NEOZ Cordless Lighting. - Important Bagatelles€¦ · hehe HilHitontot - Mancheestes Banyan Treee...

Post on 05-Apr-2020

2 views 0 download

transcript

N Wally YacYacYacYachtshts TTTTTT Thhehehehehehe FFFFFoFFour Sr Sease onso HoHoteltel - EgyEgyEgyEgygygygyyptptpttptpt ptpt p VViVirVViVirVirVirVirVir iigingingingingin AAtAt At Atlanananlanlananllannticticticicicicticcct ClClClCl ClClCl Cl CClC ubhubuubuuuububu ousouse -e - Ho HoHoHoHooHoong ngngnn Kong Conrrrn an’an’ananananaa s Is Iconco ic c ResRResRR taut rant - Tokyoky Royal Albert Ht all - LonLondondonondondonon AAArtAArtArtArt G GaG lleery of NNNN

oSheeratratratratatononononon on FijFijFijFijFijFiji Ri RRi Ri Ri Resoort t AAAAAA AAmmamamanmmananmannyyaryaryarya a Ra Ra Ra Resoesoeesortrtrt rt tt - T- Turkurkkkssss &s &ss Ca Caicocos Is Islasland nd MGMGM GrGrGr G andndndddannanddd MMMMaMaMa MaMaMMMa Ma Ma MaMMMaMaMa M M caucaucauauccccaccacaac Ja Jazz zz zzz on on onooooooo LinLLininnnnncolcolcolcolcolccoocolnnn Cn Cnn enter - New York k HHHHHHH Huvuvauvauvauvauvauvauvafffenfenfenfeefen Fu Fu Fu FuFuuF shshishis Resort -t - Ma MaaaMaaaldldldldiddldildid ves Ha Haymayman In Islasland nd ResRessooooo

WMaMandandaandanddaarinrinrinnrinrinrin OOrOrOrOr Oriiienieniienent - B- erlrlinin B BB BBBBocaoca Ra RaRaRaaaaattontonton ReResorsort & Club - Florida One & OnOnOnOnlylylylylyly ly ly PPalPallPPPalP lmilmilmillalla la - M- MMexiex co co TheTTTT Peninninnnnnnnsulss a Ha Ha Ha aa oteotel -l HoHoHooHooooonngngngng nnnn KonK g g G GGGGGGrrarararanra d Resort Laggonionississi - - AthAthensensnsss The W

hehe HilHilHilHilHilHi tontott - Mancheestes Banyan TreTreee Re Re esoesoses rt t P- PPhukhukhukkkhukkkeetet e LLLa La LL ResR erve - GeGeneva TTTThehehehehhehe he PlaPlaPlaPlaPlaPlaPlaPlazzza HotHotel l - N- New ew YorYorYorYorYororrrkkkkkkkk SkSkSkSkSk SSkS Sketcetcetctcetcetcetctcetcee ch Rh RRh Rh Rh Rh Rh Rh hhhh esesteste auaurantnt - --- -- LonLonLononLL doonnnn B Bulgagariri HotHoteel elelel llel ee && RResoesooosoortrttrrtrt t - B- B- B- B- B Balialialialiaalialiaali AAAm Am Amankankora Resort - Bhutan

Interterconcontintinententntntttalalalal alal GrGrananndndndann Hy Hyyatatatattattatatttat - TokTokyo yo TheTheTheTheTheTheTheThehhh RRiiRiRiRRiRiR Ritz HotHotel el - L- Londonddndndnddononononononon on Penfold’s Magilll El Estastaatetete tetete te - AAdelelaidaidddeee e eee e ee ee RRaffl ffl es HoHoteltel - - SinSingapg oreore Juumeimeiemeirahrahhrahrarahahh BeBeBeBBeBe Be BeB achachachachachachaachac HoH tel - DubDubDubububububbaiaiai CroCroCroCroCroCroowwnwnewnewnewne

DoDorchrchrchrchhesteste er HotHotel el W Wynnynnnnnnynnnnnn LaLaLaLaaLa LaaLas Vs Vs Vegagas Hs Hoteotel al aaandndndndnd nnd ndd CCaCaCasCasCasCCasiinon CrCrysty al Cruises BBBurjurjurjrururjrjurju j AlAlAlAAlA AlAl AAAAr ArArAAAA abab - D- Dubaubai i BMW W WelWellt -t -t -t -t -t -t -t Mu MM MM nicich h Sanandy dy LaLanLanLanananane He Hoteotelllll - Barbados Banyan TTreereee ReReReRe ReReesorsorsorosorsorsorttttttt

‘Ic‘Ice Squaquauaauarererere rerre 1001011 ’ specifi fied ed forfor Le Les Os Os OOOOOOs Ombrmmbmmm es ResResResesRessesResesestautautauauautautautautautauranranrarant, t, QuaQuai B Branranranly lyly yyyy MusMusMusMusMusMuMusMusususM eumeueumeumeumeueumeumeumm PPPPaP Paris by by by arca hithitectect Je Jean an Nouvelv of Francance, e, P iPri ktzker ArcArchithitittectectectectectctctttureureureureureureureureure PPPPrPrPPrPrPr Priiizeize Laureate 2008

Phooto by byy JacJacJacJJacacJacacacckiekiekiekiekiekiekieiee Ch Ch CC an

NEOZ Cordless Lighting.Be seen in the best Light.

Designed and assembled in Sydney Australia for the World’s Best Hotels & Restaurants

‘Creating the fi nest ambience for the Worlds Best Hotels and Restaurants’

Ice Square 100 at Les Ombres RestaurantQuai Branly Museum Paris, architect Jean Nouvel

Page 2 Page 3

FrFrFFFrommmmmmmmm ‘‘‘‘ ThThThhT e eee RiRiRitztztz HH Hotototooo elelel’ ’ innnin L Loondon to ‘‘HuHuvafefeeennn nn FFuFuuF shshi’’’ inininin thhhheeeehe M MMMMalalalalddid vees,s, NNeoeoz zz CoCordlel ss Ligghth inng gg enennsusussusures syoyoyoyoyoyoyourururrurr e eeestststttabababablishmementnt is s seen in the e bestt l lligighthtthtt.

CrCrCrCrCrrCC eaeaeeaeaeateteteteteedd dd dd bybybb o our LLigghtth ining g DeDeDeD sisisigngngng erers,s,s,, N Neooeoz z CoCoorddrddlellesssssssss LLiLiiLiLiLighghghghghghg titititititingngnggngn iiiis s rer chhc arrgegeabablele, didiidimmmmmmmabababableleee, sasaaafefefefe, and dprprprprp ovovovvidididdddeeseses u uuuup p p tototo twewentn y y titimemes thhhe eee brbrbrrigigighththth nenenenesssssss o oooffff aa cacacacacandndndndndlelelelele uuu sisisingngggg a a HHala ogogo enen b bululb b - - ththe ee sususupepepeririir ororooo l ligightththt sossosos ururu cecece wwititth h peeppp rfrfecect t cocololourur r renendedeeriringngggg fffororor dddefiefiefi n nininng g sksskininin t tononnes, foooddd c cololouourss a aandndndd tt texexextutuurereres;s; o oor rr ththe e LELED DDbubulblb optp ion n fof r mam ximum mmm lililighghhtt titimememe a a andndn e effi ffi c cieencncn y.y

ToTo g guauarranteeee performance nightht aaaftftereree nnigiggighthththt, yeyearar aaffter year Neoz Cordless LaLaampmpmpm s ss ususususe e e ononononlylyylyy t t tthehehehe hihighhest quuala ity coompmpmpponononenenentstststs ww wwitititithhhh upupupu t ttto o o ththththrereee e e yeyeyeearararrs sswawawarranntytyty i i incncncnclululul dididingngngn tt tthehehehe w wwworororo ldldldd’s’s b bbesese t t LiLiththt iuiuum-m-m iionon rechargeeeabbleele bbbbatatatatteteteteriririeseseses...

AAlAlAlsososoo d ddd esesesesigiggignenened d d fofoforr r thththe ee hohohoh mememme u uuseseer r theeessese ppporororrrrtatataaablbblble elululumimiinananaairirrireseses a a allllllowowoww c c comomomompllplp etete freeeee ddoom mm aanandd fl flflflexeeexexe ibibbbilililitti yy y – ththheyeyeyey c cc ananan b b bbe e e usususedededed tt to o ilililluluu iiminaaaanatete aaan n oououtdtdoooooooo r r sesseseetttttiniingfofofofor r r upupup t t to oo 26262660 0 0 0 hohohooururururu s*s*s*s* a aa c ccchahhargrgggeee orrrororor aaaaa asss sss cocccococ rdrddrdr ededededded ll lamamamamaampsppsp tooto cc c cononononseseservrvrve ee bababattttttttererery y y y enenenenererergygygygy wwwwheheheh n n nen ara a poweerere sosoouruurcececece...

FeFeFeatataturururu inining gg g dididimmmmmmmmininiing gg g asasasa w w welelell ll asss ttheheh canandllldle momoddeded , , aall atata t thehee t ttououo chchch oo off f a a a bubububuutttttttononn,, thththe e NENENEEOZOZZ C CCorordldlesesss lalaampmpleleetststs y yyyouou c ccrerereatatate e e ananna inntntimimata e e atatmomom spphehererere i iin nn yoyoy uur hohohoh memememe, , inininsissidedede a aaandnddn outtut.

LiLighghg titingngg D DDesese igiggnenersrsrss s ssinini ceceec 1 1989883,3,33, a aandndd p pioiooneneerers soffof C Corordldld esess s LiLL ghghtititinggngg s s sinininncecee 1 19999995,5, NN NNNeoeoeoz zzz hahas srererecececeivivivededede ssevevereralal A AAususu trralaliaiaiaan nn DeDeDeesisisiigngnggn A A Awawawaardrds s annnannd dththhe e ininteteernrnatata ioioonanal ‘rredded ddototo ddd deseesesiggiggn awawawararrd’d’d’d’ f fforororror t t t hhhihis s ououutststatanddn inining gg prprododo ucuct t t rarangngn e.e.e

* * hohoururs s babasesed d onono L Lowow ssetettitingng ( (PrPrroo babattttere y)y) w witith h LELED D bubulblb

Quality Assurance Made from the world’s best quality materials & components, under warranty for up to 3 years.

True Colour Rendering Beautiful light diff usion with halogen light bulb, the best light source for true colour rendering of skin tones, food colours and textures.

Remarkable Performance High capacity, long life, Li-ion rechargeable batteries combined with the LED bulb option gives up to 260 hours of light time on a single charge.

Easy Charging and Operation Unique charging on a dedicated base station with red and green charge status indicator, showing when the lamps are fully charged.

Fuel Gauge Base of each lamp shows battery charge level.

Eco Friendly All parts designed to be replaceable, serviceable and recyclable. ‘Green’ Li-ion battery & RoHS Compliant.

Cost and Energy Saving 1 Lamp = over 1000 Candles per yearAround 2 cents per day of electrical energy to charge and eliminates hardwiring costs.

Brighter Refl ected light 20 times brighter than a candle to read menus clearly.

Dimmable 3 dimming levels for a beautiful light ambience

Candle Eff ect A safer option without fl ame, smoke or odour that will not blow out in windy conditions.

Page 4 Page 5

Cordless Lighting Features and Benefi ts‘Ritz’ - The Ritz, Piccadilly London

Photo by Jackie Chan

Page 6 Page 7

Cordless Lighting Glass Series

Egg

Rechargeable battery table lamp with hand blown frosted glass diff user providing soft ambient light.

Margarita

Rechargeable battery table lamp with hand blown assymetric frosted glass diff user on stainless steel base providing soft ambient light.

Egg Fritted

Rechargeable battery table lamp with hand blown fritted glass diff user providing soft ambient light.

Little Margarita

Rechargeable battery table lamp with hand blown assymetric frosted glass diff user providing soft ambient light.

Saffron

Red

Aqua

Opal

‘Egg’ - Restaurant Vinkeles, The Dylan AmsterdamPhoto by Roel Ruijs

Page 8 Page 9

Cordless Lighting Glass Series

Ice Square 100

Rechargeable battery table lamp with pressed frosted glass diff user providing soft ambient light.

Ice Round 100

Rechargeable battery table lamp with pressed frosted glass diff user providing soft ambient light.

Ice Square 85

Rechargeable battery table lamp with pressed frosted glass diff user providing soft ambient light.

Ice Round 85

Rechargeable battery table lamp with pressed frosted glass diff user providing soft ambient light.

‘Ice Round 100’ - Universal Restaurant, SydneyPhoto courtesy of Universal

Page 10 Page 11

Cordless Lighting Polymer Series

Collins

Rechargeable battery table lamp with brushed stainless steel base and top with opal diff user providing soft ambient light.

Gem Square

Rechargeable battery table lamp with injection molded Plexiglas® diff user provides soft ambient light

Little Collins

Rechargeable battery table lamp with brushed stainless steel top with opal acrylic diff usor providing soft ambient side and downlight.

Gem Round

Rechargeable battery table lamp with injection molded Plexiglas® diff user provides soft ambient light

Amber

Ruby

Sapphire

Opal

Amber

Ruby

Sapphire

Opal

‘Gem Square Ruby’ - Fairmont Beijing, ChinaPhoto courtesy of Fairmont Hotels

Page 12 Page 13

Cordless Lighting Metal Series

Owl 1

Rechargeable battery table lamp with dome refl ector giving maximum direct downlight without glare. Ideal for table lighting rooms with views through glass as there is minimum refl ection.

Owl 3

Rechargeable battery table lamp with internally ribbed conical diff user providing soft ambient light.

Owl 2

Rechargeable battery table lamp cylindrical opal diff user and top plate providing soft ambient side and downlight.

Owl 1 Tall

Rechargeable battery table lamp with dome refl ector giving maximum direct downlight without glare. Increased height provides wider surface illumination. Ideal for table lighting rooms with views through glass as there is minimum refl ection.

S/Steel

Brass

Copper

Black

White

Antique Bronze

S/Steel

Brass

Copper

Black

White

Antique Bronze

S/Steel

Brass

Copper

Black

White

Antique Bronze

S/Steel

Brass

Copper

Black

White

Antique Bronze

Owl 2 Tall

Rechargeable battery table lamp cylindrical opal diff user and top plate providing soft ambient side and downlight. Increased height provides wider direct surface illumination.

Magill

Rechargeable battery table lamp with brush body with part frosted acrylic providing direct downlight and soft ambient side light.

Owl 3 Tall

Rechargeable battery table lamp with internally ribbed conical diff user providing soft ambient light. Increased height provides wider direct surface illumination.

Ritz

Rechargeable battery table lamp with solid brass traditional base and shade providing direct downlight and soft diff used sidelight.

S/Steel

Brass

Copper

Black

White

Antique Bronze

S/Steel

Brass

Copper

Black

White

Antique Bronze

Brass

Nickel

Page 14 Page 15

Cordless Lighting Handmade Resin Series

Gem 1 Resin

Rechargeable battery table lamp with hand-made solid resin diff user provides soft ambient light.

Medusa

Rechargeable battery table lamp with solid resin form encapsulating the refl ector providing glare free soft table lighting.

Gem 2 Resin

Rechargeable battery table lamp with hand-made solid resin diff user provides soft ambient light.

Amber

Ruby

Sapphire

Opal

Amber

Ruby

Sapphire

Opal

‘Medusa’ - Amanyara Resort, Turks & Caicos IslandPhoto by Lloyd Inwards

Page 16 Page 17

Cordless Lighting Specifi cations - Pro and Eco Comparison

5W halogen frosted - standard (4000+ hour life)10W halogen frosted - optional (4000+ hour life)

1.1W LED - optional (50000+ hour life)

Sanyo 2600mAhLi-ion Rechargeable Battery

1000+ full charge cycles & replaceable

4.5 hours

5W halogen frosted - standard (4000+ hour life)10W halogen frosted - optional (4000+ hour life)

1.1W LED - optional (50000+ hour life)

Sanyo 5200mAhLi-ion Rechargeable Battery

1000+ full charge cycles & replaceable

8.5 hours

Charger

Special Light Eff ects

Approvals & Standards

Intellectual Property

Warranty

5W Halogen

11 hours17 hours33 hours

10W Halogen

6 hours9 hours

17 hours

1.1W LED

56 hours104 hours260 hours

FullMediumLow

5W Halogen

-8 hours

14 hours

10W Halogen

---

1.1W LED

28 hours52 hours

130 hours

FullMediumLow

100 - 240V Switch-Mode Electronic Power Supply15W SMPU for max. 1 Lamp, 50W SMPU for max. 5 Lamps, 120W SMPU for max. 12 Lamps

Approved for worldwide usage supplied with appropriate mains electric plug type

Dimmable with 3 brightness levels, Candle mode with 2 brightness levels

CE, CSA, C-Tick, FCC, RoHS Compliant

Neoz V4 Cordless Lamps are covered by Design Registration,Software Copyright, Patents and Patents Pending

NEOZ warrants the V4 range for 36 months from the date of purchase.Please refer to our website for further information - http://www.neoz.com.au/warranty

Light Source

Power Source

Light Time

Charge Time

Cordless Lighting Specifi cations - Lamp Range

175mm x 110mm(7”) x (4½”)

160mm x 85mm(6¼”) x (3½”)

1.64 kg / 3.6 lb

1.24 kg / 2.7 lb

1.04 kg / 2.3 lb

Hand Blown Glass

Hand Blown Glass

Hand Blown glass + Stainless Steel

Hand Blown Glass

1.00 kg / 2.2 lb

1.00 kg / 2.2 lb Aqua, Opal, Saff ron, Red

Clear / Sand Blasted

Clear / Sand Blasted

1.22 kg / 2.7 lb

1.11 kg / 2.5 lb

Injection Moulded Plexiglas

Injection Moulded Plexiglas

1.20 kg / 2.6 lb Amber, Opal, Sapphire, Ruby

Amber, Opal, Sapphire, Ruby

Stainless Steel + Acrylic

Stainless Steel + Acrylic

0.73 kg / 1.6 lb Opal / Brushed Stainless Steel

Polyester Resin1.32 kg / 2.9 lb Amber, Opal, Sapphire, Ruby

1.04 kg / 2.3 lb

Polyester Resin1.48 kg / 3.3 lb Amber, Opal, Sapphire, Ruby

0.63 kg / 1.4 lb Opal / Brushed Stainless Steel

0.55 kg / 1.2 lb

0.55 kg / 1.2 lb

0.60 kg / 1.4 lb

0.60 kg / 1.4 lb

Polished metal orBaked enamel colour

Polished metal orBaked enamel colour

Polished metal orBaked enamel colour

Polished metal orBaked enamel colour

Polished metal orBaked enamel colour

Polished metal orBaked enamel colour

0.58 kg / 1.3 lb

0.58 kg / 1.3 lb

Stainless Steel + Acrylic0.85 kg / 1.9 lb Clear Lens / Brushed Stainless Steel

Polished Brass / Satin Nickel2.0 kg / 4.4 lbBrass - cast,

machined + polished Parchment shade

Stainless Steel /Brass / Copper /

Aluminium (Colour)

Stainless Steel /Brass / Copper /

Aluminium (Colour)

Stainless Steel /Brass / Copper /

Aluminium (Colour)

Stainless Steel /Brass / Copper /

Aluminium (Colour)

Stainless Steel /Brass / Copper /

Aluminium (Colour)

Stainless Steel /Brass / Copper /

Aluminium (Colour)

Polyester Resin1.42 kg / 3.2 lb Clear

175mm x 110mm(7”) x (4½”)

160mm x 85mm(6¼”) x (3½”)

180mm x 120mm(7½”) x (4¾”)

180mm x 120mm(7½”) x (4¾”)

205mm x 100mm(8”) x (4”)

180mm x 100mm(7”) x (4”)

200mm x 95mm(8”) x (3½”)

210mm x 78mm(8¼”) x (3”)

210mm x 90mm(8¼”) x (3½”)

220mm x 95mm(8½”) x (3½”)

175mm x 115mm(7”) x (4½”)

175mm x 110mm(7”) x (4½”)

195mm x 100mm(8”) x (4”)

145mm x 100mm(5¾”) x (4”)

190mm x 78mm(7½”) x (3”)

190mm x 90mm(7½”) x (3½”)

200mm x 100mm(8”) x (4”)

275mm x 125mm x 125mm(11”) x (5”) x (5”)

170mm x 110mm(6¾”) x (4½”)

170mm x 110mm(6¾”) x (4½”)

195mm x 140mm x 120mm(7¾”) x (5½”) x (4¾”)

Press Glass

Press Glass

Press Glass

Press Glass

1.81 kg / 4.0 lb Clear / Sand Blasted

Clear / Sand Blasted

Clear / Sand Blasted

Clear / Sand Blasted

Clear / Sand Blasted

Ice Square 100

Ice Square 85

Ice Round 100

Ice Round 85

Egg Fritted

Gem Square

Little Collins

Owl 3

Owl 3 Tall

Ritz

Gem 2 Resin

Egg

Little Margarita

Collins

Owl 2

Owl 2 Tall

Margarita

Gem Round

Owl 1

Owl 1 Tall

Magill

Gem 1 Resin

Medusa

PRO ECO Dimensions Material Colour / Surface FinishWeight(Based on PRO Battery)

Page 18 Page 19

Charging Options for Home Users

Base Station

The standard single Lamp charging solution for NEOZ Cordless Lamps.Equipped with LED charge indication and Base Station switching, simply rotate Lamp half a turn for diff erent brightness levels (patented). Lamps illuminate using mains power when on Base Station.

Charging Bar

Storage + charging platform for up to 5 Lamps.Five Base Stations fi tted into Bar pre-assembled with fi ve way distributor and one lead to one 50W 100-240V Switch-Mode Electronic Power Supply unit. Two sizes accomodate the full Lamp range.

Simply rotate Lamp half a turn for diff erent brightness levels (patented).Lamps illuminate using mains power when on Base Station.

Page 20 Page 21

Charging Options for Commercial Users

Bar short/long

Storage + charging platform for up to 5 Lamps using one 50W electronic power supply. Crafted with birch plywood, two sizes accomodate the full Lamp range.

Base Station

Standard equipment for single lamp user. Base Station charging with full LED charge indicator. Lamp can be illuminated using mains power when on Base station.

5 way power distributor

Flexible 5 way DC distributor. Charge 5 lamps from one power outlet (50W charger electronic power supply).

Small Recharging Trolley

Recharging and storage platform for up to 24 Lamps with two 120Wcharger electronic power supply’s fully assembled with one power plugfor mains connection. Durable polycarbonate moulding provides a stable platform with 24 docking points each with LED charge indication.

Large Recharging Trolley

Recharging and storage platform for up to 48 Lamps with four 120Wcharger electronic power supply’s fully assembled with one power plugfor mains connection. Durable polycarbonate moulding provides a stable platform with 48 docking points each with LED charge indication.

Recharging Tray

Recharging Tray for up to 12 Cordless Lamps complete with one 120Wcharger electronic power supply. Durable polycarbonate moulding provides a stable platform with 12 docking points each with LED charge indication.

‘Large Recharging Trolley’ with Owl 1 - BMW Welt, GermanyPhoto by Jonathan Knight

Page 22 Page 23

Charging Systems for Home & Commercial Users

* Note:Higher Lamp capacity per Recharging Tray + Trolley available on Owl Series, Ice Square 85 and Ice Round 85 Lamp models.Contact sales for more details.

Charging Capacity *

Lamp illuminates on

Charging Dock

Weight

Dimensions

Material

Power Supply

Approvals &

Standards

5 lamps

No

Short: 1.18 kg / 2.6 lbLong: 1.54 kg / 4.4 lb

Short565 x 110 x 39 mm(22”) x (5”) x (1½”)

Long810 x 120 x 39 mm(32”) x (5”) x (1½”)

Birch Plywood

5 lamps

No

1.06 kg / 2.3 lb

N/A(Flexible)

Polycarbonate

1 lamp

Yes

0.5 kg / 1.1 lb

Ø100mm x 25mm(Ø4” ) x (1”)

Polycarbonate

100 - 240V Switch-Mode Electronic Power Supply15W SMPU for max. 1 Lamp, 50W SMPU for max. 5 Lamps, 120W SMPU for max. 12 Lamps

Approved for worldwide usage supplied with appropriate mains electric plug type

All charging bars, trays and trolleys are supplied fully assembled and Cordless Lamps fully charged recharged ready to operate with main plug for country of use.

CE, CSA, C-Tick, FCC, RoHS Compliant

12 lamps

No

3 kg / 7 lb

595 x 440 x 26 mm(24”) x (18”) x (1”)

Polycarbonate

24 lamps

No

19 kg / 42 lb

610 x 450 x 900 mm(24”) x (18”) x (36”)

PolycarbonatePlated Steel Frame

48 lamps

No

33 kg / 73 lb

910 x 610 x 900 mm(36”) x (24”) x (36”)

PolycarbonatePlated Steel Frame

Large

Recharging Trolley

Small

Recharging Trolley

Recharging

Tray

Charging Bar

(Short or Long)

5-Way Distributor

with Base Stations

Base Station

Page 24 Page 25

Cordless Illuminated Furniture

Aura cordless

In collaboration with designer Henrietta Gothe-Ellis of 2DESIGN, the award winning Aura illuminated modular seat utilizes NEOZ V4 Cordless technology to provide a soft ambient glow. When the charger is connected the light will operate from mains power and simultaneously charge the battery.

Rombi Lit cordless

In collaboration with furniture designer Paul Morris of join, The illuminated modular seat uses the award winning NEOZ V4 Cordless technology to provide a soft ambient glow.

* In addition to the Cordless solution we also off er mains powered corded versions.

Aura Mini cordless

A mini version of the Aura, an award winning illuminated modular seat,using NEOZ V4 Cordless technology to provide a soft ambient glow. Whenthe charger is connected the light will operate from mains power andsimultaneously charge the battery.

‘Aura’ and ‘Ice Round 85’ - Hotel Paracas, PeruPhoto courtesy of Starwood Hotels

Page 26 Page 27

Charging Options for Illuminated Furniture

15W Power Supply

Plug in directly to base of lamp to charge and/or operate simultaneously. Charger comes with 4 interchangeable international mains plugs.

50W Power Supply with 5-Way Power Distributor (Long)

Charges up to 5 lamps simultaneously from one power supply. Each fl exible cable is 1.5 meters long and plugs directly into the lamp control socket.

Type A

Type G

5-Way Power Distributor (Long)

50W Power Supply

+

Type C

Type I

www.NEOZ.com

Neoz Cordless Lighting

20 Tepko Road Terrey Hills 2084 NSW Sydney Australia Tel +61 2 9810 5520 Fax +61 2 9555 1054

Email sales@neoz.com.au

Updated August 2011