Post on 17-Dec-2015
transcript
Molecular diagnosis of heterogeneous Molecular diagnosis of heterogeneous genetic diseases: the example of genetic diseases: the example of muscular dystrophiesmuscular dystrophies
Vincenzo NigroVincenzo Nigro
Dipartimento di Patologia Dipartimento di Patologia Generale, Seconda Università Generale, Seconda Università degli Studi di Napolidegli Studi di Napoli
Telethon Institute of Genetics and Telethon Institute of Genetics and Medicine (TIGEM)Medicine (TIGEM)
What is a mutation?What is a mutation?
A variation of the DNA sequenceA variation of the DNA sequence that is only found in affected individualsthat is only found in affected individuals that is never found in non affected that is never found in non affected
individualsindividuals that accounts for the pathological that accounts for the pathological
process/statusprocess/status that, when corrected in time, disease is that, when corrected in time, disease is
rescuedrescued
..that is only found in affected ..that is only found in affected andand that is never found in non that is never found in non affected affected
incomplete penetranceincomplete penetrance
that is more often found in affectedthat is more often found in affectedthan in non affected...than in non affected...
50.000 private variants = 50.000 private variants = innocuous differences belonging to innocuous differences belonging to one familyone family
CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACCCCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTTGCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCGGCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAGGCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAAAAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTCTAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAAAGAATGTTAACAATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCTCAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAATGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCTTCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGGGGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCAGGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTGTTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCATTTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAAGGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATCCCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTGCTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTTGTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAATAAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATGTGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAACACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAATTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCTGTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAGTGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAGAAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTATAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGATCCAAAGCTCTTGCTTTGTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAGGGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGGAGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCCTGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAACTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGATCTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC
CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACCCCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTTGCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCGGCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAGGCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAAAAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTCTAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAAAGAATGTTAACTATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCTCAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAATGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCTTCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGGGGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCAGGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTGTTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCATTTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAAGGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATCCCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTGCTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTTGTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAATAAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATGTGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAACACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAATTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCTGTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAGTGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAGAAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTATAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGCTCCAAAGCTCTTGCTTTGTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAGGGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGGAGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCCTGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAACTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGATCTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC
1-allele diseases1-allele diseases
monoallelic mutations may be monoallelic mutations may be responsible for responsible for dominantdominant or or X-X-linkedlinked disorders disorders
new new randomrandom mutations are the mutations are the rule with an unpredictable pattern rule with an unpredictable pattern of distributionof distribution
Gender effect in Gender effect in mutationsmutations For mutations other than point mutations, For mutations other than point mutations,
sex biases in the mutation rate are very sex biases in the mutation rate are very variablevariable
Small Small deletionsdeletions are more frequent in females are more frequent in females Germline Germline base substitutionbase substitution mutations occur mutations occur
more frequently in males than in females, more frequently in males than in females, especially in older malesespecially in older males
Point mutations at some loci occur almost Point mutations at some loci occur almost exclusively in males, whereas others occur exclusively in males, whereas others occur ten times more than in femalesten times more than in females
Relative frequency of Relative frequency of de novode novo achondroplasia for achondroplasia for different paternal agesdifferent paternal ages
Relative frequency of Relative frequency of de novode novo neurofibromatosis for different paternal neurofibromatosis for different paternal agesages
2-allele diseases2-allele diseases
novel mutations are rare, usually mutations novel mutations are rare, usually mutations have a long history (100-1000 generations)have a long history (100-1000 generations)
mutations have an mutations have an ethnical signatureethnical signature with a with a predictable pattern of distribution and predictable pattern of distribution and frequencyfrequency
biallelic mutations may be responsible for biallelic mutations may be responsible for autosomal recessiveautosomal recessive disorders disorders
polymorphisms and private variants are polymorphisms and private variants are more easily discriminated vs true mutationsmore easily discriminated vs true mutations
2-allele diseases2-allele diseases
consanguineity is a risk factor for consanguineity is a risk factor for homozygosityhomozygosity high carrier frequency is a risk factor for high carrier frequency is a risk factor for
compound heterozygositycompound heterozygosity
The effect of an alleleThe effect of an allele
null or amorph = no productnull or amorph = no product hypomorph = reduced amount / activityhypomorph = reduced amount / activity
hypermorph = increased amount / hypermorph = increased amount /
activityactivity neomorph = novel product / activityneomorph = novel product / activity antimorph = antagonistic product / antimorph = antagonistic product /
activityactivity
Loss of function mutations in the Loss of function mutations in the PAX3 gene (Waardenburg syndrome)PAX3 gene (Waardenburg syndrome)haploinsufficiencyhaploinsufficiency
amorph / hypomorph (1)amorph / hypomorph (1)
deletiondeletion– the entire genethe entire gene– part of the genepart of the gene
disruption of the gene structuredisruption of the gene structure– by insertion, inversion, translocationby insertion, inversion, translocation
promoter inactivationpromoter inactivation mRNA destabilizationmRNA destabilization splicing mutationsplicing mutation
– inactivating donor/acceptorinactivating donor/acceptor– activating criptic splice sitesactivating criptic splice sites
amorph / hypomorph (2)amorph / hypomorph (2)
frame-shift in translationframe-shift in translation– by insertion of n+1 or n+2 bases into by insertion of n+1 or n+2 bases into
the coding sequencethe coding sequence– by deletion of n+1 or n+2 bases into the by deletion of n+1 or n+2 bases into the
coding sequencecoding sequence nonsense mutationnonsense mutation missense mutation / aa deletionmissense mutation / aa deletion
– essential / conserved amino acidessential / conserved amino acid– defect in post-transcriptional processingdefect in post-transcriptional processing– defect in cellular localizationdefect in cellular localization
hypermorphhypermorph
trisomiatrisomia duplicationduplication amplification (cancer)amplification (cancer) chromatin derepression (FSH)chromatin derepression (FSH) trasposition under a strong promotertrasposition under a strong promoter
– leukemialeukemia overactivity of an abnormal proteinoveractivity of an abnormal protein
neomorphneomorph
generation of chimeric proteinsgeneration of chimeric proteins duplicationduplication amplification (cancer)amplification (cancer) missense mutationsmissense mutations inclusion of coding cryptic exonsinclusion of coding cryptic exons usage of alternative ORFsusage of alternative ORFs overactivity of an abnormal proteinoveractivity of an abnormal protein
antimorphantimorph
missense mutationsmissense mutations inclusion of coding cryptic exonsinclusion of coding cryptic exons usage of alternative ORFsusage of alternative ORFs
Mutation detectionMutation detection
mutation scanningmutation scanning– or resequencing methods for or resequencing methods for
identifying previously identifying previously unknownunknown mutationsmutations
genotypinggenotyping– methods for scoring previously methods for scoring previously
knownknown mutations or single mutations or single nucleotide polymorphisms (SNPs)nucleotide polymorphisms (SNPs)
Key questions for mutation detection strategy
expected mutations are monoallelic or biallelic?
is the gene well recognized for that disease? is the mutation pattern known? (deletion, dup,
small mutations, etc.) which is the complexity of the gene? how many patients must be examined? how many controls should be examined? how many mutations and how many variations
have already been identified in this gene? are there more members of the same gene
family (or pseudogenes) in the genome?
frequent mutations
are known?
mutationmutationscanningscanning
SEQUENCINGSEQUENCING
screeningscreeningof recurrentof recurrent mutationsmutations YESYES NONO
mutationsare identified?
YESYES
NONO
General strategy for mutation detectionGeneral strategy for mutation detection
DMD Duchenne Muscular DMD Duchenne Muscular DystrophyDystrophy - 1/3,500 boys - 1/3,500 boysOnsetOnset -- Early childhood - about 2 to 6 years -- Early childhood - about 2 to 6 years– Laboratory -- Laboratory -- CK (50x to 1.000x), LDH5, CK (50x to 1.000x), LDH5,
ALT, AST, aldolase increaseALT, AST, aldolase increase
SymptomsSymptoms -- Generalized weakness and -- Generalized weakness and muscle wasting affecting proximal limb muscle wasting affecting proximal limb muscles first. Calves often enlarged. Heart muscles first. Calves often enlarged. Heart involvementinvolvementProgressionProgression -- Disease progresses slowly but -- Disease progresses slowly but will affect all voluntary muscles. Survival will affect all voluntary muscles. Survival possible beyond late twentiespossible beyond late twenties
BMD Becker Muscular DystrophyBMD Becker Muscular Dystrophy - 1/10,000 boys - 1/10,000 boysOnsetOnset -- Adolescence or adulthood -- Adolescence or adulthoodSymptomsSymptoms -- Almost identical to Duchenne but -- Almost identical to Duchenne but often much less severe. Heart involvementoften much less severe. Heart involvementProgressionProgression -- Slower and more variable than -- Slower and more variable than DMD with survival well into mid to late DMD with survival well into mid to late adulthoodadulthood
Carrier of a balanced reciprocal X-Carrier of a balanced reciprocal X-autosome translocationautosome translocation
more DNA
Telethon-UILDM
250/300DMD/BMD
Qualitative test
Quantitative test
rejected
80plex-PCR
Deletionsduplications
Point mutations
mRNA studymRNA studyFamily tests
DMDDMDAA BB
BMDBMDCC DD
DMD patient :DMD patient :groups A, B groups A, B
BMD patient :BMD patient :groups C, D groups C, D
Deletion ex 17-43Deletion ex 17-43 Duplication ex 13-23Duplication ex 13-23
Log-PCR = 4 multiplex-PCR (2x20+2x18) with uniform spacingand gel position according to chromosomal position
1 2 3 4 5 6
1: del ex 432: del ex 11, 17, 19, 213: del ex 17, 19, 214: del ex 50, 525: del ex 7, 11, 17, 196: del ex 61
1: no del 2: del ex 8, 12, 18, 20, 223: del ex 12, 18, 20, 224: del ex 46, 515: del ex 6, 8, 12, 186: del ex 62
Hybridysation
1. The MLPA probemix is added to denatured genomic DNA
2. The two parts of each probe hybridise to adjacent target sequences
Ligation
3. Probes are ligated by a thermostable ligase3. Probes are ligated by a thermostable ligase
PCR amplification
4.4. A universal primer pair is used to amplify all A universal primer pair is used to amplify all ligated probesligated probesThe PCR product of each probe has a unique The PCR product of each probe has a unique length (130 480 bp)length (130 480 bp)
Separation and quantification by capillary electrophoresis
Each peak is the amplification product of a specific probe.
Samples are compared to a control sample.
A difference in relative peak height or peak area indicates a copy number change of the probe target sequence
MLPA discriminates sequences that differ in only a single nucleotide and can be used to detect known mutations.
Mismatch Perfect match
Ligation of the two probe oligonucleotides Amplification product
Mismatch at the probe ligation site No ligation, no amplification product
MRC-Holland b.v.
Unmethylated Target
M
M
Methylated Target
Denaturation and Multiplex probe
hybridizationM
Only undigested (methylated) and ligated probes are exponentially amplified
Ligation and Digestion with
methylation sensitive
endonucleasesM
MS-MLPA
Limb-girdle weaknessLimb-girdle weakness
proximalproximal weakness: most common weakness: most common Lower extremitiesLower extremities
– difficulty climbing stairsdifficulty climbing stairs– arising from a low chair or toiletarising from a low chair or toilet– getting up from a squatted positiongetting up from a squatted position
Upper extremitiesUpper extremities– trouble lifting objects over their head trouble lifting objects over their head – brushing their hairbrushing their hair
distal weaknessdistal weakness– difficulty opening jars, inability to turn a key in the difficulty opening jars, inability to turn a key in the
ignition, or tripping due to foot dropignition, or tripping due to foot drop cranial weaknesscranial weakness
– dysarthria, dysphagia or ptosisdysarthria, dysphagia or ptosis
Genetics of limb-girdle muscular Genetics of limb-girdle muscular dystrophiesdystrophies
autosomal dominantautosomal dominant LGMD1ALGMD1A 5q31.25q31.2 myotilin (Hauser, 2000)myotilin (Hauser, 2000) LGMD1BLGMD1B 1q211q21 lamin A/C (Bonne, 1999)lamin A/C (Bonne, 1999) LGMD1CLGMD1C 3p25.33p25.3 caveolin 3 (Minetti, 1997)caveolin 3 (Minetti, 1997) LGMD1DLGMD1D 6q22 6q22 ?? LGMD1ELGMD1E 7q35 7q35 ?? LGMD1FLGMD1F 7q31.17q31.1 filamin Cfilamin C LGMD1GLGMD1G 4p214p21 ??
autosomal recessiveautosomal recessive LGMD2ALGMD2A 15q1515q15 calpain 3 (Richard, 1995)calpain 3 (Richard, 1995) LGMD2BLGMD2B 2p13.22p13.2 dysferlin (Bashir, Liu, 1998)dysferlin (Bashir, Liu, 1998) LGMD2CLGMD2C 13q1213q12 -sarcoglycan (Noguchi, 1995)-sarcoglycan (Noguchi, 1995) LGMD2DLGMD2D 17q21.3317q21.33 -sarcoglycan (Roberds, 1994)-sarcoglycan (Roberds, 1994) LGMD2ELGMD2E 4q124q12 -sarcoglycan (Bonnemann, Lim, -sarcoglycan (Bonnemann, Lim,
1995)1995) LGMD2FLGMD2F 5q335q33 -sarcoglycan (Nigro, 1996)-sarcoglycan (Nigro, 1996) LGMD2GLGMD2G 17q1217q12 telethonin (Moreira, 2000)telethonin (Moreira, 2000) LGMD2HLGMD2H 9q339q33.1.1 TRIM 32 (Frosk, 2002)TRIM 32 (Frosk, 2002) LGMD2ILGMD2I 19q13.319q13.3 FKRP (Brockington, 2001)FKRP (Brockington, 2001) LGMD2JLGMD2J 2q24.32q24.3 titin (Udd, 2002)titin (Udd, 2002) LGMD2KLGMD2K 9q34.19q34.1 POMT1 (Balci, 2005)POMT1 (Balci, 2005) LGMD2LLGMD2L 9q319q31 fukutin (Godfrey, 2006)fukutin (Godfrey, 2006) LGMD2MLGMD2M 11p13-p1211p13-p12 ??
autosomal dominant forms autosomal dominant forms (LGMD1) are generally milder(LGMD1) are generally milder
represent less than 10% of all represent less than 10% of all LGMDLGMD
marked heterogeneity for LGMD1, marked heterogeneity for LGMD1, one gene per one single family one gene per one single family
autosomal dominant
autosomal recessiveautosomal recessive
autosomal recessive forms (LGMD2) have an autosomal recessive forms (LGMD2) have an average prevalence of 1:14,000-1:20,000 at average prevalence of 1:14,000-1:20,000 at birthbirth
frequency differences among countriesfrequency differences among countries this depends on higher carrier frequencies of this depends on higher carrier frequencies of
single mutations, as 550delA for calpain 3 in single mutations, as 550delA for calpain 3 in Croatia, L276I for FKRP in Northern Europe, Croatia, L276I for FKRP in Northern Europe, 521delT for gamma-sarcoglycan in Northern 521delT for gamma-sarcoglycan in Northern AfricaAfrica
At least 25% of families are excluded from At least 25% of families are excluded from any known locus and 40% of typical LGMD any known locus and 40% of typical LGMD cases have no mutation in any known genecases have no mutation in any known gene
Tools to address the Tools to address the diagnosis of LGMDdiagnosis of LGMD Clinical presentation (MRI)Clinical presentation (MRI) WB analysisWB analysis Segregation studySegregation study Mutation detection in patientsMutation detection in patients Mutation detection in normal Mutation detection in normal
subjectssubjects Homogeneous collection of Homogeneous collection of
mutations and polymorphismsmutations and polymorphisms
Segregation analysisSegregation analysis
Analysis of 30 polymorphic markers Analysis of 30 polymorphic markers linked to LGMD2A, 2B, 2C-2F, 2I in sib linked to LGMD2A, 2B, 2C-2F, 2I in sib pairspairs
To find homozigosity… To find homozigosity…
Calpain 3 24 exons
dysferlin 55 exons
-sarcoglycan 8 ex (10)
FKRP 4 esons (8)
Telethonin 2 exons (3)
TRIM32 1 exons (7)
Titin 363 ex (35)
-sarcoglycan 10 exons
-sarcoglycan 6 ex (7)
-sarcoglyican 9 exons
Myotilin 9 exons
Lamin A/C 13 exons
Caveolin 3 2 exons (3)
Case 1Case 1
The gene isThe gene is known known It is composed ofIt is composed of five small size exonsfive small size exons There areThere are 10 patients, 10 patients, sons of consanguineous sons of consanguineous
parentsparents Expected mutations areExpected mutations are homozygoushomozygous Mutations haveMutations have nevernever been identified in this been identified in this
genegene There isThere is nono other memberother member of the same gene of the same gene
families (or pseudogenes) in the genomefamilies (or pseudogenes) in the genome
Case 2Case 2
The gene isThe gene is known known The putative function of the gene product The putative function of the gene product
is to serve as a is to serve as a transcription factortranscription factor Expected mutations are Expected mutations are dominantdominant Mutations have Mutations have nevernever been identified in been identified in
this genethis gene There are There are other membersother members of the same of the same
gene families (or pseudogenes) in the gene families (or pseudogenes) in the genomegenome
SequencingSequencing
With the ongoing With the ongoing reduction of costsreduction of costs (today about 2-4 (today about 2-4 €€/run), sequencing of /run), sequencing of PCR products is applied for mutation PCR products is applied for mutation detectiondetection
Sequencing is often thought of as the Sequencing is often thought of as the 'gold standard''gold standard' for mutation detection. for mutation detection.
This perception is distorted due to the This perception is distorted due to the fact that this is the only method of fact that this is the only method of mutation identificationmutation identification, but this does , but this does not mean it is the best for mutation not mean it is the best for mutation detectiondetection
Sequencing artifactsSequencing artifacts
FALSE POSITIVE (specificity)FALSE POSITIVE (specificity)
–when searching for when searching for heterozygous DNA differencesheterozygous DNA differences there are a number of potential mutations, there are a number of potential mutations, together with sequence artifacts, compressions together with sequence artifacts, compressions and differences in peak intensities that must be re-and differences in peak intensities that must be re-checked with additional primers and costschecked with additional primers and costs
FALSE NEGATIVE (sensitivity)FALSE NEGATIVE (sensitivity)
–loss of information farther away or closer to the loss of information farther away or closer to the primerprimer
–does not detect a minority of mutant molecules in does not detect a minority of mutant molecules in a wild-type environmenta wild-type environment
Current mutation Current mutation scanning techniquesscanning techniques SSCP (single strand conformation SSCP (single strand conformation
polymorphism) polymorphism) HA (heteroduplex analysis)HA (heteroduplex analysis) CCM (chemical cleavage of mismatch)CCM (chemical cleavage of mismatch) CSGE (conformation sensitive gel CSGE (conformation sensitive gel
electrophoresis)electrophoresis) DGGE (denaturing gradient gel DGGE (denaturing gradient gel
electrophoresis)electrophoresis) DHPLC (denaturing HPLC)DHPLC (denaturing HPLC) PTT (protein truncation test)PTT (protein truncation test) DGCE (denaturing gradient capillary DGCE (denaturing gradient capillary
electrophoresis)electrophoresis) direct sequencingdirect sequencing
Mutation detection by Mutation detection by
heteroduplex heteroduplex
analysis: the analysis: the mutant mutant
DNADNA must first be must first be
hybridized with the hybridized with the
wild-type DNAwild-type DNA
to form a mixture of to form a mixture of
two homoduplexes two homoduplexes
and two and two
hheetteerroodduupplleexxeess
DHPLC analysis DHPLC analysis at different at different
temperatures of temperatures of the columnthe column
Analysis of dystrophin exon 59Analysis of dystrophin exon 59
Homoduplex Homoduplex DNADNA::PCR fragments PCR fragments are identicalsare identicals
0.49
3.65
3.85
6.39
0 1 2 3 4 5 6 7 8
Retention Time (min)
0.0
0.5
1.0
1.5
Intensity(mV)
0.49
3.88
6.41
0 1 2 3 4 5 6 7 8
Retention Time (min)
0.0
0.5
1.0
1.5
2.0
2.5
Intensity(mV)
Heteroduplex Heteroduplex DNA:DNA:
PCR fragments PCR fragments are differentare different
DHPLC analysis of the CAPN3 gene DHPLC analysis of the CAPN3 gene (exon 11) (exon 11)
UV
UV
00
22
FL
UO
FL
UO
00
100100
1:21:2 1:41:4 1:61:6 1:81:8 1:101:10
E3277X
c.1390 del C
missense
c.1603 delGTAinsCT
splicing
frame-shift
stop
c.94-1G>A
c.401_404 del CCAA
c.583 C>T R195X
c.433 C>T R145X
c.713_714 delTT
c.1180 del G
c.1292 G>A W431X
c.1482 delG
c.2125 C>T Q709X
R768X
c.2880_2884 del CAAAC
Q986X
Q1087X
c.3285_3288 del CAGT
c.4100 delA
Q1564X
R1577X
c.4871_4872 del AG
R1666X
c.5091del G
Q1737X
c.5690 ins A
E1925X
R1967X
c.6980 delA
c.7006 C>T Q2336X
c.8391-2 A>G
c.8732 insA
R2982X
c.9429_9430 del GC
C3337Y
c.10223+1 G>A
S805X
c.1332-9 A>G
c.2302 C>T c.4326 delG
9563+1 A>G
R1314X
Q1373X
c.6353 delA
3367 del E
R3370X
c.8668+3 A>T
c.530+1 G>A
R1844Xc.1062 G>A W354X
c.9926_9929 ins AAGCc.1300_1310 del CTCAGGGTAGC
c.4119 del G
c.3464_3471 del GTTTGGAG
Y3158X
K105X
S622X
c.3336 del G
Q242X
c.9204_9207 del CAAA
R2905X
S2008X
E3277X
c.1390 del C
missense
c.1603 delGTAinsCT
splicing
frame-shift
stop
c.94-1G>A
c.401_404 del CCAA
c.583 C>T R195X
c.433 C>T R145X
c.713_714 delTT
c.1180 del G
c.1292 G>A W431X
c.1482 delG
c.2125 C>T Q709X
R768X
c.2880_2884 del CAAAC
Q986X
Q1087X
c.3285_3288 del CAGT
c.4100 delA
Q1564X
R1577X
c.4871_4872 del AG
R1666X
c.5091del G
Q1737X
c.5690 ins A
E1925X
R1967X
c.6980 delA
c.7006 C>T Q2336X
c.8391-2 A>G
c.8732 insA
R2982X
c.9429_9430 del GC
C3337Y
c.10223+1 G>A
S805X
c.1332-9 A>G
c.2302 C>T c.4326 delG
9563+1 A>G
R1314X
Q1373X
c.6353 delA
3367 del E
R3370X
c.8668+3 A>T
c.530+1 G>A
R1844Xc.1062 G>A W354X
c.9926_9929 ins AAGCc.1300_1310 del CTCAGGGTAGC
c.4119 del G
c.3464_3471 del GTTTGGAG
Y3158X
K105X
S622X
c.3336 del G
Q242X
c.9204_9207 del CAAA
R2905X
S2008X
PTTPTTprotein truncation testprotein truncation test
Sensitivity Sensitivity 1000-bp fragment > 85% 1000-bp fragment > 85%
Detects only nonsense mutationsDetects only nonsense mutations Post PCR time: 48-72 hours Post PCR time: 48-72 hours
(translation/trascription, gel (translation/trascription, gel preparation, loading and run, analysis preparation, loading and run, analysis of results)of results)
Use of 35S radioactivityUse of 35S radioactivity No special equipment requiredNo special equipment required mRNA as starting templatemRNA as starting template
Applications of PTTApplications of PTT(% of truncating mutations)(% of truncating mutations)
Polycystic Kidney Disease Polycystic Kidney Disease PKD1PKD1 95% 95% Familial Adenomatous Polyposis Familial Adenomatous Polyposis APC APC 95% 95% Ataxia telangiectasia Ataxia telangiectasia ATM ATM 90%90% Hereditary breast and ovarian cancer Hereditary breast and ovarian cancer BRCA1-2BRCA1-2 90%90% Duchenne Muscular Dystrophy Duchenne Muscular Dystrophy DMDDMD 90%?90%? Fanconi anemia Fanconi anemia FAAFAA 80%80% Hereditary non-polyposis colorectal cancer Hereditary non-polyposis colorectal cancer hMSH1-2hMSH1-2 70%-80% 70%-80% Neurofibromatosis type 2 Neurofibromatosis type 2 NF2NF2 65%65% Hunter Syndrome Hunter Syndrome IDSIDS 50%50% Neurofibromatosis type 1 Neurofibromatosis type 1 NF1 NF1 50% 50% Cystic Fibrosis Cystic Fibrosis CFTRCFTR 15%15%
Molecular inversion probe (MIP) genotyping
•MIP genotyping uses circularizable probes with 5′ and 3′ ends that anneal upstream and downstream of the SNP site leaving a 1 bp gap•Polymerase extension with dNTPs and a non-strand-displacing polymerase is used to fill in the gap
•Ligation seals the nick, and exonuclease I is used to remove excess unannealed and unligated circular probes•The resultant product is PCR-amplified and the orientation of the primers ensures that only circularized probes will be amplified•The resultant product is hybridized and read out on an array of universal-capture probes
GoldenGate uses extension ligation between annealed locus-specific oligos (LSOs) and allele-specific oligos (ASOs)
An allele-specific primer extension step is used to preferentially extend the correctly matched ASO (at the 3′ end) up to the 5′ end of the LSO primer
Ligation then closes the nick
GoldenGate genotyping assay
A subsequent PCR amplification step is used to A subsequent PCR amplification step is used to amplify the appropriate product using common amplify the appropriate product using common primers to ‘built-in’ universal PCR sites in the primers to ‘built-in’ universal PCR sites in the ASO and LSO sequencesASO and LSO sequences
The resultant PCR products are hybridized and The resultant PCR products are hybridized and read out on an array of universal-capture probesread out on an array of universal-capture probes
GoldenGate genotyping assay
454 technology:Sequencing by synthesispyrosequencing
Up to 100 Million bpin 8 hours can be readAmbiguities arise for homopolymeric tracts