PHARMACOGENOMICS

transcript

PHARMACOGENOMICSPHARMACOGENOMICS

John N. van den Anker, MD, PhD, FCP, FAAP

Children’s National Medical Center, Washington, DC, USA &Intensive Care, Erasmus MC-Sophia Children’s Hospital,

Rotterdam, the Netherlands

John N. van den Anker, MD, PhD, FCP, FAAP

Children’s National Medical Center, Washington, DC, USA &Intensive Care, Erasmus MC-Sophia Children’s Hospital,

Rotterdam, the Netherlands

Disclosure presentation John N. van den Anker

I do not have anything to disclose related to the content of my presentation

Individual variability in drug response can have serious consequencesIndividual variability in drug response can have serious consequences

Stevens-Johnson Syndrome (SJS) Adverse Drug Reaction

Effectively treats or prevents disease

The Ideal MedicationThe Ideal Medication

Has no adverse effects

Paradox of Modern Drug Development Paradox of Modern Drug Development

1. Clinical trials provide evidence of efficacy and safety at usual doses in populations

2. Physicians treat individual patients who can vary widely in their response to drug therapy

Efficacious & Safe

No Response

Adverse Drug Reaction

• 4-6th leading cause of death in the USA1

• Health care costs: $137-177 billion annually (USA)2-3

• Cause 7% of all hospital admissions4

• Cause serious reactions in over 2,000,000 hospitalized patients (6.7%) each year in the USA1

• Cause fatal reactions in over 100,000 hospitalized patients each year in the USA1

• 50% of newly approved therapeutic health products have serious ADRs, discovered only after the product is on the market (Health Canada, 2007)

• 95% of all ADRs are unreported

• 4-6th leading cause of death in the USA1

• Health care costs: $137-177 billion annually (USA)2-3

• Cause 7% of all hospital admissions4

• Cause serious reactions in over 2,000,000 hospitalized patients (6.7%) each year in the USA1

• Cause fatal reactions in over 100,000 hospitalized patients each year in the USA1

• 50% of newly approved therapeutic health products have serious ADRs, discovered only after the product is on the market (Health Canada, 2007)

• 95% of all ADRs are unreported

Adverse Drug Reactions

4. Pirmohamed et al, BMJ, 2004 5. MjoÈrndal et al, EACPT3, 1999

6. Moore et al., 2007

1. Lazarou et al, JAMA, 19982. Johnson et al, Arch Intern Med 1995

3. Ernst et al, J. Am. Pharm. Assoc. 2001

Patient genotype is currently an unknown Patient genotype is currently an unknown factor in the prescribing of medicinesfactor in the prescribing of medicines

Genetic FactorsGenetic Factors

20-95%20-95%

AgeAge

EthnicityEthnicityWeightWeightGenderGender

Concomitant DiseaseConcomitant Disease

Concomitant DrugsConcomitant Drugs

ComplianceComplianceDietDiet

Factors Contributing to Factors Contributing to Variability in Drug ResponseVariability in Drug Response

Growth and Development Growth and Development

Determinants of Drug Response in InfantsDeterminants of Drug Response in Infants

Drug Exposure

Response

AbsorptionDistribution

Receptor InteractionBiotransformation

Excretion

AbsorptionDistribution

Receptor InteractionBiotransformation

Excretion

Environment Genetics

DiseaseDisease

The Challenge of Optimizing the Use of Medicines in Paediatric Patients: Determining the Source(s) of Variability…...

OntogenyOntogenyOntogenyOntogeny PharmacogeneticsPharmacogeneticsPharmacogeneticsPharmacogenetics

From DNA to mRNA to protein From DNA to mRNA to protein

ATG ATC CCC TTT

Met Ile Pro Phe

3 billion correct basepairs ….and 1 mutation3 billion correct basepairs ….and 1 mutation

• atgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcactacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgaattcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttca

• atgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgacttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttca

• atgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcactacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgaattcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttca

• atgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgacttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttcagtacgtacatgtccaggtgcaggacgagttca

gacgaattcagtacgtacatggacgacttcagtacgtacatg

CYP2D6slow

intermediaterapid

ultrarapid

CYP2C19

Poor metabolizer normal

anti-convulsants, proton pump inhibitors, benzodiazepines, anti-malarials

anti-depressants, anti-psychotics, anti-arrhythmics, beta-blockers, pain medications, anti-emetics, anti-cancer drugs

CYP2D6 PharmacogeneticsCYP2D6 Pharmacogenetics

DrugStable metabolites,

Excretion

Drug Stable metabolites,Excretion

“Functional” overdose“Functional” overdose

CYP2D6 PharmacogeneticsCYP2D6 Pharmacogenetics

CYP2D6 activity displays bimodal distribution in Caucasian subjects

5-10% of Caucasian population deficient in CYP2D6 activity

“Poor metabolizers” or “PMs” have two “inactive” forms (alleles) of the CYP2D6 gene

PMs at increased risk for concentration-dependent side effects with “normal” drug doses

Some drugs may not work (codeine; tramadol)

CYP2D6 activity displays bimodal distribution in Caucasian subjects

5-10% of Caucasian population deficient in CYP2D6 activity

“Poor metabolizers” or “PMs” have two “inactive” forms (alleles) of the CYP2D6 gene

PMs at increased risk for concentration-dependent side effects with “normal” drug doses

Some drugs may not work (codeine; tramadol)

CYP2D6 Pharmacogenetics:

CaucasiansBertilsson et al. Clin. Pharmacol. Ther. 51:288-97, 1992

CYP2D6 Pharmacogenetics:

CaucasiansBertilsson et al. Clin. Pharmacol. Ther. 51:288-97, 1992

120120

0.010.01 0.10.1 11 1010 100100

CYP2D6 ActivityCYP2D6 Activity

uals N = 1,011N = 1,011

12.612.6

SlowerFaster

CYP2D6 Activity: ChineseBertilsson et al. Clin. Pharmacol. Ther. 51:288-97, 1992

120120

0.010.01 0.10.1 11 1010 100100

N = 1,011N = 1,011

N = 695N = 695

12.612.6

CYP2D6 ActivityCYP2D6 Activity SlowerFaster

PMPoor Metabolizer~ 5-10 % Caucasians

EMExtensive

Metabolizer

IMIntermediateMetabolizer~ 10-15 %

UMultrarapidmetabolizer~ 10-15 %

0.1 100101 MRS

Unravelling CYP2D6 Pharmacogenetics

Griese et al. Pharmacogenetics 1998, Raimundo et al. CPT 2004, Toscano et al.Pharmacogenetics 2006

full-term healthy male infant day 7 pp: intermittent periods of difficulty in breastfeeding day 11: the baby had regained his birthweight day 12: grey skin, milk intake had fallen day 13: the baby was found dead

autopsy: no abnormality blood concentration of morphine (metabolite of codeine):

70 ng/mL versus 0-2.2 ng/mL (typical)

Pharmacogenetics of Codeinesite of actioncodeine

morphine

Cytochrome P4502D6

Blood brain barrier

Eckhardt et al., Pain 1998

0 5 10 15 20 250

Extensive Metabolizer

Poor Metabolizer

time [h]

plasma morphine levels

after 170 mg codeine p.o.

Explanation: medication mother due to episiotomy pain:

codeine 60 mg plus paracetamol 1000 mg every 12 hrs

for 2 weeks

Morphine concentration in stored milk: 87 ng/mL

mother: CYP2D6 genotype: CYP2D6*2x2 gene duplication

= Ultra rapid metabolizer phenotype

The American Academy of Pediatrics and “Drugs in Pregnancy in Lactation”, the major reference guide to fetal and neonatal risk, list

codeine as compatible with breastfeeding

– Briggs et al., 2005; Pediatrics, 2001

Prior to this publication!

FDA drug label change and FDA drug label change and public health advisories public health advisories

Health Canada Health Canada Public AdvisoryPublic Advisory

Aug. 21, 2008Aug. 21, 2008

Estimated 1846 newborn infants are at risk for Estimated 1846 newborn infants are at risk for this codeine ADR annually in Canadathis codeine ADR annually in Canada

(340,000 births, 73% breastfed, 52% mothers receive codeine post-childbirth,1.4% risk genotype)(340,000 births, 73% breastfed, 52% mothers receive codeine post-childbirth,1.4% risk genotype)

May 10, 2006May 10, 2006

Aug 17, 2007

2 year old boy

Received tonsillectomy for sleep apnea

Received standard codeine dose

Died of respiratory depression

High levels of morphine in blood

Boy carried CYP2D6 gene duplication

Kelly, Rieder, van den Anker et al. More codeine fatalities after

tonsillectomy in North American children. Pediatrics 2012;129(5):1343-7

August 20, 2009

BloodGI Lumen Cell

Transporters Receptors

Protein kinases

Phosphatases

2nd messengers Targets

Opioids and pharmacogenomicsOpioids and pharmacogenomics

Why personalizing opioid therapy?•Wide unpredictable interpatient variability•Narrow therapeutic indices Inadequate pain relief and side effects ~ 50%•Genetic factors: up to 60% (Angst 2012)

Sadhasivam et al. (2012)

Candidate genesCandidate genes

1. 410 pain genes

2. <10% translated to human pain

3. Opioid + genetic ≈ 2000 hits

Division of genesDivision of genes

• Pharmacokinetic: affect the availability at the site of action

Phase I and II enzymes, transporters etc.

• Pharmacodynamic: target and downstream signaling cascade

Mu-opioid receptor, inwardly rectifying potassium channel etc

• Pain sensitivity: susceptibility to pain

Sodium channel, interleukines etc.

• Pharmacokinetic: affect the availability at the site of action

Phase I and II enzymes, transporters etc.

• Pharmacodynamic: target and downstream signaling cascade

Mu-opioid receptor, inwardly rectifying potassium channel etc

• Pain sensitivity: susceptibility to pain

Sodium channel, interleukines etc.

PK RELATED GENESPK RELATED GENES

Metabolism fentanylMetabolism fentanyl

CYP3A4 GeneCYP3A4 Gene

• Important drug metabolizing enzyme

Highly expressed in liver and intestine

broad substrate specificity (app. 50%)

• Identified SNPs

22 alleles identified (CYPallele homepage)

Rare or lack phenotypic effect

• Caucasian

*1G and *22 allele

• Important drug metabolizing enzyme

Highly expressed in liver and intestine

broad substrate specificity (app. 50%)

• Identified SNPs

22 alleles identified (CYPallele homepage)

Rare or lack phenotypic effect

• Caucasian

*1G and *22 allele

CYP3A4 SNPsCYP3A4 SNPsCYP3A4*1G reduced activity higher plasma levelsLess fentanyl requiredMore side effects

Studies

Dong (2012),Yuan (2011) and Zhang (2010): Lower fentanyl requirement postoperative

Yuan (2011) correlation between plasma levels and requirement (r=-0.552, p<0.001)

However, not associated with AEs and Pain score

CYP3A4*1G reduced activity higher plasma levelsLess fentanyl requiredMore side effects

Studies

Dong (2012),Yuan (2011) and Zhang (2010): Lower fentanyl requirement postoperative

Yuan (2011) correlation between plasma levels and requirement (r=-0.552, p<0.001)

However, not associated with AEs and Pain score

CYP3A4*22

PD RELATED GENESPD RELATED GENES

OPRM1 and FentanylOPRM1 and Fentanyl118A>G•Higher fentanyl requirement (Zhang 2011)•Higher VAS pain score (Wu 2009)

118A>G relevant?

Liao 2013: N=97, post-operative pain, fentanyl requirement+AEs

CYP3A4*18 >> A118G

304A>G

Lower fentanyl requirement (Landau 2009)

Association with morphine requirement not found

(Wong 2010)

118A>G•Higher fentanyl requirement (Zhang 2011)•Higher VAS pain score (Wu 2009)

118A>G relevant?

Liao 2013: N=97, post-operative pain, fentanyl requirement+AEs

CYP3A4*18 >> A118G

304A>G

Lower fentanyl requirement (Landau 2009)

Association with morphine requirement not found

(Wong 2010)

OPRM1 related genesOPRM1 related genes

Stat6Stat6

PAIN SENSITIVITY GENESPAIN SENSITIVITY GENES

Pain sensitivity genesPain sensitivity genes

Action potential•SCN9A

Α-subunit Nav1.7 channel, nociceptive neurons

R1150W increased sensitivity to pain (Reimann 2010)•KCNS1

Voltage gated K channel (Kv 9.1), sensory neurons

1465A>G increased sensitivity to pain (Costigan 2010)

Action potential•SCN9A

Α-subunit Nav1.7 channel, nociceptive neurons

R1150W increased sensitivity to pain (Reimann 2010)•KCNS1

Voltage gated K channel (Kv 9.1), sensory neurons

1465A>G increased sensitivity to pain (Costigan 2010)

NICU study NICU study

• n=132• Mechanical ventilation (PNA<3 days)• 2 level III NICUs

• Continous morphine vs placebo during max. 7 days• Loading dose 100 µg/kg 10 µg/kg/hr • Additional morphine (50 µg/kg 5-10 µg/kg/hr)

Objective

Determine if polymorphisms in PD related genes (OPRM1 118A>G, COMT Val158Met, ARRB2 8622C>T) are associated with additional morphine requirement (AMR) in newborns.

• n=132• Mechanical ventilation (PNA<3 days)• 2 level III NICUs

• Continous morphine vs placebo during max. 7 days• Loading dose 100 µg/kg 10 µg/kg/hr • Additional morphine (50 µg/kg 5-10 µg/kg/hr)

Objective

Determine if polymorphisms in PD related genes (OPRM1 118A>G, COMT Val158Met, ARRB2 8622C>T) are associated with additional morphine requirement (AMR) in newborns.

Results NICUResults NICU

OPRM1 % AMR OR* [95%CI]

118AA 31.0 4.93 [1.22-20]

118AG/118GG 34.3

COMT % AMR OR*[95%CI]

158Val/Val 57.1 0.161 [0.04-0.650]

158Val/Met or 158Met/Met 26.9

ARRB2 % AMR OR* [95%CI]

8622CC 11.1 5.52 [0.371-82.2]

8622CT/8622TT 34.3

*corrected OR and 95%CI for postconceptional age, sex, allocation group, location centre .

OPRM1 and COMT significant after Bonferroni correction

Pharmacogenomics Pharmacogenomics

Avoid adverse drug reactions

Maximize drug efficacy for individual patients

All Patients with Same

Diagnosis

treat with alternative drug or dose

Moderate risk of ADR (12.5%):

Low risk of ADR (0%):10% risk of

adverse reaction

Pharmacogenetic Profile:

HighHigh risk of ADR (50%):risk of ADR (50%):

treat with conventional dose

treat with alternative drug or dose

All children are at risk for ADRs, but not all children are at equal risk.

Find the kids at highest risk for serious ADRs due to genetic factors

What do we need to do!What do we need to do!

• Identify children with ADRs

• Identify ‘matched’ children on same medications, without ADRs

• Whenever possible, DNA samples are collected from biological parents of ADR patients

• Look for genetic variation in key drug ADME enzymes

• Develop new dosing guidelines

• Bedside-benchtop-bedside science

• Identify children with ADRs

• Identify ‘matched’ children on same medications, without ADRs

• Whenever possible, DNA samples are collected from biological parents of ADR patients

• Look for genetic variation in key drug ADME enzymes

• Develop new dosing guidelines

• Bedside-benchtop-bedside science

WE CAN’T TREAT CHILDREN LIKE ADULTS

Increased Risk of Severe ADRs in Children

>75% of approved drugs used in children are untested in

pediatric populations

Young children cannot evaluate or express their own

response to medications

Pediatric dosage forms not available

Children metabolize and transport drugs differently

than adults

PHARMACOGENOMICS

Documents