R. Pandey, M. Kanduri, A. 648
Gondor, T. Grange, R. Ohlsson, and C. Kanduri. 2004. An antisense RNA 649
regulates the bidirectional silencing property of the kcnq1 imprinting control 650
region. Mol Cell Biol 24:7855-62. 651
34. Umlauf, D., Y. Goto, R. Cao, F. Cerqueira, A. Wagschal, Y. Zhang, and R. 652
Feil. 2004. Imprinting along the Kcnq1 domain on mouse chromosome 7 involves 653
repressive histone methylation and recruitment of Polycomb group complexes. 654
Nat Genet 36:1296-300. 655
35. Wutz, A., T. P. Rasmussen, and R. Jaenisch. 2002. Chromosomal silencing and 656
localization are mediated by different domains of Xist RNA. Nat Genet 30:167-657
74. 658
36. Yang, P. K., and M. I. Kuroda. 2007. Noncoding RNAs and intranuclear 659
positioning in monoallelic gene expression. Cell 128:777-86. 660
37. Zhang, L. F., K. D. Huynh, and J. T. Lee. 2007. Perinucleolar targeting of the 661
inactive X during S phase: evidence for a role in the maintenance of silencing. 662
Cell 129:693-706. 663
664
Figure Legends 665
Figure 1. Identification of a silencing domain at the 5´end of the Kcnq1ot1 antisense 666
RNA. A) shows schematic diagrams of the PH19 and the 3.6 kb Kcnq1 ICR deletion 667
fragments. The PH19 is the parent episome construct, which contains H19 (box with long 668
horizontal stripes) and Hygromycin (box with diagonal stripes) as reporter genes under 669
the regulation of SV40 enhancer (filled circle). PS742/1050/1947 are derivatives of the 670
PH19 episome and contain various portions of 3.6 kb Kcnq1 ICR covering the 1.7 kb 671
Kcnq1ot1 sequence (box with vertical stripes). Arrow represent transcription start site. 672
The SV40 PolyA sequence, depicted as round-headed arrow, inserted 9.2 kb downstream 673
of the transcription start site. (B) The Hygromycin gene activity in PS742, PS1050 and 674
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
PS1947 episome constructs was analyzed by counting the hygromycin resistant cell 675
colonies and is represented as percent expression in relation to the parent construct PH19, 676
The data represents means + standard deviation (SD) of a minimum of six independent 677
experiments. C) Shows the schematic drawings of PGL-Basic and its derivatives, PGL-678
Basic742/1050 /1947. A bar graph showing the relative Luciferase activity of PGL-679
Basic742/1050 /1947 plasmids in JEG-3 cells is shown below. The strength of the 680
promoter activity of the constructs is presented relative to the PGL-BasicCycB2. The data 681
represent means + SD of three independent experiments each performed in duplicate. 682
Figure 2. The Kcnq1ot1 SD at the 5´end of the Kcnq1ot1 antisense RNA silences 683
flanking genes in an orientation and transcription-dependent manner. (A-C) Bar graphs 684
show the activity of Hygromycin and H19 genes, analyzed for each construct. The maps 685
alongside the bar graphs depict the wild-type and mutant forms of the 5.8 kb Kcnq1 ICR 686
which were inserted into the PH19 episome between the H19 and Hygromycin genes. 687
The activity of reporter genes in each construct is shown in percent expression levels and 688
their activities are presented relative to control vectors (PH19 for H19 and Hygromycin 689
genes). The expression levels of H19 were quantified by RPA eight days after transient 690
transfection of wild type and mutant constructs into the JEG-3 cell line. The levels were 691
normalized against total input RNA (using GAPDH control) and episome copy numbers 692
(by Southern hybridization of genomic DNA from the transfected cells with an episome-693
specific probe and an internal β-actin control probe). Hygromycin gene activity was 694
analyzed by counting the hygromycin resistant cell colonies after selection with 695
hygromycin. RPA for H19: mean + SD of three independent experiments; hygromycin 696
resistant colony counts: mean + SD of a minimum of six independent experiments. (D) 697
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
shows that episome encoded Kcnq1ot1 is specifically localized in the nuclear 698
compartment and that selective deletion of the silencing domain from Kcnq1ot1 or 699
truncation of Kcnq1ot1 has no effect on its nuclear localization. E & F) show that the 700
half-life of the episome coded Kcnq1ot1 transcript is 3.2 hours (E) and that selective 701
deletion of silencing domain has no significant effect on the stability of Kcnq1ot1 (F). 702
Figure 3. The search for a Kcnq1ot1 fragment with bidirectional silencing features over 703
52 kb portion of the Kcnq1ot1 transcription unit revealed none of the fragments that have 704
similarities with the Kcnq1ot1 SD. 3A) physical maps depicting the Kcnq1/Kcnq1ot1 705
locus, overlapping fragments of 3-5 kb of Kcnq1ot1 transcription unit used in episome-706
silencing assays, and a diagrammatic presentation of the cloning of the Kcnq1ot1 gene 707
fragments into the PS6A1 episome. 3B) bar graph shows the percentage activity of the 708
Hygromycin gene in PS6A1Kcnq1ot1Frg1-15, analyzed by counting the hygromycin 709
resistant cell colonies. The data represents means + SD of a minimum of three 710
independent experiments. 711
Figure 4. High affinity chromatin attachment regions of the Xist transcript increase the 712
efficiency of bidirectional silencing. (A) A schematic representation of the Xist RNA. 713
The silencing domain containing the A-rich repeats is located at the 5´end of the 714
transcript. The boxes below the map indicate the chromatin localizing regions that have 715
previously been mapped in (35). Figure B-C) schematic maps depicted alongside the bar 716
graphs are the wild type and mutant Kcnq1 ICR fragments (the Kcnq1ot1 SD is either 717
flanked with a high affinity Xist chromatin localizing region or replaced with the Xist SD) 718
were inserted into the PS6 or PS6A1 episomes. The schematic map of the PS4∆H19 719
polyA9.2 construct alongside the bar graph is shown along with the reporter genes. The 720
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
PS6Xist SD+/- represent that the Xist SD was inserted in both positive (+) and negative 721
orientations (-) in PS6A1. Bar graphs show the percentage activity of Hygromycin and 722
H19 genes in the episomes containing wild type and mutant Kcnq1 ICR fragments, 723
calculated as described in Figure 2. The data represents means + SD of three independent 724
experiments 725
Figure 5. Kcnq1ot1 SD mediates transcriptional silencing through regulating the 726
chromatin structure. Quantitative analysis of H3K9Me3 and H3K9Ac profiles using ChIP 727
over the H19 and Hygromycin promoters on crosslinked chromatin obtained from JEG-3 728
cells transfected with PS6, PH19 and PS6A1 episomes. Bar graphs shows percentage 729
enrichment and the data were quantified as described in Experimental Procedures. The 730
data represents mean + SD of 3 independent ChIP experiments. 731
Figure 6. The Kcnq1ot1 SD localizes the linked episomal sequences to the perinucleolar 732
and perinuclear regions. (A) RNA FISH on JEG-3 cells transiently transfected with 733
PS6A13 showing perinucleolar localization of episomes. Kcnq1ot1 probe is detected in 734
green, DAPI staining is in blue. Nucleoli are visible as darker areas in the DAPI staining 735
pattern. Scalebar, 5 µm. (B) and (C) DNA FISH on JEG-3 cells propagated with PS6 (B) 736
or PS6A1 (C) for 30 days under hygromycin selection. Episomal DNA FISH signals are 737
detected in green, DAPI staining is in blue. Scale is as in (A). Representative examples of 738
cells with PS6 signals in close proximity to a nucleolus (B, cell on the left), the nuclear 739
periphery (B, cell on the right), and PS6A1 signals positioned away from these nuclear 740
compartments (C). (D) and (E) RNA immuno-FISH on JEG-3 cells stably propagated 741
with PS6A13 (D) or PS6A14 (E). Green represents episomal-encoded RNA, red 742
corresponds to nucleolar marker nucleophosmin. The outlines of the cells are shown as 743
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
dotted lines. Scale is as in (A). (F) RNA/DNA immuno-FISH on JEG-3 cells stably 744
propagated with PS6A13. Episomal-encoded RNA is in green, DNA is in red, 745
nucleophosmin staining is in blue. The outlines of the cells are shown as dotted lines. 746
Scalebar, 5 µm. 747
Figure 7. Perinucleolar localization of Kcnq1ot1 occurs during mid-S phase. A) 748
Simultaneous detection of episomal DNA by DNA FISH (green) and replication foci by 749
immunostaining for PCNA (red). B) Bar graph showing the percentage nucleolar 750
localization of PS6A13 episomes in early, mid and late S-phase of the cell cycle. The 751
data represent means + SD of three independent experiments, (n=>100). C) Kcnq1ot1 752
interacts with chromatin. Real time quantification of reverse transcribed immuno-purified 753
chromatin-associated RNA suggests that Kcnq1ot1 interacts with chromatin and this 754
interaction is mediated by the Kcnq1ot1 SD. 755
Figure 8. The transcriptional silencing by Kcnq1ot1 requires the linked sequences at the 756
perinucleolar region. Production of Kcnq1ot1 on the paternal chromosome results in the 757
recruitment of heterochromatic machinery by the Kcnq1ot1SD. Subsequently, the 758
heterochromatic machinery associated with the antisense RNA (shown in green 759
squiggles) mediates the chromatin interaction in a manner analogous to the Xist 760
transcript, resulting in the spreading of heterochromatic histone modifications (red blobs) 761
in a Kcnq1ot1-dependent manner in cis. Then the Kcnq1ot1 transcript and associated 762
heterochromatic machinery guides the linked chromosomal domain to the perinucleolar 763
region during mid S phase in order to maintain bidirectional transcriptional silencing of 764
flanking genes (red and green arrow heads indicate silenced and active status of a gene, 765
respectively) through successive cell divisions. 766
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
PH19
Orip
(origin of replication)H19 Hygrom SV40 enhancer
20 40 60 80 100 120 140 160 180 200
PGL-Basic
PGL-Basic742
PGL-Basic1050
PGL-Basic1947
Relative Luciferase activity (fold activation)
20 40 60 80 100
Relative no. of Hygromycin-resistant
colonies (%)
PH19
PS742
PS1050
PS1947
3.6 kb Kcnq1 ICR
1947
1050
742
Figure 1
A
B
PGL-BasicCycB2
PS4polyA9.2
PolyA
(1.7 kb Kcnq1ot1 sequence; 1897-3625)
PGL-Basic
Kpn1 BglII
PGL-Basic1947/
PGL-Basic1050/
PGL-Basic742
Luciferase
1947
1050
742
++
PS1947/
PS1050/PS742
Luciferase Kcnq1 ICR
deletion Fragments
H19 Hygrom
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
20 40 60 80 100
20 40 60 80 100
20 40 60 80 100
Relative no. Hygromycin-resistant
colonies (%)
20 40 60 80 100
PS6A1
PS6A2
PS6A3
PS6A4
PH19
PS6A0
PS6
Percentage activity of H19
PS6
PH19
Percentage activity of H19
PS6A6
PS6A7
PS6A8
PS6A9 PS6A10
PS6A11
PS6A12
Orip H19 Hygrom
Kcnq1 ICR
SV40 enhancer
PS6A5
PolyA
PS6
PS6A15
PS6A16
CTTGGATCCGAGTTGGGTGTGTGTATGTGTGGGTCTACAGTGGTTCCGAGTCTAGAGT T TT TTTT CT (A1 motif )
A1mt
(A2 motif )
A2mt
20 40 60 80 100
Percentage activity of H19
PS6
PH19
Relative no. Hygromycin-resistant
colonies (%)
Relative no. Hygromycin-resistant
colonies (%)
Figure 2
A)
C)
B)
Kcnq1ot1 (11.4 kb)
PS6A13
PS6A14
20 40 60 80100120
PS4polyA4.9A1
Nuclear-
specific
human
rRNA
GAPDH
Kcnq1ot1
PS
4poly
A1.7
PS
6
-RN
A
PS
4poly
A1
.7
PS
6
Nuclear Fraction Cytoplasmic Fraction
PS
6A
1
PS
6A
1
PS
4poly
A1
.7
PS
6
PS
4poly
A1.7
PS
6
Nuclear Fraction Cytoplasmic Fraction
PS
6A
1
PS
6A
1
D)
-20
0
20
40
60
80
100
120
0 2 4 6 8 10
ActD treatments (in hours)
Fra
ctio
n of
RN
A r
emai
ned
Kcnq1ot1
0
20
40
60
80
100
120
0 2 4 6 8 10
ActD treatment (in hours)
Fra
ctio
n R
NA
rem
aine
d
Kcnq1ot11
Kcnq1ot1 stability in PS6A1
Kcnq1ot1 stability in PS6E)
F)
PS4polyA4.9
3402 2514
1897
3402
3402
3402 2943
2806
2650
1897 5.8 kb Kcnq1 ICR (PS6)(1.7 kb Kcnq1ot1 sequence; 1897-3625)
(1.1 kb Kcnq1ot1 sequence; 2479-3625)
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
20 40 60 80 100 120 140
Percentage activity of Hygromycin
PS
6A
1
Kcnq1ot1
frgs (1
-15)
PS
6A
1K
cnq1ot1
Frg
s (1
-15)
Kcnq1ot1
Kcnq1ot1
frgs (1
-15)
PS6A1Kcnq1ot1Frg2
PS6A1Kcnq1ot1Frg1
PS6A1Kcnq1ot1Frg3
PS6A1Kcnq1ot1Frg4
PS6A1Kcnq1ot1Frg5
PS6A1Kcnq1ot1Frg6
PS6A1Kcnq1ot1Frg7
PS6A1Kcnq1ot1Frg8
PS6A1Kcnq1ot1Frg9
PS6A1Kcnq1ot1Frg10
PS6A1Kcnq1ot1Frg11
PS6A1Kcnq1ot1Frg12
PS6A1Kcnq1ot1Frg13
PH19
PS6
PS6A1
52 k
bK
cnq1
AB
PS6A1Kcnq1ot1Frg14
PS6A1Kcnq1ot1Frg15
90
kb
Fig
ure
3
ACCEPTED on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
20 40 60 80 100 20 40 60 80 100
Relative no. Hygromycin-resistant
colonies (%)
PS6A1
PH19
PS6
Percentage activity of H19Kcnq1 ICR
PolyA
PS6
20 40 60 80 100 20 40 60 80 100
Relative no. Hygromycin-resistant
colonies (%)
PH19
PS6
Percentage activity of H19Kcnq1 ICR
PolyA
PS6
PS6A5
PS6A1xc4.4
PS6xc4.4
PS6A1Xist SD+
PS6A1Xist SD-
A -repeat rich
silencing domainChromatin localizing region
Xist
xc4.4
Figure 4
A)
B)
C)
H19 HygromOrip
Kcnq1ot1(11.4)
Kcnq1ot1(11.4)
= Chromatin localizing region (Xist)
= Xist silencing domain(Xist SD)
= SV40 PolyA
= Kcnq1ot1 silencing domain
PS4 H19polyA9.2
Kcnq1ot1 (6.2 kb)
Kcnq1ot1 (6.25 kb)
5’ 3’
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Figure 5
0
5
10
15
20
25
30
35
PS
6P
H1
9
PS
6P
H1
9
PS
6P
H1
9
PS
6A
1
PS
6P
H19
PS
6P
H1
9
PS
6P
H1
9
H3K9Me3 H3K9Ac Serum H3K9Me3 H3K9Ac Serum
H19 promoter Hyg Promoter
PS
6A
1
PS
6A
1
PS
6A
1
PS
6A
1
PS
6A
1
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Figure 6
B C
D E
F
A
ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Figure 7 20 40 60 80 1
00
Early S
ph
ase
Mid
S p
ha
se
Late
S p
ha
se
A)
B)
20 40 60 80 100
Percentage enrichment
RN
aseA
PH19
PS4PA1.7
PS6
PS6A1
PS6xc4.4
(Kcnq1ot1)C)ACCEPTED
on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Paternal
locus
Maternal locus
Kcnq1ot1 gene
Kcnq1ot1 gene
Nucleolus
Kcnq1ot1 RNA
Heterochromatin complex
Repressive histone
modifications
Active gene
Repressed gene
Figure 8
CpG methylation
ACCEPTED on February 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from