Post on 11-May-2015
transcript
TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCTCCCCCCATGCTTACAAGCAAGTACAGCAATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTTACCCATTAGGATATCAACAAACCTACCCGCCCTTAACAGTACATAGCACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCCTCATTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCTCCCCCCATGCTTACAAGCAAGTACAGCAATCAACCTTCAACTATCACACA
Rick Kittles, Ph.D.Rick Kittles, Ph.D.Section of Genetic MedicineSection of Genetic Medicine
Race, Genetic Ancestry and Prostate Race, Genetic Ancestry and Prostate Cancer RiskCancer Risk
GenomesGenomesHumanHuman
~22,000 genes
~3.0 billion nucleotides
~10 million SNPs
23 pairs of chromosomes
DogDog
~19,000 genes
~2.4 billion nucleotides
Currently 600,000 SNPs
39 pairs of chromosomes
““RaceRace””is a crudeis a crudeproxy.proxy.
DISEASEDISEASE
Individual-biology-genotype
Environment-diet, lifestyle-SES, exposures
““RaceRace””is a crudeis a crudeproxy.proxy.
DISEASEDISEASE
Individual-biology-genotype
Environment-diet, lifestyle-SES, exposures
DISEASEDISEASE
Individual-biology-genotype
Environment-diet, lifestyle-SES, exposures
THE UNIVERSITY OF CHICAGOSection of Genetic Medicine
• “Race” as generally understood and as used in biomedical research refers to both cultural and biological features of metapopulation groups.
• “Race” is composed of:• Ethnic heritage – social component • Biogeographical ancestry – biological component• Interaction – social and biological components may
affect each other in non-additive ways
““RaceRace”” as metapopulation is a complex as metapopulation is a complex composite variablecomposite variable
THE UNIVERSITY OF CHICAGOSection of Genetic Medicine
Why is Why is ““RaceRace”” Problematic?Problematic?
•• Does not explain human biological variation.Does not explain human biological variation.•• SocioSocio--cultural meanings and the colloquial use of the cultural meanings and the colloquial use of the
term.term.•• Lack of discourse between disciplines.Lack of discourse between disciplines.•• When used as a causal genetic variable it perpetuates When used as a causal genetic variable it perpetuates
biological determinism.biological determinism.
THE UNIVERSITY OF CHICAGOSection of Genetic Medicine
Is Is ““AncestryAncestry”” better?better?
•• Useful index for human biological variation.Useful index for human biological variation.•• No historical baggage.No historical baggage.•• Increased discourse between disciplines.Increased discourse between disciplines.•• When used as an index for genetic background it allows When used as an index for genetic background it allows
for a better investigation of biological risk factors.for a better investigation of biological risk factors.
Era of Genomic Ancestry and challenges Era of Genomic Ancestry and challenges related to Health.related to Health.
1. Group definition and membership.
2. Can we accurately assess genomic ancestry?
3. How does genomic ancestry relate to skin color and possibly SES?
4. How useful is genomic ancestry for informing us about disease risk?
5. Health Disparities: are they due to biological differences?
6. How do we prevent repeating the negative past abuses of “race”.
Promises in the postPromises in the post--genome sequencing era.genome sequencing era.
1. Advances in microarray and DNA chip technology.
2. Increased research in diverse populations.
3. Integration of epidemiological, cultural, and population history.
THE UNIVERSITY OF CHICAGOTHE UNIVERSITY OF CHICAGOSection of Genetic MedicineSection of Genetic Medicine
Divergence of human populationsDivergence of human populations
Mountain et al. 2002
Genetic variation among the major continents
CD4 haplotype variation Tishkoff 2003 ARGHG
THE UNIVERSITY OF CHICAGOSection of Genetic Medicine
•• Genetic variation is not randomly distributed. Genetic variation is not randomly distributed. •• Frequencies vary with age of allele.Frequencies vary with age of allele.
•• Old = common across many populationsOld = common across many populations•• Recent = low frequency and localizedRecent = low frequency and localized
•• Population demographic history usually affects all Population demographic history usually affects all loci similarly.loci similarly.
•• Natural selection acts upon specific loci.Natural selection acts upon specific loci.
Body Mass Index
22 23 24 25 26 27 28 29 30
Perc
ent H
yper
tens
ive
0 .10
0.15
0.20
0.25
0.30
0.35
Nigeria
Cameroon
Jamaica
St. Lucia
Barbados
Maywood
Prevalence of Hypertension by Mean Body Mass Index Among Populations of the African Diaspora
North America
Caribbean
West Africa
Cooper R, Rotimi C. et al. AJPH. 1997
Farrer LA, JAMA 1997
1.1
5.6
3
0
1
2
3
4
5
6
Japanese Caucasian AfricanAmerican
Relative Risk
Alzheimer's Disease and APOE ε4 gene
Farrer LA, JAMA 1997
1.1
5.6
3
19%
14%
9%
0
5
10
15
20
Japanese Caucasian AfricanAmerican
Relative Risk
Alzheimer's Disease and APOE ε4 gene
Influencing factors
•Gene/gene and gene/environment interactions•Discrimination and perceived racism (stress process)•Accumulated stress (weathering, allostatic load, etc.)•Life course selection•Cultural factors•Behavioral differences•SES and institutional arrangement
Race(social)
Ancestry(genetic)
Disease
Genetic features of African AmericansGenetic features of African Americans
• High genetic heterogeneity due to African ancestry and admixture w/ non-African populations.
• Increased LD due to admixture.
• Pattern of variation differs geographically.
• High levels of population stratification may confound association studies.
Ancestry Informative Markers (AIMs)
• Genetic markers with large allele frequency difference (δ) between parental populations.
• For biallelic markers δ = ⎜p1-p2 ⎜
• Single Nucleotide Polymorphisms (SNPs) or Deletion/ Insertion Polymorphisms (DIPs).
Tian et al. (2006) AJHG
δδ of AIM SNPs for West African/ Europeansof AIM SNPs for West African/ Europeans
Biogeographical ancestry• Usefully accurate individual ancestry estimates
possible using ancestry informative markers• Many populations show variation in individual
ancestry levels• Ancestry estimates can be used to control for
heterogeneity in admixed populations•• Conditioning variable for regression modelsConditioning variable for regression models•• Matching cases and controls Matching cases and controls •• Bayesian Admixture MappingBayesian Admixture Mapping
Plot of individual ancestry estimates using STRUCTURE Plot of individual ancestry estimates using STRUCTURE ((FalushFalush et al. 2003)et al. 2003) on 112 AIMson 112 AIMs
Bamileke (Cameroon) European Americans (MD) African Americans (DC)(23.2% European ancestry)
Individual Ancestry: Individual Ancestry: Beyond Black and WhiteBeyond Black and White
AfricanAfrican--AmericanAmerican sample sample from Washington, D.C. from Washington, D.C. (n=221) (n=221)
EuropeanEuropean--AmericanAmerican sample sample from State College, PA from State College, PA (n=193)(n=193)
Individual Individual Ancestry:Ancestry:San Luis San Luis Valley, CO Valley, CO HispanicsHispanics
Bonilla et al. (2004) Annals of Human Genetics 68:139-153.
Individual Individual Ancestry:Ancestry:Puerto Rican Puerto Rican Women from Women from New York CityNew York City
Bonilla et al. (2004) Human Genetics 115:57-68.
European genetic contribution in African-American populations living in different geographical areas of the US.
Parra et al. AJHG 1998; Parra et al. AJPA 2002; Kittles et al. unpublished
Genetic Ancestry in Caribbean PopulationsGenetic Ancestry in Caribbean Populations
Jamaica:Jamaica: Closed circlesBarbados:Barbados: Open circlesSt. Thomas:St. Thomas: Triangles
Race(social)
Ancestry(genetic)
Disease
PIAPIA PINPIN PcaPca
Nelson et al. Mechanism of Disease: Prostate Cancer. Nelson et al. Mechanism of Disease: Prostate Cancer. NEJM 349:4, 2003NEJM 349:4, 2003
Prostate cancer: epidemiology
0
50
100
150
200
250
300
Asian/PacificIslander
White Black
inci
denc
e ra
te p
er 1
00,0
00 m
en
SEER data – 1998-2002age adjusted
?
Population differencesPopulation differences•• Prostate cancer incidence.Prostate cancer incidence.
•• Platz et al. 2000, JNCI, 92:24.Platz et al. 2000, JNCI, 92:24.
•• Advanced stage prostate cancer.Advanced stage prostate cancer.•• Hoffman et al. 2001, JNCI, 93:5.Hoffman et al. 2001, JNCI, 93:5.
•• Prostate cancer mortality.Prostate cancer mortality.•• Thompson et al. 2001, JNCI, 93:3.Thompson et al. 2001, JNCI, 93:3.
Populations of African descentPopulations of African descent•• Kingston, Jamaica Kingston, Jamaica (Glover et al. 1998).(Glover et al. 1998).
•• ~300/ 100,000 men~300/ 100,000 men•• evidence for familial Pcaevidence for familial Pca
•• Nigeria Nigeria (Osegbe, 1997; Ogunbiyi and Shittu, 1999).(Osegbe, 1997; Ogunbiyi and Shittu, 1999).•• ~127/ 100,000 men~127/ 100,000 men•• increased incidence not related to screeningincreased incidence not related to screening
•• Cameroon (Angwafo et al. 2003).Cameroon (Angwafo et al. 2003).•• ~195/ 100,000 men~195/ 100,000 men•• rural population from rural population from DibombariDibombari (significant Pca and HGPIN)(significant Pca and HGPIN)
Risk Factors for Prostate CancerRisk Factors for Prostate CancerPositive family history is now considered the strongest risk factor for prostate cancer, especially early-onset disease (2 to 11-fold increased risk).Many genes have been implicated in hereditary and sporadic prostate cancer.Dietary risk factors include total fat intake, animal fat intake and consumption of red meat.Behavioral risk factors include smoking.
Dietary components that protect against Pca include the antioxidants lycopene (common in tomatoes), vitamins A, D, and E, and selenium.
Heterocyclic Aromatic Amines• HCA - are small molecules formed when components of food
proteins and creatine (components found in muscle) are exposed to high heat.
» Grilling/ Barbecuing » Broiling » Pan Frying
• PhIP - 2- Amino-1methyl-6phenylimidazo[4,5-b]pyridine - is a carcinogen “cancer causing”.
Felton et al. 1986
Why the differences in prevalence?Why the differences in prevalence?•• Overall increased genetic susceptibility.Overall increased genetic susceptibility.•• Increased androgen biosynthesis.Increased androgen biosynthesis.•• Strong environmental influences.Strong environmental influences.
•• Diet, exercise, carcinogen and /or pathogen exposuresDiet, exercise, carcinogen and /or pathogen exposures
•• UVR exposure and Vitamin D.UVR exposure and Vitamin D.•• Plasma Vitamin D levels influenced by UVR exposure, Plasma Vitamin D levels influenced by UVR exposure,
skin color, BMI, and dietskin color, BMI, and diet•• Lower UVR intensity in northern latitudesLower UVR intensity in northern latitudes
Scragg et al. (2004) Serum 25-Hydroxyvitamin D, Diabetes, and Ethnicity in the Third National Health and Nutrition ExaminationSurvey. Diabetes Care 27:2813–2818.
Garland et al. (2006) AJPH 96(2): 252-261
SKIN COLOR
UVR EXPOSURE
GENETIC BACKGROUND
LIGHT DARK
LOW RISK HIGH RISKfor Pca for Pca
High Moderate Low
DIETARY VITAMIN D
High LOWVitamin D Vitamin D intake intake
Protective RiskGenotypes Genotypes
MODIFIERS OF VITAMIN D AND PROSTATE CANCER RISK
Luscombe et al. 2001
Grant, 2002
Relationship between plasma 25(OH)-Vitamin D levels and lifetime UVR exposure* in 260 African American men.
P=0.008
*Based on UVQ (Harvey et al. 1996; Ramsay et al. 2000)
African American Hereditary Prostate African American Hereditary Prostate Cancer (AAHPC) StudyCancer (AAHPC) Study
Royal, C. et al. Recruitment experience in the first phase of thRoyal, C. et al. Recruitment experience in the first phase of the African American Hereditary e African American Hereditary Prostate Cancer (AAHPC) study. Prostate Cancer (AAHPC) study. Ann Ann EpidemiolEpidemiol 10, S6810, S68--77 (2000).77 (2000).
Powell, I.J. et al. AfricanPowell, I.J. et al. African--American heredity prostate cancer study: a model for genetic American heredity prostate cancer study: a model for genetic research. research. J Natl Med AssocJ Natl Med Assoc 93, 25S93, 25S--28S (2001).28S (2001).
Ahaghotu, C. et al. Clinical characteristics of AfricanAhaghotu, C. et al. Clinical characteristics of African--American men with hereditary prostate American men with hereditary prostate cancer: the AAHPC Study. cancer: the AAHPC Study. Prostate Cancer Prostate Cancer ProstaticProstatic DisDis 7, 1657, 165--9 (2004).9 (2004).
•• Recruit 100 informative AAHPC familiesRecruit 100 informative AAHPC families•• minimum of 4 clinically diagnosed malesminimum of 4 clinically diagnosed males•• age of onset less than or equal to 65 yearsage of onset less than or equal to 65 years•• minimum of 8 family membersminimum of 8 family members•• HPC only on 1 side of familyHPC only on 1 side of family
•• Find HPC genesFind HPC genes
Chicago
Houston
Detroit
Atlanta
Washington DC
New York
South Carolina
AAHPC Collaborative Recruitment Centers (1997AAHPC Collaborative Recruitment Centers (1997--2004)2004)
Candidate prostate cancer susceptibility genes with Candidate prostate cancer susceptibility genes with significant allele frequency differences between populationssignificant allele frequency differences between populations
• SRD5A21
• CYP11A11
• GST-T1,GST-M1, GST-P11
• IGF-11
• IGFBP-31
• Vitamin D receptor2
• Vitamin D binding protein2
• Androgen receptor3
• COX-24
• EphB25
• MSR18
• RNASEL8
• TRPV68
• CYP3A4 and CYP3A56,8
• ICAM gene cluster7
1Nam et al. 2004; 2Kidd et al. 2004; 3Kittles et al. 2001; 4Panguluri et al. 2004; 5Kittles et al. 2005;6Plummer et al 2003; 7Chen et al. 2006; 8unpublished
Revolution in genetics
ColonProstateBreast
Significance of identifying Significance of identifying susceptibility genessusceptibility genes
•• Improved diagnosticsImproved diagnostics•• better phenotypebetter phenotype
•• early detection and early detection and preventionprevention
•• pharmacogenomicspharmacogenomics•• efficient designer drugsefficient designer drugs
•• avoid complicationsavoid complications
THE UNIVERSITY OF CHICAGOTHE UNIVERSITY OF CHICAGOSection of Genetic MedicineSection of Genetic Medicine
UCCRC Diversity and Community Outreach UCCRC Diversity and Community Outreach Mission StatementMission Statement
The UCCRC is committed to building strong The UCCRC is committed to building strong meaningful relationships with the surrounding meaningful relationships with the surrounding community and recognizes the importance of community and recognizes the importance of education and trust in increasing participation education and trust in increasing participation of underrepresented communities in of underrepresented communities in population research, clinical trials and basic population research, clinical trials and basic research.research.
Efforts to Enhance Minority Accrual:Efforts to Enhance Minority Accrual:
Development of Development of Southside Community Southside Community PartnershipsPartnerships
• DuSable Museum of African American History
• Chicago Public Schools• Southside Farmer’s Markets• Southside Health
Collaborative – UHI• Southside Health and Vitality
Study (SSHVS)
Opportunities/ Future DirectionsOpportunities/ Future Directions
Preparation of R25 Preparation of R25 -- Cancer education grantCancer education grant““Community Curriculum on Cancer Disparities: Education and Community Curriculum on Cancer Disparities: Education and ActionAction””January submissionJanuary submissionPartner with City CollegesPartner with City Colleges
Develop forums surrounding populationDevelop forums surrounding population--based based research:research:
HPV, vaccinations and Cervical Cancer (March 2009 HPV, vaccinations and Cervical Cancer (March 2009 –– Ken Ken Alexander)Alexander)Marrow donors and transplantationMarrow donors and transplantation
Leverage our relationships with community health Leverage our relationships with community health centers:centers:
SummarySummary
African and Hispanic Americans are a socially, culturally, and genetically heterogeneous macro-ethnic group with diverse ancestries and continental U.S. experiences.
Exhibit significant population substructure.
Need to estimate genetic ancestral background to fully assess genetic and non-genetic confounders and predictors of complex diseases.
SummarySummary
Equitable benefits from genetic medicine depends on population genetics, market economics, and most importantly on historical and cultural identities.
Inclusion means paying attention to context…. (social, cultural and historical)
SpecificsSpecifics……
Take genetic ancestry into account in biomedical study designs (self-identified “Race” alone may be a confounder).
Figure out effects (interaction) of “Race”/ skin color, racism and poverty on health disparities.
Engage social scientists more to gain better appreciation and understanding of critical non-genetic (and genetic) variables which should also be explored.
Ohio State UniversityOhio State UniversityCassandra GrenadeCassandra Grenade
University of ChicagoUniversity of ChicagoStanley HookerStanley Hooker Rebecca Santos, MPH Rebecca Santos, MPH Wenndy Hernandez, M.S. Wenndy Hernandez, M.S. NefertitiNefertiti OjiOji--NjidekaNjidekaHankui Chen, Ph.D. Hankui Chen, Ph.D. Jada Benn, Ph.D. Jada Benn, Ph.D.
Oxford UniversityOxford UniversityCarolina Bonilla, Ph.DCarolina Bonilla, Ph.D..
COLLABORATORSCOLLABORATORSHoward UniversityHoward UniversityChiledum Ahaghotu, M.D.Chiledum Ahaghotu, M.D.Aaron Jackson, M.D.Aaron Jackson, M.D.Georgia Dunston, Ph.D.Georgia Dunston, Ph.D.Medical College of GeorgiaMedical College of GeorgiaSally Weinreich, Ph.D.Sally Weinreich, Ph.D.St. Thomas, Virgin IslandsSt. Thomas, Virgin IslandsNeil Garbutt, M.D.Neil Garbutt, M.D.University of LouisvilleUniversity of LouisvilleLa Creis Kidd, Ph.D.La Creis Kidd, Ph.D.Penn State UniversityPenn State UniversityMark Shriver, Ph.D.Mark Shriver, Ph.D.Translational GenomicsTranslational GenomicsJohn Carpten, Ph.D.John Carpten, Ph.D.
Johns Hopkins UniversityJohns Hopkins UniversityWilliam Isaacs, Ph.D.William Isaacs, Ph.D.University of Illinois, ChicagoUniversity of Illinois, ChicagoVincent Freeman, M.D.Vincent Freeman, M.D.LiberiaLiberiaLinda Sanvee, M.D.Linda Sanvee, M.D.CameroonCameroonFru Angwafo III, M.D.Fru Angwafo III, M.D.NigeriaNigeriaUsifo Osime, M.D. Usifo Osime, M.D. Clement Adebamowo, M.D.Clement Adebamowo, M.D.Meharry Medical CollegeMeharry Medical CollegeFlora Ukoli, M.B.B.S., MPHFlora Ukoli, M.B.B.S., MPHUniversity of WashingtonUniversity of WashingtonLayron Long, M.D.Layron Long, M.D.
FUNDINGFUNDINGNIGMS, NCRR, NCI, ORMH, and NHGRI of the National Institutes of NIGMS, NCRR, NCI, ORMH, and NHGRI of the National Institutes of Health.Health.Department of DefenseDepartment of Defense