Post on 17-Aug-2018
transcript
www.exiqon.comwww.exiqon.com
microRNA Knockdown
microRNA Expression Profi ling
microRNA Profi ling Services
microRNA Detection
microRNA ResearchmiRCURY™ LNA Products
911851 - microRNA katalog v.1.3.1 1911851 - microRNA katalog v.1.3.1 1 26/01/07 11:34:5726/01/07 11:34:57
www.exiqon.comwww.exiqon.com2
Table of ContentsContact information ........................................................................2
About microRNAs .............................................................................3
Overview of miRCURY™ LNA Products .....................................4
miRCURY™ LNA microRNA Knockdown ...................................5
miRCURY™ LNA microRNA Profi ling ..........................................7
miRCURY™ microRNA labeling kits .....................................9
miRCURY™ LNA microRNA Profi ling Services ......................10
miRCURY™ LNA microRNA Detection
Northern blotting ...................................................................12
in situ hybridisation ................................................................13
General Conditions .......................................................................15
MicroRNA Research with miRCURY™ LNA microRNA Products
Contact Information Outside North America:Business Hours:
0830 – 1630 Central European Time (GMT +100)
Mailing address:
Exiqon A/S
Bygstubben 9
2950 Vedbaek, Denmark
Ordering:
Phone: +45 45 65 09 29
Fax: +45 45 66 18 88
Email: order@exiqon.com
Technical Assistance:
Phone: +45 45 65 09 29
Fax: +45 45 66 18 88
Email: support@exiqon.com
General Inquiries:
Phone: +45 45 65 09 29
Fax: +45 45 66 18 88
Email: support@exiqon.com
Contact Information North America:
Business Hours:
0830 - 1630 Eastern Standard Time
Mailing address:
Exiqon, Inc.
600 West Cummings Park · Suite 1650
Woburn MA 01801
United States
General Enquiries and Technical Assistance:
Phone: +1 781 376 4150
Fax: +1 781 376 4152
Toll free: +1 888 miRCURY
Email: support@exiqon.com
About ExiqonExiqon is a leading supplier of high-value gene expression
analysis products for the life sciences, research and drug
discovery industries. Exiqon’s rapidly growing product
off erings integrate innovative chemistries with webbased
software tools to help scientists achieve rapid and reliable
results. Exiqon markets its products directly on
www.exiqon.com, or through distributors, and partners
its proprietary Locked Nucleic Acids (LNA™) and
Anthraquinone (AQ-Link™) technologies through industry
leaders. Exiqon is located in the Medicon Valley area
of Copenhagen, Denmark and has an offi ce in Boston,
United States.
911851 - microRNA katalog v.1.3.2 2911851 - microRNA katalog v.1.3.2 2 26/01/07 11:35:0526/01/07 11:35:05
www.exiqon.comwww.exiqon.com 3
What are microRNAs?MicroRNAs (miRNAs) have rapidly emerged as an
important class of short endogenous RNAs that act as
posttranscriptional regulators of gene expression by
base-pairing with their target messenger RNAs (mRNAs).
In the cytoplasm of the cell, miRNAs are typically found
in the mature form as 19-25 nucleotide (nt) RNAs that
have been processed sequentially from longer hairpin
transcripts by the RNAse III ribonucleases Drosha and
Dicer.
To date more than 4000 miRNAs have been annotated
in vertebrates, invertebrates and plants and many
miRNAs that correspond to putative genes have also
been identifi ed. Some miRNAs have multiple loci in
the genome and occasionally, several miRNA genes
are arranged in tandem clusters. Recent bioinformatic
predictions combined with array analyses, small RNA
cloning and Northern blot validation indicate that the
total number of miRNAs in the diff erent vertebrate
genomes is signifi cantly higher than previously estimated
and maybe as high as 1000.
About microRNAs
A signifi cant role in gene regulationInitial studies indicate that miRNAs may regulate as much
as 30% of all genes in the genome, thus comprising a
totally new level of gene regulation. miRNAs have already
been found to play important roles in several types of
cancers and in tissue diff erentiation.
MicroRNA researchThe study of miRNAs represents a new area for research
of post-transcriptional control. Perturbed expression of
miRNAs has been implicated in cancer and other diseased
states, such as viral infection. An understanding of
miRNAs appears promising as a basis for diagnostics and
provides novel targets for treating disease. There is a clear
need to better understand the role and signifi cance of
miRNA for control of gene expression.
A representation of microRNA biogenesisReprinted by permission of Federation of the European Biochemical
Societies from ”MicroRNA function in animal development“ by Erno
Wienholds and Ronald H.A. Plasterk, FEBS Letters, Vol 579, 5911-5922,
Copyright 2005.
911851 - microRNA katalog v.1.3.3 3911851 - microRNA katalog v.1.3.3 3 26/01/07 11:35:0726/01/07 11:35:07
www.exiqon.comwww.exiqon.com4
SAMPLE
miRCURY™ LNA
microRNA Knockdown
SAMPLE
miRCURY™ LNA Detection
Data Validation and Refi nement
Exiqon’s miRCURY™ LNA microRNA products provide the
perfect basis for studying short nucleic acid targets. The
key to this is the nucleotide analog Locked Nucleic Acid
(LNA™).
What is a Locked Nucleic Acid?Locked Nucleic Acids
(LNA™) are a class of nucleic
acid analogues in which
the ribose ring is “locked”
by a methylene bridge
connecting the 2’-O atom
with the 4’-C atom (see
structure right).
LNA™ nucleosides contain the six common nucleobases
(T, C, G, A, U and mC) that appear in DNA and RNA and
thus are able to form base-pairs according to standard
Watson-Crick base pairing rules. Oligonucleotides
incorporating LNA™ have increased thermal stability
and improved discriminative power with respect to their
nucleic acid targets.
LNA™ can be mixed with DNA, RNA and other nucleic
acid analogs using standard phosphoramidite synthesis
chemistry. LNA™ oligonucleotides can easily be labeled
with standard oligonucleotide tags such as DIG,
fl uorescent dyes, biotin, amino-linkers, etc. Thus a very
high degree of freedom in the design of primers and
probes exists.
Overview of miRCURY™ LNA Products
The LNATM advantageIt has been known for a long time that LNA-based probes
show particular advantageous properties when used
in the detection of short RNA and DNA targets, or short
sequences within larger targets
Exiqon has been able to exploit the uniquely high
affi nities that LNA-based probes have for miRNAs in our
range of miRCURY™ LNA products for microRNA research.
This technology is the basis for microRNA functional
studies through miRCURY™ LNA Knockdown probes,
microRNA profi ling with miRCURY™ LNA Arrays, and
miRNA detection through miRCURY™ LNA microRNA
in situ hybridisation and Northern blot probes.
LNATM
Tm increase/monomeragainst DNA (°C)
2.0-6.0
Tm increase/monomeragainst RNA (°C)
3.0-8.0
ΔTm at single mismatch against DNA (°C)
LNA>>DNA
Compatible with standard molecular biology
Yes
Water solubility High
SAMPLE
miRCURY™ LNA
microRNA Knockdown
miRCURY™ LNA Real Time PCR
0.8
0.6
0.4
0.2
0
0 10 20 30 40
Figure of hsa-mir-124a expression in human brain kindly contributed
by Dr. Zissimos Mourelatos, UPenn, Philadelphia, USA.
911851 - microRNA katalog v.1.3.4 4911851 - microRNA katalog v.1.3.4 4 26/01/07 11:35:0826/01/07 11:35:08
www.exiqon.comwww.exiqon.com 5
At a glance: Eff ective and sequence-specifi c antisense inhibition
of miRNA
Minimal cytotoxicity
Compatible with standard cell transfection methods
Increased biological stability
Knockdown of microRNAsKnockdown of miRNAs represents one of the most
appropriate methods to determine miRNA function and
the validation of putative miRNA targets. Due to the fact
that miRNAs repress protein expression at the level of
mRNA, knockdown of a miRNA will typically lead to an
increase in target protein expression. This can be a useful
tool in identifying mRNA transcripts predicted to be
miRNA targets by bioinformatics
miRCURY™ LNA microRNA Knockdown
miRCURY™ LNA microRNA Knockdown probes:
Confi rm or determine miRNA function
A: 2-fold decrease in miR-223 levels observed in NB4 cells treated
with a miRCURY™ LNA microRNA Knockdown probe against miR-223
compared to a control probe against miR-126 not expressed in the
cells (U6 loading control). B: Knockdown of miR-223 at 2 diff erent
conditions produce a 30-40% reduction of CD11b expression levels
while maintaining the level of CD14 unaltered. Reprinted from Cell, 123,
Fazi et al, A Minicircuitry Comprised of MicroRNA-223 and Transcription
Factors NFI-A and C/EBPa Regulates Human Granulopoiesis; 819-831,
Copyright 2006 with permission from Elsevier.
Effi cient uptake of fl uorochrome-labelled miRCURY™ microRNA
LNA knockdown probes into human K562 cells. The LNA™
enhanced knockdown antisense oligonucleotides are readily
transfected into cells by any standard transfection method
e.g. electroporation and lipid mediated. The image shows
electroporated cells and is kindly provided by Dr. Jens Eriksen,
Laboratory of Oncology, Herlev University Hospital, Denmark.
Specifi c Knockdown of microRNAKnockdown probes for miRNA need to be highly specifi c,
eff ective at physiological temperatures and non-toxic.
Exiqon’s miRCURY™ LNA microRNA Knockdown
technology enables sequence-specifi c inhibition of
mature miRNAs in vitro and in vivo. LNA-based probes
consistently show improved antisense effi cacy and higher
Tm’s towards their complementary single-stranded RNA
targets compared to 2’-O-methyl oligonucleotides. Using
our expertise in bioinformatics design of LNATM probes,
along with in-house research, we have optimally designed
each miRCURY™ LNA microRNA Knockdown probe to be
as specifi c for its target as possible.
The increased affi nity of miRCURY™ LNA microRNA
Knockdown probes means that they are eff ective at
physiological temperature. Furthermore, they can be
used at a low concentration, thus minimizing potential
cytotoxic eff ects.
Depletion of miRNAs can be judged in a number of ways:
by the decrease in signal of the target miRNA on an array,
specifi c for miRNAs by the absence of binding of an in situ
hybridisation probe, and by the decrease in hybridisation
signals in Northern blots as LNA-miRNA hybrids are
thermally stable in denaturing gels. De-repression of the
cognate target protein expression is another indicator of
successful miRNA knockdown.
25
20
15
10
5
0CD11b+
10-8 MRA 10-6 MRA
- - -CD14+ CD11b+
LNA-126 LNA-223
CD14+
fold
ind
uct
ion
A
B
miR-223
U6
LNA-126 LNA-223
911851 - microRNA katalog v.1.3.5 5911851 - microRNA katalog v.1.3.5 5 26/01/07 11:35:1426/01/07 11:35:14
www.exiqon.comwww.exiqon.com6
Published Research using miRCURY™ LNA Knockdown ProbesIn one of the fi rst examples of a
publication using miRCURY™ LNA
microRNA Knockdown probes, Fazi
et al. (Cell 123, 819-831), hsa-mir-223
levels were reduced two-fold using
a miRCURY™ LNA microRNA
Knockdown probe. This lead to
reduced expression of CD14+,
demonstrating that hsa-mir-223 is an important
modulator of human myeloid diff erentiation.
Ørum et al. (Gene 372, 137-141) showed that miRCURY™
LNA-based microRNA Knockdown was used to up-
regulate the expression of Hid protein in KC 167 cells from
Drosophila melanogoster. Naguibneva et al. (Nature Cell
Biology 8, 278-284), demonstrated eff ective knockdown
of hsa-mir-181, with a demonstrable eff ect on myoblast
diff erentiation.
Product DescriptionEach miRCURY™ LNA microRNA Knockdown probe is a full
length complementary probe to it’s miRNA target. Every
probe is an LNA-enhanced oligonucleotide, designed
using Exiqon’s in-house design software.
5 nmole of probe is provided in RNAse-free water,
allowing direct application in standard transfection
protocols.
Probes are available with a choice of labels: unlabeled
probes are available, termed ‘Ready to label.’ This means
that the probes can be enzymatically labeled with e.g.,
kinase or ligase.
Effi cient knockdown of hsa-miR-204 - known to be involved in cell proliferation - using a microRNA specifi c miRCURY™ LNA microRNA Knockdown
probe against miR-204 as judged by A: A signifi cant decrease in cell number and in the proliferation rate using Cell Proliferation Reagent WST-1
(Roche) and B: A signifi cant increase in caspase activity using the Homogenous Caspase Assay (Roche). The HeLa cells were transfected using
X-tremeGENE siRNA Transfection Reagent (Roche). Data taken from Watzele et al, Biochemica, 2006. (wo tfx = without transfection reagent)
miRCURY™ LNA microRNA Knockdown
400%350%300%250%200%150%100%
50%0%
wo tfx miR 2045 pmol
scrambled5 pmol
Caspase normalised to WST-1 Caspase normalised to cell number
scrambled11 pmol
miR 20411 pmol
Ca
spa
se n
orm
ali
sed
120%
100%
80%
60%
40%
20%
0%wo tfx miR 204
5 pmolscrambled
5 pmol
WST-1 cell number
scrambled11 pmol
miR 20411 pmol
WS
T-1
or
cell
nu
mb
er
*”Ready to label” means that the miRCURY™ LNA microRNA Knockdown
probe can be enzymatically labeled with the detection moiety of choice.
For example, nucleotides labeled with DIG, radiolabel, biotin or fl uorophores.
Pre-designed miRCURY™ LNA microRNA
Knockdown probes
are available for all known miRNAs as registered and
annotated in the miRNA Registry (miRBase) at The
Wellcome Trust Sanger Institute (http://microrna.sanger.
ac.uk/).
Custom miRCURY™ LNA microRNA Knockdown probes
are available for all other microRNAs and other small
RNAs.
Control miRCURY™ LNA microRNA Knockdown probes
are available. Please go to www.exiqon.com
Ordering: Go to www.exiqon.com/shop. Select your
miRCURY™ LNA microRNA Knockdown product by
Product Number, name of microRNA (must be entered
exactly as given in the Sanger miRNA registry, e.g.
“hsa-mir-1”) or sequence. (For example, ordering a
miRCURY™ LNA microRNA Knockdown probe for hsa-
mir-1 can begin by entering 118008-00, hsa-miR-1 or
UGGAAUGUAAAGAAGUAUGUA into the search window.
Product no. Product Description Label
XXXXXX-00 miRCURYTM LNA microRNA Knockdown, 5 nmole Ready to Label*
XXXXXX-02 miRCURYTM LNA microRNA Knockdown, 5 nmole 5’-amino
XXXXXX-04 miRCURYTM LNA microRNA Knockdown, 5 nmole 5’-fl uorescein
XXXXXX-06 miRCURYTM LNA microRNA Knockdown, 5 nmole 3’-amino
XXXXXX-08 miRCURYTM LNA microRNA Knockdown, 5 nmole 3’-fl uorescein
A B
911851 - microRNA katalog v.1.3.6 6911851 - microRNA katalog v.1.3.6 6 26/01/07 11:35:1626/01/07 11:35:16
www.exiqon.comwww.exiqon.com 7
At a glance Tm-normalized, LNA-enhanced capture probes
Works on just 1μg total RNA
No need for miRNA enrichment
Reduced sample handling
Use less sample, get reliable results and save time
Microarrays represent one of the fastest and most
comprehensive methods for determining the miRNA
profi le of a sample. It has been argued that the miRNA
profi le of a sample can be used as a ‘signature’ that can be
used as a basis for diagnosis. The miRCURY™ LNA Array
provides the ability to conduct genome-wide profi ling of
miRNA in samples. It can be used to identify signatures
associated with cancer, tissue profi ling, drug profi ling,
development up- and down-regulation of miRNAs.
The superior alternative to DNA-based arrays for microRNA profi lingmiRCURY™ LNA Arrays have been designed to address
issues faced when using DNA-based oligonucleotide
capture probes for the profi ling of miRNAs. Specifi cally,
DNA-based methods require miRNA enrichment and
signal amplifi cation methods due to the lower affi nity
of DNA oligonucleotides for short nucleic acid targets.
Furthermore, there is limited fl exibility for producing a
Tm-normalized capture probe set for such short targets as
miRNA with DNA-based oligonucleotides.
Tm-normalized capture probesThe capture probes used in the miRCURY™ LNA Arrays
use Exiqon’s LNA™ design expertise to produce Tm-
normalized, high affi nity capture probes – Tm of 72°C
- ensuring all miRNA targets hybridise to the array
with equal affi nity at the high-stringency hybridisation
temperature of 60°C.
Profi le microRNA with just 1 μg of total RNA - no need for microRNA enrichment:miRCURY™ LNA Arrays require just 1μg of total RNA
to obtain an accurate miRNA profi le without miRNA
enrichment saving time and reducing the possibility of
losing miRNAs during sample prep. Removing the miRNA-
enrichment step allows time-saving and reduces the
possibility of miRNA-enrichment artefacts from aff ecting
your data.
miRCURY™ LNA Array Workfl ow
miRCURY™ LNA Arrays require only 1 μg of total RNA to profi le
microRNAs
Identical miRNA profi les are produced from starting amounts of total RNA
that span the range of 10μg to 1μg, without miRNA enrichment. 17 diff erent
miRNAs, detected in human lung total RNA are represented. Numbers in the
top right hand of each box show the amount of total RNA used to produce
each profi le.
miRCURY™ LNA Array microRNA Expression Profi ling
miRCURY™ LNA Arrays:
the fastest and most accurate way for microRNA profi ling
24
ho
urs
1. Prepare RNA sample
Total RNA sample
(Use 1 – 10 μg, total RNA).
miRNA enrichment is
optional.
2. Label RNA sample with
Hy3TM/Hy5TM dyes.
Uniform and robust
miRNA labeling in
90 minutes
3. Hybridise overnight
4. Obtain the microRNA
profi le of your sampleLo
g2
( F
luo
resc
en
ce in
ten
sity
)
microRNA targets
16
14
12
10
8
6
4
2
0
10μg 5μg 2μg 1μg
911851 - microRNA katalog v.1.3.7 7911851 - microRNA katalog v.1.3.7 7 26/01/07 11:35:1726/01/07 11:35:17
www.exiqon.comwww.exiqon.com8
Published Research using miRCURY™ LNA ArraysCastoldi et al. (RNA 12, 913-920) demonstrated the
advantages of using LNA-based probes for miRNA
profi ling, when compared with DNA-based arrays. The
paper describes how the biophysical properties of LNA
were exploited to design probe sets for uniform, high-
affi nity hybridisations yielding highly accurate signals able
to discriminate between single nucleotide diff erences and,
hence, between closely related miRNA family members.
The superior detection sensitivity eliminates the need for
RNA size selection and/or amplifi cation.
High sensitivity and dynamic range of miRCURY™ LNA ArrayBy using careful design rules regarding incorporation
of LNA™, the miRCURY™ LNA Array capture probes have
been found to be signifi cantly more sensitive than DNA-
based arrays for miRNA detection. The miRCURY™ LNA
Array is capable of detecting as little as 50 attomole of
miRNA.
Two pools of synthetic miRNAs (2 fmol of each miRNA) were spiked into
a complex background of yeast total RNA (1 μg/μL) with hsa-miR-196a/
hsa-miR-19a in one pool and hsa-miR-196b/hsa-miR-19b in the other pool.
One pool was labeled with Hy3™ and the other pool was labeled with Hy5™
using the miRCURY™ LNA Array Labeling Kit. The labeling reactions were
pooled and hybridized onto miRCURY™ LNA Arrays system.
The perfect-match/mismatch ratios are in the range 32-1110.
Product DescriptionEach miRCURY™ LNA Array consists of LNA-modifi ed
capture probes specifi c for each miRNA target. Capture
probes are Tm-normalized to 72°C. Probes are spotted
onto Corning® Epoxide slides. Each array is delivered in
a (vacuum) sealed package containing dessicant.
miRCURY™ LNA Arrays come in pack sizes of 3, 6 and 24
arrays. Arrays, or ready-to-spot probesets come supplied
with hybridisation and wash buff ers.
miRCURY™ LNA Array Spike-in miRNA Kit: Improve the quality of your data analysisAvailable with all miRCURY™ LNA Array products, the
Spike-in miRNA kit contains 10 synthetic spike-in miRNAs.
The spike-in capture probes can be used
as a control of the labeling reaction and hybridization
as a help in deciding scanner settings between channels
as a control of the data normalization procedure
to estimate the variance of replicated measurements
within arrays
to assess technical variability between diff erent parts of
the array
miRCURY™ LNA Array microRNA Expression Profi ling
Product Number Name Description
All organisms miRCURYTM LNA Array, 3 microarray slides, hyb and wash buff ers
All organisms miRCURYTM LNA Array, 6 microarray slides, hyb and wash buff ers
All organisms miRCURYTM LNA Array, 24 microarray slides, hyb and wash buff ers
All organisms miRCURYTM LNA Array, ready to spot probe set, 300 pmol, hyb and wash buff ers
208020 Hybridisation buff er miRCURYTM LNA Array, 2X hybridisation buff er (1 mL)
208021 Washing buff er miRCURYTM LNA Array, washing buff er kit /saltbuff er 125 mL; detergent 15 mL)
208040 Spike-in miRNA miRCURY™ LNA Array, Spike-in miRNA Kit
Updated
according to
miRBase
The fi gure shows the distribution of the 10 spike-in miRNAs spiked into a
total RNA sample.
Hy
5T
M S
ign
al
Hy3TM Signal
Normalized signal100000
10000
1000
100
10
10 100 1000 10000 100000
microRNA
Spike-ins
hsa-miR-196a hsa-miR-196b hsa-miR-19bhsa-miR-19a
Sig
na
l
Capture Probe
911851 - microRNA katalog v.1.3.8 8911851 - microRNA katalog v.1.3.8 8 26/01/07 11:35:2126/01/07 11:35:21
www.exiqon.comwww.exiqon.com 9
At a glance: The perfect complement to miRCURY™ LNA Arrays
One-step protocol
Requires just 1 μg of total RNA
Scalable protocol
Uniform labeling method means all target miRNAs are
labeled to the same degree without sequence bias
Matches all common microarray scanning equipment.
Straightforward and fast microRNA labelingThe miRCURY™ LNA Array labeling kit provides a fast and
simple method that allows you to label your total RNA
sample and apply it directly to your microarray. There is
no need for miRNA enrichment, or other time-consuming
sample handling steps. When used with miRCURY™ LNA
Arrays, the labeling kit allows for the labeling of down to
1μg of total RNA for use in miRNA profi ling.
The kits are used for labeling of total RNA samples with
Hy3™ and Hy5™ fl uorophores - dyes spectrally equivalent
to the well-known Cy3™ and Cy5™ fl uorophores, allowing
for miRNA expression patterns to be determined on
standard array scanning instrumentation.
miRCURY™ LNA Array Labeling methodThe miRCURY™ LNA Array Labeling Kit requires just 1 μg
of total RNA with no requirement for miRNA enrichment.
The labeling protocol is 90 minutes and miRNAs are
uniformly labeled.
One fl uorescent label per microRNADue to the method used in the miRCURY™ LNA Array
labeling kits, only one fl uorescent label is incorporated
per miRNA.
The miRCURY™ LNA Array microRNA labeling kit works on
plant miRNAs in addition to animal miRNAs, making it the
most versatile miRNA labeling kit available.
miRCURY™ LNA Array microRNA Labeling
miRCURY™ LNA Array Labeling Kit: Fast and simple miRNA Labeling
Product Number Name Description
208030 Hy5TM labeling kit miRCURYTM LNA Array, Hy5TM labeling kit (24 rxns)
208031 Hy3TM labeling kit miRCURYTM LNA Array, Hy3TM labeling kit (24 rxns)
208031 Hy3TM/Hy5TM labeling kit miRCURYTM LNA Array, Hy3TM /Hy5TM labeling kit (24 rxns)
Flo
we
rF
low
er
100
1000
10000
100000
100 1000 10000 100000
Seedling
20
16
12
8
4
0
Lo
g2
(in
ten
sity
)
miR
-145
miR
-189
miR
-196
a
miR
-10a
miR
-200
c
miR
-320
miR
-106
a
miR
-142
-5p
UU-3’ GU-3’ GG-3’ UG-3’ GG-3’ AA-3’ GC-3’ AC-3’
911851 - microRNA katalog v.1.3.9 9911851 - microRNA katalog v.1.3.9 9 26/01/07 11:35:2226/01/07 11:35:22
www.exiqon.comwww.exiqon.com10
At a glance: Obtain reliable results fast
Use Exiqon’s time and expertise
Built-in controls
Unique QC feature:
synthetic spike-in miRNAs
Capture probes spotted 4 times, positive and
negative controls
Speed up your microRNA researchExiqon’s miRCURY™ LNA Array miRNA Profi ling Services is
designed to allow you to obtain miRNA profi les for your
samples without doing more than sending us your total
RNA samples and analysing your data when we send it to
you. Following a check for RNA sample quality, Exiqon will
take care of the steps in-between the steps in-between-
sample labeling, hybridisation to miRCURY™ LNA Arrays
and data generation.
Using miRCURY™ LNA Array miRNA Profi ling Services
gives you access to the most advanced miRNA profi ling
arrays available, incorporating LNA™-based capture
probes that provide the following benefi ts:
Use less sample
• Profi ling using 2μg total RNA/sample/array
Obtain results you can rely on
• Tm-normalized capture probes with high
affi nity for miRNA targets
• No miRNA enrichment required
Save time
Use Exiqon’s expertise to keep your research on track
• Obtain results in 2-3 weeks
Use Exiqon’s expertise and advice Each service is customized to your specifi c requirements,
in consultation with Exiqon’s experts, who have broad
experience in miRNA expression analysis
miRCURY™ LNA Array microRNA Profi ling Service
911851 - microRNA katalog v.1.3.10 10911851 - microRNA katalog v.1.3.10 10 26/01/07 11:35:2626/01/07 11:35:26
www.exiqon.comwww.exiqon.com 11
Getting StartedGo to www.exiqon.com/services and fi ll in the request form. We will then contact you very shortly after you submit your
request to further discuss your requirements. After we have agreed on the best way to proceed with the experiments,
we will provide you with a free, no obligation quote.
miRCURY™ LNA Array microRNA Profi ling Service
2 -
3 w
ee
ksEach service project is tailored to your
specifi c requirements in consultation
with Exiqon’s experts, who have broad
experience in microRNA expression
analysis.Consultation
Samplesubmission
RNA QC
Labeling andHybridization
Data collectionand analysis
Final report
We can profi le miRNA expression from
as little as 2μg total RNA. There is no need
for microRNA enrichment.
Prior to initiating the analysis we will
subject your samples to a RNA quality
control to assess the integrity of the
RNA, its content of small RNA, and its
concentration.
Our miRCURYTM LNA Array labeling kit
allows uniform labeling of microRNAs
with no sequence bias. Hybridization
and washing steps are fully automated
for excellent reproducibility.
Arrays will be scanned and image analysis
performed to quantify the signals on
the arrays. The data obtained will be
normalized using methods applicable to
the performed experiment and we will
perform a quality assessment of the data.
Upon completion of the miRNA profi ling
service, we will send you an email with a
link to a secure web-server from which
you may download the fi nal report and
all associated fi les. For further details on
report content, please see overleaf.
911851 - microRNA katalog v.1.3.11 11911851 - microRNA katalog v.1.3.11 11 26/01/07 11:35:2826/01/07 11:35:28
www.exiqon.comwww.exiqon.com12
At a glance Preserve your precious RNA samples
Superior to DNA probes
Get results in a few hours
Detect miRNA in as little as 2.5 μg total RNA
Improved Northern Blot Detection of microRNAsExiqons miRCURY™ LNA technology enables sensitive
and specifi c detection of miRNAs by Northern blotting.
miRCURY™ LNA microRNA Northern blotting probes
have high binding affi nity and discrimination, enabling
the specifi c and sensitive detection of miRNAs. Due to
the high binding affi nity of the miRCURY™ LNA microRNA
Detection probes less than 1/10 the amount of sample
is needed compared to traditional probes. Furthermore,
the exposure time is reduced to just a few hours.
For researchers who wish to detect miRNAs on Northern
blots by non-radioactive methods, we recommend the
use of DIG-tailing, where multiple DIG moeities are added
to the miRCURY™ probe.
Northern blot showing high specifi city using miRCURY™ LNA Detection
probes. The probe specifi city was assessed using 32P-labeled perfect match,
double mismatch and three single mismatch miRCURY™ LNA microRNA
Detection probes in the detection of miR171 in A. thaliana fl owers (1) and
leaves (2). The fi lters were washed at low stringency and high stringency.
From Válóczi et al. 2004, Nucleic Acids Res. e175; reprinted by permission of
Oxford University Press.
The fi gure shows a Northern analysis of two duplicate dilution series of
A.thaliana total RNA hybridised with 32P-labeled DNA and miRCURY™ LNA
Detection probes, respectively, for A. thaliana miR171 and miR319. From
Válóczi et al. 2004, Nucleic Acids Res. e175; reprinted by permission of Oxford
University Press
Product DescriptionPre-designed miRCURY™ LNA microRNA Northern blot
detection probes for are available for all known miRNAs in
invertebrates, vertebrates and plants, as annotated in the
miRNA Registry (miRBase) at The Welcome Trust Sanger
Institute.
Custom miRCURY™ LNA microRNA Detection probes are
available for your own miRNAs and other small RNAs.
Using miRCURY™ LNA microRNA Detection probes double
and even single mismatches are readily discriminated as
shown left.
miRCURY™ LNA microRNA Detection: Northern blot probes
Low stringency
2xSSC, 45ºC
High stringency
0.1xSSC, 65ºC
EtBr
1 2
Pe
rfe
ct m
atc
h
Do
ub
le m
ism
atc
h
Sin
gle
mis
ma
tch
,
po
siti
on
11
Sin
gle
mis
ma
tch
,
po
siti
on
8
Sin
gle
mis
ma
tch
,
po
siti
on
14
1 2 1 2 1 2 1 2
miR171
miR319
100 50 25 10 5 2.5 100 50 25 10 5 2.5 μg RNA
miRCURY™ LNA probe
6h exp6h exp
6h exp6h exp
12h exp12h exp
12h exp12h exp
DNA probe
EtBr
911851 - microRNA katalog v.1.3.12 12911851 - microRNA katalog v.1.3.12 12 26/01/07 11:35:3426/01/07 11:35:34
www.exiqon.comwww.exiqon.com 13
At a glance Detect low abundance miRNAs
Probes available for all miRNAs
Single- or dual-base discrimination
Probes are ready to be labeled or pre-labeled with
your preferred detection method, e.g. DIG, biotin,
fl uorescence
Fully developed protocols
Truly Enabling TechnologyExiqons miRCURY™ microRNA technology enables
sensitive and specifi c detection of mature miRNAs
by in situ hybridisation. For the detection of miRNAs,
the development of miRCURY™ LNA microRNA in situ
Detection probes has been a truly ground-breaking,
enabling technology.
miRCURY™ LNA microRNA in situ Detection probes
have high binding affi nity and discrimination, enabling
the specifi c and sensitive detection of miRNAs. Specifi c
in situ detection of miRNA is possible in whole mounts,
thin sections, single cells, frozen samples and in formalin-
fi xed, paraffi n-embedded tissue sections (including
archived samples).
Detection of the brain specifi c miRNA-138 (red) in the hippocampus of
mouse cells using miRCURY™ LNA microRNA Detection probes. DNA is
labeled with DAPI (in blue).
The image was kindly provided by Dr. Javier Martinez, IMBA - Institute of
Molecular Biotechnology, Vienna, Austria.
Specifi c detection of miR-122a (top), miR-206 (middle) and miR-124a
(bottom) using miRCURY™ LNA microRNA Detection probes in in situ
hybridisation of whole mount zebrafi sh embryos.
The images were kindly provided by Dr. Ronald Plasterk, Hubrecht
Laboratory, The Netherlands.
miRCURY™ LNA microRNA Detection probes for the in
situ detection of miRNAs have been used successfully
in both animal and plant species. Their importance has
been demonstrated in a number of publications, due to
the expression patterns of miRNAs, which show highly
specifi c tissue- and cell expression patterns. These probes
have truly helped answer the questions of ”when” and
”where” a particular miRNA is expressed.
miRCURY™ LNA microRNA Detection: in situ hybridisation probes
See precisely where your miRNA is expressed with a sensitivity and
specifi city not possible with probes.
911851 - microRNA katalog v.1.3.13 13911851 - microRNA katalog v.1.3.13 13 26/01/07 11:35:3426/01/07 11:35:34
www.exiqon.comwww.exiqon.com14
miRCURY™ LNA microRNA in situ Detection probes in researchA number of papers have been published using
miRCURY™ LNA microRNA in situ Detection probes.
Wienholds et al. elucidated the temporal and spatial
expression patterns of 115 conserved miRNAs in zebrafi sh
embryos. One important conclusion from this work is that
the role of miRNAs is in the diff erentiation or maintenance
of tissue identity. Sokol and Ambros used miRCURY™
LNA microRNA Detection probes to detect miR-1-1 and
miR-1-2 expression in Drosophila muscle. Nelson et al.
used miRCURY™ LNA microRNA Detection probes to
study the expression patterns of miRNAs in archived
human brain tissue samples. The in situ expression
patterns were able to help refi ne the data obtained from
a microarray. Most recently, Obernosterer et al., have
demonstrated diff erential distribution patterns of mature
and pre-mirs in mouse embryos.
Pre-designed miRCURY™ LNA microRNA Detection probes These probes are available for in situ hybridisation and
northern blotting are available for all known microRNAs
as registered and annotated in the miRNA Registry at The
Wellcome Trust Sanger Institute. Control probes are also
available.
miRCURY™ LNA microRNA Detection
Product Number Product Description Label
XXXXXX-00 miRCURYTM LNA microRNA Detection probe, 250 pmol ready to label*
XXXXXX-01 miRCURYTM LNA microRNA Detection probe, 250 pmol 5’-DIG
XXXXXX-02 miRCURYTM LNA microRNA Detection probe, 250 pmol 5’-amino
XXXXXX-03 miRCURYTM LNA microRNA Detection probe, 250 pmol 5’-biotin
XXXXXX-04 miRCURYTM LNA microRNA Detection probe, 250 pmol 5’-fl uorescein
XXXXXX-05 miRCURYTM LNA microRNA Detection probe, 250 pmol 3’-DIG
XXXXXX-06 miRCURYTM LNA microRNA Detection probe, 250 pmol 3’-amino
XXXXXX-07 miRCURYTM LNA microRNA Detection probe, 250 pmol 3’-biotin
XXXXXX-08 miRCURYTM LNA microRNA Detection probe, 250 pmol 3’-fl uorescein
Custom miRCURY™ LNA microRNA Detection probes For in situ hybridisation and northern blotting are
available for all other microRNAs, including pre-mirs,
please inquire.
The miRCURY™ LNA microRNA Detection probes are
available in a ”ready to label” format (using enzymatic
labeling kits) and in a pre-labeled format e.g. labeled with
DIG, biotin etc.
Control miRCURY™ LNA microRNA Detection probesare available. Please go to www.exiqon.com
Ordering: Go to www.exiqon.com/shop. Select your miRCURY™
LNA microRNA Detection product by Product Number,
name of microRNA (must be entered exactly as given in
the Sanger miRNA registry, e.g. “hsa-mir-1”) or sequence.
For example, ordering a miRCURY™ LNA Detection probe
for hsa-mir-1 can begin by entering 18008-00, hsa-miR-1
or UGGAAUGUAAAGAAGUAUGUA into the search
window.
*”Ready to label” means that the miRCURY™ LNA microRNA Detection probe can be enzymatically
labeled with the detection moiety of choice, for example DIG, radiolabel, biotin or fl uorophores.
911851 - microRNA katalog v.1.3.14 14911851 - microRNA katalog v.1.3.14 14 26/01/07 11:35:3726/01/07 11:35:37
www.exiqon.comwww.exiqon.com 15
General Conditions for Sale and Supply of Goods from Exiqon A/S.
The General Conditions shall apply, unless otherwise agreed in writing
by both parties. In case of discrepancy between the parties on agreed
conditions, the General Conditions given below shall apply.
1. Price, Quotation.
1.1 All orders are received to Exiqon’s acceptance and order
confi rmation in writing. An order is accepted at the price quoted
at the date of the quotation. Quotations are valid for a period of 30
days only and fi xed prices as specifi ed in Exiqon´s Product
Catalogue current at date of order are guaranteed except where
changes in costs, rate of currencies, taxes, or the like may
necessitate a price increase.
1.2 Unless expressly stated otherwise all prices are exclusive of
V.A.T. or similar sales taxes.
1.3 Orders below 350 EURO will be charged a handling fee of
30 EURO.
2. Product Information, Drawings and Descriptions.
2.1 All information and data contained in product brochures and
price lists are binding only to the extend that they are by
references expressly included in Exiqon’s acceptance of an order.
2.2 All drawings and technical documents relating to the Goods
or its manufacture submitted by one party to the other shall
remain the property of the submitting party.
3. Delivery - Passing of Risk.
3.1 If no trade terms is specifi cally agreed delivery shall be Free
Carrier (FCA, Vedbaek) (Incoterms 2000). The risk for accidental
damage to the Goods will pass to the purchaser upon delivery to
the purchaser or third party e.g. a carrier.
3.2 If the purchaser fails to accept delivery the purchaser shall be
charged with the expenses incurred by Exiqon.
3.3 Exiqon will use its best eff orts to deliver the Goods within the
time agreed and if no time is agreed within a reasonable time but
in no circumstances will Exiqon be liable for loss or damage of any
kind caused directly or indirectly by any delay in delivery of the
Goods.
3.4 Exiqon may make delivery by installments.
4. Payment.
4.1 Where no account has been agreed by Exiqon the Goods will
not be delivered until Exiqon is paid the amount shown on the
proforma invoice relating to the Goods.
4.2 Where an account has been agreed the price will become
payable upon delivery and payment will be made by the Buyer
within 30 days of the date on the invoice.
4.3 The Goods shall remain the property of Exiqon until payment
has been made in full. If purchaser does not pay within the time
stipulated Exiqon is entitled to charge interests on overdue
payments at the rate of 2 (two) per cent per month.
5. Warranty.
5.1 Exiqon will repair or at its option replace any Goods
manufactured by Exiqon which are proved to the reasonable
satisfaction of Exiqon to be defective in material or workmanship
provided such defects are notifi ed to the seller within 12 (twelve)
months of the date of despatch.
5.2 No warranty shall be undertaken for damage which is
attributable to the following: Unsuitable or improper use, faulty
assembly or commissioning by purchaser or third parties, faulty
or negligent handling, unsuitable utilities, chemical, electronically
or electrical infl uences provided that they are not attributable to
the fault of Exiqon.
5.3 Purchaser waives all rights to be indemnifi ed for any
consequential damages, e.g. loss of profi t, loss suff ered by third
parties, and claim for damages which is not incurred on the
goods themselves, unless it is established that such loss is due
to gross negligence on Exiqon’s part or other parts for whom
Exiqon is liable. If Exiqon should be liable compensation for
defects is limited to 10 (ten) per cent of the net selling price.
6. Cancellation.
6.1 The purchaser is not entitled to cancel, extend or delay the
contract or part thereof.
6.2 If Exiqon consents to the purchaser cancelling the contract or
part thereof and returning any Goods, the purchaser shall be liable
to pay Exiqon current handling charges.
7. Product Liability.
7.1 Exiqon is not liable for damages to real property or movables
unless it is established that such damage to real property or
movables is due to gross negligence on Exiqon’s part or others for
whom Exiqon is liable.
7.2 Exiqon is under no circumstances liable for personal injury
or damages if such personal injury or damages are due to the
use of the delivered products contrary to Exiqon’s manuals or
technical specifi cations or due to negligent acts on the part of
others than Exiqon, i.e. subsuppliers or independent transporters.
7.3 Exiqon is under no circumstances liable for indirect loss, loss of
profi ts, or any other kind of consequential loss.
7.4 Exiqon is liable for personal injuries and for damages to real
property or movables intended for noncommercial purposes
according to the rules in the Danish Act of Product Liability to
the extend that Exiqon’s liability is not limited pursuant to clause
7.1 through 7.3.
7.5 In the event that Exiqon is held liable according to the rules
concerning “product liability” in relation to a third party, purchaser
is obliged to indemnify Exiqon from all claims to the extend that
Exiqon has limited its liabilities according to clause 7.1 through
7.4. If a third party should claim damages from one of the
contracting parties in respect to the delivery made under these
General Conditions, this party is obliged to inform the other party
with the outmost dispatch.
8. Force Majeure.
8.1 Any delay or failure of performance of either party shall be
considered as cases of relief of responsibility to the extend that
such delay in or failure of performance are caused by occurrences
after the acceptance of the quotation and are beyond the control
of the party aff ected including but not limited to: Industrial
disputes, fi re, war, general mobilisation of unforeseen
military mobilisations, requisition, general shortage of materials,
shortage of transport, civil commotion, import bans or export
bans, restrictions in the use of power, defects on production
facilities or delays in deliveries by subsuppliers.
9. Disputes and Applicable Law.
9.1 Any disputes arising out of the contract regarding the
interpretation and application of the contract shall be governed
by Danish Law.
9.2 The venue for any legal actions instituted by purchaser against
Exiqon shall be The Maritime and Commercial Court in
Copenhagen.
9.3 Legal actions against purchaser can be instituted at Exiqon’s
discretion at The Maritime and Commercial Court in Copenhagen
or at purchasers normal venue.
Latest revision: February, 2004
911851 - microRNA katalog v.1.3.15 15911851 - microRNA katalog v.1.3.15 15 26/01/07 11:35:3726/01/07 11:35:37
www.exiqon.comwww.exiqon.com
Outside North America
Exiqon A/S · Bygstubben 9 · DK-2950 Vedbaek · Denmark
Phone: +45 45 660 888 · Fax: +45 45 661 888
support@exiqon.com · www.exiqon.com
miRCURY™ LNA microRNA KnockdownPre-designed knockdown probes for all annotated miRNAs.
Probes available labeled or unlabelled. Control probes and
Custom probes for other small RNAs also available.
The miRCURY™ LNA Product Series
miRCURY™ LNA Arrays for all organisms
Pack sizes: 3, 6 and 24 slides
Ready-to-spot probe set
miRCURYTM LNA Array Labeling Kits
miRCURY™ LNA Array, Hy3™/Hy5™ Labeling kit (24 rxns)
miRCURY™ LNA Array, Hy3™ Labeling kit (24 rxns)
miRCURY™ LNA Array, Hy5™ Labeling kit (24 rxns)
miRCURY™ LNA microRNA Detection
- all microRNAs, all organisms
In situ detection probes, unlabeled or multiple
choice of labels (DIG, fl uorescein, biotin etc.)
Northern blot detection probes, unlabeled or
multiple choice of labels
miRCURY™ LNA microRNA Expression
Profi ling Services
Your biological sample profi led using miRCURY™
LNA Array technology
Patents and Trademarks
Exiqon, AQ-Link, LNA, miRCURY, ProbeLibrary and ProbeFinder are registered trademarks of Exiqon A/S, Vedbaek,
Denmark.
Anthraquinone photochemistry products (AQ products) are covered by patents owned by Exiqon A/S.
Locked Nucleic Acids are covered by the following patents owned by Prof. Imanishi: AU 720472, AU 742476, CA
2,283,509, USP 6,268,490 and USP 6,770,748 and by patents and patent applications owned by Exiqon A/S.
Disclaimers
Exiqon Products: Products are for research use only and not for diagnostic or therapeutic use. The products may
be used only for the buyer’s internal research purposes and not for commercial use. The buyer may not resell
products in their original or any modifi ed form. The purchase of products does not include or carry an implied
right or license for the buyer to use such products in the provision of services to third parties and a license must
be obtained directly from Exiqon A/S for such use.
Prespotted arrays: This product and its use are covered by one or more of the following patents owned by
Oxford Gene Technology Limited or Oxford Gene Technology IP Limited: US 6,054,270, US 5,700,637, EP
0,373,203; Jap. 3,393, 528 and 3,386,391 and pending patents. The purchaser is licensed to practice methods and
processes covered by these patents using this product for its own internal research purposes only but may not:
transfer data derived from the use of this product to third parties for value; use this product in the provision of
services to third parties for value; use this product to make, have made, create or contribute to the creation of
stand alone expression database products for license, sale or other transfer to a third party for value; or use this
product for the identifi cation of antisense reagents or the empirical design of probes or sets of probes for using
or making nucleic acid arrays.
Capture probe oligonucleotide sets: Exiqon A/S is not licensed under any patents owned by Oxford Gene
Technology Limited or related companies (»OGT«) and cannot pass any such license to its customers. A license
under OGT’s patents may be necessary to manufacture or use oligonucleotide arrays. To enquire about a license
under OGT’s oligonucleotide array patents, please contact licensing@ogt.co.uk.
PCR: PCR is covered by patents owned by Roche Inc. Use of the PCR process requires a license. The use of certain
probes in 5’nuclease assays is covered by European patent EP-B1-0543942 and corresponding patents. The
purchase of this product does not provide a license to use the patented technology described in the above-
mentioned patent. A license to practice this technology for research applications must be obtained by the
end-user from the company entitled to grant licenses under this patent.
DIG: DIG is licensed from Roche Diagnostics GmbH.
Specifi cations in this document are subject to change without notice. miR
CU
RY
TM
LN
A P
rod
uct
Cat
alo
g, v
ers
ion
1.3
- 91
18
51
- ©
ww
w.r
ek
lam
eh
use
t.co
m
Read more about published miRNA research using
miRCURY™ LNA products at www.exiqon.com
North America
Exiqon, Inc. · 600 West Cummings Park · Suite 1650,
Woburn, MA 01801, USA · Phone: +1 781 376 4150
Fax: +1 781 376 4152 · Toll free: +1 888 miRCURY
support@exiqon.com · www.exiqon.com
911851 - microRNA katalog v.1.3.16 16911851 - microRNA katalog v.1.3.16 16 26/01/07 11:35:3726/01/07 11:35:37