Proteins and Base Mutations

Polypeptides made up of amino acids Peptides are at Least 2 amino acids bonded

together via peptide bonds Proteins ARE polypeptides, numerous amino

acids

First Recall Proteins------

**Peptide Bond between amino acids

**All AA’s look the same EXCEPT the “R” group. It’s a group of molecules. They determine which amino acid it is because each are different!

The amino acid sequence determines the protein!! Shape-specific

Example - The sequence for a specific enzyme will be totally different from that of a hormone!

Amino Acid Sequence - Polypeptide

Human Growth HormoneAmylase Enzyme

Basic Types of Proteins

Structural Proteins – forms part of cell materials

fibrous and stringy and provide support. Examples: Keratins strengthen protective coverings such as hair, quills, feathers, horns, and beaks. include keratin

Collagen, and elastin. Collagens and elastin provide support for connective tissue such as tendons and ligaments.

Structural Proteins

Hormones – Body’s chemical messengers

Functional Proteins

Hormones – Chemical Signals released by a cell or a gland in one part of the body that sends out messages that affect cells in other parts of the organism

Growth and development Metabolism - how your body gets energy from the foods you eat Sexual function Reproduction Mood

Enzymes – catalyze chemical reactions. Example – Amylase is the enzyme that breaks starches in

your mouth. Speeds up the rate of digestion.

Functional Proteins

Remember that DNA is replicated during the S phase of Interphase in both Mitosis and Meiosis (the formation of gametes)

Mutations may or may not change the function of a protein

May change phenotype, how a gene is expressed

Example: brown hair is a phenotype, sickle cell anemia is a phenotype, dwarfism is a phenotype

Mistakes Can Occur

***Errors in replication, transcription, cell division, or by external agents called mutagens (chemicals, radiation, X-rays etc.)

***Some occur randomly, some phenotypes are selected for in nature

***Although mutations can cause problems, if it weren’t for mutations we wouldn’t have new genes such as those for green eyes

Mutations-------

** Newly synthesized DNA is EXACTLY the same as the parent DNA……or is it??

Enzymes proofread as bases are paired during replication and replace those wrongly paired

Other enzymes police the replication process

But…………

“Fixing” Errors

May be random or spontaneous (influenced) When genes have an error in their DNA code,

they may not work properly, and are said to be "altered" or mutated.

DNA damage from environmental agents such as radiation (sunlight), nuclear radiation, some viruses, some chemicals, genetics, inflammation, infection

Mistakes that occur when a cell copies its DNA in preparation for cell division.

Can occur during meiosis (making of sper, and egg)

Mutations

Enzymes Speed up the rate of reaction For example, amylase breaks down

starches in your mouth

Functional Proteins

Mismatched Base Pair Can Occur – Usually Random

Spontaneous Mutions Environmental agents such as nuclear radiation can damage DNA by breaking bonds between nucleotides on either side of the DNA molecule can occur

Some mutated cells will be defeated by the body's immune system

others will undergo apoptosis, or cell suicide. occasionally a cell with mutations slips through

proofreading safeguards. When mutations accumulate, the genetic material is so

scrambled that the cell no longer acts like a normal, healthy cell.

Tumors, mass of cells that have no purpose, may form

Mutated Cells

Not malignant tumor (cancerous) Does not invade nearby tissue or spread to other parts of

the body the way cancer can. But benign tumors can be serious if they press on vital

structures such as blood vessels or nerves. Some, such as colon polyps, can become cancerous

Benign Tumors (non-cancerous)

Abnormal cells grow uncontrolled Invades surrounding tissues Usually capable of producing metastases

(spread to other organs) May recur after attempted removal May cause death of the host unless

adequately treated

Cancerous Tumor

Mutations and Reproduction**Mutations can occur during meiosis, the

making of sperm or egg by changing the nucleotide sequences within a gene and can be passed along to offspring

**Example: Achonroplasia is a type of dwarfism that can come from a mutation during sperm

formation**The mutation may produce a new trait (good OR bad) or it may result in a protein that does not work correctly.

Types of Mutations

** Point mutations, base substitution, affects a single base

**Frameshift – Addition or deletion of a base – Affects entire protein

**chromosomal mutations – affects whole chromosomes

Base Pair Substitution – AKA Point Mutation

Affects a single base and change the codon

May or may not affect the amino acid Sometimes if the third base of the codon

changes, the amino acid may stay the same!

UCU UCC UCA UCG

Point MutationsALL code for Ser

TACCAGGATTAACATGGAAGTGTAATCAUGGUCCUAAUUGUACCUUCACAUUAG

Met Val (STOP)HisSerProVal IleLeu

DNA

mRNA

Amino Acid)

NORMAL SEQUENCE

Met Val IleLeu

TACCAGGATTAAAUGGUCCUAAUU

AATGGAAGTGTAATC DNA

UUACCUUCACAUUAG mRNA

Leu (STOP)HisSerPro

What if the C was substituted with an A ?????

Addition or deletion of a base shifts the amino acids left or right affecting the whole protein. It won’t function properly

Frameshift Mutation

TACCAGGATTAACATGGAAGTGTAATC

AUGGUCCUAAUUGUACCUUCACAUUAG

(STOP)HisSerProVal

Met Val IleLeu

TACCAGGATTAAAUG GUC CUA AUU

Met Val IleLeu

ATGGAAGTGTAATC… UACCUUCACAUUAG…

Tyr His IleLeu

Example: Deletion of the C shifts the entire protein over to the left – Framshifts change ENTIRE PROTEIN –

There is NO STOP CODON!!

Ser or Arg….

Frame-Shift Mutations (Add or Delete a Base)

Sickle Cell Anemeia – red blood cells are misshaped (sickle-shaped) and cannot carry enough oxygen

Base Substitution Example

Tay-Sachs - disorder of the central nervous system.

An enzyme that is responsible for breaking down certain fatty substances in brain and nerve cells is ineffective and these substances accumulate, eventually destroying brain and nerve cells, and so the entire central nervous system.

It is an inherited trait and you can be a carrier

Example of Frameshift

Mutation Exercise

To give you a better idea of genetic mutations that effect proteins (we haven’t gotten to wntire chromsomes yet) do a little research…

Research a trait, disease/disorder that is caused by a point mutation and one that is caused by a frameshift mutation. Without getting to technical, describe where the mutation occurs, the symptoms and the prognosis

Your turn……..