Post on 26-Dec-2015
transcript
PTT 104 Introduction toBiotechnology
Lecture 3
Techniques in Biotechnology
Recombinant DNA & PCR
Miss Noorulnajwa Diyana Yaacob
Course Outcome
CO 2: Ability to demonstrate important recent advances in methods and applications of biotechnology with regards to microorganisms and plants.
Biotechnology today
• Focuses on DNA Deoxyribonucleic Acid- a double-stranded helical molecule that stores genetic information for the production of all the organism’s proteins
What Is the Structure of DNA?
• DNA Is Composed of Four Nucleotides
• DNA Is a Double Helix of Two Nucleotide Strands
• Many people contributed to the discovery, but Francis Crick and James Watson (and Maurice Wilkins) got the Noble prizes.
Hydrogen Bonds
• Hydrogen bonds hold certain nitrogenous base pairs together–A bonds with T, G bonds with C–Bonding bases called complementary
base pairs
• Ladder-like structure of the two DNA strands are twisted into a double helix
What Is the Structure of DNA?
• Hydrogen Bonds Between Complementary Bases Hold the Two DNA Strands Together
• The Order of Nucleotides in DNA Can Encode Vast Amounts of Information
Figure E9-6 Biology: Life on Earth 8/e ©2008 Pearson Prentice Hall, Inc.
5 end
3 end
3 end
5 end
Recombinant DNA
• DNA produced by joining segments of DNA from different sources
• eg. To produce human insulin, scientists have combined bacterial plasmid DNA + human DNA
Tools for Producing Recombinant DNA
Restriction enzymes: enzymes that cleave the DNA double helix at specific nucleotide sequences
Use of the Restriction Enzyme Bam H1
5’— G G A T C C — 3’ 3’— C C T A G G — 5’
5’— G G A T C C — 3’ 3’— C C T A G G — 5’
sticky end
sticky end
Results in
Tools for Producing Recombinant DNA
Vector: carrier of DNA; can be virus or plasmid
Plasmid: extrachromosomal, independently replicating, small circular DNA molecule
Producing Recombinant DNA
restriction enzyme
Treat source DNA with restrictionenzyme
Treat plasmid DNA with same enzyme
restriction enzyme
Mix togetherAdd DNA Ligase
Many recombinant DNAmolecules are produced,each with a different piece of source DNA
Transform bacterial cells
Each bacterial cellcarries a different recombinant plasmid
Tools for Producing Recombinant DNA
Probe: sequence of DNA that is complementary to the gene of interest; Used to locate a copy of the gene by hybridization
Add ProbeProbe Binds to gene
AGCTTAGCGATTCGAATCGCTA
AATCGCAGCTTAGCGAT
TCGAATCGCTA
Denature DNA by heating
Building a
DNA Library
Applying Your KnowledgeApplying Your Knowledge
A. An enzyme that cleaves DNA at specific sequences is a __________ .
B. A sequence of DNA that is complementary to the gene of interest is a _________.
C. A small, independently replicating DNA molecule is a ___________.
1. Probe2. Clone3. Plasmid4. Restriction Enzyme
Polymerase Chain Reaction• PCR is a technique that is
used to amplify a sample of DNA from miniscule amount of DNA (ex., DNA from a crime scene, archaeological samples, organisms that can’t be cultured).
Who developed PCR?• PCR was developed by Kary Mullis.• Kary Mullis is a scientist and surfer
from Newport Beach, California.• He won a Nobel Prize in Chemistry in
1993 for the development of PCR.• He was working for Cetus Corporation
in the 70’s and received $10,000 bonus for the idea.
How is PCR used?• Medical Diagnosis: To detect and identify the causes of
infectious diseases from bacteria and viruses.• Genetic testing: To determine whether a genetic mutation
has been passed on (ex. cystic fibrosis).• Evolutionary study: To gather archaeological samples and
analyzed for similarities/differences.• DNA fingerprinting: To profile DNA from blood, hair, and
skin cells for criminal identification and forensics
Stages of PCRPCR is divided into 3 stages:1. Denaturation2. Anneal3. Extension
What is a primer?• A primer is a short
oligonucleotide which is the reverse complement of a region of a DNA template.
• It would anneal to a DNA strand to facilitate the amplification of the targeted DNA sequence.
oligonucleotide
Primer Selection variables
• Primer length• Melting Temperature• GC content• Hair-pin loop• Self-dimerization• Cross-dimerization
Primer Length• Should be between 18 – 25
bases.• The longer the primer, the more
inefficient the annealing.• If primers are too short, they will
cause non-specific annealing and end up amplifying non-specific sequences.
Melting Temperature
• Formula (18-25 bp range):– Tm = 2(A+T) + 4(G+C)
• The forward and reverse primers should be having similar Tm, or else amplification will be less efficient.
• Melting Temperature should be between 55ºC and 65ºC.
GC Content
• GC% = (G + C) / length of seq * 100%• The base composition should be in the range of 45% to
55%.• Poly G’s or C’s can result in non-specific annealing.
Hairpin Loop
• Primers with hairpin loop may interfere with annealing to the template by forming partially double-stranded structure.
Self-dimerization
• Primers may form inter-primer homology with its own copies.
Cross Dimerization• Forward and Reverse primers may
hybridize to form primer-dimer.
Algorithm for primer designInput the start and end of central region
Input the length of primers
GC content 45-55%
Tm:
55-65oC
Hairpin and self-dimerization
Cross Dimerization
Excluded
primers
N
N
Y
Y
Y
Y
NN
List of acceptable primers
Input DNA sequence
Polymerase Chain Reaction (PCR)
Amplifies a specific region in the DNA Used for identification, especially if the amount of DNA is small
Uses repeated cycles of heating to denature DNA and cooling to synthesize new DNA
Involves the use of
---Taq polymerase (withstands heat)
---primers to begin synthesis
Polymerase Chain Reaction:One PCR Cycle
OriginalDouble-helixDNA
SeparateDNAStrands
90 °C
Primers &Taqpolymerasebind
50 °C
Taq Polymerase Primer
72 °C
DNAsynthesized