Primate Comparative Genomics

transcript

“…man’s position in the animate world is an indispensable preliminary to the proper understanding of his relations to the universe – and this again resolves itself, in the long run, into an inquiry into the nature and the closeness of the ties which connect him with those singular creatures (the Great Apes) whose history has been sketched in the preceding pages.”

-Thomas H. Huxley -Man’s Place in Nature, 1894

Humans and Chimps

Homo sapiens à 99.9% identical Homo sapiens and Pan troglodytes à 99.0% identical

Why sequence chimps?

Two white papers. http://www.genome.gov/11008056

Chimps Are Resistant To Many Human Diseases

Comparison of disease susceptibility between chimps and humans Condition Human Chimp

HIV progression to AIDS common very rare Influenza A symptoms moderate/severe mild Hepatitus B/C complications moderate/severe mild Plasmodium falciparum malaria susceptible resistant Menopause universal rare E. Coli K99 gastroenteritis resistant sensitive Alzheimer’s disease pathology complete incomplete Epithelial cancers common rare

Source: Olson, M.V. et al. White paper advocating the complete sequencing of the common chimpanzee, Pan troglyodytes, (2002)

Chimp sequence can inform our unique population history

Kasserman et al (2001) Nat. Genet. 27: 155-56

Chimps can inform our unique population history

•  Fixation of deleterious alleles during bottlenecks

•  Chimp genome might offer a “fix” to common diseases

speech+ speech--

hypertension+

hypertension--

obesity+ obesity-- bipedal+

bipedal--

speech+

hypertension+ obesity+

bipedal+

Chimp sequence can help detect selection

•  Important to know the ancestral allele •  Over-representation of the non-ancestral allele can

suggest selection

B B B B B B

A allele fixed in Chimps

A and B are polymorphic in Humans

Only species appropriate for comparison of fast moving regions

•  Pericentric duplications •  Subtelomeric repeats •  Y-chromosome •  5-7% of the genome is in large segmental

duplications

What does the genome tell us?

•  (Roughly) same size genome (3.1 GB) •  (Roughly) same number of genes (~20,500) •  (Roughly) same genes •  Large number of papers reporting specific

differences between human and chimps •  Many papers also claim to detect positive

selection on specific human genes

Not too much yet…

Let’s do the math

How many differences do we need to look at? (3 x 109 bp) (1% divergence) (50% in humans) = 15 million bp In coding DNA? (15 million bp) (1.5% coding) (75% non-synonomyous) =169,000 bp or about 7 non-synonomyous changes per gene Non-coding DNA? (15 million bp) (3.5% under selection) = 525,000 bp

What are the possibilities?

•  Gene loss •  Gene gain •  Gene mutation (a few or many) •  Gene regulation •  Something else?

Inter- versus Intraspecific Variation

He (man) resembles them (apes) as they resemble one another – he differs from them as they differ from one another.

-Thomas Huxley -Man’s Place in Nature, 1894

Gene Loss

Hypothesis: Humans have lost (one or more) genes compared to chimps, and it is the loss of those functions that accounts for our “humanness”

Sialic Acid Biology an example of database mining

Chou et al. (1998) Proc. Natl. Acad. Sci. USA 95, 11751-11756

•  Apes have lots of Neu5Gc, humans very little •  Neu5Gc is located on the surface of epithelial cells •  Neu5Gc is present in very low levels in the brain even

in animals that have lots of Neu5Gc

hydroxylase

human chimp gorilla mouse

A 92 bp deletion in the CMP-Neu5a hydroxylase is specific to the human lineage

ATG ATG ATG ATG

Indels are ~50% of human-chimp differences Frazer et al (2003) Genome. Res. 13: 341-346 Locke et al. (2003) Genome. Res. 13: 347-357

Gene Gain

Hypothesis: Humans have gained (one or more) genes compared to chimps, and it is the gain of these new functions that accounts for our “humanness.”

Morpheus Gene Family

Johnson et al. (2001) Nature 413:514-519

Morpheus Gene family

Johnson et al. (2001) Nature 413:514-519

•  20 Kb duplicated segment on short arm of chromosome 16

•  98% identity in introns/non-coding DNA, 81% identity in exonic DNA

•  Ka/Ks tests indicate (possibility of) extreme positive selection

•  Gene family has no homology to known genes

Morpheus Gene Family

Gene Mutation

Hypothesis: Humans acquired (one or more) substitutions in the coding regions of their genes that alter the functions of those proteins so as to account for our “humanness.”

What about organism specific substitutions?

http://sayer.lab.nig.ac.jp/~silver/

C-C chemokine receptor (nucleotides 1 to 60) Human_1 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC Human_2 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC Human_3 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC Human_4 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC Chimp_1 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCGATTATTATACATCGGAGCCCTGC Chimp_2 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCGATTATTATACATCGGAGCCCTGC Chimp_3 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCGATTATTATACATCGGAGCCCTGC Goril_1 ATGGATTATCAAGTGTCAAGTCCAACCTATGACATCGATTATTATACATCGGAGCCCTGC Goril_2 ATGGATTATCAAGTGTCAAGTCCAACCTATGACATCGATTATTATACATCGGAGCCCTGC Goril_3 ATGGATTATCAAGTGTCAAGTCCAACCTATGACATCGATTATTATACATCGGAGCCCTGC

************************* ********** ***********************

Problem: How can we make a conclusion based on one substitution?

Detecting Selective Sweeps •  Selective sweeps are (thought to be) accompanied

by a local reduction in diversity •  Test for overabundance of low frequency alleles

(Tajima’s D)

Apadted from Carroll, S. (2003) Nature 422:849-57

beneficial mutation arises Selection drives mutation to fixation mutation/recombination

FOXP2, The Human Speech Gene? 1)  Mapped in families with inherited speech

defects (normal IQ) 2)  Forkhead transcription factor

FOXP2 Nucleotide Substitutions

Enard et al. (2002) Nature 418, 869-72

FOXP2, The Human Speech Gene?

Enard et al. (2002) Nature 418, 869-72

•  Sequencing of adjacent non-coding DNA revealed an excess in the number of low frequency alleles relative to what would be expected given neutral DNA in a randomly mating population of constant size

•  Tajima’s D = -2.20 (P<0.01)

Gene Expression

Hypothesis: It is not the structural differences in proteins, but rather their differences in expression between humans and chimps that account for our “humanness.”

Differences in Gene Expression in the Brain? Enard et al (2002) Science 296, 340-343.

microarrays

2D Gels

Neutral Theory of Gene Expression?

•  Consider how one might construct a neutral theory of gene expression akin to the neutral theory of gene mutation

1)  What is the sequence of the normal Human Genome?

2)  What accounts for the genetic differences between individuals?

Finding Segmental Duplications in the Human Genome

Bailey et al (2002) Science 297:1003-07

Segmental Duplications in the Human Genome

Bailey et al (2002) Science 297:1003-07

Polymorphism in Segmental Duplications

Iafrate et al (2004) Nat Genet 36:949-51

Polymorphism in Segmental Duplications

•  CGH studies find many copy number polymorphisms in segmental duplications (~12 per individual)

•  Rare and common polymorphisms •  Many overlap coding regions •  Critical for the interpretation of

amplifications in cancers •  Responsible for phenotypic differences

between people?

SNPs/Hap Map/1000 Genomes The International HapMap Project is a multi-country effort to identify and catalog genetic similarities and differences in human beings. Using the information in the HapMap, researchers will be able to find genes that affect health, disease, and individual responses to medications and environmental factors. The Project is a collaboration among scientists and funding agencies from Japan, the United Kingdom, Canada, China, Nigeria, and the United States. All of the information generated by the Project will be released into the public domain

Questions

1.  How many sub-populations best partition the data?

2.  How strong is the evidence for the clusters? 3.  Do the inferred clusters correspond to our

notions of race, ethnicity, ancestry, or geography?

4.  Given the inferred clusters can we accurately can we classify new individuals?

5.  Can we identify population admixture or migration events?

Attempts to group humans by genotype

π and Fst

1.  π, average nucleotide diversity (~1 in 1000 bp)

2.  Fst, proportion of genetic variation that can be ascribed to differences between populations (~10%)

Summary of Findings •  π and Fst are small •  Diversity within “African” populations is

highest •  Unsupervised clustering tends to support

either 3 or 4 sub-populations depending on number and type of markers and individuals included in the study, but the composition of the groups are often different in different studies

A contradiction?

•  Although they differed on the extent and composition of sub-populations, so far all studies have found evidence of significant sub-structure in human populations

•  And yet, all studies agree that Fst is small (between 3-15%)

See review by Jorde and Wooding (2004) Nature Genet. 36: S28-S33

Small Fst does not imply lack of structure

C1 A2 D1 A2

E1 E1 E1 E1

Clustering human populations by genotype

K-means clustering of gene expression data

•  Pick a number (k) of cluster centers

•  Assign every gene to its nearest cluster center

•  Move each cluster center to the mean of its assigned genes

•  Repeat 2-3 until convergence

EM-based clustering of genotype data

•  Pick a number (k) of sub-populations

•  Assign every individual to a sub-population based on the allele frequencies in the sub-population

•  Recalculate the allele frequencies in each sub population

•  Repeat 2-3 until convergence

An Example I1= (A1,B1,C2) I2= (A1,B1,C2) I3= (A1,B2,C2) I4= (A2,B2,C1) I5= (A1,B1,C1) I6= (A1,B1,C2) I7= (A1,B1,C2) I8= (A2,B2,C2) I9= (A1,B2,C1) I10= (A2,B1,C2) I11= (A2,B2,C2) I12= (A2,B2,C2)

12 individuals genotyped at three different independent biallelic loci

k1 k3 k2

I1= (A1,B1,C2) I2= (A1,B1,C2) I3= (A1,B2,C2) I4= (A2,B2,C1)

F(A1)k1=0.75 F(B1)k1=0.5 F(C1)k1=0.25

F(A1)k2=0.75 F(B1)k2=0.75 F(C1)k2=0.25

F(A1)k3=0.25 F(B1)k3=0.25 F(C1)k3=0.25

Consider individual I1= (A1,B1,C2) P(I1 in k1) = (.75)(.5)(.75) = 0.28 P(I1 in k2) = (.75)(.75)(.75) = 0.42 P(I1 in k3) = (.25)(.25)(.75) = 0.046 Therefore reassign I1 to k2

An example Bamshad et al (2003) Am. J. Hum. Genet. 72:578-89

But… Bamshad et al (2003) Am. J. Hum. Genet. 72:578-89

Genes mirror geography in Europe Novembre et al. Nature 456, 98-101

Pharmacogenomics •  Many drugs never reach the market because

of side effects in a small minority of patients

•  Many drugs on the market are efficacious in only a small fraction of the population

•  This variation is (in part) due to genetic determinants – OrissaàEGF mutations – Codeineàcytochrome P450 alleles

Question: Is race, ancestry, ethnicity, geography or genetic substructure a

reasonable proxy for genotype at alleles relevant for drug metabolism?

Answer: So far…No. Still looks as if we will have to genotype the relevant loci before making any guesses

Population genetic structure of variable drug response.

Wilson et al (2001) Nat Genet. 29: 265-269

A = African

B = European

C = Asian

A B C CYP1A2

CYP2C19

CYP2D6

Evidence for Archaic Asian Ancestry on the Human X Chromosome Garrigan et al. (2005) Mol. Biol. And Evol. 22:189-192

1)  Pseudogene on the X-chromosome 2)  18 substitutions between human-chimp 3)  15 substitutions between two human alleles 4)  Assuming a molecular clock the split between

the two human alleles is about 2 million years 5)  Both alleles found in southern Asia, only one

allele found in Africa 6)  Only human gene tree to “root” in Asia

Garrigan et al. (2005) Mol. Biol. And Evol. 22:189-192

Human evolution in a nutshell

chimps H. sapien

H. ergaster

H. erectus

H. neanderthalis

5-6 mya

0.5 mya

0.2 mya

Human evolution in a nutshell

chimps H. sapien

H. ergaster

H. erectus H. neanderthalis

5-6 mya

0.5 mya

0.2 mya ?

So what happened?

1.  Strong selection for the Asian allele in southern Asia -not likely since this is a pseudogene locus -fails Tajima’s D test

2.  Gene flow between H. sapien and H.erectus in southern Asia

-branch lengths are about right for 2 million years of divergence -H. erectus was in southern Asia until 18,000 years ago

(Morwood et al. and Brown et al. in Nature (2004) vol 431.)

-supporting evidence from genetic analysis of lice and other human parasites (Reed et al (2004) PLoS 2:1972-83)

Primate Comparative Genomics

Documents