PTT 104 Introduction toBiotechnology

Lecture 3

Techniques in Biotechnology

Recombinant DNA & PCR

Miss Noorulnajwa Diyana Yaacob

Course Outcome

CO 2: Ability to demonstrate important recent advances in methods and applications of biotechnology with regards to microorganisms and plants.

Biotechnology today

• Focuses on DNA Deoxyribonucleic Acid- a double-stranded helical molecule that stores genetic information for the production of all the organism’s proteins

What Is the Structure of DNA?

• DNA Is Composed of Four Nucleotides

• DNA Is a Double Helix of Two Nucleotide Strands

• Many people contributed to the discovery, but Francis Crick and James Watson (and Maurice Wilkins) got the Noble prizes.

Hydrogen Bonds

• Hydrogen bonds hold certain nitrogenous base pairs together–A bonds with T, G bonds with C–Bonding bases called complementary

base pairs

• Ladder-like structure of the two DNA strands are twisted into a double helix

What Is the Structure of DNA?

• Hydrogen Bonds Between Complementary Bases Hold the Two DNA Strands Together

• The Order of Nucleotides in DNA Can Encode Vast Amounts of Information

Figure E9-6 Biology: Life on Earth 8/e ©2008 Pearson Prentice Hall, Inc.

5 end

3 end

3 end

5 end

Recombinant DNA

• DNA produced by joining segments of DNA from different sources

• eg. To produce human insulin, scientists have combined bacterial plasmid DNA + human DNA

Tools for Producing Recombinant DNA

Restriction enzymes: enzymes that cleave the DNA double helix at specific nucleotide sequences

Use of the Restriction Enzyme Bam H1

5’— G G A T C C — 3’ 3’— C C T A G G — 5’

5’— G G A T C C — 3’ 3’— C C T A G G — 5’

sticky end

sticky end

Results in

Tools for Producing Recombinant DNA

Vector: carrier of DNA; can be virus or plasmid

Plasmid: extrachromosomal, independently replicating, small circular DNA molecule

Producing Recombinant DNA

restriction enzyme

Treat source DNA with restrictionenzyme

Treat plasmid DNA with same enzyme

restriction enzyme

Mix togetherAdd DNA Ligase

Many recombinant DNAmolecules are produced,each with a different piece of source DNA

Transform bacterial cells

Each bacterial cellcarries a different recombinant plasmid

Tools for Producing Recombinant DNA

Probe: sequence of DNA that is complementary to the gene of interest; Used to locate a copy of the gene by hybridization

Add ProbeProbe Binds to gene

AGCTTAGCGATTCGAATCGCTA

AATCGCAGCTTAGCGAT

TCGAATCGCTA

Denature DNA by heating

Building a

DNA Library

Applying Your KnowledgeApplying Your Knowledge

A. An enzyme that cleaves DNA at specific sequences is a __________ .

B. A sequence of DNA that is complementary to the gene of interest is a _________.

C. A small, independently replicating DNA molecule is a ___________.

1. Probe2. Clone3. Plasmid4. Restriction Enzyme

Polymerase Chain Reaction• PCR is a technique that is

used to amplify a sample of DNA from miniscule amount of DNA (ex., DNA from a crime scene, archaeological samples, organisms that can’t be cultured).

Who developed PCR?• PCR was developed by Kary Mullis.• Kary Mullis is a scientist and surfer

from Newport Beach, California.• He won a Nobel Prize in Chemistry in

1993 for the development of PCR.• He was working for Cetus Corporation

in the 70’s and received $10,000 bonus for the idea.

How is PCR used?• Medical Diagnosis: To detect and identify the causes of

infectious diseases from bacteria and viruses.• Genetic testing: To determine whether a genetic mutation

has been passed on (ex. cystic fibrosis).• Evolutionary study: To gather archaeological samples and

analyzed for similarities/differences.• DNA fingerprinting: To profile DNA from blood, hair, and

skin cells for criminal identification and forensics

Stages of PCRPCR is divided into 3 stages:1. Denaturation2. Anneal3. Extension

What is a primer?• A primer is a short

oligonucleotide which is the reverse complement of a region of a DNA template.

• It would anneal to a DNA strand to facilitate the amplification of the targeted DNA sequence.

oligonucleotide

Primer Selection variables

• Primer length• Melting Temperature• GC content• Hair-pin loop• Self-dimerization• Cross-dimerization

Primer Length• Should be between 18 – 25

bases.• The longer the primer, the more

inefficient the annealing.• If primers are too short, they will

cause non-specific annealing and end up amplifying non-specific sequences.

Melting Temperature

• Formula (18-25 bp range):– Tm = 2(A+T) + 4(G+C)

• The forward and reverse primers should be having similar Tm, or else amplification will be less efficient.

• Melting Temperature should be between 55ºC and 65ºC.

GC Content

• GC% = (G + C) / length of seq * 100%• The base composition should be in the range of 45% to

55%.• Poly G’s or C’s can result in non-specific annealing.

Hairpin Loop

• Primers with hairpin loop may interfere with annealing to the template by forming partially double-stranded structure.

Self-dimerization

• Primers may form inter-primer homology with its own copies.

Cross Dimerization• Forward and Reverse primers may

hybridize to form primer-dimer.

Algorithm for primer designInput the start and end of central region

Input the length of primers

GC content 45-55%

Tm:

55-65oC

Hairpin and self-dimerization

Cross Dimerization

Excluded

primers

N

N

Y

Y

Y

Y

NN

List of acceptable primers

Input DNA sequence

Polymerase Chain Reaction (PCR)

Amplifies a specific region in the DNA Used for identification, especially if the amount of DNA is small

Uses repeated cycles of heating to denature DNA and cooling to synthesize new DNA

Involves the use of

---Taq polymerase (withstands heat)

---primers to begin synthesis

Polymerase Chain Reaction:One PCR Cycle

OriginalDouble-helixDNA

SeparateDNAStrands

90 °C

Primers &Taqpolymerasebind

50 °C

Taq Polymerase Primer

72 °C

DNAsynthesized