Post on 04-Jul-2020
transcript
PHARMACOGNOSTICAL, PHYTOCHEMICAL AND
PHARMACOLOGICAL SCREENING FOR
BAMBUSA VULGARIS (GRAMINEAE) AND
PANDANUS ODORATISSIMUS (PANDANACEAE)
Thesis submitted to
The Tamilnadu Dr. M.G.R. Medical University, Chennai
in partial fulfillment of the requirements for the degree of
Doctor of Philosophy
By
Mr. M.K.Senthil Kumar M.Pharm.,
Under the guidance of
Dr.L.Suseela, M.Pharm.,Ph.D
JANUARY 2012
C.L. BAID METHA COLLEGE OF PHARMACY,
THORAPAKKAM,
CHENNAI : 600 097.
CERTIFICATE
This is to certify that the thesis entitled “PHARMACOGNOSTICAL,
PHYTOCHEMICAL AND PHARMACOLOGICAL SCREENING FOR
BAMBUSA VULGARIS (GRAMINEAE) AND PANDANUS
ODORATISSIMUS (PANDANACEAE)” is a record of research work done by
Mr. M.K.Senthil Kumar M.Pharm, , under my guidance, and supervision at
C.L. Baid metha college of pharmacy, Thorapakkam, Chennai ., during the years
2008-2012 and this thesis has not previously formed the basis for the award of any
Degree, Diploma, Associateship, Fellowship or other similar title. I also certify
that the thesis represents independent work done by the candidate and this has not
formed in part or fully the basis for the award of any other previous research
degree.
Dr.L.Suseela, M.Pharm.,Ph.D
Principal (retd)
Madurai Medical College
College of Pharmacy
Madurai.
Date :
DECLARATION
I hereby declare that the thesis entitled PHARMACOGNOSTICAL,
PHYTOCHEMICAL AND PHARMACOLOGICAL SCREENING FOR
BAMBUSA VULGARIS (GRAMINEAE) AND PANDANUS
ODORATISSIMUS (PANDANACEAE) submitted by me for the award of
degree of Doctor of Philosophy in Pharmacy under the Tamilnadu Dr.MGR
Medical University, Chennai is the result of my original and independent work at
C.L. Baid metha college of pharmacy,Thorapakkam, Chennai ., during the years
2008 – 2012, under the supervision of Dr. L. Suseela, M.Pharm., Ph.D and has
not formed the basis for the award of any Degree, Diploma, Associateship,
Fellowship, or any other similar title, previously.
Date : M.K.. Senthil Kumar
ACKNOWLEDGEMENT
Every event, small or big in nature, is itself a creation. At the heart of every event,
lies, a reason and a motivating force or an inspiration. To a student, in whatever
walk of life he may be, this inspiration is always there through a guide, a mentor.
It gives me a deep-seated pleasure to express my sence of gratitude to my guide
Dr. L. Suseela, M.Pharm., Ph.D who suggested this interesting and challenging
field of investigation. I wish to express my gratitude to her for her effective
guidance and constant encouragement. I am very thankful for her excellent care,
continuous support and optimistic approach, which influenced me to accomplish
this work successfully.
I wish to express my heartfelt gratitude to Dr.V.Vaidhyalingam, M. Pharm.,
Ph.D.,Joint Director of Medical Education,Pharmacy, (retd)chennai , whose belief
and confidence in me gave me the courage to follow my dreams in the area of
research. I also express my sincere thanks to Mrs.Arivuselvi vaidhyalingam.
My heartful thanks to Dr.Shantha Arcot ,, M.Pharm., Ph.D., Principal, C.L.
Baid metha college of pharmacy, Thorapakkam, Chennai, for her untiring support
and encouragement during my study period.
My affectionate thanks to my loving friend Prof.V.Rajesh, Head, Dept of
Pharmacology,J.K.K.Nataraja college of pharmacy for his timely assistance in
Pharmacological work and also giving valuable suggestion in entire research
work. I also express my sincere thanks to
Dr.S.Suresh kumar, Head, Dept of Pharmacognosy, J.K.K.Nataraja college of
pharmacy and all my friends for their friendly help during my work.
I sincerely express my deep sence of gratitude and immence respect to secretary
and correspondent Smt. N. Sendamaraai, J.K.K.Rangammal charitable trust
and, , for her kind cooperation. I am immensely thankful to Dr. P. Perumal,
M.Pharm., Ph.D., Principal, J.K.K.nataraja College of Pharmacy,
komarapalayam, for his valuable suggestions in all aspect of my research work.
I specially thank my beloved father in law Mr.K.Rangasamy, my mother in law
Mrs.R.Dhanalakshmi, my uncle Mr. N.Rangasamy, my aunty Mrs. T.N.
Anusuya my father Mr.N.Krishnamurthy, my mother Mrs.M.Malligeswari for
their love and affection.
Words are inadequate to express gratitude to my wife Mrs.
R.suganthi.B.com.M.B.A and my loving daughters S.Mohanapreetha and
S.Rithika for their patience, and valuable support which made this commitment
feasible.
No words are adequate to express my thanks for the help done by Dr. Ashok
Godavarthi, and Mr. Pavan Kumar, Radiant Research Services Pvt. Ltd.
Bangalore.
(M.K. Senthil kumar)
DDDDDDDDEEEEEEEEDDDDDDDDIIIIIIIICCCCCCCCAAAAAAAATTTTTTTTEEEEEEEEDDDDDDDD TTTTTTTTOOOOOOOO
““““HIS HOLINESSHIS HOLINESSHIS HOLINESSHIS HOLINESS,,,,
AVATHARA VARISHTARAVATHARA VARISHTARAVATHARA VARISHTARAVATHARA VARISHTAR,,,,
SRISRISRISRI RAMAKRISHNA RAMAKRISHNA RAMAKRISHNA RAMAKRISHNA
PARAMAHAMSARPARAMAHAMSARPARAMAHAMSARPARAMAHAMSAR””””
CONTENTS
Chapter
No TITLE
PAGE
NO
1 INTRODUCTION 1
2 AIM AND OBJECTIVE 10
3 REVIEW OF LITERATURE 13
4 MATERIALS AND METHODS 26
5 RESULTS AND ANALYSIS 54
6 DISCUSSION 120
7 SUMMARY AND CONCLUSION 124
8 BIBLIOGRAPHY 129
LIST OF TABLES
TABLE
NO TITLE
PAGE
NO
1 Ash values 70
2 Extractive value 70
3 Moisture content 71
4 Phytochemical analysis of Bambusa vulgaris leaf extracts 72
5 Phytochemical analysis of Pandanus odoratissimus root
extracts
74
6 Body weight analysis of test drug treated rats 90
7 Macroscopic findings of animals from test drug treated
groups
91
8 Body weight analysis of test drug treated mice 93
9 Macroscopic findings of animals from test drug treated
groups 94
10 Anti pyretic effect of Methanol extract of Bambusa vulgaris on
Brewer’s yeast-induced pyrexia in rats 96
11 Effect of the methanol extract of Pandanus odoratissimusi
on the lethality of snake venom 99
12 Cytotoxic study of Bambusa vulgaris leaf extracts against
L6 cell line by MTT assay 103
13 In vitro glucose uptake studies in L-6 cell line 104
14 In situ glucose uptake studies in rat hemi diaphragm 106
15
In vivo antidiabetic activity of methanolic extracts of
Bambusa vulgaris leaf and Pandanus odoratissimus root
108
16
Effect of Bambusa vulgaris leaf and Pandanus
odoratissimus root on STZ induced changes on the serum
biochemical parameters
112
17
Effect of Bambusa vulgaris leaf and Pandanus
odoratissimus root on STZ induced changes on the serum
biochemical parameters 117
LIST OF FIGURES
FIGURE
NO
TITLE PAGE
NO
1.1 T S of lamina of Bambusa vulgaris leaf 59
1.2 T S of lamina through midrib of Bambusa vulgaris leaf 59
1.3 T S of lamina through midrib of Bambusa vulgaris leaf 59
2.1 T S of lamina through smaller lateral veins of Bambusa
vulgaris leaf 60
2.2 T S of lamina through smaller lateral veins of Bambusa
vulgaris leaf 60
2.3 T S of lamina through marginal part of Bambusa vulgaris
leaf 60
3.1 Lower epidermis of the leaf, showing the stomata of
Bambusa vulgaris leaf 61
3.2 Upper epidermis cells showing wavy cell wall of Bambusa
vulgaris leaf 61
3.3 Venation of the lamina of Bambusa vulgaris leaf 61
4.1 Surface view of the cleased leaves showing parallel veins of
Bambusa vulgaris leaf 62
4.2 Surface view of the cleased leaves showing parallel veins
of Bambusa vulgaris leaf
62
4.3 Crystals in the leaf mesophyll tissue of Bambusa vulgaris
leaf 62
5.1 TS of thin root-entire view of Pandanus odoratissimus root 63
5.2 TS of thick root showing the crystals with inner cortical
cells Pandanus odoratissimus root 63
6.1 TS of thin root –Cortical portion of Pandanus
odoratissimus root 64
6.2 TS of thin root-Stele-enlarged of Pandanus odoratissimus
root 64
7.1 TS of thick root –entire view of Pandanus odoratissimus
root 65
7.2 TS of thick root –a sector enlarged of Pandanus
odoratissimus root 65
8.1 TS of old root –Periderm and cortex of Pandanus
odoratissimus root 66
8.2 TS of old root-Stele of Pandanus odoratissimus root 66
9.1 TS of thick root – secondary xylem of Pandanus
odoratissimus root 67
10.1 Fibres of Pandanus odoratissimus root powder 68
10.2 Fibres and vessels of Pandanus odoratissimus root powder 68
10.3 A single vessel element of Pandanus odoratissimus root
powder 68
11 Anti pyretic effect of Methanol extract of Bambusa
vulgarison Brewer’s yeast induced pyrexia in rats 97
12 Effect of the methanol extract of Pandanus odoratissimusi
on the lethality of snake venom 100
13 In vitro glucose uptake effect of extracts of Bambusa
vulgaris in L-6 cell line 105
14 In vitro glucose uptake effect of extracts of Pandanus
odoratissimusi in L-6 cell line 105
15 Glucose uptake effect of extracts of Bambusa vulgaris in rat
hemi diaphragm 107
16 Glucose uptake effect of extracts of Pandanus
doratissimusi in rat hemidiaphragm 107
17 Glucose uptake effect of extracts of Pandanus
odoratissimusi in rat hemidiaphragm 109
18 Effect of methanolic extracts on blood glucose levels in
diabetic rats 109
19 Effect of methanolic extracts on serum HbA1c levels in
diabetic rats 110
20 Effect of methanolic extracts on serum CK levels in
diabetic rats 110
21 Effect of methanolic extracts on serum LDH levels in
diabetic rats 111
22 Effect of extracts on serum cholesterol levels in diabetic
rats 113
23 Effect of extracts on serum triglycerides levels in diabetic
rats 113
24 Effect of extracts on serum HDL levels in diabetic rats 114
25 Effect of extracts on serum LDL levels in diabetic rats 114
26 Effect of extracts on serum creatinine levels in diabetic rats 115
27 Effect of extracts on urea levels in diabetic rats 115
28 Effect of extracts on serum Alkaline phosphotase levels in
diabetic rats 116
29
Histopathology 117
ABBREVIATIONS
% : Percent
α : Alpha
β : Beta
µ : Micron
ºC : Degree Celsius
µg : Microgram
µg/ml : Microgram per milliliter
ALAT : Alanine aminotransferase
ANOVA : Analysis of variance
ASAT : Aspartate aminotransferase
ALP : Alkaline phosphatase
b.w. : Body weight
CCl4 : Carbon tetra chloride
DMSO : Dimethyl sulphoxide
et al., : and coworkers
Fig. : Figure
g : Gram
g/l : Grams per Litre
H2O : Water
H2O2 : Hydrogen peroxide
hr : Hour
kg. : Kilogram
l : Litre
IU/mg : International Unit per milligram
LD50 : Lethal dose (50)
LDH : Lactate dehydrogenase
Ltd. : Limited
mg/dl : Milligram per deciliter
mg/kg : Milligram per kilogram
SEM : Standard Error Mean
min : Minute
No. : Number
Pvt. : Private
Rf : Retention factor
SGOT : Serum Glutamate Oxaloacetate
Transaminase
SGPT : Serum Glutamate Pyruvate
Transaminase
Tc : Total cholesterol
TGL : Triglycerides
Tp : Total protein
U : Unit
U / l : Units per litre
UV / VIS : Ultra-Violet – Visible
WHO : World Health Organization
% : Percent
w / w : Weight / weight
Introduction
1
CHAPTER-1
INTRODUCTION
Fossil records date human use of plants as medicines at least to the Middle Paleolithic age some
60,000 years ago1. From that point the development of traditional medical systems incorporating
plants as a means of therapy can be traced back only as far as recorded documents of their
likeness. However, the value of these systems is much more than a significant anthropologic or
archeologic fact. Their value is as a methodology of medicinal agents, which, according to the
World Health Organization (WHO), almost 65% of the world’s population has incorporated into
their primary modality of health care2. The goals of using plants as sources of therapeutic agents
are a) to isolate bioactive compounds for direct use as drugs, e.g., digoxin, digitoxin, morphine,
reserpine, taxol, vinblastine, vincristine; b) to produce bioactive compounds of novel or known
structures as lead compounds for semisynthesis to produce patentable entities of higher activity
and/or lower toxicity, e.g., metformin, nabilone, oxycodon (and other narcotic analgesics),
taxotere, teniposide, verapamil, and amiodarone, which are based, respectively, on galegine, Δ9-
tetrahydrocannabinol, morphine, taxol, podophyllotoxin, khellin, and khellin; c) to use agents as
pharmacologic tools, e.g., lysergic acid diethylamide, mescaline, yohimbine; and d ) to use the
whole plant or part of it as a herbal remedy, e.g., cranberry, echinacea, feverfew, garlic, ginkgo
biloba, St. John’s wort, saw palmetto.
The number of higher plant species (angiosperms and gymnosperms) on this planet is estimated
at 250,000 , with a lower level at 215,0003 and an upper level as high as 500,000
4-5 (Jones et al,
2006; Drahl et al, 2005). Of these, only about 6% have been screened for biologic activity, and a
Introduction
2
reported 15% have been evaluated phytochemically 6. With high throughput screening methods
becoming more advanced and available, these numbers will change, but the primary
discriminator in evaluating one plant species versus another is the matter of approach to finding
leads. There are some broad starting points to selecting and obtaining plant material of potential
therapeutic interest. However, the goals of such an endeavor are straightforward. Plants have an
advantage in this area based on their long-term use by humans (often hundreds or thousands of
years). One might expect any bioactive compounds obtained from such plants to have low
human toxicity. Obviously, some of these plants may be toxic within a given endemic culture
that has no reporting system to document these effects. It is unlikely, however, that acute toxic
effects following the use of a plant in these cultures would not be noticed, and the plant would
then be used cautiously or not at all. Chronic toxic effects would be less likely to signal that the
plant should not be used. In addition, chemical diversity of secondary plant metabolites that
result from plant evolution may be equal or superior to that found in synthetic combinatorial
chemical libraries.
It was estimated that in 1991 in the United States, for every 10,000 pure compounds that are
biologically evaluated (primarily in vitro), 20 would be tested in animal models, and 10 of these
would be clinically evaluated, and only one would reach U.S. Food and Drug Administration
approval for marketing. The time required for this process was estimated as 10 years at a cost of
$231 million 7. Most large pharmaceutical manufacturers and some small biotechnology firms
have the ability to screen 1,000 or more substances per week using high throughput in vitro
assays. In addition to synthetic compounds from their own programs, some of these companies
screen plant, microbial, and marine organisms. Thus, the challenges facing these companies in
Introduction
3
acquiring organisms and extracts (vide infra) usually result in a failure to consider collection of
plants, especially if the acquisitions are based on ethnomedical use. It is time-consuming to
collect specific plants having an ethnomedical history. Despite these problems, one cannot
discount the past importance of plants as sources of structurally novel drugs.
For thousands of years, natural products have played an important role throughout the world in
treating and preventing human diseases. Natural product medicines have come from various
source materials including terrestrial plants, terrestrial microorganisms, marine organisms, and
terrestrial vertebrates and invertebrates 8. The value of natural products in this regard can be
assessed using 3 criteria: (1) the rate of introduction of new chemical entities of wide structural
diversity, including serving as templates for semisynthetic and total synthetic modification, (2)
the number of diseases treated or prevented by these substances, and (3) their frequency of use in
the treatment of disease.
An analysis of the origin of the drugs developed between 1981 and 2002 showed that natural
products or natural product-derived drugs comprised 28% of all new chemical entities (NCEs)
launched onto the market. In addition, 24% of these NCEs were synthetic or natural mimic
compounds, based on the study of pharmacophores related to natural products 9. This combined
percentage (52% of all NCEs) suggests that natural products are important sources for new drugs
and are also good lead compounds suitable for further modification during drug development.
The large proportion of natural products in drug discovery has stemmed from the diverse
structures and the intricate carbon skeletons of natural products. Since secondary metabolites
from natural sources have been elaborated within living systems, they are often perceived as
Introduction
4
showing more “drug-likeness and biological friendliness than totally synthetic molecules” 10
making them good candidates for further drug development 11-12
.
Scrutiny of medical indications by source of compounds has demonstrated that natural products
and related drugs are used to treat 87% of all categorized human diseases (48/55), including as
antibacterial, anticancer, anticoagulant, antiparasitic, and immunosuppressant agents, among
others 13
. There was no introduction of any natural products or related drugs for 7 drug categories
(anesthetic, antianginal, antihistamine, anxiolytic, chelator and antidote, diuretic, and hypnotic)
during 1981 to 2002. In the case of antibacterial agents, natural products have made significant
contributions as either direct treatments or templates for synthetic modification. Of the 90 drugs
of that type that became commercially available in the United States or were approved
worldwide from 1982 to 2002, ~79% can be traced to a natural product origin 14
.
Frequency of use of natural products in the treatment and/or prevention of disease can be
measured by the number and/or economic value of prescriptions, from which the extent of
preference and/or effectiveness of drugs can be estimated indirectly. According to a study, 84 of
a representative 150 prescription drugs in the United States fell into the category of natural
products and related drugs 15
. They were prescribed predominantly as anti-
allergy/pulmonary/respiratory agents, analgesics, cardiovascular drugs, and for infectious
diseases. Another study found that natural products or related substances accounted for 40%,
24%, and 26%, respectively, of the top 35 worldwide ethical drug sales from 2000, 2001, and
2002 16
. Of these natural product-based drugs, paclitaxel, a plant-derived anticancer drug, had
sales of $1.6 billion in 2000. The sales of 2 categories of plant-derived cancer chemotherapeutic
agents were responsible for approximately one third of the total anticancer drug sales worldwide,
Introduction
5
or just under $3 billion dollars in 2002; namely, the taxanes, paclitaxel and docetaxel, and the
camptothecin derivatives, irinotecan and topotecan 17-18
.
This short review covers new drugs derived from natural sources launched in the 6-year period
from 2000 to 2005, and drug candidates from natural sources in clinical trials during the same
time period arranged according to their origin (terrestrial plants, terrestrial microorganisms,
marine organisms, and other natural sources). For drug candidates in clinical trials 19
, only
examples of new chemical templates of potential cancer chemotherapeutic drugs will be
mentioned.
Drug discovery from terrestrial plants
Terrestrial plants, especially higher plants, have a long history of use in the treatment of human
diseases. Several well-known species, including licorice (Glycyrrhiza glabra), myrrh
(Commiphora species), and poppy capsule latex (Papaver somniferum), were referred to by the
first known written record on clay tablets from Mesopotamia in 2600 BC, and these plants are
still in use today for the treatment of various diseases as ingredients of official drugs or herbal
preparations used in systems of traditional medicine 20
. Furthermore, morphine, codeine,
noscapine (narcotine), and papaverine isolated from P. somniferum were developed as single
chemical drugs and are still clinically used. Hemisuccinate carbenoxolone sodium, a semi-
synthetic derivative of glycyrrhetic acid found in licorice, is prescribed for the treatment of
gastric and duodenal ulcers in various countries 21
.
Historical experiences with plants as therapeutic tools have helped to introduce single chemical
entities in modern medicine. Plants, especially those with ethnopharmacological uses, have been
Introduction
6
the primary sources of medicines for early drug discovery. In fact, a recent analysis by Fabricant
and Farnsworth showed that the uses of 80% of 122 plant-derived drugs were related to their
original ethnopharmacological purposes 22
. Current drug discovery from terrestrial plants has
mainly relied on bioactivity-guided isolation methods, which, for example, have led to
discoveries of the important anticancer agents, paclitaxel from Taxus brevifolia and
camptothecin from Camptotheca acuminate 23
.
In fact, over 120 pharmaceutical products in use are obtained from the plants 24
. A large number
of therapeutic activities are mediated by these drugs, and a host of drugs in use are still obtained
from plants in which they are synthesized. Examples include, cardiotonic glycosides (Digitalis
glycosides), anticholinergics (belladonna type tropane alkaloids), analgesics and antitussives
(opium alkaloids), antihypertensives (reserpine), cholinergics (physostigmine, pilocarpine),
antimalarials (cinchona alkaloids), antigout (colchicines), anesthetic (cocaine), skeletal muscle
relaxant (tubocurarine), and anticancer agents (paclitaxel, vincristine, vinorelbine, teniposide,
and analogs of camptothecin) 25
.
Analysis of the number and sources of anticancer and anti-infective agents, reviewed mainly in
Annual Reports of Medicinal Chemistry from 1984 to 1995, indicates that over 60% of the
approved drugs and pre-NDA candidates (for the period 1989-1995), excluding biologics,
developed in these diseases areas are of natural origin. According to Newman et al 26
that during
the period of 1981-2002 vast majority of New Chemical Entities (NCEs) i.e. 10% are unmodified
natural products, 68% are derived from natural products source (semisynthetic) and 1 (1%) is by
total synthesis, but originally modeled on natural products parent and natural product mimic.
79% of the whole is from the natural products source in one or the other way. Thus natural
Introduction
7
products have been playing an invaluable role in the drug discovery process, particularly in the
areas of metabolic disorders, cancer and infectious diseases.
Examples of plant-derived compounds currently in clinical trials
From terrestrial plant-derived secondary metabolites, several new chemical entities are
undergoing clinical trials including four that are derivatives of known anticancer drugs like
camptothecin, paclitaxel, epipodophyllotoxin, and vinblastine 27
. In addition, combretastatin A4,
isolated from the South African medicinal tree, Combretum caffrum (Combretaceae), was
derivatized to combretastatin A4 phosphate and AVE-8062 28-29
. These analogs bind to tubulin
leading to morphological changes and then disrupt tumor vasculature, and are in phase II trials 30-
31. Homoharringtonine , a cephalotaxus alkaloid from the tree, Cephalotaxus harringtonia found
in mainland China 32
, is an inhibitor of protein synthesis and is reported to have activity against
hematologic malignancies 33
. Ingenol 3-O-angelate, an analog of the polyhydroxy diterpenoid,
ingenol, which was originally obtained from Euphorbia peplus (known as “petty spurge” in
England or “radium weed” in Australia), is a potential topical chemotherapeutic agent for skin
cancer and exhibits its action through activation of protein kinase C 34-35
. Phenoxodiol, a
synthetic analog of daidzein, a well known isoflavone from soyabean (Glycine max), is being
developed as a therapy for cervical, ovarian, prostate, renal, and vaginal cancers, and induces
apoptosis through inhibition of anti-apoptotic proteins including XIAP and FLIP 36
. Phenoxodiol
is currently undergoing clinical studies in the United States and Australia 37
. Protopanaxadiol, a
derivative of a triterpene aglycone of several saponins from ginseng (Panax ginseng), exhibits its
apoptotic effects on cancer cells through various signaling pathways, and is also reported to be
cytotoxic against multidrug resistant tumors 38-39
. Triptolide, a diterpene triepoxide, was isolated
Introduction
8
from Tripterygium wilfordii, and has been used for autoimmune and inflammatory diseases in the
People’s Republic of China 40
. PG490–88 (12, 14-succinyl triptolide sodium salt), a
semisynthetic analog of triptolide, exerts antiproliferative and proapoptotic activities on primary
human prostatic epithelial cells as well as tumor regression of colon and lung xenografts 41
.
Indian Scenario
India is a treasure chest of biodiversity which hosts a large variety of plants and has been
identified as one of the eight important “Vavilorian” centres of origin and crop diversity. Its
diversity is unmatched due to the presence of 16 different agroclimatic zones, 10 vegetative
zones and 15 biotic provinces. The country has 15000-18000 flowering plants, 23000 fungi,
2500 algae, 1600 lichnens, 1800 bryophytes and 30 million micro-organisms. India also has
equivalent to ¾ of its land exclusive economic zone in the ocean, harbouring a large variety of
flora and fauna, many of them with therapeutic properties. Although its total land area is only
2.4 percent of the total geographical area of the world, the country accounts for eight percent of
the total global biodiversity with an estimated 49000 species of plants of which 4900 are
endemic 42
. The ecosystems of the Himalayas, the Khasi and Mizo hills of northeastern India, the
Vindhya and Satpura ranges of northern peninsular India, and the Western Ghats contain nearly
90 percent of the country's higher plant species and are therefore of special importance to
traditional medicine. Although, a good proportion of species of Medicinal Plants (MP) do occur
throughout the country, peninsular Indian forests and the Western Ghats are highly significant
with respect to varietal richness 43
. About 1500 plants with medicinal uses are mentioned in
ancient texts and around 800 plants have been used in traditional medicine.
Introduction
9
Peninsular India extending downwards from Gujarat, Madhya Pradesh and Southern Bihar was
once dominated by a continuum of tropical forests, namely: thorn forests, dry deciduous forests,
moist deciduous forests, dry evergreen forests, wet evergreen forests and semi-evergreen forests.
The complexity with respect to soils, topography and climate has created an exceptional variety
of bio-mass and specialized habitats within this region. The ecosystems of southern peninsular
India including the southern Western Ghats contain more than 6000 species of higher plants
including an estimated 2000 endemic species. Of these, 2500 species representing over 1000
genera and 250 families have been used in Indian systems of medicine 44
.
The classical Indian texts include Rigveda, Atherveda, Charak Samhita and sushruta samhita.
The herbal medicines/Traditional medicaments have, therefore, been derived from rich traditions
of ancient civilizations and scientific heritage. Ancient literature also mentions herbal medicines
for age-related diseases namely memory loss, osteoporosis, diabetic wounds, immune and liver
disorders, etc. for which no modern medicine or only or palliative therapy is available. Herbal
medicines have stood the test of time for their safety, efficacy, cultural acceptability and lesser
side effects. The chemical constituents present in them are a part of the physiological functions
of living flora and hence they are believed to have better compatibility with the human body. It
has been observed that, the plant materials selected based on their traditional claims was found to
be biologically active. So, the appreciation of the significance of natural products as sources for
structurally novel and mechanistically unique drugs and enormous biodiversity of India
prompted our interest in evaluating the traditional medicinal plants for their potential biological
properties.
Aim and Objective
10
CHAPTER-2
AIM AND OBJECTIVE
The use of traditional medicines and medicinal plants in most developing countries as
therapeutic agents for the maintenance of good health has been widely observed. Interest
in medicinal plants as a re-emerging health aid has been fuelled by the rising costs of
prescription drugs in the maintenance of personal health and well being and the
bioprospecting of new plant-derived drugs. The ongoing growing recognition of
medicinal plants is due to several reasons, including escalating faith in herbal medicine
and also least risk of side effects when compared to modern drugs.
However among the estimated 2,50,000 to 4,00,000 plant species, only 6 % have been
studied for biological activity and about 15 % have been investigated phytochemically.
This shows a need for planned activity guided phyto-pharmacological evaluation of
herbal drugs, since most of the modern drugs has its natural product prototype. Correct
identification and quality assurance of the starting materials is an essential prerequisite to
ensure reproducible quality of herbal medicine which will contribute to its safety and
efficacy, so standardization of a plant material becomes at most important which can be
done by pharmacognostic studies.
Aim and Objective
11
In these views, the present work is undertaken based on its traditional claims to study the
Pharmacognostical, Phytochemical and Pharmacological screening for Bambusa vulgaris
Schrad (gramineae) and Pandanus odoratissimus Linn.f (Pandanaceae).
Plan of work
Based on the objectives, the research work was planned as described below.
Phase I: Literature survey and collection of plant material
1. To screen the geographical source and the availability of the Bambusa vulgaris
Schrad (Graminae) and Pandanus odoratissimus Linn.f (Pandanaceae) in India.
2. Identification, authentication and collection of plant material
Phase II: Pharmacognostical studies on plant parts and powders
1. To evaluate the pharmacognostical characters of Bambusa vulgaris leaves and
Pandanus odoratissimus root
Phase III: Phytochemical evaluation of extracts
1. Preparation of extracts by using standard techniques
2. To evaluate the phytochemical constituents present in the extracts
3. To estimate the total Phenolic content
Phase IV: Pharmacological screening based on traditional claims
1. Determination of Acute oral toxicity study of methanolic extract of Bambusa
vulgaris leaves and Pandanus odoratissimus root.
2. Determination of venom neutralizing potential of Pandanus odoratissimus root
extract.
Aim and Objective
12
3. Evaluation of antipyretic activity of methanolic extract of Bambusa vulgaris
leaves.
4. Determination of in vitro cytotoxicity of Bambusa vulgaris leaves, and
Pandanus odoratissimus root using hexane, benzene, chloroform,
ethylacetate,and methanol extracts in skeletal muscle cell line.
5. In vitro glucose uptake studies for Bambusa vulgaris leaves and Pandanus
odoratissimus root using hexane, benzene, chloroform, ethylacetate, and
methanol extracts in skeletal muscle cell line.
6. Glucose uptake studies in rat hemi diaphragm for Bambusa vulgaris leaves, and
Pandanus odoratissimus root using hexane, benzene, chloroform, ethylacetate
and methanol extracts.
7. In vivo anti-diabetic activity for methanolic extracts of Bambusa vulgaris leaves
and Pandanus odoratissimus root.
Phase V: Isolation and characterization of phytoconstituents
1. Isolation of phytoconstituents by column chromatography from the bioactive
extracts and fractions.
2. Identification and characterization of isolates by different spectral studies.
Review of Literature
13
CHAPTER-3
REVIEW OF LITERATURE
Since the beginning of human civilization, medicinal plants have been used by mankind
for its therapeutic value. Nature has been a source of medicinal agents for thousands of
years and an impressive number of modern drugs have been isolated from natural
sources. Many of these isolations were based on the uses of the agents in traditional
medicine. The plant-based, traditional medicine systems continues to play an essential
role in health care, with about 80% of the world’s inhabitants relying mainly on
traditional medicines for their primary health care 45
. India has several traditional medical
systems, such as Ayurveda and Unani, which has survived through more than 3000 years,
mainly using plant-based drugs. The materia medica of these systems contains a rich
heritage of indigenous herbal practices that have helped to sustain the health of most rural
people of India. The ancient texts like Rig Veda (4500-1600 BC) and Atharva Veda
mention the use of several plants as medicine. The books on ayurvedic medicine such as
Charaka Samhita and Susruta Samhita refer to the use of more than 700 herbs 46
.
The use of traditional medicines and medicinal plants in most developing countries as
therapeutic agents for the maintenance of good health has been widely observed 47
.
Modern pharmacopoeia still contains at least 25% drugs derived from plants and many
others, which are synthetic analogues, built on prototype compounds isolated from plants.
Interest in medicinal plants as a re-emerging health aid has been fuelled by the rising
costs of prescription drugs in the maintenance of personal health and well being and the
Review of Literature
14
bioprospecting of new plant-derived drugs 48
. The ongoing growing recognition of
medicinal plants is due to several reasons, including escalating faith in herbal medicine
49. Furthermore, an increasing reliance on the use of medicinal plants in the industrialized
societies has been traced to the extraction and development of drugs and
chemotherapeutics from these plants as well as from traditionally used herbal remedies 50
.
The medicinal properties of plants could be based on the antioxidant, antimicrobial,
antipyretic effects of the phytochemicals in them 51-52
. According to World Health
Organization, medicinal plants would be the best source to obtain a variety of drugs.
Therefore, such plants should be investigated to better understand their properties, safety
and efficacy 53
. The traditional knowledge especially on the medicinal uses of plants has
provided many important drugs of modern day 54-56
.
In India, the Ayurvedic system has described a large number of such medicines based on
plants or plant product and the determination of their morphological and pharmacological
or pharmacognostical characters can provide a better understanding of their active
principles and mode of action. However a large number of plants have not been studied in
detail for their chemical constituents, pharmacological properties of the extracts, and their
pharmacognostical characterization.
Traditional medicinal claims of Bambusa vulgaris and Pandanus odoratissimus
Even though Bambusa vulgaris is known for its usage in fencing and construction, the
Bambusa vulgaris had been used as an important medicinal plant for a long period of
time. Since generations, it is an integral part of many important herbal formulations that
Review of Literature
15
are used in traditional systems of medicine. Many Orientals think it has medicinal values.
Medieval alchemists in Europe extracted tabachir, a poison anti-dote from the species.
Javanese people use water preserved in Golden Bamboo tubes as cure for jaundice 57
. In
Nigeria, a drink of macerated leaves is taken against sexually transmitted diseases, and in
Congo, leaves are used as part of treatment against measles. A chloroform extract of
leaves is active against Mycobacterium tuberculosis. The leaves of Bambusa vulgaris
have been used in Indian folk medicine to treat various inflammatory conditions. Other
traditional uses are astringent, emmanogogue, vulnerary, and febrifuge to heal the
wounds and also to control diarrhea in cattle 58
. Manna is a crystalline substance found
inside the bamboo and leaves are used in ayurvedic medicine in ptosis and paralytic
complaints 59
.
Leaves have been claimed to be used as astringent, ophthalmic solution, sudorific and
febrifuge. In Nigerian folklore medicine, bamboo is claimed to be used as an
emmenagogue, abortifacient, appetizer and for managing respiratory diseases as well as
gonorrhea. Leaves are used in Ayurvedic medicine in ptosis and paralytic complaints 60-
62.
Pandanus odoratissimus is said to be a restorative, deodorant, indolent and phylactic,
promoting a feeling of wellbeing and acting as a counter to tropical lassitude. It may be
chewed as a breath sweetener or used as a preservative on foods. It is also said to have
healthful properties. In Ayurveda, the therapeutic activities of Pandanus
odoratissimus have been mentioned to treat for various ailments 63
. Pandanus
Review of Literature
16
odoratissimus root have been claimed to be used as bitter, sweet, acrid, thermogenic,
emollient, dupurative, procreant, antiseptic, cephalic, aphrodisiac, carminative,
stomachic, suppurative, anodyne, deodorant, urinary astringent, vulnerary, sudorific,
febrifuge and tonic. They are useful in vitiated conditions of kapha and pitta,skin
diseases, leprosy, cephalalgia, coxalgia, otalgia, wounds, ulcers, dyspepsia, flatulence,
colic, fever, diabetes, strerility spontaneous abortion and general debility. The roots
considered as antidote to snake bite; Tribal/Folklore practitioners use this drug to treat
many ailments. The root and flowers of the drug Pandanus odoratissimus acts as an
abortifacient and it is indicated for the treatment of skin diseases, leprosy, scabies and
syphilis 64
. A mixture of the dried root powder along with one spoonful turmeric juice and
supernatant from a clean lime water extract, taken early in the morning orally for one
week will cure urinary disorders 65
.While the root decoction has diuretic activity 66
. In
Villupuram, India, the traditional medicinal system is very efficient for successfully
treating jaundice, female sterility and rheumatism. The leaves of Pandanus spp. are a
natural antioxidant and Pandanus extracts are capable of retarding oxidation.
In the Marshall Islands this plant is used for a number of conditions related to the female
reproductive organs. In infants with jaundice, restlessness and colic, the juice squeezed
from the aerial roots together with Centella asiatica is given to the infant in a dose of one
teaspoon and then the rest is rub over the whole body of the infant. For oral thrush the
juice of the soft part of the aerial root is squeezed into the child’s mouth 67
. In Palau
Island a drink prepared from the root alleviates stomachache while the leaves can help
relieve vomiting. In Kiribati decoction of the root is a remedy for haemorrhoids, In the
Review of Literature
17
Marshall Islands the male flower is believed to have aphrodisiac properties 68
. Water
distilled from the flowering tops is considered an antispasmodic while at the same time
helps in relieve of faintness and giddiness. The oil extracted from the flowering tops
of Pandanus odoratissimus is used to treat earaches and otorrhoea. The leaves are remedy
for cold/flu, asthma, boils and cancer in Kiribati.
Pharmacognosy
"Pharmacognosy" derives from two Greek words, "pharmakon" or drug, and "gnosis" or
knowledge. Like many contemporary fields of science, Pharmacognosy has undergone
significant changes in recent years and today represents a highly interdisciplinary science,
which is one of five major areas of pharmaceutical education. Its scope includes the study
of the physical, chemical, biochemical and biological properties of drugs, drug
substances, or potential drugs or drug substances of natural origin as well as the search
for new drugs from natural sources.
After decades of serious obsession with the modern medicinal system, people have
started looking at the ancient healing systems; however a key obstacle, which has
hindered the acceptance of the alternative medicines in the developed countries, is the
lack of documentation and stringent quality control. There is a need for documentation of
research work carried out on traditional medicines 69
. With this backdrop, it becomes
extremely important to make an effort towards standardization of the plant material to be
used as medicine. The process of standardization can be achieved by stepwise
pharmacognostic studies 70
.These studies help in identification and authentication of the
Review of Literature
18
plant material. Correct identification and quality assurance of the starting materials is an
essential prerequisite to ensure reproducible quality of herbal medicine which will
contribute to its safety and efficacy. Simple pharmacognostic techniques used in
standardization of plant material include its morphological, anatomical and biochemical
characteristics 71
.
To differentiate the two plants, Shakoor et al 72
carried out the pharmacognostic study and
identifies the two plants as different on the basis of anatomical characters, chemical
composition and compared the pharmaceutical and medical applications. In the same
context, Ashraf and Riaz 73
described the, botanical chemical, medicinal and
pharmacological background of various Nymphaea species to resolve the controversy
regarding application of common indigenous name Nilofar. Reviewing the reported
literature on various Nymphaea species, botanical name N. alba was assigned to Nilofar.
Based on the two main forms of indigenous drugs (parts) viz. double stained transverse
section and dry powder of Conyza ambigua, Eclipta alba and Sonchus asper were studied
by 74
.
Similar work was carried out for Bamboo species, where anatomical and histological
features were studied from all the species known from Taiwan to suggest a new
classification of Bambuseae 75
.In another study, cultivated Bambusa vulgaris of two and
four year old was studied for their anatomy and physical properties to know degrees of
variation correlation with age. The leaf of Pandanus odoratissimus was also studied for
histological, physical and powdered characteristics 76
.
Review of Literature
19
Phytochemistry
“Phyto” is the Greek word for plant. Phytochemistry, evolved from natural products
chemistry is confined to the study of products elaborated by plants and it has developed
as a distinct discipline between natural product organic chemistry and plant biochemistry
in recent years. It deals with the study of chemical structure of plant constituents, their
biosynthesis, metabolism, natural distribution and biological functions. The fact that only
less than 10% of about 7.5 lakhs species of plants on earth has been investigated indicates
the opportunity provided and challenges thrown open to phytochemists. The task of the
phytochemist is compounded in accomplishing the characterization of very small quantity
of the compounds isolable from plants. Phytochemistry also enjoys the application of
modern research for the scientific investigation of ancestral empirical knowledge. It has
found wide and varying application in about all fields of life and civilization. Its
involvement in the field of food and nutrition, agriculture medicine and cosmetics, is well
known for years. Its contribution even in calmingly remote areas such as plant
physiology, plant pathology, plant ecology, palaeobotany, plant genetics, plant
systematics and plant evolution has been increasingly felt 77-82
.
There are many “families” of phytochemicals, the most important of these bioactive
constituents of plants are alkaloids, tannins, flavonoids, and Phenolic compounds 83
and
they help the human body in a variety of ways. Phytochemicals may protect human from
a host of diseases. Phytochemicals are non-nutritive plant chemicals that have protective
or disease preventive properties. Plant produces these chemicals to protect itself but
Review of Literature
20
recent research demonstrates that many phytochemicals can protect humans against
diseases. There are many phytochemicals in fruits and herbs and each works differently.
Recovery of bioactive compounds from plant materials is typically accomplished through
different extraction techniques taking into account their chemistry and uneven
distribution in the plant matrix. For example, standard methods of extraction, separation
and chemical characterization of flavonoid compounds are described by Tracey as well as
Harborne 84
. Systematic procedure for the flavonoid identification employing
chromatographic methods of analysis and chemical and spectral methods of identification
have been explained by Geissman 85
, Harborne 86
, Mabry 87
, Markham 88
and Linskens
and Jackson 89
.
The conventional chromatographic methods like column, paper and thin layer are still in
use for separation and purification of the flavonoid compounds. Increase in speed and
efficiency in the separation of mixtures had been achieved by high pressure liquid
chromatography (HPLC). Among the separation techniques applied to flavonoids HPLC
has the advantage over to other techniques in regard to sensitivity, rapidity and easy
quantification.
Various phytoconstituents have been isolated from past few years from both the species
of Bambusa vulgaris and Pandanus odoratissimus. Preliminary phytochemical screening
of the aqueous extract of Bambusa vulgaris leaves revealed the presence of bioactive
agents such as alkaloids, tannins, phenolics, glycosides, saponins, flavonoids and
Review of Literature
21
anthraquinones, Quantitative analysis of the phytochemicals indicated that the aqueous
extract of the leaves of Bambusa vulgaris consisted largely of alkaloids, while the
flavonoids were the least, where as pet ether extract showed the presence of phytosterols
and tannins 90
.
The roots of Pandanus odoratissimus have showed the presence of various
phytochemicals, two phenolic compounds, four lignan type compounds plus a new
benzofuran derivative was isolated from methanolic root extract. Among them,
pinoresinol and 3, 4-bis (4-hydroxy-3-methoxybenzyl) tetrahydrofuran showed strong
antioxidative activities. The new compounds were identified as 4-hydroxy-3-(2′, 3′-
dihydroxy-3′-methylbutyl)-benzoic acid methyl ester and 3-hydroxy-2-isopropenyl-
dihydrobenzofuran-5-carboxylic acid methyl ester, by spectroscopic analysis 91
, other
phytoconstituents such as 2-phenyl ethyl alcohol, 2-phenyl ethyl methyl ether, terpinen-4-
ol, 3-hydroxy-2-isopropenyl-dihydrobenzofuran-5-carboxylic acid methyl ester, 3-
methyl-3-buten-1-yl acetate, 3-methyl-3-buten-1-yl cinnamate, 3-methyl-2-buten-1-yl
acetate, 3-methyl-2-buten-1-yl cinnamate, 25-diene-3-one, alpha terpienol, beta carotene,
beta sitosterol, benzyl benzoate, pinoresinol, germacrene B, stigmasterol, viridine,
vitamin C 92
.
Venom Neutralizing study
Snake bite is a major socio-medical problem of tropical countries, especially in India.
20,000 deaths per year have been reported in India 93
. Snake bite treatment is as variable
as the bite & its symptoms. The one & only medical treatment available is the usage of
Review of Literature
22
antisera, but the usage of snake venom antisera has its own limitations. Due to its high
cost & lack of availability, it is difficult for the rural patients to access antisera. Further,
due to its storage difficulty & short expiry, its use is restricted. Snake venom antiserum or
AVS has administration problem, the exact dosage of AVS is also not clear. AVS
administration is often associated with hypersensitive reactions (early & late) which need
further medical attention 94
.
Various plants have been worked out as an antidote for snake envenomation, some of
which possesses strong neutralizing activity whereas others possess moderate activity
against snake venom. Plants like Pluchea indica, Hemidesmus indicus95-96
, Strychnous
nux vomica 97
, Emblica officinalis, Vitex negundu 98
& Curcuma aromatica possess
strong neutralizing capacities, whereas Aristolochia indica, Andrographis paniculata,
Dolichondron sp., Crotolaria juncea, Croton tiglium, Moringa oliefera possess moderate
snake venom neutralizing capacity. So far no open scientific literature that addresses the
anti venom potential activity is available for Pandanus odoratissimus.
Antipyretic study
Pyrexia or fever is caused as a secondary impact of infection, malignancy or other
diseased states. It is the body’s natural defense to create an environment where infection
agent or damaged tissue cannot survive. Most of the antipyretic drugs inhibit Cox-2
expression to reduce the elevated body temperature by inhibiting prostaglandin E2
(PGE2) biosynthesis. Moreover these synthetic agents irreversibly inhibit Cox-2 with
high selectivity but are toxic to the hepatic cells, glomeruli, cortex of brain and heart
Review of Literature
23
muscles, whereas the natural Cox-2 inhibitors have lower selectivity with fewer side
effects. A natural antipyretic agent with reduced or no toxicity is therefore essential 99-100
.
Medicinal plants contain so many chemical compounds which are the major source of
therapeutic agents to cure human diseases. Recent discovery and advancement in
medicinal and aromatic plants have lead to the enhancement of health care of mankind.
Various medicinal plants like Neem, Arjuna, Aswagandha, Tulsi, etc. traditionally used
for treating fever. The extract prepared from the heartwood of Acacia catechu, stem bark
and leaves of Bauhinia racemosus, Cleome viscosa etc. reported to have antipyretic
activity in rats 101
. So far no open scientific literature that addresses the anti pyretic
potential activity is available for Bambusa vulgaris.
Antidiabetic study
Diabetes is a syndrome characterized by deranged carbohydrate metabolism resulting in
abnormally high blood sugar level (hyperglycemia). It is caused by hereditary, increasing
age, poor diet, imperfect digestion, obesity, sedentary lifestyle, stress, drug-induced,
infection in pancreas, hypertension, high serum lipid and lipoproteins, less glucose
utilization and other factors.
There are three main types of diabetes:
• Type 1 diabetes: results from the body's failure to produce insulin, and presently
requires the person to inject insulin. (Also referred to as insulin-dependent
diabetes mellitus, IDDM for short, and juvenile diabetes.)
Review of Literature
24
• Type 2 diabetes: results from insulin resistance, a condition in which cells fail to
use insulin properly, sometimes combined with an absolute insulin deficiency.
(Formerly referred to as non-insulin-dependent diabetes mellitus, NIDDM for
short, and adult-onset diabetes.)
• Gestational diabetes: is when pregnant women, who have never had diabetes
before, have a high blood glucose level during pregnancy. It may precede
development of type 2 DM.
The treatment of diabetes with synthetic drugs is costly and chances of side effects are
high. For example, long-term use of Exenetide (Byetta) has lead to side effects such as
nausea, vomiting, diarrhea, dizziness, headache, jittery feeling and acidity. Sulfonylureas
cause abdominal upset, headache and hypersensitivity, while Metformin 102
causes
diarrhea, nausea, gas, weakness, indigestion, abdominal discomfort and headache.
Thiazolidinediones has side effects like, upper respiratory infections and sinusitis,
headache, mild anemia, retention of fluid in the body which may lead to heart failure and
muscle pain.
Ayurveda and other traditional medicinal system for the treatment of diabetes describe a
number of plants used as herbal drugs. Hence, they play an important role as alternative
medicine due to less side effects and low cost. The active principles present in medicinal
plants have been reported to possess pancreatic beta cells regenerating, insulin releasing
and fighting the problem of insulin resistance 103
. Aloe vera juice stimulates the release of
insulin from the beta-cells in human, Acacia catechu wood extract enhances the
regeneration of pancreatic beta cells in rabbits, Momordica charantia fruit extract
Review of Literature
25
enhances insulin secretion by the islets of Langerhans etc. A significant proportion of
these plants have been observed to possess potent antioxidant activity, which may
contribute to anti-diabetic property in strepotozotocin /alloxan, induced animal model 104
.
Not only in Ayurveda, but also in several other traditional systems of medicine, it is
described that plants useful in diabetes also possess strong antioxidant/free-radical
scavenging properties.
Previous reports on Bambusa vulgaris has showed its antidiabetic potential by various
extracts against different models, the aqueous extract was tested against for its
hypoglycemic activity, where the effect of the extract was superior to tolbutamide 105
. So
far no open scientific literature that addresses the antidiabetic potential of is available for
Pandanus odoratissimus.
Materials and Methods
26
CHAPTER-4
MATERIALS AND METHODS
PHARMACOGNOSY
Collection of specimens and identification
All the plant materials were collected from the ABS botanical research centre, Karipatti,
Salem. They were identified and authenticated by Dr. P. Jayaraman, Director, Medicinal
Plant Research unit and plant anatomy Research centre, Chennai India. Voucher
specimens of the plants have been deposited in the herbarium.
Pharmacognostical studies on Bambusa vulgaris leaf and Pandanus odoratissimus
root
The collected healthy plant specimens for the proposed study were carefully selected.
The samples of different parts were cut and removed from the plant and fixed in FAA
(Farmalin-5ml+ Acetic acid-5ml + 70% Ethyl alcohol-90ml).After 24 hrs of fixing, the
specimens were dehydrated with graded series of tertiary –Butyl alcohol as per the
schedule given by Sass, 1940. Infiltration of the specimens was carried by gradual
addition of paraffin wax (melting point 58-600C) until TBA solution attained super
saturation. The specimens were cast into paraffin blocks.
Sectioning
The paraffin embedded specimens were sectioned with the help of Rotary Microtome.
The thickness of the sections was 10-12 μm. Dewaxing of the sections was by customary
Materials and Methods
27
procedure 106
. The sections were stained with Toluidine blue as per the method published
by 107
. Since Toluidine blue is a polychromatic stain, the staining results were remarkably
good; and some cytochemical reactions were also obtained. The dye rendered pink colour
to the cellulose walls, blue to the lignified cells, dark green to suberin, violet to the
mucilage, blue to the protein bodies etc. wherever necessary sections were also stained
with safranin and Fast-green and IKI(for Starch).
For studying the stomatal morphology, venation pattern and trichome distribution,
paradermal sections (sections taken parallel to the surface of leaf) as well as clearing of
leaf with 5% sodium hydroxide or epidermal peeling by partial maceration employing
Jeffrey’s maceration fluid 108
were prepared. Glycerine mounted temporary preparations
were made for macerated/cleared materials. Powdered materials of different parts were
cleared with NaoH and mounted in glycerin medium after staining. Different cell
component were studied and measured.
Photomicrographs
Microscopic descriptions of tissues are supplemented with micrographs wherever
necessary. Photographs of different magnifications were taken with Nikon labphoto 2
microscopic Unit. For normal observations bright field was used. For the study of
crystals, starch grains and lignified cells, polarized light was employed. Since these
structures have birefringent property, under polarized light they appear bright against
dark background. Magnifications of the figures are indicated by the scale-bars.
Materials and Methods
28
Descriptive terms of the anatomical features are as given in the standard Anatomy books
109.
Pharmacognostical evaluation of selected plants was carried out in order to establish the
identity and standardization of the plants. Microscopical characters were studied as per
standard protocol.
Physiochemical evaluation
Bambusa vulgaris leaf and Pandanus odoratissimus root were used for analysis for
physiochemical parameters such as ash values, extractive values and moisture content.
Determination of Ash Values 110
Ash values such as total ash, acid insoluble ash, water soluble ash, acid soluble and
sulfated ash were determined. The total ash determination method is designed to measure
the total amount of material remaining after ignition. This includes both “physiological
ash”, which is derived from the plant tissue itself, and “non physiological ash”, which is
the residue of extraneous matter adhering to the plant surface.
For determination of ash values, powder was prepared of roots (Pandanus odoratissimus)
and leaf (Bambusa vulgaris) and shifted through sieve no. 20 and following tests were
performed.
Materials and Methods
29
Determination of Total Ash
About 3 g each of powdered parts were accurately weighed and taken separately in silica
crucible, which was previously ignited and weighed. The powder was spread as a fine
layer on the bottom of crucible. The powder was incinerated gradually by increasing
temperature to make it dull red hot until free from carbon. The crucible was cooled and
weighed. The procedure was repeated to get constant weight. The percentage of total ash
was calculated with reference to the air dried powder.
Acid Insoluble Ash
The ash obtained as described above was boiled with 25 ml of 2N HCl for 5 minutes. The
insoluble ash was collected on an ash less filter paper and washed with hot water. The
insoluble ash was transferred into a crucible, ignited and weighed. The procedure was
repeated to get a constant weight. The percentage of acid insoluble ash was calculated
with reference to the air dried drug.
Water Soluble Ash
The ash obtained as described for the total ash, was boiled for 5 minutes with 25 ml of
water. The insoluble matter was collected on ash less filter paper and washed with hot
water. The insoluble ash was transferred into silica crucible, ignited for 15 min. and
weighed. The procedure was repeated to get a constant weight. The weight of insoluble
matter was subtracted form the weight of total ash. The difference of weight was
considered as water soluble ash. The percentage of water soluble ash was calculated with
reference to air dried parts respectively.
Materials and Methods
30
Acid soluble Ash
Total ash treated with dilute hydrochloric acid reacts with minerals to form soluble salts
and the insoluble residue consists mainly of silica, as acid insoluble ash.
To the crucible/silica dish containing the total ash obtained by the previous test, 25ml of
HCl (N70g/l) was added, covered with a watch glass and boiled gently for 5 min on a hot
plate or burner. Watch glass was rinsed with 5ml of hot water and washings were added
to the crucible. Insoluble matter was collected on an ash less filter paper by filtration and
rinsed repeatedly with hot water until the filtrate was found to be neutral/free from acid.
Filter paper containing the insoluble matter was transferred to the original crucible, dried
on a hot plate and ignited to a constant weight in the muffle furnace at 450°-500°C. Silica
dish was allowed to cool in desiccator for 30 min and weighed without delay. Content of
acid insoluble ash as % was calculated as followed.
Where, A = sample weight in g
B = wt. of dish + contents after drying (g)
C = wt. in g. of empty dish.
Sulphated ash
A silica crucible was heated to red for 10 min. and was allowed to cool in a desiccator
and weighed. A gram of substance was accurately weighed and transferred to the
crucible. It was ignited gently at first, until the substance was thoroughly charred. Then
the residue was cooled and moistened with 1 ml of concentrated sulfuric acid, heated
Acid insoluble ash % = (B-C)
A × 100
Materials and Methods
31
gently until white fumes are no longer evolved and ignited at 800 oC ± 25
oC until all
black particles have disappeared. The ignition was conducted in a place protected from
air currents. The crucible was allowed to cool. A few drops of concentrated sulfuric acid
were added and heated. Ignited as before and was allowed to cool and weighed. The
operation was repeated until two successive weighing do not differ by more than 0.5 mg.
Determination of Extractive values 111-112
Water Soluble Extractive
Five grams of the each raw material was added to 50mL of water 80oc in a stoppered
flask. It was shaken well and allowed to stand for 10min. It was cooled to 15oc and 2 g of
Kiesulghur was added and filtered, 5 mL of the filterate was transferred to a tarred
evaporating basin. The solvent was evaporated on a water bath, for ½ h and then dried in
steam for 2 h and weighed. The percentage of water soluble extractive was calculated
with reference to the air dried powdered plant material.
Alcohol Soluble Extractive
Five grams of each raw material was macerated with 100mL of 70% alcohol in a closed
flask for 24h, shaken frequently during 6h and allowed to stand for 18h. It was filtered
rapidly taking precatutions against loss of alcohol and 25 mL of the filterate was
evaporated to dryness in tarred flat bottomed shallow dish and dried at 105o and
weighed. The percentage of alcohol soluble extractive was calculated with reference to
air- dried powdered formulation.
Materials and Methods
32
Determination of Moisture Content or Loss on Drying
About 5 g of each raw material were accurately weighed. The air dried material was
taken in a previously dried and tarred flat weighting bottle in IR moisture balance and the
temperature was adjusted to 105oC and heating was done for 5 minutes. The procedure
was repeated for three times for different samples and the loss in weight of the
formulation was calculated with respect to the original weight.
The formula used for calculating LOD is = W1/W2 x100
W1-weight of raw material after heating
W2- Original weight of the raw material
Materials and Methods
33
PHYTOCHEMISTRY
Preparation of Extracts
The dry leaf powder of B. vulgaris and root powder of P. odoratissimus 500 gms each
were subjected to soxhlet extraction. Using hexane, benzene, chloroform, ethylacetate
and methanol for 48 hours. The extracts were concentrated to dryness under reduced
pressure and controlled temperature (40-50 °C) using Buchi R-153 Rotavapour and
preserved in a desiccator until further use.
Qualitative Phytochemical Screening
The different qualitative tests were performed for establishing profile of the given extract
for its chemical composition. The following tests were performed on extracts to detect
various phyto constituents present in them.
Detection for carbohydrates 113
500 mg of extract was dissolved in 5 ml of distilled water and filtered. The filtrate was
used to test the presence of carbohydrates.
Molisch’s test
Molish reagent: 10 gm of alpha napthol was dissolved in 100 ml of 95% methanol to
prepare Molish reagent
To the extract, two drops of Molish reagent and few drops of concentrated H2SO4 is
added, formation of purple-violet ring indicates the presence of carbohydrates.
Materials and Methods
34
Detection of Glycosides 114
0.5 gm of the extract was hydrolyzed with 20 ml of HCl (0.1 N) and filtered. The filterate
was used to test the presence of Glycosides.
a. Modified Borntrager’s test
To 1 ml of filterate, 2 ml of 1% ferric chloride solution was added in a test tube and
heated for 10 minutes in boiling water bath. The mixture was cooled and shaken with
equal volumes of Benzene. The Benzene layer was separated and treated with half of its
volume of ammonia solution. Formation of rose pink or cherry red colour in the
ammonical layer indicates the presence of anthranol glycoside.
b. Keller-Killiani test: To the extract, few drops of glacial acetic acid and one drop of
5% FeCl3 and concentrated H2SO4 was added, formation of reddish brown colour at the
junction of two liquid layers and upper layer turned bluish green indicates the presence of
glycosides.
Detection of Saponins 115
a. Foam test: 1 ml of extract was diluted to make up to 20 ml with distilled water and
slowly shaked in a graduated cyclinder for 15 minutes. 1 one cm layer of foam indicates
the presence of saponins.
Materials and Methods
35
Detection of Alkaloids 113,116
0.5 gm of the extract was dissolved in 10 ml of dilute HCL (0.1N) and filtered. The
filterate was used to test the presence of alkaloids.
a. Mayer’s test
Mayer’s reagent: readily available from Sd fine chemicals, Mumbai.
Filtrate was treated with Meyer’s reagent; formation of yellow cream colored precipitate
indicates the presence of alkaloids.
b. Dragendrodroff’s test
Dragendroff’s reagent:
i) Dissolve 8 gm of bismuth subnitrate in 20 ml of nitric acid.
ii) Dissolve 27.2 gm of Potassium iodide in 50 ml of distilled water, mix (a) and
(b) and adjust the volume to 100 ml with distilled water.
Filtrate was treated with Dragendroff’s reagent; formation of red colored precipitate
indicates the presenc of alkaloids.
Detection of Flavonoids 117
a. Alkaline reagent test:
To 100 mg 0f extract, few drops of NaOH solution was added in a test tube. Formation of
intense yellow color that becomes colorless on addition of few drops of of dilute HCl
indicates the presence of Flavonoids.
Materials and Methods
36
Detection of Phenolics and Tannins 115
100 mg of extract was boiled with 1 ml of distilled water and filtered. The filterate was
used for the following test,
a. Ferric chloride test: To 2 ml of filtrate, 2 ml of 1% ferric chloride solution was added
in a test tube. Formation of bluish black color indicates the presence of phenolic nucleus.
b. Test for Tannins: To the extract 0.5 ml NaOH was added, formation of precipitate
indicates the presence of tannins.
Detection of Phytosterols and Triterpenoids 116-118
0.5 gm of extract was treated with 10 ml chloroform and filtered. The filterate was used
to test the presence of Phytosterols and Triterpenoids.
a. Leibermann’s test: To 2 ml of filtrate in hot alcohol, few drops of acetic anhydride
was added. Formation of brown precipitate indicate the presence of sterols.
b. Leiberman-Bucharat test: To the extract, few drops of acetic acid and concentrated
H2SO4 were added, deep red ring at the junction of two layers indicates the presence of
triterpenes.
c. Salkowaski test: To the extract solution few drops of Conc Sulphuric acid was added
and shaken and allowed to stand, lower layer turns red indicating the presence of sterols.
Materials and Methods
37
Detection of fixed oils and fats 113
a. Oily spot test: One drop of extract was placed on filter paper and solvent was allowed
to evaporate. An oily stain on filter paper indicates the presence of fixed oil.
Estimation of Total phenol content
Total phenol content of the extracts was determined by using the Folin-Ciocalteu Method
119. This test is based on the oxidation of Phenolic groups with phosphomolybdic and
phosphotungstic acids. After oxidation the green– blue complex formed was measured at
750 nm.
Chemicals and Reagents
1. Folin-Ciocalteu Reagent
Commercially available Folin-Ciocalteu reagent was diluted (1:10) with distilled
water and used.
2. Sodium carbonate
20.25 g of sodium carbonate was dissolved in 100 ml of distilled water and used (0.7
M).
Preparation of test and standard solutions
The plant extracts (50 mg each) were dissolved separately in 50 ml of methanol. These
solutions were serially diluted with methanol to obtain lower dilutions. Gallic acid
monohydrate (50 mg) was dissolved in 50 ml of distilled water. It was serially diluted
with water to obtain lower dilutions.
Materials and Methods
38
Procedure
In a test tube, 200 μl of the extract (1 mg/ml) was mixed with 1 ml of Folin-Ciocalteu
reagent and 800 μl of sodium carbonate. After shaking, it was kept for 2 h for reaction.
The absorbance was measured at 750 nm. Using gallic acid monohydrate, standard curve
was prepared and linearity was obtained in the range of 10-50 μg/ml. Using the standard
curve the total phenol content of the extract was determined and expressed as gallic acid
equivalent in mg/g of the extract.
Isolation and characterization of phytoconstituent from methanolic extract of
Bambusa vulgaris leaves 120
Definition
“Technique employed for the separation of mixture by continuous distribution of the
components between two phases, when the chromatographic operations are carried using
column, it is called column chromatography”.
Choosing the solvent system (Standardization of mobile solvent)
To standardize the mobile solvent, initially TLC study was performed for separation of
compounds. For this different combination of mobile phases were tried with two solvent
systems at variable proportions viz., Hexane, Chloroform, Ethyl acetate, Methanol. It was
concluded that Chloroform and methanol solvent system showed good separation, so this
combination was chosen as mobile phase for column chromatography.
Materials and Methods
39
Loading of column (wet packing)
Column was packed with slurry of silica gel of mesh size 60-120 (SD fine chemicals,
Mumbai) with chloroform. Column length is 100 cm and diameter is 3 cm. on top of
silica bed, sample 15 Gms was loaded. On top of the sample cotton was placed to avoid
any disturbance to the sample bed.
Elution of the column
Based on TLC results column elution was started with Chloroform but initially
chloroform solvent was eluted for small quantity for correct distribution of activated
sample in the column and later Chloroform and Chloroform: Methanol solvent
combination was followed with increasing polarity. Fractions were collected in 50 ml
portions and monitored on TLC and the fraction showing similar spots were pooled.
Pattern of column elution
Solvent ratio Fraction
no TLC result
Eluted
sample
color
Solvent ratio
For TLC
Chloroform 1 to 3 No spots Colorless Chloroform: Methanol:9:1
Chloroform 4 Multiple spots
(2-3 spots)
Light
straw
colour
Chloroform: Methanol:9:1
Chloroform 5-6 Multiple spots
(2-3 spots)
Dark
Straw Chloroform: Methanol:9:1
Chloroform 7-9 Multiple spots
(2-3 spots)
Light
straw
colour
Chloroform: Methanol:9:1
Materials and Methods
40
Chloroform:
Methanol:
9.5:0.5
10-21 No spots colorless Chloroform: Methanol:
9.5:0.5
Chloroform:
Methanol:
9.5:0.5
22 3 bands with
tailing pattern
Straw
colour
Chloroform: Methanol:
9.5:0.5
Chloroform:
Methanol:
9.5:0.5
23
Single band
Flourescent
orange
Green
colour
Chloroform: Methanol:
9.5:0.5
Chloroform:
Methanol:
9.5:0.5
24
3 bands,
Flourescent
Orange, Light
blue and Reddish
orange.
Green
Colour
Chloroform: Methanol:
9.5:0.5
Chloroform:
Methanol:
9.5:0.5
25-26
3 bands,
Flourescent light
Orange, Light
blue and Reddish
orange.
Dark
Green
Colour
Chloroform: Methanol :
9.5:0.5
Chloroform:
Methanol:
9.5:0.5
27-55 Multiple spots
(2-3 spots)
straw
colour
Chloroform: Methanol:
9:1
Evaporation of fractions
During the above column elution process, the fraction 23 has a single banding pattern
which was confirmed by TLC study with various mobile phases. So it was kept for
evaporation to dryness in room temperature. After drying the dried residue was scrapped
off once again checked for its purity and named as S2. The remaining fractions were not
Materials and Methods
41
worked out because of lower yield as well impurity. The compounds were sent for
spectral analysis i.e., IR, MASS, C13
NMR & 1H NMR for structural elucidation.
Pandanus odoratissimus root material bioactivity guided identification for
antidiabetic compound or an active fraction 120
Column chromatography purification of methanolic extract
Adsorption of sample on silica gel
The methanolic extract was dissolved in methanol and mixed with dry activated silica
gel, after air drying the sample; it was used for purification process. Adsorbed sample
kept for complete drying and later used for column elution.
Choosing the solvent system (Standardization of mobile solvent)
To standardize the mobile solvent, initially TLC study was performed for separation of
compounds. For this different combination of mobile phases were tried with two solvent
systems at variable proportions viz., Hexane, Chloroform, Ethyl acetate, Methanol. It was
concluded that Hexane, Chloroform and methanol solvent system showed good
separation, so this combination was chosen as mobile phase for column chromatography.
Loading of column (wet packing)
Column was packed with slurry of silica gel of mesh size 60-120 (Sd fine chemicals,
Mumbai) with Hexane. Column length was 100 cm and diameter is 3 cm. on top of silica
Materials and Methods
42
bed, activated sample was loaded and cotton was placed on top of it to avoid any
disturbance to the sample bed.
Elution of the column
Initially Hexane solvent was eluted for small quantity for correct distribution of activated
sample in the column and later with two solvent combinations with increasing order of
polarity was used.
Based on preliminary TLC observations, column elution was started with Hexane,
Chloroform and Methanol combinations Fractions were collected in 50 ml portions and
all the fractions were pooled wit respect to their mobile phase.
Pattern of column elution
Solvent ratio Fraction no TLC result
Eluted
sample color
Hexane 1 Multiple spots Green
Chloroform 2 Multiple spots Straw
Chloroform: Methanol:70:30 3 Multiple spots Brown
Chloroform: Methanol:50:50 4 Multiple spots Brown
Chloroform: Methanol:30: 70 5 Multiple spots Brown
Methanol 6 Multiple spots Brown
Materials and Methods
43
From above elution process, the fractions were pooled as per their mobile phase
concentrations, all the pooled fractions were evaporated under reduced pressure. Later
each fraction was tested for its toxicity in L6 cell line by MTT assay (Table no 1).
After obtaining the CTC50 value, the above fractions were tested for its antidiabetic study
by Glucose uptake study by L 6 cell lines (Table no 2). From the Glucose uptake study it
was found out that the Methanol fraction showed good antidiabetic activity followed by
Chloroform: Methanol: 30: 70 fractions with % glucose uptake of 15.54 and 12.42 over
the control. So the Methanol fraction was further preceded for purification by preparative
TLC.
Purification of phytoconstituents from methanolic fraction by preparative TLC
The mobile phase was standardized for the Methanol fraction fractions, Hexane:
Chloroform: Methanol: 2:4:1 was used for separating phytoconstituents. After
developing/separating the TLC plate was visualized under UV light, the bands at Rf value
13.5 (FBR) was scrapped off and the scrapped band was dissolved in methanol for two to
three times, later it was sent for spectral analysis.
Materials and Methods
44
BIOLOGICAL ACTIVITIES
Acute toxicity studies
Animals
Adult healthy female Sprague–Dawley rats with body mass of approximately 200–225 g
were used. Adult healthy female mice weighing 20±2g were used. The animals were
conditioned at room temperature and at natural photoperiods for 1 week before study. A
commercial balanced diet and tap water ad- libitum were provided. Room temperature
was maintained at 22±2°C with light and dark cycle of 12/12 h. The experiments were
conducted as per the guidelines of CPCSEA, Chennai, India (approval no
APTUS/IAEC/252/11)
.
Treatment
The animals received a single dose of the test item by oral administration at 2000 mg/kg
body weight, after being fasted for approximately 18.0 hours but with free access to
water. Food was provided again at approximately 3.0 hours after dosing for both the
Steps. The administration volume was 10 mL/kg body weight. The animals were dosed
using 18 G oral Stainless steel feeding tubes.
The animals were observed daily during the acclimatization period and mortality/viability
and clinical signs were recorded. All animals were observed for clinical signs during first
30 minutes and at approximately 1, 2, 3 and 4 hours after administration on test day 0 and
once daily during test days 1-14. Mortality/viability was recorded twice daily during days
1-14 (at least once on day of sacrifice). Body weights were recorded on test day 0 (prior
Materials and Methods
45
to administration), test days 7 and 14. All animals were necropsied and examined
macroscopically.
Necroscopy
All animals were sacrificed at the end of the observation period by carbon dioxide in
euthanasia chamber and discarded after the gross/macroscopic pathological changes were
observed and recorded. No organs or tissues were retained.
Evaluation of venom neutralization activity 121
Selection and Maintenance of Animals
Female Swiss albino mice (20±2 g, 8-10 weeks old) were obtained from the animal house
of Aptus Biosciences Private Limited, Hyderabad. Mice were housed in open top cages
and maintained on food and water ad labium. Room temperature was maintained at
22±2°C with light and dark cycle of 12/12 h. The experiments were conducted as per the
guidelines of CPCSEA, Chennai, India (approval no APTUS/IAEC/253/11)
Venom
The snake venom was obtained from Irula Snake Catcher’s Industrial Co-operative
Society Ltd, Chennai and was preserved at 4°C. Before use, the venom was dissolved in
saline, centrifuged at 2000rpm for 10 min and supernatant was used for anti-venom
studies. Venom concentration was expressed in terms of dry weight.
Materials and Methods
46
Snake venom antiserum
Lyophilized polyvalent snake venom antiserum (as standard reference serum) was
obtained from vins Bioproducts Ltd, Eradur, Medak dist, Andhra Pradesh, India. Before
use the antiserum was dissolved in 10ml of water for injection.
Determination of median lethal dose (LD50) of venom
Animals, total of 48 were divided into 6 groups (n=8) i.e. Group I to Group VI. Group I
was kept as control received 0.2 ml of saline intra peritonially (i.p.). Group II to VI
received different concentrations of venom ranging from 100 to 20 µg in saline solution
(0.2 ml i.p.). LD50 was determined by the standard method with the confidence limit at
50% probability by the analysis of deaths occurring within 24 h of venom injection 122
.
Experimental Design
The animals, total of 56 were divided into seven groups (n=8) i.e. Group I to Group VII.
Except the Group I, rest of the groups received LD50 dose of venom prepared in saline
(0.2ml) at zero hour. This was followed by i.p. administration of antiserum and plant
extract as described below,
Group I: Normal control and received saline (0.2ml).
Group II: Venom control and received saline (0.2ml).
Group III: Positive control was treated with dil. snake venom antiserum (0.2ml).
Group IV: Treated with Methanolic extract (250 mg/kg b. wt)
Group V: Treated with Methanolic extract (500 mg/kg b. wt)
Materials and Methods
47
Group VI: Treated with Methanolic extract (750 mg/kg b. wt)
Group VII: Treated with Methanolic extract (1000 mg/kg b. wt)
After 24 h of treatment, the number of mice survived in each group was counted. The
efficacy of the plant extracts was evaluated against the venom induced lethality and
expressed in percentage of survival and increase in survival rate by extract treatment.
Antipyretic studies 123
Animals
Adult healthy male wistar rats with body mass of approximately 150-200 g were used.
The animals were conditioned at room temperature and at natural photoperiods for 1
week before study. A commercial balanced diet and tap water ad- libitum were provided.
The experiments were conducted as per the guidelines of CPCSEA, Chennai, India
(approval no APTUS/IAEC/254/11)
Treatment
The antipyretic activity of formulations was evaluated using Brewer’s yeast induced
pyrexia in male albino rats of wistar strain weighing between 150-200 gms. Fever was
induced by subcutaneous injecting 10 ml/kg of 20 percent aqueous suspension of
Brewer’s yeast in normal saline after measuring the rectal temperature using the digital
thermometer. Eighteen hours (0 h) after the yeast injection, the animals were again placed
in individual cages for recording the rectal temperature. The different groups of rats were
treated orally with polyherbal formulations at doses of 500 and 250 mg/kg body weight.
Materials and Methods
48
The animals of control group were administered orally the suspension of 2% aqueous
solution of Tween 80 a volume of 2 ml/kg body weight. The animals of Positive control
group were received the standard prototype antipyretic agent, paracetamol (150 mg/kg
body weight) orally. The rats were restrained for their rectal temperature to be recorded at
the 0 h immediately before formulation or vehicle or paracetamol administration and
again at regular time intervals for next six hours.
Statistical analysis
The results of the experiment were expressed as mean ± SE in each test. The data were
evaluated by one-way Analysis of Variance (ANOVA) followed by Tukey’s multiple
pair-wise comparison tests to assess the statistical significance, using software ANOVA
ver. 0.98.
Anti diabetic studies
In vitro anti-diabetic studies 124
Chemicals
3-(4, 5–dimethyl thiazol–2–yl)–5–diphenyl tetrazolium bromide (MTT), Fetal Bovine
serum (FBS), Phosphate Buffered Saline (PBS), Bovine Serum Albumin (BSA), D-
glucose, Dulbecco’s Modified Eagle’s Medium (DMEM), Metformin and Trypsin were
obtained from Sigma Aldrich Co, St Louis, USA. EDTA, Antibiotics from Hi-Media
Laboratories Ltd., Mumbai. Insulin (Torrent Pharmaceuticals, 40IU/ml) was purchased
from a drug store. Dimethyl Sulfoxide (DMSO) and Propanol from E.Merck Ltd.,
Mumbai, India.
Materials and Methods
49
Cell lines and Culture medium
L-6 (Rat, Skeletal muscle) cell culture was procured from National Centre for Cell
Sciences (NCCS), Pune, India. Stock cells of L-6 were cultured in DMEM supplemented
with 10% inactivated Fetal Bovine Serum (FBS), penicillin (100 IU/ml), streptomycin
(100 µg/ml) and amphotericin B (5 µg/ml) in an humidified atmosphere of 5% CO2 at
37°C until confluent. The cells were dissociated with TPVG solution (0.2% trypsin,
0.02% EDTA, 0.05% glucose in PBS). The stock cultures were grown in 25 cm2 culture
flasks and all experiments were carried out in 96 microtitre plates (Tarsons India Pvt.
Ltd., Kolkata, India).
Preparation of Test Solutions
For in vitro studies, each weighed test drugs were separately dissolved in distilled DMSO
and volume was made up with DMEM supplemented with 2% inactivated FBS to obtain
a stock solution of 1 mg/ml concentration and sterilized by filtration. Serial two fold
dilutions were prepared from this for carrying out cytotoxic studies.
Cytotoxicity studies
The 24 hr cell cultures with 70-80% confluency in 96 well plates were used for the study.
100 µl of each dilution of the test drugs were added in quadruplicate in 96 well plate and
cell controls maintained in same number. The culture were incubated at 370 C with 5%
CO2 for 24 hrs and the cultures were observed microscopically for any visible change in
morphology of cells and observations were recorded. The cell viability assay was
determined by MTT assay (francis and Rita). The percentage cytotoxicity caused by each
Materials and Methods
50
dilution of the drug was determined and Cytotoxic Concentration 50 (CTC50) values
determined by interpolation method. The non-toxic concentrations of test drugs, i.e.
concentrations below CTC50 value were taken for glucose uptake studies.
In vitro glucose uptake assay
Glucose uptake activity of test drugs were determined in differentiated L6 cells 125-126
. In
brief, the 24 hr cell cultures with 70-80% confluency in 40mm petri plates were allowed
to differentiate by maintaining in DMEM with 2% FBS for 4-6 days. The extent of
differentiation was established by observing multinucleation of cells. The differentiated
cells were serum starved over night and at the time of experiment cells were washed with
HEPES buffered Krebs Ringer Phosphate solution (KRP buffer) once and incubated with
KRP buffer with 0.1% BSA for 30min at 370C. Cells were treated with different non-
toxic concentrations of test and standard drugs for 30 min along with negative controls at
370C. 20µl of D-glucose solution was added simultaneously to each well and incubated at
370C for 30 min. After incubation, the uptake of the glucose was terminated by aspiration
of solutions from wells and washing thrice with ice-cold KRP buffer solution. Cells were
lysed with 0.1M NaOH solution and an aliquot of cell lysates were used to measure the
cell-associated glucose. The glucose levels in cell lysates were measured using glucose
assay kit (Biovision Inc, USA). Three independent experimental values in duplicates
were taken to determine the percentage enhancement of glucose uptake over controls 127-
128.
Materials and Methods
51
In situ glucose uptake studies in rat hemi diaphragm 129
Glucose uptake by rat hemi-diaphragm was estimated by the methods described earlier
130-131 with some modification. Albino rats of either sex weighing between 160-180 gm
were selected. The animals were maintained on a standard pellet diet (water ad libitum),
and fasted overnight. The animals were sacrificed by decapitation and diaphragms were
dissected out quickly with minimal trauma and divided into two halves. The hemi
diaphragms were then rinsed in cold Tyrode solution (without glucose) to remove any
blood clots and were placed in small culture tubes containing 2ml Tyrode solution with
2% glucose and incubated for 30 minutes at 370C. Twelve sets containing five numbers
of graduated test tubes (n=5) each and treated with negative, positive controls (Insulin)
and with different extracts at 200 µg/ml. Two diaphragms from the same animal were not
used for the same set of experiment. Following incubation, the hemi-diaphragms were
taken out and weighed. The glucose content of the incubated medium was measured by
GOD-POD method. The uptake of glucose was calculated in mg/g of moist tissue/30 min.
Glucose uptake per gram of tissue was calculated as the difference between the initial and
final glucose content in the incubated medium.
In vivo anti-diabetic studies 132
Animals
Adult healthy male Sprague–Dawley rats with body mass of approximately 200–225 g
were used. The animals were conditioned at room temperature and at natural
photoperiods for 1 week before study. A commercial balanced diet and tap water ad-
Materials and Methods
52
libitum were provided. The experiments were conducted as per the guidelines of
CPCSEA, Chennai, India (approval no APTUS/IAEC/254/11)
Induction of diabetes
The animals were initially divided into two groups, the first group (6) received saline
solution intraperitonially (i.p.) and it was kept as control. The second group (36 rats) was
injected with a single intravenous dose of streptozotocin (STZ) at 40 mg/kg of body
weight, dissolved in 0.01 M citrate buffer, pH 4.5, immediately before use. Three days
later blood glucose levels were determined in this group in whole blood samples
collected from the tip of the tail.
Treatment
The animals which received saline were named as Group I, normal controls were fed with
normal diet. The diabetic rats were devided into Group II-VII, in which Group II served
as positive control without any treatment. Group III and IV were treated with different
doses of methanolic extract (500 and 1000 mg/kg) of Bambusa vulgaris Schrad leaves.
Group V and VI were treated with different doses of methanolic extract (500 and 1000
mg/kg) of Pandanus odoratissimus Linn.f. root. Group VII were treated with the standard
drug Gliclazide at 25mg/kg b.w. Treatment was carried out for 4 weeks.
Blood and tissue collection
At the end of the experiment, rats were fasted overnight and anesthetized with sodium
pentothal (intraperitoneally) and 2.5 ml of blood was withdrawn through the retro-orbital
Materials and Methods
53
plexus using a glass capillary and collected in tubes and subjected to blood serum
analysis. The animals were sacrificed and pancreas was collected to study
histopathological parameters.
Preparation of hemolysate
Collected blood was centrifuged for 10 minutes at 3000 rpm. Plasma and serum was
separated for the analsysis. The plasma thus obtained was used for glucose and
glycosylated hemoglobin (HbA1C) using commercial kits. The serum samples were used
for the estimation of creatine kinase (CK) and lactate dehydrogenase (LDH) using
commercial kits.
Histopathology
The pancreas were fixed in 10% neutral buffered formalin, and 4 ftm paraffin sections
were cut and stained with haematoxylin and eosin (H&E). Degeneration and necrotic
damage produced by STZ was observed microscopically.
Results and Analysis
54
CHAPTER-5
RESULTS AND ANALYSIS
PHARMACOGNOSTICAL STUDIES ON BAMBUSA VULGARIS LEAF AND
PANDANUS ODORATISSIMUS ROOT
Bambusa vulgaris leaf microscopy study
The leaf consists of a median, less prominent midrib and uniformly thick lamina (fig 1.1). The
vascular bundle of the midrib is slightly larger than the vascular bundles of the lateral veins (fig
1.1). the vascular bundle of the midrib consists of two wide metaxylem elements and short row
of proto xylem elements; a wide circular mass of phloem elements is situated in between the
metaxylem elements; a thick mass of fibres occurs beneath the phloem and small are of fibres is
situated on the adaxial end of the vascular strand.(fig 1.2). The vascular bundles of the lateral
veins vary in size, some being larger others being smaller. The larger lateral vein-bundles are
circular with two large metaxylem elements and wide mass of phloem elements. The vascular
strand has parenchymatous bundle sheath with wide, circular hyline cells (fig 1.3). A flat pade of
two layers of fibres is situated at the lower end of the bundle; a thin vertical pillar of
sclerenchyma cells is also seen on the upper of the vascular strand. The vascular strand is 90µm
wide. Smaller vascular bundlesof the lateral veins use also circular with less prominent xylem
elements, lightly dilated parenchymatous bundle sheath and a thickpad of sclerenchyma located
on the lower end of the vascular strand. The palisade cells are horizontally transcurrent along
adaxial end of the vascular strands (fig2.1, 2).
Results and Analysis
55
Epidermal layers
The adaxial epidermal cells are barrel shaped with thick smooth cuticle (fig 2.1, 2). The cells are
barrel shaped. The abaxial epidermal cells are circular with with heavy cuticle. The cuticle
develops thick, peg like outgrowth on each epidermal cells. (fig.1.3) the cells are 13µm thick.
The ground tissue is differentiated into adaxial and abaxial zones of mesophyll tissue, and a
median row of air-chambers (fig 1.1; 2.1, 2).the adaxial mesophyll tissue consists of three layers
of short, compact cylindrical cells; the abaxial zone has two or three layers of spherical compact
cells. Both abaxial and axial cells have dense chloroplasts. The median air chambers are wide
and rectangular, separated laterally by thick septa and vascular bundles of the lateral veins.
Bulli form cells
Some of the adaxial epidermal cells are highly dilated into vertically elongated triangular, thin
walled cells. A group of 3-5 cells form such dilated cluster which are called bulliform cells or
motor cells(fig.1.3; 2.1,2) of the cluster of cells,the central cell is the highest and the lateral cells
are short. In sectional view, the bulliform cells appear pyramidal in shape. The bulliform
apparatus is 60µm in heightand 40µm in width.
Leaf margin
The marginal portion of the lamina is thin and conical; the mesophyll tissue consists of four
layers of short compact cells; the air chambers are totally absent. At the extreme end of the
margin is a wide circular canal, which does not contain any inclusion (fig2.3).
Results and Analysis
56
Stomata and epidermal cells
The stomata are monocot-type; the stoma consists of two dumb – bell shaped guardcells with
one semicircular subsidiary cells on either side of the guard cells.the stomata occur in
longitudinal lines (fig3.1).the epidermal cells are rectangular , arranged in longitudinal files.
Their walls are closely undulate (fig 3.2).
Venation
Uniformly thick veins run parallel to each other along straight lines (fig.3.3). The veins include
xylem elements of spiral, annular and scalar form lateral thickenings. Bundle sheath cells are
seen all along the lateral sides of the veins –bundles. The cells are rectangular, thin walled and
hyaline. (fig.3.3). the midrib is thicker than the lateral veins (fig 4.1, 2).the veins are linned by
thin sclereids at certain places.
Crystals
Calcium oxalate crystals are abundant in the mesophyll tissue. The crystals are druses. They are
scattered and random in distribution (fig.4.3).
Pandanus odoratissimus root microscopy study
Both thin root and thick root were studied. The thin root measuring 600 micro meter in diameter
is undulate in cross sectional view (fig.5.1) .The epidermal layer is not well defined. The cortex
consists of outer zone of compact cells and inner zone of aerenchyma. The outer cortical zone
consists of 6 or 7 layers of thin walled, compact shrunken cells .The outer layer of the cortex
consists mucilaginous coating and assumes the function of the epidermis (fig.5.1, 6.1) .Thinner
Results and Analysis
57
cortex consists of two or three layers of small air-chambers separated by thin uniseriate
filaments. In the intersecting regions of the separation filaments occur small circular clusters of
thick walled fibres (fig.6).
The stele is circular measuring 210 micro meter thick.It consists of well defined endodermoid
layer of spindle shaped cells, lacking the characteristic annular thickenings. Inner to the
endodermoid layer is a thin hyaline layer of pericycle. The stele consists of about 9 exarch xylem
strands with 3 elements in each strand and alternating 9 small groups of phloem elements. The
ground tissue of the stele consists of sclerenchyma cells. The xylem elements are angular and
wide. The sclerenchyma elements are thick walled and lignified.
The thick root is 2.5 mm in diameter. It is circular with wavy outer surface. The epidermis
remains intact at certain places; it consists of spindle shaped cells with thick cuticle. Inner to the
epidermis is a wide zone of storied periderm (or storied cork).It includes about 8 layers of tabular
suberised cells which do not form regular radial seviation. The cortex wide comprises outer
compact cells and minor several radial rows of air chambers. Small groups of sclerenchyma cells
are located both in the outer ground tissue and inner aerenchyma cells. The sclerenchyma
clusters include thick walled, lignified fibres (fig.7.1, 2; 8.1).
The stele consists of an endodermoid layer of barrel shaped cells; inner to the endodermoid layer
is a thin layer of parenchyma cells which is the pericycle (fig.8.2). The ground tissue of the stele
is sclerenchymatous mixed with wide, thin walled parenchyma cells. Small clusters of highly
thick walled fibres are also present with ground tissue. There are several wide circular vessels
Results and Analysis
58
diffusely distributed in the pith. These central wide elements are metaxylem cells. Along the
periphery of the stele is the protoxylem. Alternating with the protoxylem strands are several
phloem islands (fig.9). The metaxylem cells are wide and elliptical or circular in outline. The
cells are up to 150 micro meter in diameter.
Root Powder microscopic results
The root powder includes fibres, and vessel elements. Fibres are either wide or narrow. The wide
fibres are thin walled with wide lumen. They are about 700 micrometer long and 30 micrometer
wide. The narrow fibres have thick walls and narrow lumen. They are up to 850 micrometer long
and 10 micrometer thick (fig.10.1, 2).
Vessel elements are long, narrow and coiled (fig.6). They have either annular or spiral
thickenings. The metaxylem elements are vessels with wide shorter cells and wide elliptical
simple perforations at the end walls. The lateral walls have circular bordered pits (fig.7). These
elements are up to 250 micrometer long.
Crystals
Calcium oxalate crystals are abundant with inner cortical cells (fig.5.2) .The crystals are either
raphide bundles or sphaero crystals .They occur in the cells outer to the endodermoid layer. They
are random in distribution and do not occur in specialized cells.
Results and Analysis
59
Fig 1.1 (10X): T S of lamina of Bambusa vulgaris leaf
Fig 1.2 (40X): T S of lamina through midrib of Bambusa vulgaris leaf
Fig 1.3 (40X): T S of lamina through lateral veins and bulliform apparatus of Bambusa
vulgaris
(AdE: Adaxial epidermis ; Ads: Adaxial side ;B C, Bulliform cells ; E C : Echinate cuticle ;L V : Lateral
veins; M R : Midrib; M X : Metaxylem; Ph; Phloem; Sc; Scleren chyma;V B: Vascular bundle; X : Xylem)
Results and Analysis
60
Fig 2.1 (40X): T S of lamina through smaller lateral veins of Bambusa vulgaris leaf.
Fig 2.2 (40X): T S of lamina through smaller lateral veins of Bambusa vulgaris leaf.
Fig 2.3 (40X): T S of lamina through marginal part of Bambusa vulgaris leaf
(AbE: Abaxial Epidermis; Abs: Abaxial side; A C: Air-chamber; AdE :Adaxial epidermis ; Ads : Adaxial
side; B C : Bulli form cells; B S: Bundle sheath; Cu: Cuticle; L M : Leaf- margin ; L V: Lateral vein ; M T
: Mesophyll tissue; Ph: phloem; SC: Sclerenchyma, X: Xylem)
Results and Analysis
61
Fig 3.1 (10X): Lower epidermis of the leaf, showing the stomata of Bambusa vulgaris leaf
Fig 3.2 (40X): Upper epidermis cells showing wavy cell wall of Bambusa vulgaris leaf
Fig 3.3 (40X): Venation of the lamina of Bambusa vulgaris leaf
(E C: Epidermal cells; B C: Bundle sheath cells; Scl: sclereid ; St : Stomata; Ve: Veins)
Results and Analysis
62
Fig 4.1 (40X): Surface view of the cleased
leaves showing parallel veins of Bambusa
vulgaris leaf
Fig 4.3 (10X): Crystals in the leaf mesophyll tissue of Bambusa vulgaris leaf
(Cr: Crystals; L V, Lateral vein; M R : Midrib; Ve :veins)
Fig 4.2 (10X): Surface view of the
cleased leaves showing parallel veins
of Bambusa vulgaris leaf
Results and Analysis
63
Fig 5.1 (10X): TS of thin root-entire view of Pandanus odoratissimus root.
Fig 5.2 (10X): TS of thick root showing the crystals with inner cortical cells Pandanus
odoratissimus root
(AC- Air Chamber; Co-Cortex; Cr-Crystals; St-Stele)
Results and Analysis
64
Fig 6.1 (40X): TS of thin root –Cortical portion of Pandanus odoratissimus root
Fig 6.2 (40X): TS of thin root-Stele-enlarged of Pandanus odoratissimus root
(AC-air chamber; En-Endodermoid layer ;MX- Metaxylem; Pe- Periderm; Ph-Phloem; PX- Protoxylem; SC-
Sclerenchyma)
Results and Analysis
65
Fig 7.1 (40X): TS of thick root –entire view of Pandanus odoratissimus root
Fig 7.2 (40X): TS of thick root –a sector enlarged of Pandanus odoratissimus root
(AC-Air chamber; ACo- Aerenchymatous Cortex ;En – Endodermis ; MX- Metaxylem; Pe- Periderm; PF –
Partition filament; Ph-Phloem; PX- Protoxylem; Sc-Sclerenchyma strands; St-Stele)
Results and Analysis
66
Fig 8.1 (10X): TS of old root –Periderm and cortex of Pandanus odoratissimus root
Fig 8.2 (40X): TS of old root-Stele of Pandanus odoratissimus root
(AC-Air Chamber; ICo-inner Cortex; En – Endodermis ; MX- Metaxylem; Pe- Periderm; ; PX- Protoxylem;
OCo-Outer Cortex ;SC-Sclerenchyma)
Results and Analysis
67
Fig 9.1 (40X): TS of thick root – secondary xylem of Pandanus odoratissimus root
(MX- Metaxylem; Ph-Phloem; PX- Protoxylem; XF-Xylem Fibres)
Results and Analysis
68
Fig 10.1 (10X): Fibres of Pandanus odoratissimus root powder
Fig 10.2 (10X): Fibres and vessels of Pandanus odoratissimus root powder
Fig 10.3 (40X): A single vessel element of Pandanus odoratissimus root powder
(NFi- Narrow fibre; VE- Vessel element; WFi- Wide Fibre; XE- Xylem Element)
Results and Analysis
69
Physiochemical evaluation
For physiochemical evaluation, Bambusa vulgaris leaf and Pandanus odoratissimus root were
used for analysis for physiochemical parameters such as ash values, extractive values and
moisture content.
The total ash determination method is designed to measure the total amount of material
remaining after ignition. This includes both “physiological ash”, which is derived from the plant
tissue itself, and “non physiological ash”, which is the residue of extraneous matter adhering to
the plant surface.
The physiochemical parameters of plant materials viz., ash values (total ash, water soluble ash,
acid insoluble ash, and sulphated ash) were performed as per WHO bulletin, 2002 and recorded
in table.
Determination of Ash values
The ash values was determined as per standard procedure for Bambusa vulgaris leaf and
Pandanus odoratissimus root material and expressed interms of percentage found to be 4.14
(total ash), 0.76 (water soluble ash), 0.84 (acid insoluble ash), 3.30( acid soluble ash), 1.38
(sulphated ash) for Bambusa vulgaris leaf. Similarly ash values were also determined for
Pandanus odoratissimus root material and found to be higher than Bambusa vulgaris leaf viz.,
9.51(total ash), 1.23 (water soluble ash), 6.19 (acid insoluble ash), 3.30(acid soluble ash), 2.57
(sulphated ash).
Results and Analysis
70
Table 1: Ash values
Sample
Ash value %
Total
Ash
Water
soluble ash
Acid
insoluble ash
Acid
soluble ash
Sulphated
ash
Bambusa vulgaris
leaves
4.14 0.76 0.84 3.30 1.38
Pandanus
odoratissimus root 9.51 1.23 6.19 3.30 2.57
Determination of Extractive values
Both Bambusa vulgaris leaf and Pandanus odoratissimus root material was studied for extractive
value and found to be nearly equal. The alcohol soluble extractives for Bambusa vulgaris leaf
and Pandanus odoratissimus root found to be 8 and 10 % respectively. Similarly the water
soluble extractives found to be 11.1 and 12 % respectively (Table 2).
Table 2: Extractive value
Plant material Extractive value in %
Alcohol Water
Bambusa vulgaris 8% 11.1
Pandanus odoratissimus 10% 12
Results and Analysis
71
Determination of Moisture Content or Loss on Drying
The moisture content was found to be 9 and 7 % for Bambusa vulgaris leaf and Pandanus
odoratissimus root material respectively (Table 3).
Table 3: Moisture content
Plant material Moisture content in %
Bambusa vulgaris 9
Pandanus odoratissimus 7
PHYTOCHEMISTRY
Preparation of Extract
For phytochemical study the dry leaf powder of Bambusa vulgaris and root powder of Pandanus
odoratissimus extracted with different solvents was dried under reduced pressure and the average
extractive value was found to be 1.4% (hexane), 0.6% (benzene), 3% (chloroform), 1.4% (ethyl
acetate) and 6 % (methanol) for Bambusa vulgaris and 2 % (hexane), 1.8% (benzene), 3.5% (
chloroform), 2 % (ethyl acetate) and 8 % (methanol) for Pandanus odoratissimus.
Qualitative Phytochemical Screening
The qualitative chemical tests were performed on the both plant extracts to detect the various
phyto- constituents present in them as per the standard procedures and findings were recorded.
The qualitative chemical tests on the methanolic extract of Bambusa vulgaris leaves revealed the
presence of carbohydrates, glycosides, saponins, alkaloids, flavonoids, phenolics and tannins,
phytosterols and triterpenoids, fixed oils and fats, where as remaining extracts showed the
Results and Analysis
72
presence for Phytosterols and Triterpenoids, methanol and chloroform extracts showed the
presence for carbohydrates (Table 4).
Similar results were observed for the methanolic extract of Pandanus odoratissimus showed the
presence of carbohydrates, saponins, alkaloids, phenolics and tannins, phytosterols and
triterpenoids in methanolic extract. Whereas remaining extracts showed the presence for
phytosterols and triterpenoids, only methanol and chloroform extracts showed the presence for
carbohydrates (Table 5).
Table 4: Phytochemical analysis of Bambusa vulgaris leaf extracts
Sl/No Test M C E B H
1 Test for carbohydrates
a. Molisch’s test
+ + + - -
2 Test for Glycosides
b. Modified Borntrager’s test
c. Keller-Killiani test
+
+
-
-
-
-
-
-
-
-
3 Test for Saponins
a. Foam test
+ - - - -
4 Test for Alkaloids
a. Mayer’s test
b. Dragendrodroff’s test
+
+
-
-
-
-
-
-
-
-
5 Test for Flavonoids
a. Alkaline reagent test
+ + - - -
Results and Analysis
73
6 Test for Phenolics and Tannins
a. Ferric chloride test
b. Test for Tannins
-
+
-
-
-
-
-
-
-
-
7 Test for Phytosterols and Triterpenoids
a. Leiberman-Bucharat test
b. Salkowaski test
+
-
+
+
+
+
+
+
+
+
8 Test for fixed oils and fats
a. Oily spot test
+ - - - +
(+) Present, (-) Absent
M= Methanol extract, C= Chloroform, E=Ethyl acetate, B=Benzene, H=Hexane
Results and Analysis
74
Table 5: Phytochemical analysis of Pandanus odoratissimus root extracts
Sl.No Test M C E B H
1
Test for carbohydrates
a. Molisch’s test
+ + - - -
2
Test for Glycosides
a. Modified Borntrager’s test
b. Keller-Killiani test
-
-
-
-
-
-
-
-
-
-
3
Test for Saponins
a. Foam test
+
-
-
-
-
4
Test for Alkaloids
b. Mayer’s test
c. Dragendrodroff’s test
+
+
-
-
-
-
-
-
-
-
5
Test for Flavonoids
a. Alkaline reagent test
-
+
-
-
-
6
Test for Phenolics and Tannins
a. Ferric chloride test
b. Test for Tannins
-
+
-
-
-
-
-
-
-
-
7
Test for Phytosterols and
Triterpenoids
a. Leiberman-Bucharat test
+
+
+
+
+
Results and Analysis
75
b. Salkowaski test - + + + +
8
Test for fixed oils and fats
a. Oily spot test
-
-
-
-
-
(+) Present, (-) Absent
M= Methanol extract, C= Chloroform, E=Ethyl acetate, B=Benzene, H=Hexane
Estimation of Total phenol content
Both methanolic extracts were estimated for the total phenol content by Folin – ciocalteu
method. The total Phenolic content was found to be in Methanolic extract of Bambusa vulgaris
leaves 4.4±0.81 and Pandasmus odorantismus root 4.8±0.17 gallic acid equivalent in mg/g of the
dried extract.
Isolation and characterization of phytoconstituent from methanolic extracts of Bambusa
vulgaris leaves
The leaf of Bambusa vulgaris was extracted with methanol, concentrated under reduced pressure.
The methanol extract was then subjected for column chromatography with chloroform and
methanol solvent combinations with silica gel of 60-120 mesh size to afford 55 fractions. From
the fraction no 23, a single compound S2 was obtained, later by spectral analysis it was found to
be Palmitic acid.
Results and Analysis
76
Interpretation and observation of S 1 sample:
The compound in its IR spectrum exhibits absorption bands at 3400 cm-1
(broad band,
characteristic of –COOH group), 1712 cm-1
for a carbonyl group, 1455, 1374 and 722 cm-1
suggesting the presence of methylene groups.
In its 1H-NMR spectrum shows a triplet at δ 0.84 for three protons due to a terminal methyl
group adjacent to a methylene group. The multiplet signal at δ 1.86 shows the presence of a
methylene group adjacent to a carbonyl group. A strong singlets at δ 1.29 is due to the presence
of long chain methylene groups in the compound.
13C-NMR spectrum exhibits a signal at δ 12.08 for a methyl group and the signal at δ 29.00 due
to long chain methylene groups which confirms the assignment made in the 1H-NMR spectrum.
The negative mode APCI-MS indicates the molecular weight to be 256 by exhibiting a signal at
m/z 255 for [M-H]-1
ion. Based on the above data the structure of the compound may be of a
saturated fatty acid i.e. Palmitic acid
Physical properties and other details of isolated compound
1. S2:
Solubility: Chloroform
Nature: Dark green powder
Rf value: 0.75 (Chloroform: methanol: 9.5:0.5)
Detection: UV Long wavelength: Fluorescent Yellowish orange.
Results and Analysis
77
Spectral analysis:
1) S2:
1H NMR of S2:
Results and Analysis
78
Results and Analysis
79
C13
NMR of S 2:
Results and Analysis
80
Mass of S2:
Results and Analysis
81
IR of S2
E:\
STA
FF
\OU
TS
IDE
SA
MP
LE
\S-2
.0
S-2
In
str
um
ent
type a
nd /
or
accessory
22/0
2/2
011
3956.67
3903.70
3811.48
3767.18
3382.57
3332.56
3100.15
2920.24
2854.06
2344.00
2112.38
2052.99
1712.07
1456.72
1374.01
1240.07
1162.30
1088.24
1047.67
908.42
781.04
722.98
676.38
622.87
1000
1500
2000
2500
3000
3500
Wavenum
ber
cm
-1
889092949698100
Transmittance [%]
P
ag
e 1
/1
Results and Analysis
82
Pandanus odoratissimus root material bioactivity guided identification for antidiabetic
compound or an active fraction
The dried roots of Pandanus odoratissimus was extracted extracted with methnol to obtain
brown waxy material upon evaporation was subjected for purification by column
chromatography with 60-120 mesh size silica gel to afford 6 different fraction eluted with
Hexane, chloroform and methanol solvent combinations. All six fractions were studied for
Glucose uptake study by L 6 cell lines. From the Glucose uptake study it was found out that the
Methanol fraction showed good antidiabetic activity followed by Chloroform: Methanol: 30: 70
fractions with % glucose uptake of 15.54 and 12.42 over the control. So the Methanol fraction
was further preceded for purification by preparative TLC. After separation by TLC a brown band
with mobile phase Hexane: Chloroform: Methanol: 2:4:1 was scrapped off and dissolved with
methanol to obtain FBR which later upon spectral analysis it was found out to be Heptadecanoic
acid ethyl ester.
Interpretation and observation of FBR sample
The Compound in its ESI-MS (positive mode) spectrum exhibits a peak at m/z 322 for an ion
[M+Na] +
suggesting a molecular weight of 299.
In its 1H-NMR spectrum it showed peaks at δ 0.85 showing the presence of methyl groups in the
compound. The large singlet at δ 1.2 and the signals at δ 1.80 were due to the long chain
methylene groups. The signal at δ 1.99 is due to a methylene adjacent to a carbonyl group. The
signal at δ 4.00 may be due to the protons attached to oxygen function.
Results and Analysis
83
In the 13
C-NMR the signals at δ 20.00 is due to methyl group, at δ 28.00 to 31.00 are due to the
methylene carbons. The signal at δ 70.00 is due to the carbon attached to the oxygen function.
The signal at δ 170.00 confirms the presence of a carbonyl group.
Based on the above data the structure of the compound may be Heptadecanoic acid ethyl ester
Physical properties and other details of isolated compound
1. FBR
Solubility: Methanol
Nature: Yellowishbrown powder
Rf value: 0.75 (Chloroform: methanol: 9.5:0.5)
Detection: UV Long wavelength: Brown
Results and Analysis
84
Spectral analysis:
1) FBR:
1H NMR of FBR:
Results and Analysis
85
Results and Analysis
86
C13
NMR of FBR:
Results and Analysis
87
Mass of FBR:
Results and Analysis
88
IR of S2
Results and Analysis
89
BIOLOGICAL STUDY
ACUTE TOXICITY STUDIES
All animals were survived in step I and step II until the end of the experimental period. All the
animals dosed at 2000 mg/kg body weight did not show evident toxicity throughout the
experimental period (Table 7 and 9). The animals which were survived throughout the
experiment increased their body weight by day 14 as compared to day 0 (Table 7 and 9). No
abnormalities were detected for all the animals at necropsy. Based on the results, the median
lethal doses (LD50) of Bambusa vulgaris and Pandanus odoratissimus were greater than
2000mg/kg body weight and are classified as category 4.
Results and Analysis
90
Table 6: Body weight analysis of test drug treated rats
Sl.
No
Test drug Group
Dose
(mg/kg
bw)
Animal
Numbers
Sex
Test day 0
(treatment)
(g)
Test day
7
(g)
Test day
14
(g)
1
Bambusa
vulgaris
I 2000
R1 Female 220.23 241.22 252.38
R2 Female 221.24 241.89 252.13
R3 Female 202.28 240.92 251.68
II 2000
R4 Female 222.41 243.11 263.61
R5 Female 223.12 243.68 253.84
R6 Female 222.51 243.00 253.38
2 Pandanus
odoratissimus
I 2000
R7 Female 211.83 222.95 254.06
R8 Female 206.12 231.41 261.16
R9 Female 205.04 231.78 260.85
II 2000
R10 Female 212.12 240.54 255.72
R11 Female 211.35 231.35 253.24
R12 Female 201.54 231.54 252.63
mg/kg = miligram/kilogram, g = gram
Results and Analysis
91
Sl.
No Test drug Group
Dose
(mg/kg
bw)
Animal
Number
Sex
Mode of
death
Macroscopic
findings
1
Bambusa
vulgaris
I 2000
R1 Female
Terminal
Sacrifice
No abnormalities
Detected
R2 Female
Terminal
Sacrifice
No abnormalities
Detected
R3 Female
Terminal
Sacrifice
No abnormalities
Detected
II 2000
R4 Female
Terminal
Sacrifice
No abnormalities
Detected
R5 Female
Terminal
Sacrifice
No abnormalities
Detected
R6 Female
Terminal
Sacrifice
No abnormalities
Detected
2
Pandanus
odoratissimu
s
I 2000
R7 Female
Terminal
Sacrifice
No abnormalities
Detected
R8 Female
Terminal
Sacrifice
No abnormalities
Detected
R9 Female
Terminal
Sacrifice
No abnormalities
Detected
Table 7: Macroscopic findings of animals from test drug treated groups.
Results and Analysis
92
mg/kg = miligram/kilogram bw = body weight
II
2000
R10 Female
Terminal
Sacrifice
No abnormalities
Detected
R11 Female
Terminal
Sacrifice
No abnormalities
Detected
R12 Female
Terminal
Sacrifice
No abnormalities
Detected
Results and Analysis
93
Table 8: Body weight analysis of test drug treated mice
Sl.
No
Test drug Group
Dose
(mg/kg
bw)
Animal
Numbers
Sex
Test day 0
(treatment)
(g)
Test day
7
(g)
Test day
14
(g)
1
Bambusa
vulgaris
I 2000
M1 Female 220.23 241.22 252.38
M2 Female 221.24 241.89 252.13
M3 Female 202.28 240.92 251.68
II 2000
M4 Female 222.41 243.11 263.61
M5 Female 223.12 243.68 253.84
M6 Female 222.51 243.00 253.38
2 Pandanus
odoratissimus
I 2000
M7 Female 211.83 222.95 254.06
M8 Female 206.12 231.41 261.16
M9 Female 205.04 231.78 260.85
II 2000
M10 Female 212.12 240.54 255.72
M11 Female 211.35 231.35 253.24
M12 Female 201.54 231.54 252.63
mg/kg = miligram/kilogram, g = gram
Results and Analysis
94
Table 9: Macroscopic findings of animals from test drug treated groups.
Sl.
No Test drug Group
Dose
(mg/kg
bw)
Animal
Number Sex Mode of death
Macroscopic
findings
1 Bambusa
vulgaris
I 2000
M1 Female
Terminal
Sacrifice No abnormalities
Detected
M2 Female Terminal
Sacrifice
No abnormalities
Detected
M3 Female Terminal
Sacrifice
No abnormalities
Detected
II 2000
M4 Female Terminal
Sacrifice
No abnormalities
Detected
M5 Female Terminal
Sacrifice
No abnormalities
Detected
M6 Female Terminal
Sacrifice
No abnormalities
Detected
2 Pandanus
odoratissimus
I 2000
M7 Female
Terminal
Sacrifice No abnormalities
Detected
M8 Female Terminal
Sacrifice
No abnormalities
Detected
M9 Female Terminal
Sacrifice
No abnormalities
Detected
II 2000
M10 Female Terminal
Sacrifice
No abnormalities
Detected
M11 Female Terminal
Sacrifice
No abnormalities
Detected
M12 Female Terminal
Sacrifice
No abnormalities
Detected
mg/kg = miligram/kilogram bw = body weight
Results and Analysis
95
ANTIPYRETIC STUDIES
The experimental rats showed a marked increase in rectal temperature 18 h after the Brewer’s
yeast injection. In the study it is observed that methonolic of Bambusa vulgaris exerted their
antipyretic effect with varied efficacy. Bambusa vulgaris at 1000 mg/ kg b wt. exhibited
significant antipyretic activity (Table no 10 and Fig 11). Both the test doses of Bambusa vulgaris
caused reduction in temperature from 2 h onwards and by the end of 5th
hour temperatures of
both the groups brought down to normal. In case of Paracetamol treated group, significant
decrease towards normal in body temperature was observed from the 1 h onwards and normal
body temperature was maintained then on. Where as in pyrexia control group, the elevated body
temperature maintained throughout the study with marginal reduction at the end of the study.
Results and Analysis
96
Table 10: Anti pyretic effect of Methanol extract of Bambusa vulgaris on Brewer’s yeast-induced pyrexia in rats
Values are mean ± S.E.M. n= 6 animals in each group. values are significantly different from paracetamol intoxicated group.
ns; p*<0.05; p
**<0.01; p
***<0.001. (ANOVA, followed by Dunnett’s test). a: temperature just before yeast injection; b:
temperature just before drug administration; MEBV: Methanol extract of Bambusa vulgaris
Groups Treatment Dose
Rectal temperature 0c at time (hr)
-18a 0
b 1 2 3 4 5 6
Group I
2% w/v
acacia
5
ml/kg
37.07 ±
0.05
38.27 ±
0.12
38.22 ±
0.07
38.08 ±
0.06
38.02 ±
0.04
38.05 ±
0.02
38.03 ±
0.03
38.02 ±
0.07
Group II
Methanol
extract
500
mg/kg
37.07 ±
0.04
38.20 ±
0.08ns
38.35 ±
0.07ns
38.0 ±
0.04ns
37.80 ±
0.04*
37.82 ±
0.03***
37.38 ±
0.04***
37.18 ±
0.04***
Group III
Methanol
extract
1000
mg/kg
37.15 ±
0.05
38.40 ±
0.09ns
38.35 ±
0.06ns
37.82 ±
0.03**
37.47 ±
0.03***
37.30 ±
0.03***
37.13 ±
0.04***
37.12 ±
0.03***
Group IV Paracetamol 150
mg/kg
37.15 ±
0.06
38.32 ±
0.04ns
37.92 ±
0.01*
37.87 ±
0.02**
37.45 ±
0.03***
37.30 ±
0.02***
37.22 ±
0.03***
37.05 ±
0.02***
Results and Analysis
97
Fig 11: Anti pyretic effect of Methanol extract of Bambusa vulgaris on Brewer’s yeast induced pyrexia in rats
Results and Analysis
98
VENOM NEUTRALIZING ACTIVITY
From the studies, LD50 of snake venom was established at 60 µg/mouse (20 g body weight) i.p.
For the determination of venom neutralizing effect of extracts LD50 was employed as lethal test
dose. Whereas based on the observations from acute toxicity studies, test doses 1000, 750, 500
and 250 mg/ kg b. wt of methanolic extract of Pandanus odoratissimus were selected and studied
for their venom neutralizing potency. The methanolic extract exhibited venom neutralizing effect
in dose-dependant manner (Table 11). The methanolic extract exhibited significant venom
antagonistic effect at the higher test dose i.e at 1000 mg/kg b. wt. by exhibiting the percent
increase in survival rate by 75 % (Figure 12). Whereas, at 750 mg/ kg b. wt dose it showed
moderate activity with 25 % increase in survival of animals. At the lower doses, methanolic
extract failed to offer protection to the animals. Treatment with standard snake venom antiserum
has protected all the animals from the lethal effects of venom
Results and Analysis
99
Table 11: Effect of the methanol extract of Pandanus odoratissimusi on the lethality of
snake venom.
Sl.
No
Groups
(n=8)
Treatment % Survival
% Increase
in survival
rate
1 I Normal control 100.00 -
2 II Venom control 50.00 -
3 III
Postive control
(Snake venom antiserum)
100.00 100.00
4 IV
Methanolic extract
(250 mg/kg b.wt)
50.00 0.00
5 V
Methanolic extract
(500 mg/kg b. wt)
50.00 0.00
6 VI
Methanolic extract
(750 mg/kg b. wt)
62.50 25.00
7 VII
Methanolic extract
(1000 mg/kg b. wt)
87.50 75.00
Results and Analysis
100
Fig 12: Effect of the methanol extract of Pandanus odoratissimusi on the lethality of snake
venom.
Results and Analysis
101
ANTI-DIABETIC STUDIES
Different extracts of Bambusa vulgaris and Pandanus odoratissimus were investigated for their
glucose uptake enhancing properties in vitro in L-6 cell line. Methanolic extracts of both the plants
enhanced the glucose uptake in L-6 cells over control. Among the extracts, methanolic extracts of
Bambusa vulgaris and Pandanus odoratissimus exhibited better glucose uptake enhancement
properties with 13.50 ± 3.10 and 28.99 ± 3.56 percent over control (Table 13, fig.13 and 14).
Standard drugs, Insulin and Metformin enhanced the glucose uptake significantly. Glucose
uptake studies in isolated rat hemi diaphragm also revealed the similar results. Methanolic
extracts of Bambusa vulgaris and Pandanus odoratissimus enhanced the glucose uptake by 11.25
± 1.35 and 19.86 ± 1.86 percent over control (Table 14, fig. 15 and 16). Whereas, other extracts
enhanced glucose uptake moderately with values ranging between 5.45 to 9.80 percent over
control.
In vivo studies with methanolic extracts of Bambusa vulgaris and Pandanus odoratissimus against
Streptozotocin (STZ) induced diabetic rat model. It was observed that, in STZ-induced diabetic rats
a significant decrease in body weight gain when compared to controls. However, diabetic rats
treated with Bambusa vulgaris and Pandanus odoratissimus showed augmented body weight
when compared with STZ alone treated rats (Table 15). The blood glucose increased in STZ-
diabetic rats as compared to normal rats (fig.17). However, treatment of STZ-diabetic rats with
Pandanus odoratissimus significantly reduced the hyperglycemia when compared with STZ alone
treated rats (Table 15, fig.18). Whereas, Bambusa vulgaris was found to be moderately active at
its higher test dose i.e 1000 mg/ kg. HbAIC levels were higher in the STZ-induced diabetic rats
compared to the control rats (fig.19). The supplementation of 1000 mg/kg of Pandanus
Results and Analysis
102
odoratissimus decreased the HbAIC level of the STZ induced diabetic rats. In STZ-diabetic rats
the activities of serum CK and LDH were significantly increased (p < 0.05). The administration
of 1000mg/kg dose of Pandanus odoratissimus to STZ-diabetics rats decreased the activity of
LDH significantly, when compared other test groups (fig.21). However, the serum CK did not
return to the basal level compared to STZ controls (Table 15).
STZ treatment elevated the levels of serum cholesterol, triglycerides, LDL, creatinine, urea, and
ALP. It was observed that the treatment with Pandanus odoratissimus had brought down the test
parameters towards normal levels in dose dependant manner. Whereas, Bambusa vulgaris failed
to bring down these parameters towards normal (Table 16, fig.22-28). HDL levels were poorly
elevated by Pandanus odoratissimus and Bambusa vulgaris treatment, when compared to STZ
treated control group.
Based on these in vivo results, methanolic extract of Pandanus odoratissimus was processed
further to identify the phytoconstituents present in it. Fractions from the methanolic extract of
Pandanus odoratissimus were further studied in vitro to determine their glucose uptake enhancement
properties. It was observed that, methanol (100%) fraction exhibited significant enhancement in
glucose uptake in L-6 cells with 38.55 ± 4.32 percent over control (Table 17 and Fig 30). Other
fractions, Chloroform:Methanol (50:50) and Chloroform:Methanol (30:70) also enhanced the glucose
uptake by 23.44 ± 2.49 and 24.84 ± 2.95 percent over control.
Results and Analysis
103
Table no 12: Cytotoxic study of Bambusa vulgaris leaf extracts against L6 cell line by
MTT assay
Sl. No Plant
Name of
Extract
CTC50
( µg/ml)
1
Bambusa vulgaris
Hexane >1000
2 Benzene >1000
3 Ethyl acetate 493.16 ± 18.46
4 Chloroform 513.00 ± 16.85
5 Methanol 456.00 ± 10.56
6
Pandanus
odoratissimus
Hexane >1000
7 Benzene 856.75 ± 24.50
8 Ethyl acetate 786.00 ± 19.00
9 Chloroform 650.50 ± 23.50
10 Methanol 510.75 ± 17.00
Results and Analysis
104
Table 13: In vitro glucose uptake studies in L-6 cell line
Sl.No Name of the extract
Test concentration
(µg/ml)
% glucose uptake
over control
Bambusa vulgaris extracts
1. Hexane 200 3.97 ± 1.03
2. Benzene 200 8.45 ± 1.35
3. Ethyl acetate 200 5.50 ± 0.75
4. Chloroform 200 7.56 ± 2.35
5. Methanol 200 13.50 ± 3.10
Pandanus odoratissimusi extracts
6. Hexane 200 8.57 ± 2.65
7. Benzene 200 7.30 ± 1.85
8. Ethyl acetate 200 8.45 ± 2.54
9. Chloroform 200 11.00 ± 3.76
10. Methanol 200 28.99 ± 3.56
Standard drugs
11. Insulin 1 IU/ml 131.50 ± 17.62
12. Metformin 100 68.35 ± 11.45
Results and Analysis
105
Fig 13: In vitro glucose uptake effect of extracts of Bambusa vulgaris in L-6 cell line
Fig 14: In vitro glucose uptake effect of extracts of Pandanus odoratissimusi in L-6 cell line
Results and Analysis
106
Table 14: In situ glucose uptake studies in rat hemi diaphragm
Sl.No Name of the extract
Test concentration
(µg/ml)
% glucose uptake
over control ± SE
Bambusa vulgaris extracts
1. Hexane 200 6.59 ± 0.35
2. Benzene 200 7.95 ± 1.10
3. Ethyl acetate 200 5.75 ± 0.64
4. Chloroform 200 9.10 ± 1.56
5. Methanol 200 11.25 ± 1.35
Pandanus odoratissimusi extracts
6. Hexane 200 5.45 ± 0.95
7. Benzene 200 7.95 ± 2.10
8. Ethyl acetate 200 7.56 ± 1.85
9. Chloroform 200 9.80 ± 2.36
10. Methanol 200 19.86 ± 1.86
Standard drugs
11. Insulin 1 IU/ml 23.45 ± 4.13
Results and Analysis
107
Fig 15: Glucose uptake effect of extracts of Bambusa vulgaris in rat hemi diaphragm
Fig 16: Glucose uptake effect of extracts of Pandanus odoratissimusi in rat hemi
diaphragm
Results and Analysis
108
Table 15: In vivo antidiabetic activity of methanolic extracts of Bambusa vulgaris leaf and Pandanus odoratissimus root.
Group Treatment Body weight
(g)
Blood glucose
(mg/dl ) HbA1C (%) CK (IU/L) LDH (IU/L)
Group 1 Control 284.67 ± 12.45 115.00 ± 4.78 1.43 ± 0.16 204.48 ± 18.15 91.17 ± 5.47
Group 2 STZ treated
control 155.50 ± 16.00
a 351.17 ± 5.71
a 4.29 ± 0.84
a 284.57 ± 74.23
a 161.67 ± 16.42
a
Group 3 STZ + BV
(500 mg/kg)
157.33 ± 6.68 304.83 ± 21.41 b 4.27 ± 0.54 272.28 ± 50.27 129.42 ± 13.27
b
Group 4 STZ + BV
(1000 mg/kg)
189.17 ± 8.93b
179.00 ± 8.03 b
3.68 ± 0.58 271.90 ± 28.07 127.28 ± 13.72 b
Group 5 STZ + PO
(500 mg/kg)
220.00 ± 10.51b 191.00 ± 6.13
b 3.03 ± 0.29
b 275.11 ± 30.62 115.1 ± 27.04
b
Group 6 STZ + PO
(1000 mg/kg)
244.50 ± 11.79 b 146.5 ± 10.08
b 2.59 ± 0.67
b 239.17 ± 23.86 101.84 ± 21.3
b
Group 7 STZ + GLI
(25 mg/kg)
240.5 ± 14.52 b
146.50 ± 12.08 b 2.91 ± 0.69
b 262.35 ± 41.58 131.10 ± 25.90
BV: Bambusa vulgaris, PO: Pandanus odoratissimus
p values <0.05, a - when compared with a normal control; b – when compared with STZ treated
Results and Analysis
109
Fig 17: Effect of methanolic extracts on body weight in diabetic rats
Fig 18: Effect of methanolic extracts on blood glucose levels in diabetic rats
Results and Analysis
110
Fig 19: Effect of methanolic extracts on serum HbA1c levels in diabetic rats
Fig 20: Effect of methanolic extracts on serum CK levels in diabetic rats
Results and Analysis
111
Fig 21: Effect of methanolic extracts on serum LDH levels in diabetic rats
Results and Analysis
112
Table 16: Effect of Bambusa vulgaris leaf and Pandanus odoratissimus root on STZ induced changes on the serum biochemical
parameters
Treatment Cholestrol TG HDL LDL Creatineine Urea ALP
Group 1 Control 152.5 ± 3.0 82 ± 3.4 37 ± 1.7 94.3 ± 3.0 0.49 ± 0.02 23.0 ± 2.1 115.6 ± 3.3
Group 2 STZ treated
control 269.5 ± 3.7
a 191.8 ± 4.9
a 30 ± 2.6
a 187 ± 7.0
1.40 ± 0.04
a 59.3 ± 4.8
a 317.1 ± 6.1
a
Group 3 STZ + BV
(500 mg/kg) 214.6 ± 17
b 184.1 ± 8.8 30 ± 1.5 161.8 ± 5 1.14 ± 0.11
b 46.8 ± 3.1
b 270.5 ± 14
b
Group 4 STZ + BV
(1000 mg/kg) 203.0 ± 7.8
b 177 ± 11 27.3 ± 2.1 154.8 ± 5 1.12 ± 0.11
b 39 ± 4.2
b 224.8 ± 8
b
Group 5 STZ + PO
(500 mg/kg) 169 ± 16.2 138.50 ± 1
b 30.50 ± 1.8 131.6 ± 8
b 0.74 ± 0.11
b 31.0 ± 1
b 202.8 ± 21
Group 6 STZ + PO
(1000 mg/kg) 171.3 ± 10 135.17 ± 9
b 29.50 ± 1.7 114 ± 8
b 0.69 ± 0.07
b 33.6 ± 3
b 170.5 ± 15
Group 7 STZ + Gli (25
mg/kg) 158.0 ± 7.1
b 172.1 ± 11
b 50.3 ± 2.3
b 78.1 ± 6
0.60 ± 0.05
b 34.2 ± 2.4
b 126.8 ± 4.3
b
BV: Bambusa vulgaris, PO: Pandanus odoratissimus
p values <0.05, a - when compared with a normal control; b – when compared with STZ treated
Results and Analysis
113
Fig 22: Effect of extracts on serum cholesterol levels in diabetic rats.
Fig 23: Effect of extracts on serum triglycerides levels in diabetic rats
Results and Analysis
114
Fig 24: Effect of extracts on serum HDL levels in diabetic rats
Fig 25: Effect of extracts on serum LDL levels in diabetic rats
Results and Analysis
115
Fig 26: Effect of extracts on serum creatinine levels in diabetic rats
Fig 27: Effect of extracts on urea levels in diabetic rats
Results and Analysis
116
Fig 28: Effect of extracts on serum Alkaline phosphotase levels in diabetic rats
Results and Analysis
117
Table no 17: In vitro glucose uptake activities of fractions from methanolic extract of
Pandanus odoratissimus root against L6 cell line
Sl.No Fraction name CTC50 in µg/ml
Test
concentration
(µg/ml)
% glucose
uptake over
control
1 Chloroform (100%) 712.65 ± 23.50 200 10.76 ± 1.45
2 Chloroform: Methanol:
(70:30)
678.15 ± 12.56 200 9.04 ± 0.75
3 Chloroform: Methanol:
(50:50)
524.50 ± 8.50 200 23.44 ± 2.49
4 Chloroform: Methanol:
(30:70)
576.00 ± 14.50 200 24.84 ± 2.95
5 Methanol (100%) 459.00 ± 11.50
200 38.85 ± 4.32
6 Insulin - 1 IU/ml 98.76 ± 11.30
Fig.29: Histopathology
Results and Analysis
118
Fig 30: In vitro glucose uptake effect of fractions from methanolic extract of
Pandanus odoratissimus in L-6 cell line
Discussion
119
CHAPTER-6
DISCUSSION
After decades of serious obsession with the modern medicinal system, people have started
looking at the ancient healing systems; however a key obstacle, which has hindered the
acceptance of the alternative medicines in the developed countries, is the lack of documentation
and stringent quality control. There is a need for documentation of research work carried out on
traditional medicines 69
. With this backdrop, it becomes extremely important to make an effort
towards standardization of the plant material to be used as medicine. The process of
standardization can be achieved by stepwise pharmacognostic studies 70
.These studies help in
identification and authentication of the plant material. Correct identification and quality
assurance of the starting materials is an essential prerequisite to ensure reproducible quality of
herbal medicine which will contribute to its safety and efficacy. Simple pharmacognostic
techniques used in standardization of plant material include its morphological, anatomical and
biochemical characteristics 71
.
Two traditional medicinal plants Bambusa vulgaris and Pandanus odoratissimus were selected
based on their traditional use in treating different ailments. Bambusa vulgaris has been
mentioned as feberifuge and its effectiveness against jaundice, measules etc. Particullarly in
India, it has been used in treating wounds, inflammations etc. Pandanus odoratissimus was
mentioned for its traditional uses in treating snakebite, skin disorders, lepracy, urinary disorders
jaundice etc. Pandanus odoratissimus was reported to have potent antioxidant properties.
With an objective to evaluate and confirm the biological efficacy, leaves of Bambusa vulgaris
and root of Pandanus odoratissimus were selected and different extracts were prepared, studied
Discussion
120
for their biological activities. Based on the traditional claims, initially Bambusa vulgaris was
tested for its antipyretic activity against brewer yeast induced pyrexia. Methanolic extract of
Bambusa vulgaris exhibited significant antipyretic activity. It has reduced the body temperature
from 2 h onwards and by 5 h the body temperature was normal.
Methanolic extract of Pandanus odoratissimus was tested for venom neutralizing potential
against snake venom. It was observed that at 750 mg/kg dose, the extract offered 75 percent
protection against lethal effect of snake venom. These observations confirmed the earlier
traditional claims on Pandanus odoratissimus as an anti-dote. The methanolic extract of
Pandanus odoratissimus exhibited dose dependant effect in protecting the animal from the lethal
effects of venom.
In anti-diabetic studies, different extracts of Bambusa vulgaris and Pandanus odoratissimus were
initially screened for their glucose uptake activity in L-6 cells. Methanolic extracts from both the
plants exhibited higher glucose uptake with 13.50 ± 3.10 and 28.99 ± 3.56 percent over control.
Other extracts from both the plants exhibited moderate to poor efficacy. Even the phytochemical
analysis revealed that the methanloic extracts are rich with active phytoconstituents and the
results confirms the same. Based on these in vitro results the methanolic extracts of Bambusa
vulgaris and Pandanus odoratissimus were studied for their antidiabetic activity in STZ induced
diabetic rat models. Both the extracts exhibited dose dependant activity and Pandanus
odoratissimus was found to be potent among the two plants. Pandanus odoratissimus at
1000mg/kg dose has regulated the diabetic parameters like, body weight of diabetic rats, blood
glucose, HbA1c and LDH. Even the biochemical analysis on lipid profile of diabetic rats
Discussion
121
revealed that Pandanus odoratissimus at 1000mg/kg dose restored all the parameters towards
normal.
From the pharmacological studies it was understood that the methanolic extracts of Bambusa
vulgaris and Pandanus odoratissimus were active. Both of these extracts were further processed
to identify the active principles responsible for their activity. Suitable techniques like
fractionization, column chromatography and analytical techniques were employed to isolate and
identify the phytoconstituents responsible for the activities.
From Bambusa vulgaris we were able to isolate the pure compound Palmitic acid. Simulatiously,
methanolic extract of Pandanus odoratissimus was further fractionated and glucose uptake
potential of those fractions were evaluated. Among the fractions, methanolic fraction (100%)
was found to have better glucose uptake potential with 38.85 ± 4.32 percent over control.
Further, methanolic fraction (100%) was processed through column chromatography to isolate
pure compound Heptadecanoic acid ethyl ester.
Present study revealed the pharmacological properties of both the plants. The method for
selection of plants based on traditional usage is once again proved to be beneficial in selection of
medicinal plants for pharmacological evaluation. From the present studies it has been understood
that Bambusa vulgaris has got potent antipyretic properties and phytochemical analaysis
followed by isolation led to the isolation of a compound Palmitic acid. Methanolic extract of
Pandanus odoratissimus exhibited potent venom neutralizing and anti-diabetic properties. As
discussed earlier, Pandanus odoratissimus is mentioned as anti-dote and present study confirms
Discussion
122
the same and it is a good finding from the present study. These results will help in developing a
product for treating the lethal effects of venom. Same time, Pandanus odoratissimus exhibited
potent anti-diabetic properties. So, further studies and phytochemical investigations are required
to understand any other phytochemical behind these biological activities.
Summary and Conclusion
123
CHAPTER-7
SUMMARY AND CONCLUSION
Despite the recent interest in molecular modeling, combinatorial chemistry, and other synthetic
chemistry techniques by pharmaceutical companies and funding organizations, natural products,
particularly medicinal plants, remains an important source of new drugs, new drug leads, and
new chemical entities. It is evident that, natural products have played a vital role in drug
discovery, by contributing a wide variety of phytochemicals for the treatment of cancer,
cardiovascular diseases, infections related with viral and microbial origin and other health
disorders.
After collection and authentication of the plant material, the plant materials were analysed for
pharmacognostic and physiochemical parameters. Both Bambusa vulgaris leaf and Pandanus
odoratissimus root material were studied for extractive value and found to be nearly equal. The
alcohol soluble extractives for Bambusa vulgaris leaf and Pandanus odoratissimus root found to
be 8 and 10 % respectively. Similarly the water soluble extractives found to be 11.1 and 12 %
respectively.
For phytochemical study the dry leaf powder of Bambusa vulgaris and root powder of Pandanus
odoratissimus extracted with different solvents was dried under reduced pressure and the average
extractive value was found to be 1.4% (hexane), 0.6% (benzene), 3% (chloroform), 1.4% (ethyl
acetate) and 6 % (methanol) for Bambusa vulgaris and 2 % (hexane), 1.8% (benzene), 3.5% (
chloroform), 2 % (ethyl acetate) and 8 % (methanol) for Pandanus odoratissimus.
Summary and Conclusion
124
The qualitative chemical tests were performed on the both plant extracts to detect the various
phyto- constituents present in them as per the standard procedures and findings were recorded.
The qualitative chemical tests on the methanolic extract of Bambusa vulgaris Schrad leaves
revealed the presence of carbohydrates, glycosides, saponins, alkaloids, flavonoids, phenolics
and tannins, phytosterols and triterpenoids, fixed oils and fats, where as remaining extracts
showed the presence for Phytosterols and Triterpenoids, methanol and chloroform extracts
showed the presence for carbohydrates.
Similar results were observed for the methanolic extract of Pandanus odoratissimus showed the
presence of carbohydrates, saponins, alkaloids, phenolics and tannins, phytosterols and
triterpenoids in methanolic extract. Whereas remaining extracts showed the presence for
phytosterols and triterpenoids, only methanol and chloroform extracts showed the presence for
carbohydrates.
The methanolic extract from the both the plants were selected for in vivo studies for antipyretic,
anti-venom and antidiabetic activities. Prior to in vivo studies, acute toxicity studies were
performed in rats and mice as per standard protocol. In acute toxicity studies, all animals were
survived in step I and step II until the end of the experimental period. All the animals dosed at
2000 mg/kg body weight did not show evident toxicity throughout the experimental period
(Table 7 and 9). The animals which were survived throughout the experiment increased their
body weight by day 14 as compared to day 0 (Table 7 and 9). No abnormalities were detected for
all the animals at necropsy. Based on the results, the median lethal doses (LD50) of Bambusa
Summary and Conclusion
125
vulgaris and Pandanus odoratissimus were greater than 2000mg/kg body weight and are
classified as category 4.
The methanolic extract of Bambusa vulgaris was studied for its antipyretic properties. The
experimental rats showed a marked increase in rectal temperature 18 h after the Brewer’s yeast
injection. In the study it is observed that methonolic of Bambusa vulgaris exerted their
antipyretic effect with varied efficacy. Bambusa vulgaris at 1000 mg/ kg b wt. exhibited
significant antipyretic activity (Table no 10 and Fig.11). Both the test doses of Bambusa vulgaris
caused reduction in temperature from 2 h onwards and by the end of 5th
hour temperatures of
both the groups brought down to normal.
The methanolic extract of Pandanus odoratissimus was studied for its venom neutralizing
potential. Test doses 1000, 750, 500 and 250 mg/ kg b. wt of methanolic extract of Pandanus
odoratissimus were selected and studied for their venom neutralizing potency. The methanolic
extract exhibited venom neutralizing effect in dose-dependant manner (Table 11). The
methanolic extract exhibited significant venom antagonistic effect at the higher test dose i.e at
1000 mg/kg b. wt. by exhibiting the percent increase in survival rate by 75 %. Whereas, at 750
mg/ kg b. wt dose it showed moderate activity with 25 % increase in survival of animals. At the
lower doses, methanolic extract failed to offer protection to the animals. Treatment with standard
snake venom antiserum has protected all the animals from the lethal effects of venom.
In anti-diabetic studies, different extracts of Bambusa vulgaris and Pandanus odoratissimus were
investigated for their glucose uptake enhancing properties in vitro in L-6 cell line. Methanolic
Summary and Conclusion
126
extracts of both the plants enhanced the glucose uptake in L-6 cells over control. Among the extracts,
methanolic extracts of Bambusa vulgaris and Pandanus odoratissimus exhibited better glucose
uptake enhancement properties with 13.50 ± 3.10 and 28.99 ± 3.56 percent over control. Glucose
uptake studies in isolated rat hemi diaphragm also revealed the similar results. Methanolic
extracts of Bambusa vulgaris and Pandanus odoratissimus enhanced the glucose uptake by 11.25
± 1.35 and 19.86 ± 1.86 percent over control.
In vivo studies with methanolic extracts of Bambusa vulgaris and Pandanus odoratissimus against
Streptozotocin (STZ) induced diabetic rat model. Diabetic rats treated with Bambusa vulgaris and
Pandanus odoratissimus showed augmented body weight when compared with STZ alone treated
rats. The blood glucose increased in STZ-diabetic rats as compared to normal rats. However,
treatment of STZ-diabetic rats with Pandanus odoratissimus significantly reduced the
hyperglycemia when compared with STZ alone treated rats. Whereas, Bambusa vulgaris was
found to be moderately active at its higher test dose i.e 1000 mg/ kg. HbAIC levels were higher
in the STZ-induced diabetic rats compared to the control rats. The supplementation of 1000
mg/kg of Pandanus odoratissimus decreased the HbAIC level of the STZ induced diabetic rats. In
STZ-diabetic rats the activities of serum CK and LDH were significantly increased (p < 0.05).
The administration of 1000mg/kg dose of Pandanus odoratissimus to STZ-diabetics rats
decreased the activity of LDH significantly, when compared other test groups. However, the
serum CK did not return to the basal level compared to STZ controls.
STZ treatment elevated the levels of serum cholesterol, triglycerides, LDL, creatinine, urea, and
ALP. It was observed that the treatment with Pandanus odoratissimus had brought down the test
Summary and Conclusion
127
parameters towards normal levels in dose dependant manner. Whereas, Bambusa vulgaris failed
to bring down these parameters towards normal. HDL levels were poorly elevated by Pandanus
odoratissimus and Bambusa vulgaris treatment, when compared to STZ treated control group.
Based on these in vivo results, methanolic extract of Pandanus odoratissimus was processed
further to identify the phytoconstituents present in it. Fractions from the methanolic extract of
Pandanus odoratissimus were further studied in vitro to determine their glucose uptake enhancement
properties. It was observed that, methanol (100%) fraction exhibited significant enhancement in
glucose uptake in L-6 cells with 38.55 ± 4.32 percent over control (Table 17 and Fig 30). Other
fractions, Chloroform:Methanol (50:50) and Chloroform:Methanol (30:70) also enhanced the glucose
uptake by 23.44 ± 2.49 and 24.84 ± 2.95 percent over control.
Based on the pharmacological reports, methanolic extracts of Pandanus odoratissimus and
Bambusa vulgaris were further processed for the isolation of active phytoconstituents. We were
successful in isolating Palmitic acid and Heptadecanoic acid ethyl ester from Bambusa vulgaris
and Pandanus odoratissimus, respectively.
In conclusion, methanolic extracts of Pandanus odoratissimus and Bambusa vulgaris were
evaluated for different biological activities. Methanolic extract of Bambusa vulgaris was found
to have significant antipyretic properties. Whereas, Pandanus odoratissimus exhibited potent
venom neutralizing and antidiabetic properties. Its venom neutralizing activity confirms its
traditional claim as an anti-dote. Whereas, its anti-diabetic activity was observed for the first time
and good finding of present study.
Bibliography
CHAPTER-8
BIBLIOGRAPHY
1. Solecki R. Shanidar IV. A Neanderthal flower burial in northern Iraq.
Science.1975; 190:880–881.
2. Farnsworth NR, Akerele O, Bingel AS, Soejarto DD, Guo Z. Medicinal plants in
therapy. Bullutein W H O.1985; 63:965–981.
3. Cronquist A. An Integrated System of Classification of Flowering Plants. New
York: Columbia University Press; 1981.
4. Jones WP, Chin YW, Kinghorn AD. The role of pharmacognosy in modern
medicine and pharmacy. Current Drug Targets. 2006; 7:247-264.
5. Drahl C, Cravatt BF, Sorensen EJ. Protein-reactive natural products.
Angewandte Chemie International Edition. 2005; 44:5788-5809.
6. Verpoorte R. Pharmacognosy in the new millennium. Lead finding and
biotechnology. Journal of Pharmacy and Pharmacology. 2000; 52:253–262.
7. Vagelos PR. Are prescription drug prices high? Science. 1991; (252):1080–
1084.
8. Newman DJ, Cragg GM, Snader KM. The influence of natural products upon
drug discovery. Natural Product Reports. 2000; (17):215–234.
9. Newman DJ, Cragg GM, Snader KM. The influence of natural products upon
drug discovery. Natural Product Reports. 2000 ;( 17):215-234.
10. Koehn FE, Carter GT. The evolving role of natural products in drug
discovery. Nature Reviews Drug Discovery. 2005; 4:206-220.
Bibliography
11. Balunas MJ, Kinghorn AD. Drug discovery from medicinal plants. Life
Science. 2005; 78:431-441.
12. Drahl C, Cravatt BF, Sorensen EJ. Protein-reactive natural products.
Angewandte Chemie International Edition. 2005; 44:5788-5809.
13. Newman DJ, Cragg GM, Snader KM. Natural products as sources of new drugs
over the period. Journal of Natural Products. 1981-2002, 2003; (66):1022-1037.
14. Newman DJ, Cragg GM, Snader KM. Natural products as sources of new drugs
over the period. Journal of Natural Products. 1981-2002, 2003; (66):1022-1037.
15. Grifo F, Newman D, Fairfield A, Bhattacharya B, Grupenhoff J. The origins of
prescription drugs. In Grifo F, Rosenthal J, eds. Biodiversity and Human Health.
Washington, DC Island Press; 1997.
16. Butler MS. The role of natural product chemistry in drug discovery. Journal of
Natural Products. 2004; 67:2141-2153.
17. Thayer A. Bristol-Myers to settle suits. Chemical and Engineering News. 2003;
81:6.
18. Oberlies NH, Kroll DJ. Camptothecin and taxol: historic achievements in natural
products research. Journal of Natural Products. 2004; 67:129-135.
19. Butler MS. Natural products to drugs: natural products derived compounds in
clinical trials. Natural Products Reports. 2005; 22:62-195.
20. Newman, D. J.; Cragg, G. M.; Snader, K. M. Natural Products Reports. 2000; 17:
215-234.
21. Dewick PM. Medicinal Natural Products: A Biosynthetic Approach. Chichester
UK: 2nd
ed. John Wiley & Sons; 2002.
Bibliography
22. Fabricant DS, Farnsworth NR. The Value of Plants Used in Traditional Medicine
for Drug Discovery. Environmental Health Perspectives .2001; 109(1):69-75.
23. Kinghorn AD. The discovery of drugs from higher plants. Biotechnology 1994;
(26):81–108.
24. Soejarto, D. D.; Farnsworth, N. R. Perspectives in Biology and Medicine. 1989;
32:244-256.
25. Balandrin MF, Kinghorn AD, Farnsworth NR. In Human Medicinal Agents from
Plants; Kinghorn AD, Balandrin MF, Eds.; American Chemical Society:
Washington; 2003.
26. Newman DJ, Cragg GM, Snader KM. Natural products as sources of new drugs
over the period. Journal of Natural Products. 1981-2002, 2003; (66):1022-1037.
27. Butler MS. Natural products to drugs: natural products derived compounds in
clinical trials. Natural Product Reports. 2005; 22:62-195.
28. Cirla A, Mann J, Combrestatins. From natural products to drug discovery.
Natural Product Reports. 2003; 20:558-564.
29. Pinney KG, Jelinek C, Edvardsen K, Chaplin DJ, Pettit GR. The discovery and
development of the combrestatins. In: Cragg GM, Kingston DGI, Newman DJ,
eds. Anticancer Agents from Natural Products. Boca Raton. FL: CRC Press.
2005; 23-46.
30. West CML, Price P. Combrestatin A4 phosphate. Anticancer Drugs. 2004;
15:179-187.
31. Young SL, Chaplin DJ. Combrestatin A4 phosphate: background and current
clinical status. Expert Opinion on Investigational Drugs. 2004; 13:1171-1182.
Bibliography
32. Powell RG, Weisleder D, Smith CR, Rohwedder WK. Structuresof harringtonine,
isoharringtonine and homoharringtonine. Tetrahedron Letters. 1970; 11:815-818.
33. Kantarjian HM, Talpaz M, Santini V, Murgo A, Cheson B, O’Brian SM. Homoh
arringtonine: history, current research, and future direction. Cancer. 2001;
92:1591-1603.
34. Kedei N, Lundberg DJ, Toth A, Welburn P, Garfield SH, Blumberg PM. Characte
rization of the interaction of ingenol 3-angelate with protein kinase C. Cancer
Research. 2004; (64):3243-3255.
35. Ogbourne SM, Suhrbier A, Jones B. Antitumor activity of ingenol 3-angelate:
plasma membrane and mitochondrial disruption and necrotic cell death. Cancer
Research. 2004; (64):2833-2839.
36. Kamsteeg M, Rutherford T, Sapi E, et al. Phenoxodiol - an isoflavone analog -
induces apoptosis in chemoresitant ovarian cancer cells. Oncogene. 2003;
(22):2611-2620.
37. Constantinou AI, Mehta R, Husband A. Phenoxodiol, a novel isoflavone
derivative, inhibits dimethylbenz[a]anthracene (DMBA)-induced mammary
carcinogenesis in female Sprague-Dawley rats. European Journal of Cancer.
2003; (39):1012-1018.
38. Shibata S, Tanaka O, Sado M, Tsushima S. The genuine sapogenin of
ginseng. Tetrahedron Letters. 1963; (4):795-800.
39. Jia W, Yan H, Bu X, Liu G, Zhao Y. Aglycone protopanaxadiol, a ginseng
saponin, inhibits P-glycoprotein and sensitizes chemotherapy drugs on multidrug
resistant cancer cells. Journal of Clinical Oncology, 2004; (22):9663.
Bibliography
40. Kiviharju TM, Lecane PS, Sellers RG, Peehl DM. Antiproliferative and
proapoptotic of triptolide (PG490), a natural product entering clinical trials, on
primary cultures of human prostatic epithelial cells. clinical cancer
research. 2002; (8):2666-2674.
41. Fidler JM, Li K, Chung C, et al. PG490-88, a derivative of triptolide, causes
tumor regression and sensitizes tumors to chemotherapy. Molecular Cancer
Therapeutics. 2003; (2):855-862.
42. Kumar U, Asija MJ. Biodiversity Priniciples and Conservation. Geobios (India),
Jodhpur; 2000.
43. Parrota JA. Healing Plants of Peninsular India. CABI, New York; 2001.
44. Jain SK. Dictionary of Indian Folk Medicine and Ethnobotany. Deep
Publications, New Delhi; 1991.
45. Owolabi J, Omogbai EKI, Obasuyi O. Antifungal and antibacterial activities of
the ethanolic and aqueous extract of Kigelia africana (Bignoniaceae) stem bark.
African Journal of Biotechnology. 2000; 6 (14): 882-85.
46. Jain SK.Medicinal Plants. National Book Trust, India; 1968.
47. UNESCO (1996). Culture and Health, Orientation Texts – World Decade for
Cultural Development 1988 – 1997, Document CLT/DEC/PRO – 1996, Paris,
France, pgs. 129.
48. Lucy H, Edgar JD. Medicinal plants: a reemerging health aid. Electronic Journal
of Biotechnology. 1999; 2 (2): 1-15.
49. Kala CP. Health traditions of Buddhist community and role of Amchis in trans-
Himalayan region of India. Current Science.2005; 89: 1331-1338.
Bibliography
50. UNESCO (1998). FIT/504-RAF-48 Terminal Report: Promotion of Ethnobotany
and the Sustainable Use of Plant Resources in Africa, pgs. 60, Paris, 1998.
51. Cowman MM. Plant products as antimicrobial agents. Clinical Microbiology
Reviews. 1999: 12; 561-582.
52. Adesokan AA, Yakubu MT, Owoyele BV, Akanji MA, Soladoye A, Lawal OK.
Effect of administration of aqueous and ethanolic extracts of Enantia chlorantha
stem bark on brewer’s yeast-induced pyresis in rats. African Journal of
Biochemistry Research. 2008: 2(7); 165-169.
53. Nascimento GGF, Lacatelli J, Freitas PC, Silva GL. Antibacterial activity of
plants extracts and phytochemical on antibioticresistant bacteria. Brazilian Journal
of Microbiology. 2000; 31:886-891.
54. Anon. Ethnobotany and the Search for New Drugs. John Wiley and Sons,
England; 1994.
55. Cox PA, Ballick MJ. The ethnobotanical approach to drug discovery. Scientific
American. 1994; 82–87.
56. Fabricant DS, Farnsworth NR. The value of plants used in Traditional medicine
for Drug Discovery. Environment Health Perspectives.2001; 109: 69–75.
57. Horace Freestone Clay, James C. Hubbard and Rick Golt Tropical Exotics,
University of Hawaii Press; 1987.
58. Kirtikar KR, Basu BD. Indian Medicinal Plant, Vol. 1. Dehradun, India:
International book distributor; 1990.
59. Aman. Medicinal secrets of your food; 1985.
Bibliography
60. Yakubu MT, Bukoye BB. Abortifacient potentials of the aqueous extract of
Bambusa vulgaris leaves in pregnant Dutch rabbits. Contraception. 2009; 80:
308–313.
61. Gill LS. Ethnomedical uses of plants in Nigeria. Benin, Nigeria: Uniben Press;
1992.
62. Carey WM, Mani J, Dasi B, Rao NV, Gottumukkala KM. Antiinflammatory
activity of methanolic extract of Bambusa vulgaris leaves. International Journal of
Green Pharmacy. 2009; 3(3): 234-238.
63. Sharma PV. Dravyaguna Vijnana, Vol-II. Varanasi: Chaukhamba Bharati
Academy; 2001.
64. Jain SK. Dictionary of Indian Folk Medicine and Ethnobotany. Deep Publication,
New Delhi; 1991.
65. Majumdar K, Saha R, Datta BK, Bhakta T. Medicinal plants prescribed by
different tribal and non-tribal medicine men of Tripura state. Indian Jornal of
Traditional Knowledge. 2006; 5(4): 559-562.
66. Stone BC, Dassanayake MD, Fosberg FR. A Revised Handbook to the Flora of
Ceylon. New Delhi: Oxford and IBH Publishing Co; 1981.
67. Irene J. Taafaki, Maira Kabua Fowler, Randolph R. Thaman Traditional Medicine
of the Marshall Islands IPS Publications Suva; 2006.
68. Craig R. Elevitch Traditional Trees of Pacific Islands: Their Culture,
Environment, and Use. Permanent Agriculture Resources Holualoa; 2006.
69. Dahanukar SA, Kulkarni RA, Rege NN. Pharmacology of medicinal plants and
natural products. Indian Journal of Pharmacology. 2000; 32: 81-118.
Bibliography
70. Ozarkar KR. Studies on anti-inflammatory effects of two herbs Cissus
quadrangularis Linn. and Valeriana wallichi DC using mouse model. University
of Mumbai, Mumbai 2005 (unpublished report).
71. Anonymous Macroscopic and microscopic Examination: Quality Control
Methods for Medicinal Plant Materials. WHO Geneva; 1998
72. Shakoor Abdul, Akram Mahmood, Asharaf CM , Siddiqui MR. Pharmagonistic
study and chemical/pharmacological evaluation of Brahmi-buti. Hamdard
Medicus. 1994; 37(3): 92-109.
73. Ashraf CM, Riaz M.Controversies in water Lilies (Nilofar). Hamdard Medicus.
1994.37(1): 109-112.
74. Saeed MA ,Khan ZD. Pharmacognostic studies of indigenous medicinal plants-I:
comparative cytomorphological and irritant studies of some members of family
Asteraceae. Hamdard Medicus. 1996;37(1): 60-67.
75. Margaret Chih-Ying WU. The classification of Bambuseae based on leaf
Anatomy. Botanical Bulletin of Academia Sinica.1962; 3:83-96.
76. Sneha R Chilakwad, Manjunath KP, Kusum S Akki, Savadi R V, Netravati
Deshpande. Pharmacognostic and Phytochemical investigation of leaves of
Pandanus odoratissimus Linn.f. Ancient Science of Life. 2008; 28(2):3-6.
77. Miller LP. Phytochernistry. Van Nostrand Reinhold New York; 1973.
78. Loewus FA, Ryan CA. Recent Advances in Phytochemistry. Plenum Press.
London; 1965-1981.
79. Reinhold L, Harbome JB. Progress in Phytochemistry. Pergarnon Press Oxford;
1977.
Bibliography
80. Harbome. JB. Phytochemical Methods. 2nd
edition. Chapman and Hall. New
York; 1988.
81. Dey PM, Harbome JB. Methods in Plant Biochemistry. Vol 1-111.Academic
Press, London; 1989.
82. Atta-Ur-Rahman. Studies in Natwal Products Chemistry. Vol 1-111.Elsevier,
Amsterdam; 1989.
83. Hill AF. Economic Botany. A textbook of useful plants and plant products. 2nd
edn. McGraw-Hill Book Company Inc, New York; 1952.
84. Harbome. JB. Phytochemical Methods. 2nd
edition. Chapman and Hall. New
York; 1988.
85. Geissman TA, Hinreiner E. Theories of the biogenesis of flavonoid compounds.
Botanical Review. 1952; 18:77-244.
86. Jeffrey B Harborne and Marian Boardley. Trisubstituted Flavonol Glycosides in
Coronilla Emerus Flowers Phytochemistry. 1983; 22(2): 622-625.
87. Mabry TJ, Markham KR, Thomas MB. Systematic Identification of Flavonoids,
Springer-Verlag. Sew York; 1970.
88. Markham KR. Techniques of Flavonoid Identification: Academic Press, London;
1982.
89. Linskens HF, Jackson JF.Modem Methods of Plant Analysis. Vol V. Springer-
Verlag, Berlin; 1987.
90. Musa T Yakubu, Bimbo B. Bukoye. Abortifacient potentials of the aqueous
extract of Bambusa vulgaris leaves in pregnant Dutch rabbits. Contraception
.2009:308–313.
Bibliography
91. Ting-Ting Jong , Shang-Whang Chau. Antioxidative Activities of constituents
Isolated from Pandanus odoratissimus. Phytochemistry. 5 December 1998;
49(7):2145-2148.
92. Vahirua-lechata, Neautb B, Roiga B, Bessierea JM , Lamatya G. Isoprene related
esters, significant components of Pandanus tectorius. Phytochemistry 1996;
43(6):1277-1279.
93. Swaroop S, Grab B. Snakebite mortality in the world: Bulletin of World Health
Organisation. 1954; 10: 35–76.
94. Cannon R, Ruha AM, Kashani J. Acute hypersensitivity reactions associated with
administration of crotalidae polyvalent immune Fab antivenom. Annals of
emergency medicine. 2008; 51(4): 407-411.
95. Alam MI, Auddy B, Gomes A. Isolation, purification and partial characterization
of viper venom inhibiting factor from the root extract of the Indian medicinal
plant sarsaparilla (Hemidesmus indicus R. Br.). Toxicon.1994; 32(12):1551-1557.
96. Alam MI, Auddy B, Gomes A. Isolation, purification and partial characterization
of viper venom inhibiting factor from the root extract of the Indian medicinal
plants Hemidesmus indicus and Pluchea indica root extract. Phytotherapy
Research. 1996; 10: 58-61.
97. Chatterjee I, Chakravarty AK, Gomes A. Antisnake venom activity of ethanolic
seed extract of Strychnos nux vomica Linn. Indian Journal of Experimental
Biology. 2004; 42: 468-475.
Bibliography
98. Alam MI, Gomes A. Snake venom neutralization by Indian medicinal plants
(Vitex negundo & Emblica officinalis Linn.) root extracts. Journal of
Ethnopharmcology. 2003; 86(1): 75-80.
99. Valarmathi R, Rajendran A, Akilandeswari S, Senthamarai R. Study on
Antipyretic Activity of a Mollugo pentaphylla Linn in Albino Mice. International
Journal of Pharm Tech Research; 2 (4):2388-2390.
100. Amit Jaiswal, Niranjan Sutar, Ranju Garai, Manoj Kumar Pati, Abhinav
Kumar.Antipyretic activity of Platycladus orieantalis leaves extract. International
Journal of Applied Biology and Pharmaceutical Technology. 2011; 2(1).
101. Maurya Umashanker and Srivastava Shruti. Traditional Indian Herbal Medicine
used as antipyretic, antiulcer, anti-diabetic and anticancer: A Review.
International Journal for Radiation Physics and Chemistry.2011; 1(4):1152-59.
102. Bolen S, Feldman L, Vassy J, Wilson L, Yeh HC, Marinopoulos S, Wiley C,
Selvin E, Wilson R, Bass EB, Brancati FL: Systematic review: comparative
effectiveness and safety of oral medications for type 2 diabetes mellitus. Annals
of Internal Medicine. 2007; 147:386–399.
103. Welihinda J, Arvidson G, Gylfe E, Hellman B, Karlsson E. The insulin releasing
activity of the tropical plant Mormodica Charantia. Acta Biol Med Germ 1982;
41: 1229-1240.
104. Grover JK, Yadav S, Vats V. Medicinal plants of India with anti-diabetic
potential. Journal of Ethnopharmacology.2002; 81(1):81-100.
Bibliography
105. Fernando MR, Thabrew MI. ,. Karunanayake EH . Hypoglycaemic activity of
some medicinal plants in Sri-Lanka. General Pharmacology: The Vascular
System. 1990; 21(5):779-782.
106. Johnsen DA. Plant Micro technique. Mc Graw Hill Book Co; New York; 1940.
107. O’Brien TP, Feder N, Mc Cull ME. Polychromatic Staining of Plant cell walls
by toluidine blue-O.Protoplasma.1964; 59:364-373.
108. Sass JE. Element of Botanical Micro technique. McGraw Hill Book Co; New
York; 1940.
109. Esau K. Plant Anatomy John Wiley and sons, New York; 1964.
110. Anonymous Indian Pharmacopoeia, Vol. II, 3rd Ed., Controller of Publications,
Govt. Of India, New Delhi; 1985.
111. Indian Pharmacopocia. Govt of India, Ministry of Health of Family welfare.
The Controller of Publications, Delhi, India; 1985.
112. Jain UR, Dixit VR. Investigations for the development of quality control
methods Chyavanprash. Indian Drugs, 2003; 40(6):333-39.
113. Rosenthaler L. Chemical investigations of Plants. G. Bell and Sons, London;
1930.
114. Middeltone, H. Systematic Qualitative Analysis. Edward Arnnold Publishers
Ltd., London; 1956.
115. Kokate CC, Purohit AP and GokhaleSB. Text Book of Pharmacognosy.
Carbohydrate and derived products, drugs containing glycosides, drugs containing
tannins, lipids and proteins alkaloids. 7th
Ed, Nirali Prekashan, India; 2001.
Bibliography
116. Peach T, Trancey MV. Modern Methods in Plant Analysis. Springer Verlog,
Berlin; 1955.
117. Shellard EJ. Practical Plant Chemistry for Pharmacy Students. Pitman Medical
Publishing Co. Ltd, London; 1957.
118. Finar IL. Organic Chemistry. 2nd
ed. The English language Book society,
London; 1959.
119. Spanos GA, Wrolstad RE .Influence of processing and storage on the phenolic
composition of Thompson seedless grape juice. Journal of Agricultural & Food
Chemistry. 1990; 38:1565–1571.
120. Harborne JB. Phytochemical methods [M]. Chapman and Hall, London, 1998.60-
66.
121. Hajare SW, Chandra S, Tandan SK, Sarma J, Lal J and Telang AG: Analgesics
and antipyretic activity of Dalbergia sissoo Leaves. Indian Journal of
Pharmacology 2000; 32:357-360.
122. Shirwaikar A, Rajendran K, Bodla R and Kumar CD. Neutralization potential of
Viper russelli (Russell’s viper) venom by ethanol leaf extract of Acalypha indica.
Journal of Ethnopharmacology. 2004; 94: 267-273.
123. Theakston RDG and Reid HA. Development of simple standard assay procedures
for the characterization of snake venoms. Bulletin of the World Health
Organization. 1983; 61: 949-956.
124. Angeline Yap, Shin Nishiumi, Ken-ichi Yoshida, and Hitoshi Ashida . Rat L6
myotubes as an in vitro model system to study GLUT4-dependent glucose uptake
Bibliography
stimulated by inositol derivatives. Cytotechnology. 2007 December; 55(2-3):
103–108.
125. Koivisto UM, Martinez-Valdez H, Bilan PJ, Burdett E, Ramlal T, Klip A.
Differential regulation of the GLUT1 and GLUT4 glucose transport systems by
glucose and insulin in L6 muscle cells in culture. The Journal of Biological
Chemistry. 1991; 266: 615-2621.
126. Walker PS, T Ramlal J. A Donovan TP. Doering A. Sandra A. Klip and Pessin
JE. Insulin and glucose-dependent regulation of the glucose transport system in
the rat L6 skeletal muscle cell line. The Journal of Biological Chemistry. 1989;
264:6587-6595.
127. Hisako Takigawa-Imamura, Takumi Sekine, Mitsuo Murata, Kiyoshi Takayama,
Kiyoshi Nakazawa and Junichi Nakagawa .Stimulation of glucose uptake in
muscle cells by prolonged treatment with scriptide, a histone deacetylase
inhibitor. Bioscience, Biotechnology, and Biochemistry. 2003; 67:1499–1506.
128. Russo C, Gao Y, Mancini P, Vanni C, Porotto M, Falasca M,Torrisi MR, Zheng
Y, Eva A. Modulation of oncogenic DBL activity by phosphoinositol phosphate
binding to pleckstrin homology domain. The Journal of Biological Chemistry
.2001; 276:19524-19531.
129. Angeline Yap, Shin Nishiumi, Ken-ichi Yoshida, and Hitoshi Ashida . Rat L6
myotubes as an in vitro model system to study GLUT4-dependent glucose uptake
stimulated by inositol derivatives. Cytotechnology. 2007 December; 55(2-3):
103–108.
Bibliography
130. Walaas E, Walaas O. Effect of insulin on rat diaphragm under anaerobic
conditions. The Journal of Biological Chemistry. 1952; 195: 367-73.
131. Chattopadhyay RR, Sarkar SK, Ganguly S, Banerjee RN, Basu TK. Effect of
leaves of Vinca rosea Linn, on glucose utilization and glycogen deposition by
isolated rat hemidiaphragm. Indian Journal of Physiology and Pharmacology.
1992; 36: 137-38.
132. Sharma RK Sahu, Roy A, Golwala DK. In vivo antidiabetic and antioxidant
potential of Stephania hernandifolia in streptozotocin-induced-diabetic rats,
Pharmacognosy.2010; 2(3):255-260.
Pandanus odoratissimus
Bambusa vulgaris