Pathways of technology adoption and adaptation Saheer Gharbia Applied and Functional Genomics Centre...

transcript

Pathways of technology adoption and adaptation

Saheer GharbiaApplied and Functional Genomics

Centre for InfectionHealth Protection Agency

Methods and approaches to elucidate the spread of infectious diseases are as old as human civilisation and stretch in their logic from magical, philosophical to scientific.

Pheno-, Sero-, phage and biotypes

extremely valuable, able to identify cellular

components associated with virulence.Limited discriminatory power, resolving

pathogens into only a few types.Challenged by Diversity, mutations and

acquisition of new traits

Technology in diagnostics is a composite of:

•Refining what is established•Exploring what is new (concept or tool)•Adapting the new to the function

Examples of Streamlining:

VIDAS®: automated system for Rapid Pathogen Monitoring

VITEK® 2 Compact: automated system for microbial identification

API® / ID 32/ APIWEB®: microbial identification with internet-base tool

TEMPO®: enumeration of quality indicators in food

air IDEAL®: aerobiocontamination control

Count-Tact™ range: monitoring of surface and air biocontamination

BacT/ALERT® 3D microbial detection system

Multiplex Fluorescent Immunoassay

RaPET Rapid Particle Enhanced Technology

Salvador Luria and Max Delbruck (1943)

Provided a statistical demonstration that inheritance in bacteria follows Darwinian principles. Mutations occur randomly in bacterial populations. They occur in small numbers in some populations and in large numbers in other cultures.

awarded the Nobel Prize in Medicine or Physiology in 1969.

Classical Molecular Genetics for the analysis of infectious agents was a natural follow up especially with the publication of the Watson-Crick DNA model.

Gross DNA structure: Restriction Diget, southern hybridisation, RFLP,AFLP, plasmid profiling, PFGE, fAFLP and ribotyping

PCR lead to the next phase by accelerating the process, adding higher resolution, selective amplification and quantitative measurements

The power of PCR-based methods is the ease with which they can be applied to many bacterial pathogens and their multilocus discrimination.

Such methods have proven valuable for genetic dissection of pathogens for which previous methods have failed.

Dendrogram of MroI FAFLP

However, a limitation of many PCR-based approaches is the biallelic (binary) nature of their data resulting from the presence or absence of a marker fragment.

Draft Microbial Genomes

The first pathogens to be sequenced under the current program are members of the Bacillus, Brucella, Clostridium, Francisella, Shigella, and Yersinia groups. In many of these groups, several strains or related species will be sequenced, for example, two strains of Bacillus anthracis (anthrax) and one of the similar species Bacillus thuringiensis.

Sequence-derived DNA typing is more rapid and has an even greater capacity for genetic dissection of bacterial pathogens. It is limited only by the genome size and the technology.

Because most microbial genomes consist of millions of nucleotides,

technology is invariably limiting.

The flagellum is composed of 20,000 flagellin subunits

• Flagellin subunit is the antigenic determinant

H antigen typing of Salmonella

Kauffmann-White scheme

• Expression of antigens is determined by agglutination with specific antisera

• In accordance with this scheme, routine clinical laboratories classify Salmonella by their particular combination of flagellar (H) and somatic (O) antigens.

• O antigens (60 have been distinguished)• H1 antigens (63 have been distinguished)• H2 antigens, not always present (37 have been distinguished)

• H-antigens are designated by letters of the alphabet (a, to z, z1, z2 etc.) and by Arabic numerals.

Identification of unique amino acid motifs

Sequence distances of fliC of different serotypes

g-complex sequences

“non-g” sequences

Nucleotide Substitutions (x100) 0

10 20 30 40 50 60

-_gallinarum_M84979 -_pullorum_B51

g,m_enteritidis_B16 g,m_enteritidis_B18 g,m,s_emek_B20 -_gallinarum_M84975 -_gallinarum_M84976 g,m_enteritidis_B17 g,m,[t]_othmarschen_U06455 f,g,m,p_enteritidis g,m_essen_U05299 g,q_moscow_Z15086

g,p_dublin2_M84972 g,p_dublin3_M84973 g,p_dublin1_z15067 g,p_dublin_B12 g,p,u_rostock g,p,s_naestved g,m_enteritidis_B19 g,m,[p],s_montevideo g,m,{p},s_montevideo_B31

[g,s,t]_simsbury g,s,t_senftenberg g,[s],t_B59

g,t_budapest f,g,s_agona_B01 f,g_derby f,g_derby_B09 f,g_adelaide

f,g,t_berta m,t_banana m,t_oranienburg

g,z51_C15 g,z51_C09

g,z51_newmexico r_A37_heidleberg r_A30_heidleberg r_A40_heidleberg r_A32_heidleberg r_A31_heidleberg

i_typhimurium_C01 i_typhimurium_A01 i_typhimurium e,h_anatum_B02

e,h_saintpaul_A22 e,h_newport_B36

c_choleraesuis_B04 c_choleraesuis_AF159459

z41_bongori_C11 z_indiana_B25 z10_hadar z10_haifa_B22

z35_arizonae_C08 k_thompson_B62

l,v_panama_B39 l,v_B03

a_miami_B28 d_muenchen_A63 d_muenchen_X03395 d_duisberg_B15

b_paratyphiB_A41 z4,z24_seminole_C16

z4,z23_stanleyville_B61 z4,z23_arizonae_C05

Pyrosequencing™

Analysis of several SNPs

5’-C/TGGCCGGGTCACGAT/GGCCC-3’

Identification of H1:g,p vs. H1:g,m

•A test was designed specifically for differentiation between dublin and enteritidis serotypes.

•Based on a SNP in the central variable region.

S. dublin genotype:

S. enteritidis genotype:

•One of the most recent developments in molecular analysis involves the analysis of VNTR sequences.

•Short nucleotide sequences that are repeated multiple times often vary

in copy number, creating length polymorphisms that can be detected

by PCR using flanking primers.

•Satellites: Spanning megabases

•Minisatellites: Repeat units 6-100bp (spans 100’s bps

•Microsatellites: Repeat units 1-5 bp (spans 10’s bps)

The multi-locus VNTR banding patterns, as originally described by Alec Jeffreys enable us to determine relationships and degrees of relationship between individuals. Bands on the blot may be classified as 'M' for maternal, 'P' for paternal, 'I' for invariant, or 'X' for non-parental.

VNTR Background

Polymorphism at a VNTR locus can occur either as a result of nucleotide sequence changes between individual repeat units or as a result of variation in the number of repeat units, hence creating allelic variants.

GATCATCGGT

GATCATCGGTCATAGACTATGATC

GATCATCGGTCATAGACTAT

TAGACTAGATAGC

Electrophoretic analysis of VNTR fragments from different B. anthracis isolates

Capillary Electrophoresis

VNTR Cluster AnalysisCategorical

VNTR largest x-y

K@lisademo@00000006

K@lisademo@00000016

K@lisademo@00000003

K@lisademo@00000004

K@lisademo@00000010

K@lisademo@00000013

K@lisademo@00000001

K@lisademo@00000017

K@lisademo@00000008

K@lisademo@00000009

K@lisademo@00000005

K@lisademo@00000007

K@lisademo@00000002

K@lisademo@00000014

K@lisademo@00000011

K@lisademo@00000012

K@lisademo@00000015

18-NCTC_10.

E168704B

16-NCTC_10.

17-NCTC_10.

19-NCTC_10.

13-NCTC_59.

E16895B

11-NCTC_20.

10-NCTC_570.

09-NCTC_144.

12-NCTC_28.

08-NCTC_59.

14-NCTC_87.

15-NCTC_87.

Nairobi.

Kenya?

Java .

Java; .

India; .

Type s.

Califor.

Probab.

PH 80/63

13925/58

13927/58

PH 90/63

Tjiwidej

Bombay 2.

Bombay 1

Soemeda.

10329 and 10330 from same.

received via Pasteur Institute .

patient from Maratha plague .

Spermophilus beecheyi

sample received from India .

Antiqua

Medievalis

Orientalis

Microarrays

Array Technology

High density oligonucleotide arrays

High density ‘spotted’ arrays

Low density ‘line-probe’ arrays

Low density addressable arrays

Pathogenesis

The CDC, NAID: SARS, smallpox

Disease Susceptibility “susceptibility genes” in HIV

Vaccine Development to examine transcriptional activity of all genes of pathogenic

microorganisms under in vivo conditions

Pathogen Identification Identify pathogens using ribosomal DNA sequences

Drug Response

identify the presence of drug resistance genes catalog individual genetic variations in drug resistance

Imagine a world where microscopic medical implants patrol our arteries, diagnosing ailments and fighting disease; where military battle-suits deflect explosions; where computer chips are no bigger than specks of dust; and where clouds of miniature space probes transmit data from the atmospheres of Mars or Titan.Many incredible claims have been made about the future's nanotechnological applications, but what exactly does nano mean, and why has controversy plagued this emerging technology?

Nanotechnology is science and engineering at the scale of atoms and molecules. It is the manipulation and use of

materials and devices so tiny that nothing can be built any smaller.

Water Soluble & Functional NIR Dyes

Fluorene Oligomer for Electronic Applications

Green Emission Quantum Dot

Molecular diagnostics is becoming a driving force in drug development. Applications have spread

from identifying infections to include screening for cancer, hepatitis and genetic disorders

Personalised MedicineThe scientific community is progressing quite

rapidly in developing molecular diagnostics, and industry is developing assay prototypes and

conducting larger validation studies to advance this research to full clinical utility.

The risk associated with the newer technologies is that the accuracy and precision of the data generated will be compromised. Highly specific assay formats are required to detect DNA sequence variations

To achieve such specificity, Careful assay design, Validation, Quality Control Standards are required

Pathways of technology adoption and adaptation Saheer Gharbia Applied and Functional Genomics Centre...

Documents