Post on 03-Feb-2022
transcript
Polymerase Chain Reaction technique as a diagnostic tool for bacterial detection in root canals of cleft lip and palate patients
ORIGINAL | ORIGINAL
ABSTRACTObjective: Polymerase chain reaction is the most sensitive of all microbiological methods for the detection of microorganisms. It consists of enzymatic amplification of DNA. PCR is faster, much more sensitive and more accurate than the culture method. This study investigated the occurrence of Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis in the root canals of cleft lip and palate patients.Methods: Samples were collected from 24 root canals followed by polymerase chain reaction.Results: A. actinomycetemcomitans was detected in 12.5% and P. gingivalis in 8.3% of the investigated root canals. The method proposed in this study was highly sensitive and specific for the direct detection of microorganisms in root canal samples. Conclusion: This new molecular-based dentistry provides useful information for clarifying the etiology of root canal microbiota and for developing new strategies for endodontic diagnosis and treatment. Indexing terms: cleft lip; cleft palate; dental pulp cavity; polymerase chain reaction.
RESUMOObjetivo: A Reação em Cadeia da Polimerase é um método com alta sensibilidade e especificidade quando comparado com alguns méto-dos microbiológicos convencionais. Baseia-se na amplificação enzimática de uma sequência especifica de DNA, visando à produção de milhões de cópias desta sequência em um tubo de ensaio. Desta forma, recentemente as técnicas de biologia molecular têm sido usadas em endodontia pela sua rapidez e eficácia. Portanto, este estudo avaliou por meio da técnica de Reação em Cadeia da Polimerase a presença dos micro-organismos Actinobacillus actinomycetemcomitans e Porphyromonas gingivalis de canais radiculares em pacientes com fissuras lábio-palatais.Métodos: Foram coletadas amostras de 24 canais radiculares e realizada a técnica de Reação em Cadeia da Polimerase.Resultados: Das amostras estudadas, 12,5% mostraram resultado positivo para A. actinomycetemcomitans e 8,3% para P. gingivalis. O método proposto neste estudo foi altamente sensível e específico na detecção direta de amostras clínicas.Conclusão: A odontologia com base molecular fornece informações úteis para esclarecer a etiologia da microbiota de canais radiculares e o desenvolvimento de novas estratégias de diagnóstico e tratamento endodôntico.Termos de indexação: fenda labial; fissura palatina; cavidade pulpar; reação em cadeia da polimerase.
Técnica de Reação em Cadeia da Polimerase como ferramenta de identificação da microbiota de canais radiculares em pacientes com fissuras labiopalatinas
Tatiana Cristina Silveira PEREIRA1
Thais Marchini OLIVEIRA2
Vivien Thiemy SAKAI2
Thiago José DIONÍSIO2
Renata Pardini HUSSNE1
Celso Kenji NISHIYAMA1
Maria Aparecida Andrade Moreira MACHADO2
Carlos Ferreira SANTOS2
RGO - Rev Gaúcha Odontol., Porto Alegre, v. 58, n. 2, p. 151-154, abr./jun. 2010
1 Universidade de São Paulo, Hospital de Reabilitação de Anomalias Craniofaciais. Bauru, SP, Brasil. 2 Universidade de São Paulo, Faculdade de Odontologia. Alameda Dr. Octávio Pinheiro Brisolla, 9-75, 17012-901, Bauru, SP, Brasil. Correspon- dência para / Correspondence to: TM OLIVEIRA. E-mail: <marchini@usp.br>.
INTRODUCTION
Cultures have traditionally been used as referencefor the assessment of microbiota associated with variousinfectious diseases, including those of endodontic origin1-6.
Species identification is routinelydonewithagarplatesandhighly diluted samples, which may not correctly representthesampleinquestion.Therefore,nonviableoruncultivablebacteria cannot be isolated by culture methods. Recently,scientistshavequestionedif culturesareindeedthereferencemethodforbacterialidentification1,3-4,7.
152
A new era has been heralded for diagnosismicrobiology.MicroorganismdetectionmethodsthatdetectmicrobialDNArather than themicroorganisms themselveshavebeenintroducedinbothresearchandclinicallaboratories.These methods are revolutionizing the knowledge of infectiousdiseasesbyallowingeffectiveandrapiddiagnosisof many diseases8. Identifying and understanding both the etiologic factors and the pathophysiology of the disease process comprise the basis of any clinical treatment. Thisknowledge allows the development of rational solutionsto deal with the problem. Since endodontic diseases areprimarilyof infectiousetiology,findingthemicrobialspeciesinvolved in thepathogenesisof thesediseases isof utmostimportance9.
Molecular methods have been used to detectmicroorganisms that are impossible or difficult to culture.Polymerase chain reaction (PCR)has thehighest sensitivityof all the microbiological methods for the detection of microorganisms10.PCRisaninvitromethodforreplicatingspecificsequencesof DNA.Startingfromaverylowquantityof DNA, as fewas justonebacterial cell,PCRamplifies abillion-foldaspecificknownsequenceof microbialDNAandallowsitsdetectionbyelectrophoresis6.SincePCRishighlysensitiveandabletodetectuncultivablemicroorganisms,ithaspotential applicability in endodontic research and diagnosis.
Root canal therapy success depends on complete eradicationof themicroflorawithin the root canal system.Agreatdealof researchisneededtoidentifyanddefinetheroleof thepathogensthatare involved inthepathogenesisof periradicular diseases. For instance,Tannerella forsythensis,Treponema denticola, other Treponema species, Dialisterpneumosites, and Prevotella tannerae were detected in infectedrootcanalsforthefirsttimewithPCRandwerefoundtobehighly prevalent.Moreover, other bacterial species, such asPorphyromonasendodontalis,Porphyromonasgingivalis,Actinobacillusactinomycetemcomitans and some Eubacterium spp. have beenreportedinendodonticinfectionsmorefrequentlywhenPCRisused thanwhencultures areused for such investigations1,4-6,9.
Thepurposeof thisstudywastoassesstheprevalenceof Actinobacillusactinomycetemcomitans and Porphyromonasgingivalisin root canals of cleft lip and palate patients using polymerase chain reaction.
METHODS
Samples were collected from root canals of 24teeth of adult patients admitted to our institution for pain management of endodontic origin. Selectionwas based onclinical and radiographic examination. All teeth presented cariouslesions;initially,theywerecleansedwithpumiceandisolatedwith a rubber dam.The tooth, the clamp, and the
rubberdamwerecleansedwith3%hydrogenperoxideandthendisinfectedwith a2.5%sodiumhypochlorite solution.After completion of the access preparations, the operativefield, including the pulp chamber, was swabbedwith 2.5%sodium hypochlorite. The root canal was dried with paperpoint. Samples were initially collected by means of #15K-typefilewiththehandlecutoff.Thefilewas introducedto a level approximately1mmshortof the tooth apex anda discrete filingmotion was applied. Two sequential paperpointswereplacedonthesamelevelandusedtosoakupthefluidinthecanal.Eachpaperpointwasretainedinpositionfor1mm.Thecutfileandthetwopaperpointswerethentransferred to a sterile microcentrifuge tube containing 0.5 mLof sterilewater,andfrozenat-20o C for later analysis.
For DNA extraction, microcentrifuge tubes werethawedandcentrifugedat10,000Xgfor5minutesat4oC. The supernatantwasdiscarded and the resultingpelletwaswashed2moretimeswith1mlof sterilewater.Thepelletwasreconstitutedwith100μLof waterand100μLof InstaGeneMatrix(Bio-RadLaboratories,Inc.,Hercules,CA,USA),andincubated at 56oC for 30minutes.The sampleswere thenvortexedandboiled for10minutes.Aftercentrifugation toremove unbroken cells and large debris (10,000X g for 3minutes),thesupernatantwasanalyzedbyPCR.
Atotalof 50μLof PCRreactionmixturecontained10μLof DNAsample,5μLof 10XPCRbuffer,1.25unitof TaqDNApolymerase,0.2mMeachof deoxyribonucleotides,1.0 μM of each primer, and 1.0 mM of MgCl2 for A. actinomycetemcomitansor1.5mMof MgCl2 for P.gingivalis. As positivecontrols,isolatedDNAfromA.actinomycetemcomitans ATCC29522andP.gingivalisATCC33277weretestedwiththe species-specific primers. Ubiquitous primers were alsoused as a positive control for the PCR amplification. Foreach set of primers, PCR was performed on sterile waterto check for DNA contamination (negative controls). Thespecificitiesof allprimerswerepreviouslyinvestigated11-14and primersequenceswerecomparedwithsimilarsequencesof thereferenceorganismsbyBLASTsearch(http://ncbi.nlm.nih.gov/blast/).Tofurthertestthespecificityof theprimers,totalDNA fromboth aforementionedbacterial strainswasusedwitheachof theprimerpairs12,15.
The sequences of primers for P. gingivalis weredesigned to amplify a 404 base pair (sense primer (5’-3’): AGGCAGCTTGCCATACTGCG, antisense primer(5’-3’): ACTGTTAGCAACTACCGATGT), and forA. actinomycetemcomitans a 557 base pair (sense primer (5’-3’): ATGCCAACTTGACGTTAAAT, antisenseprimer (5’-3’): AAACCCATCTCTGAGTTCTTCTTC).Ubiquitous primers were used as a positive controlfor bacterial presence through PCR reaction and weredesigned to amplify a 602 base pair (sense primer (5’-3’):GATTAGATACCCTGCTAGTCCAC, antisense primer(5’-3’): CCCGGGAACGTATTCACCG). The primersequencesweredescribedbyAshimotoetal.12.
TCS PEREIRA et al.
RGO - Rev Gaúcha Odontol., Porto Alegre, v. 58, n. 2, p. 151-154, abr./jun. 2010
153
PCR amplification products (9 μL) were analyzedby 2% agarose gel electrophoresis. The agarose gels werestainedwith0.5μg/mlethidiumbromideandphotographedunderultraviolet light.A100bpDNAladderservedasthemolecularweightmarker.
The detection limit of the PCR method wasdetermined using DNA from known numbers of targetorganisms(10-107 cellsperPCRasdeterminedbyviablecellcounts).
The Institutional Experimentation Committee forHuman Experiments approved the protocol for this study(protocol#019/2006).
RESULTS
All tested samples contained the amplicon of the ubiquitousbacterialprimers(Figure1).A.actinomycetemcomitanswasdetectedin 16.6%of thecases(4of 24)andP.gingivaliswasdetected in8.3%of thecases (2of 24).Figures2and3 depict representative amplicons from PCR analysis of the presence of A. actinomycetemcomitans and P. gingivalis,respectively.ReferenceDNAandclinical samples thatwerepositive forA. actinomycetemcomitans and P. gingivalis showedonlyonebandof 557bpand404bp,respectively.
Figure 1.Ethidiumbromide-stainedagarosegelof PCRproductsfrominfected rootcanals.Lane1,100bpDNAladder; lanes2-7,bacterialDNA detectedin6samplesusingubiquitousprimers(positivecontrol,602 bp);lane8,watercontrolforubiquitousprimers.
Figure 2.Ethidium bromide-stained agarose gel of PCR products from infected root canals. Lane 1, 100 bp DNA ladder; lanes 2-5, A. actinomycetemcomitansDNAdetected in4 samplesusingspecific primers (557 bp); lanes 6 and 7, failure to detect A. actinomycetemcomitansDNAin2samples;lane8,watercontrolfor A. actinomycetemcomitans.
Figure 3.Ethidium bromide-stained agarose gel of PCR products from infectedrootcanals.Lane1,100bpDNAladder; lanes2and3,P. gingivalisDNAdetectedin2samplesusingspecificprimers(404bp); lanes4-7, failure todetectP. gingivalisDNA in4 samples; lane8, watercontrolforP.gingivalis.
DISCUSSION
Oral mucous membranes and teeth are colonizedbyavarietyof microorganisms,mostlybacteria,butthevitaldentalpulpisnormallysterile.Themostcommoninitiatorsof pulpaldestructionarebacteria.Studieshaveexaminedtheuseof PCR to identify endodontic pathogens in root canals5,9,11,16.
PCR technique has enabled the detection of bacterial speciesthataredifficultorevenimpossibletoculture1-4.Inaddition,PCR is faster, much more sensitive, and more accurate thanculture4,10-11.Itsuseinendodonticstoinvestigatethemicrobiotaof rootcanalshasexpandedtheknowledgeonthebacteriainvolvedin the pathogenesis of periradicular diseases1,9,11,17-18.
Cultures require at least an 8 h incubation of the sample intheculturemediumfollowedbybiochemicalandotherteststoidentifythemicroorganism.Thetimerequiredforidentificationcanbeevenlongerforslow-growingmicroorganismsorsampleswith lowmicrobial counts.When traditional culturemethodsareused,laboratoriesmayneed7-14daystoidentifyanaerobicbacteria,whilePCRcanprovideinformationinonlyafewdays4.
Other studieshavealso founda similarprevalenceof the pathogens A.actinomycetemcomitansandP.gingivalis in root canals of patientswithoutcleftlipandpalate1,3,6,9,11,17-18.Thesepathogens,A.actinomycetemcomitans and P. gingivalis, are found inendodonticinfectionsmoreoftenwhenthe infectionsare investigatedwithPCR thanwith cultures1,3-7,9,11,17-18. This study has demonstratedthatPCRisanefficientmethodfordetectingthepresenceof thesebacteria in infected root canals of cleft lip and palate patients.
CONCLUSION
Molecular biology techniquesmayprovide insightsintothecompleteandcomplexmicrofloraof theoralcavityingeneral,andparticularlyof infectedrootcanals.PCRhascontributedsignificantlytotheknowledgeof therootcanalmicrobiota by allowing the identification of endodonticpathogens.Thismayalsocontributetothedevelopmentof improvedtreatmentstrategiesfor cleft lip and palate patients.
Polymerase Chain Reaction Technique
RGO - Rev Gaúcha Odontol., Porto Alegre, v. 58, n. 2, p. 151-154, abr./jun. 2010
154
REFERENCES
1. SiqueiraJFJr,RôçasIN,OliveiraJCM,SantosKRN.Detectionof putative oral pathogens in acute periradicular abscessesby 16S rDNA-directed polymerase chain reaction. J Endod.2001;27(3):164-7.
2. ConradsG,GharbiaSE,GulabivalaK,LampertF,ShahHN.The use of a 16rDNA directed PCR for the detection of endodontopathogenicbacteria.JEndod.1997;23(7):433-8.
3. RolphHJ,LennonA,RiggioMP,SaundersWP,MacKenzieD,ColderoL, et al.Molecular identificationof microorganismsfromendodonticinfections.JMicrob.2001;39(9):3282-9.
4. Siqueira JF Jr, Rôças IN. PCR methodology as a valuabletool for indentification of endodontic pathogens. J Dent.2003;1(5):333-9.
5. SiqueiraJFJr,RôçasIN.Moleculardetectionandidentificationof Synergistes phylotypes in primary endodontic infections.OralDis.2007;13(4):398-401.
6. Siqueira JF Jr, Rôças IN. Polymerase chain reaction-basedanalysisof microorganismsassociatedwithfailedendodontictreatment.OralSurgOralMedOralPatholOralRadiolEndod.2004,97(1):85-94.
7. Siqueira JF Jr, Rôças IN, Moraes SR, Santos KR. Directamplification of rRNA gene sequences for identification of selectedoralpathogens inrootcanal infections.IntEndodJ.2002;35(4):345-51.
8. Pitt TL, Saunders NA. Molecular bacteriology: a diagnostictoolforthemillennium.JClinicalPathol.2000;53(1):71-5.
9. Siqueira JF Jr, Rôças IN, Cunha CD, Rosado AS. Novelbacterial phylotypes in endodontic infections. J Dent Res.2005;84(6):565-9
10. SantosCF,SakaiVT,MachadoMAAM,SchippersDN,GreeneAS.Reversetranscriptionandpolymerasechainreaction:principlesandapplicationsindentistry.JApplOralSci.2004;12(1):1-11.
11. OliveiraJCM,SiqueiraJFJr,AlvesGB,HirataJrR,AndradeAFB.Detection of porphyromonas endodontalis in infectedroot canals by 16S rRNA gene-directed polymerase chainreaction.JEndod.2000;26(12):729-32.
12. Ashimoto A, Chen C, Bakker I, Slots J. Polymerase chainreaction detection of 8 putative periodontal pathogens insubgingival plaque of gingivitis and advanced periodontitislesions.OralMicrobiolImmunol.1996;11(4):266-73.
13. Kimura S, Ooshima T, Takiguchi M, Sasaki Y, Amano A,Morisaki I, et al. Periodontopathic bacterial infection inchildhood.JPeriodontol.2002;73(1):20-6.
14. Ooshima T, Nishiyama N, Hou B, Tamura K, Amano A,Kusumoto A, et al. Occurrence of periodontal bacteria inhealthychildren:a2-year longitunial study.CommunityDentOralEpidemiol.2003;31(6):417-25.
15. UmedaM,ContrerasA,ChenC,BakkerI.Theutilityof wholesalivatodetecttheoralpresenceof periodontopathicbacteria.JPeriodontol.1998;69(7):828-33.
16. NandakumarR,WhitingJ,FouadAF.Identificationof selectedrespiratorypathogensinendodonticinfections.OralSurgOralMedOralPatholOralRadiolEndod.2008;106(1):969-75.
17. BateAL,MaJKC,FordTRP.Detectionof bacterialvirulencegenes associated with infective endocarditis in infected rootcanals.IntEndodJ.2000;33(3):194-203.
18. BogenG, Slots J. Black-pigmented anaerobic rods in closedperiapicallesions.IntEndodJ.1999,32(3):204-10.
Recebidoem:5/7/2008Versãofinalreapresentadaem:23/10/2008
Aprovadoem:1/4/2009
TCS PEREIRA et al.
RGO - Rev Gaúcha Odontol., Porto Alegre, v. 58, n. 2, p. 151-154, abr./jun. 2010
Collaborators
TCSPEREIRAwas responsible for the laboratorywork andwritingof the article.TMOLIVEIRAhelped inthe laboratory, incollectingsamplesandwriting thearticle.
VT SAKAI and TJ DIONÍSIO helped in the laboratory.RP HUSSNE helped in the collection of samples. CKNISHIYAMA provided all the clinical support. MAAMMACHADO provided the material used in the study. CFSantos was the supervisor of the study at USP School of DentistryandwrotethearticleinEnglish.