Post on 26-Jan-2016
description
transcript
Lipase: protein that hydrolyses lipids
Polymerase: protein that builds polymers
Ligase: protein that ligates DNA fragments
Proteinase or protease: protein that hydrolyses proteins
DNase: protein that hydrolyses DNA
RNase: protein that hydrolyses RNA
Naming enzymes
Quiz 1 closes tomorrow morning 9 am
Tomorrow 4 pm in T4 Prac room: safety and lab induction by Vance Lawrence
Basic methods
PCR and mutation
Lecture 4
Adapted from David Tscharke @ RSB
Lecture overview
Hybridisation
-Melting temperature
Cutting DNA
-Restriction endonucleases
Polymer chain reaction (PCR)
-hybridisation
-DNA amplification
-mutation
Watson and Crick
Nucleic acid base-pairing relies on hydrogen bonds being stronger than the repulsive force of the –ve charge on the backbones
Base pairing is reversable
DenaturationMelting
HybridisationAnnealing
Renaturation
Manipulating base pairing
Low saltHigh tempHigh pH
Low ‘G+C’
High saltLow temp
High ‘G+C’
Hybridisation jargon I
Tm: temperature at which hybrids are 50% melted-Equilibrium point between melting and annealing
Hybridisation jargon II
Stringency: ease at which hybrids form-Stringent conditions favour fidelity
Tm is used to standardize stringency
There are two rules to work out Tm
-one for short lengths of DNA-one for longer (> 30 bp) lengths
Coming to a tute near you soon!
Primer design
Calculating Tm (in oC)
For fragments > 30 bp• DNA-DNA hybrids:
– Tm = 16.6log[Na+] + 0.41(%G+C) + 81.5
• RNA-RNA hybrids:
– Tm = 79.8 + 18.5log[Na+] - 0.584(%G+C) + 11.8(%G+C)2
• DNA-RNA– The average of DNA-DNA and RNA-RNA
For short DNA (oligonucleotides)• Rule of thumb: 4 (# of C or G) + 2 (# of A or T)
– Assumes physiological salt (0.9% NaCl or ~100 mM)
Stringency and fidelity
mismatches tolerated hi-fidelity
DNA sequence(A)
Non-stringent (Tm – 30 ºC) Stringent (Tm – 15 ºC)
Alberts
temperature
rises
DNA sequences(A – F)
The key is to bias the outcome
If you want highly stringent hybridisation- keep temperature high- in some applications can use lower salt- in some applications can add formamide- can sometimes choose sequence
If you want ‘sloppy’ hybridisation- use lower temperature
PCR
Revolutionized molecular biology
PCR is a polymerase-based method
Polymerases need?
DNApol
3’ 5’
5’ 3’
- Primers
- dNTPs (dATP, dCTP, dGTP, dTTP)
- The right buffer / temperature conditions
Same goes for PCR
Both strands of DNA are copied in PCR
5’ 3’
3’ 5’
+ 2 primers+ polymerase+ dNTPs
3’ 5’
5’ 3’
Denature
The copying is repeated…Old and new DNA strands can be templates
Denature Primers, pol, dNTPs all still there!
original template
original template
orig.
orig.
The primers define the length of the copies made from the new templates
PCR is a dance with 3 steps
Time (min)
Temperature(ºC)
1 2 3 4 5 6 7
50
60
70
80
90
100
Adapted Brown 9.6
Annealing
Denaturation
Extension
What kind of enzyme works at 72 oC?In the beginning, PCR used Klenow subunit-C-terminal part of E. coli Pol I-Not heat stable-DNA synthesis done at 37 oC-More had to be added in every cycle
The breakthrough came from Thermus aquaticus-Likes it hot-Has a polymerase that works best at 72 oC = Taq-Allowed automation of PCR-Higher stringency for primer binding-Taq named ‘molecule of the year’ in 1989 by Science
Theory versus realityDNA amplification by PCR is not exponential-Approaches exponential for first ~20 cycles
Number of cycles0 10 20 30 40
Amount ofPCR
product
Limitations to amplificationLimitation of primer or nucleotides-Amount of primers and nucleotides in the reaction mix can become exhausted
Lifetime of the polymerase-Even Taq doesn’t like 94 oC for too long
Competition between template and primer-Newly synthesised DNA strands compete with the primers for annealing to the DNA for use as template
Limitations associated with TaqOnly good for relatively short stretches-Error rate is about 1 in 9,000 nucleotides-5 kb is about the limit for Taq
PCR products have errors-Errors made in early cycles are multiplied-1 in every 300 bp by the end of 30 cycles
Both problems arise because Taq lacks ‘proof-reading’ ability-3’ → 5’ exonuclease activity to remove misincorporated bases-Some errors cause Taq to stall
Alternatives to TaqA variety of thermostable polymerases that have proof-reading ability have been found-Essential if fidelity of sequence is important
Taq remains the most commonly used polymerase for PCR-Cheap, robust
Vent is a polymerase with 3’→5’ proof-reading -Similar cost as Taq but 10-fold higher fidelity
Phusion is a polymerase with 3’→5’ proof-reading-50-fold lower error rate than Taq-Can amplify 10 kb plasmids reliably-3 times more expensive than Taq
Controls for PCRPCR turns a few copies into hundreds of millions
Any error made in the beginning is also amplified
Contamination of product into reagents is a hazard-A big issue in diagnostic and forensic applications-Separate rooms can be used for DNA extraction, reaction preparation and analysis of products-Be skeptical of PCR-based claims
A ‘water’ control is essential if you are claiming detection of a DNA sequence by PCR
For preparative PCR, contamination is less of an issue-e.g. just making more of a particular DNA sequence
Parameters that affect PCR
Primers and annealing temperature most important
Easy when starting from plasmid rather than genomic DNA
EVERYTHING!
Choosing the right parameters
Too short = lack of specificity-A given 8-mer appears ~46,000 times / genome by chance
Too long = annealing temperature becomes too high-Also… longer primers are more likely to have errors-…and you’ll go broke (oligos are charged by the bp)
17 – 25 bp is usually good
Want Tm to be around 55 – 65 oC-Tm more important than G+C content
- Choose closer to 50% G+C if you have the choice- 3’-end should be a G or C if possible
Avoid runs (AAAAA or CCCC) and self-complementarity
Choosing the right primer pair
Naming is with respect to the sequence of the TOP strand-Primers (like all DNA) written 5’ → 3’-Sense primer will have the same sequence as the top strand-Anti-sense primer will be the complement of the top strand
Match Tm
-Compensate for GC differences by changing lengths
Avoid pairs that bind to each other
5’
3’
3’
5’
Sense, 5’ or forward primerBinds to the BOTTOM strand
Anti-sense, 3’ or reverse primerBinds to the TOP strand
Choosing the right annealing temperature
Too low promotes promiscuous priming-Non-specific products
Too high and you get no priming
Rough calculation of Tm (in oC)4x(# of G or C) + 2x(# of A or T)
Annealing temperature is generally between Tm and Tm – 5 oC
Can have only one annealing temperature!- Must be OK for both primers
The problem of mispriming in early cycles
This wrong DNA now has a perfect primer sequence on the endWill propagate as efficiently as the desired product in future cycles
CGTTGCTGATAGGATC
GCA CGA TAT CTAGT G
Primer
Template(wrong) T
CGTTGCTGATAGGATC
GCAACGACTATCCTAG
Primer
Template
Refinements
For fidelity It’s most important to reduce mispriming in early cycles: Hot-start - combine reagents cold and start the first cycle by placing sample in a well that has been pre-heated at 94 oC - stops mispriming as the sample warms up in first cycle
PCR success / failure
Well designed primers, good quality template-Little trouble-Little need for optimisation or refinement-It just works
Bad primers or tricky templates (e.g. high G=C)-Big trouble-Lots of optimization-Much misery!
Summary
PCR is a powerful technique that allows amplification of a chosen sequence of DNA-Each new strand of DNA can become a template
The power of PCR is also its Achilles heel-Controls without input template are important-Taq is an error-prone enzyme-Errors in early cycles are amplified
Good primers and the right annealing temperature are the key to successful PCR-Adequate Tm for primers, suitable annealing temperature
Changing the nucleotide sequence by PCR
New restriction sites
Site-directed mutagenesis
PCR can add new ends to insert
The 5’ end of a PCR primer does not need to match the template
AGGCCTGGAATGCGCTAATGACTGTCCGGACATGCTCCTTACGCGATTACTGACAGG
CGAGAATTC
3’ 5’
5’
3’
New ends by PCR
Add useful restriction sites to the 5’ end of primers-Make sure the Tm of the template-specific part is still OK-If adding RE, need extra bases so the RE site is not right on the end
Always:purify PCR product (agarose gel)purify linearized vector (agarose gel)
AGGCCTGGAATGCGCTAATGACTGTCCGGACATGCTCCTTACGCGATTACTGACAGG
CGAGAATTC
3’ 5’
5’
3’
EcoRI
Protein mutation by PCR I
Selectively replace a codon for a new one
PCR with mutation primers-Mismatch at the mutation site
z
2 PCR reactions1.Red primers2.Blue primers
z
z
z
z
z
z
Protein mutation by PCR II
- Amplification of full-length product
Mixing and annealing the PCR products
During 3rd PCR with the original terminal primers-Primer extension completes one of the duplexes
z
Protein mutation by PCR III
Good mutation primers -have about 1.5 times more nucleotides downstream than upstream of the mutation site-match the Tm of the other primers -end with a G or C at the 3’ end
z
AGGCCTGGAATGCGCTAATGACTGTCCGGACATGCT5’ 3’ GCGATTACTGAACAGCCTGTA 5’3’
PCR primers
$0.4 per nucleotide
Up to 30mer is usually reliable
Up to 60mer may be OK-Longer sequences need gel purification-Much longer sequences need confirmation by sequencing
A good primer makes a GC base pair at the 3’ end
Summary
PCR for changing DNA and mutating proteins-Primer design
Add/insert/delete nucleotides
-Only Tm of matching segments matters
-Inserts and deletions of any length possible