Post on 19-Jun-2020
transcript
Research Collection
Doctoral Thesis
Promoter analysis and transcriptional regulation of the CMT1A-disease gene peripheral myelin protein PMP22
Author(s): Maier, Marcel
Publication Date: 2003
Permanent Link: https://doi.org/10.3929/ethz-a-004485643
Rights / License: In Copyright - Non-Commercial Use Permitted
This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.
ETH Library
Diss. ETH No. 14943
Promoter Analysis and Transcriptional Regulation
of the CMT1A-Disease Gene
Peripheral Myelin Protein PMP22
A dissertation submitted to the
SWISS FEDERAL INSTITUTE OF TECHNOLOGY (ETH) ZURICH
for the degree of
Doctor of Natural Science
presented by
Marcel Maier
Dipl. Natw. ETHZ, Switzerland
Born May 23, 1974
Citizen of Zürich (ZH), Switzerland
Accepted on the recommendation of
Prof. Dr. Ueli Suter, examiner
Prof. Dr. Peter Sonderegger, co-examiner
2003
for Carina and my parents
M
YELIN
G
ENE
R
EGULATION
T
ABLE
OF
C
ONTENTS
3
1 S
UMMARY
....................................................................5
2 Z
USAMMENFASSUNG
....................................................7
3 I
NTRODUCTION
.............................................................9
3.1 Origin and differentiation of Schwann cells................................. 93.2 Genetic defects in myelin proteins are associated with hereditary
peripheral neuropathies .............................................................. 113.3 Transcriptional control of myelin genes..................................... 13
3.3.1 Glial transcription factors and their function ......................................153.3.2 Transcriptional control elements in myelin genes ..............................16
3.4 Aim and motivation of the work ................................................ 25
4 M
YELIN
G
ENE
R
EGULATION
IN
VITRO
........................27
4.1 Aims and Experimental strategies .............................................. 274.2 Promoterdeletion study in MSC80 and NIH 3T3 cells .............. 294.3 Is PMP22 regulated by Sox10 in N2a cells? .............................. 324.4 Screening for transcription factors upregulated upon Krox20
induced myelin gene expression................................................. 33
5 R
EGULATORY
E
LEMENTS
ON
THE
-10/0
KB
PMP22 L
AC
Z T
RANSGENE
...............................................37
5.1 Aims and Experimental strategies .............................................. 375.2 Generation of transgenic mice expressing the reporter lacZ gene
under the control of the PMP22 promoters (-10/0kb PMP22 LacZ)..................................................................................................... 37
5.3 Analysis of the first wave of -10/0kb PMP22 lacZ expression during embryonic development.................................................. 39
5.4 -10/0kb PMP22 lacZ expression is strongly upregulated in postnatal neurons and Schwann cells of peripheral nerves ........ 41
5.5 Transgenic ß-gal expression in sensory and motor neurons of cranial nerves.............................................................................. 45
5.6 Tissue specificity of the -10/0kb PMP22 lacZ transgene........... 465.7 -10/0kb PMP22 lacZ transgene regulation in Schwann cells after
loss of axonal contact and in regeneration. ................................ 485.8 Sciatic nerve of PMP22 mutant animals show reduced ß-gal levels
.................................................................................................... 50
M
YELIN
G
ENE
R
EGULATION
T
ABLE
OF
C
ONTENTS
4
6 PMP22 P
ROMOTER
D
ELETION
A
NALYSIS
IN
VIVO
....53
6.1 Late myelination Schwann cell specific elements (LMSE) reside in the 6 kb DNA fragment upstream of promoter ........... 55
6.2 The LMSE confer Schwann cell specificity to the non-cell type-specific
hsp68
promoter and are functionally independent of core promoter 1 and exon 1A ..................................................... 59
6.3 The 4 kb sequence upstream of exon 2, including promoter 2, contains elements directing expression in sensory neurons ....... 62
7 C
OMPUTATIONAL
A
NALYSIS
OF
C
ONSERVED
P
ROMO
-
TER
E
LEMENTS
AND
R
EPETITIVE
G
ENOMIC
R
EGIONS
65
8 D
ISCUSSION
AND
O
UTLOOK
.......................................69
8.1 PART I: Myelin Gene Regulation
in vitro
................................. 698.2 PART II: Regulatory Elements on the -10/0kb PMP22 lacZ ........
Transgene ................................................................................... 738.3 PART III & IV: PMP22 Promoter Deletion Analysis
in vivo
.... 77
9 EXPERIMENTAL METHODS ................................87
9.1 Generation of reporter constructs ............................................... 879.2 Generation of transgenic animals ............................................... 889.3 ß-gal histochemical analysis....................................................... 899.4 ß-gal solution assay .................................................................... 909.5 Quantitative analysis of PMP22 mRNA levels .......................... 919.6 PMP22-lacZ x PMP22-/- and PMP22-lacZ x Tr mice ............... 929.7 Sciatic nerve transsection and crush........................................... 939.8 Immunocytochemistry of dissociated DRG ............................... 939.9 Cell culture, transfection and reporter assays............................. 949.10 Sequence analysis and determination of potential binding sites 96
10 R
EFERENCES
...............................................................9711 A
CKNOWLEDGEMENTS
.............................................11112 C
URRICULUM
V
ITAE
................................................112
S
UMMARY
- Z
USAMMENFASSUNG
5
1 S
UMMARY
Minor changes in Peripheral Myelin Protein 22 (PMP22) gene dosage have profound
effects on the development and maintenance of peripheral nerves. This is evident from
the genetic disease mechanisms in the hereditary peripheral neuopathy Charcot-Marie-
Tooth disease type 1A (CMT1A) and Hereditary Neuropathy with liability to Pressure
Palsies (HNPP) as well as in transgenic animals with altered PMP22 gene dosage. Thus,
regulation of
PMP22
is a crucial aspect in understanding the function of this protein in
health and disease.
As a first approach to study PMP22 transcriptional regulation, I have generated
transgenic mice containing ten kilobases of 5`-flanking region of the
PMP22
gene,
including the two previously identified alternative promoters, fused to a
lacZ
reporter
gene. I showed that this part of the
PMP22
gene contains the necessary information to
reflect the endogenous expression pattern in peripheral nerves during development,
regeneration, and in mouse models of demyelination due to genetic lesions. Transgene
expression is strongly regulated during myelination, demyelination and remyelination in
Schwann cells, demonstrating the important influence of neuron-Schwann cell
interactions in the regulation of
PMP22
. In addition, the region of the
PMP22
gene
present in this transgene also directs expression in sensory and motor neurons.
These results provided the basis for further analysis of the elements that direct these
specific aspects of temporal and spatial regulation of the
PMP22
gene. To this end, I
subdivided the ten kilobase 5’-flanking region of the PMP22 gene and analyzed different
cis-acting elements as a fusion with either the corresponding PMP22 promoter or a
heterologous hsp68 promoter, both together with a lacZ reporter gene in vivo. This
revealed the existence of two separate elements. The first is a late myelinating Schwann
cell specific element (LMSE) located 5’ to promoter 1 of PMP22. The LMSE is strongly
regulated during myelination and is responsible for specific expression of PMP22 during
the later phase of myelination in Schwann cells. The second element, 2kb 5’ of and
including promoter 2 of PMP22, was active postnatally specifically in sensory neurons.
The activities of these two elements contribute to distinct parts of the endogenous
PMP22 expression.
SUMMARY - ZUSAMMENFASSUNG
6
These in vivo studies were complemented by cell culture experiments analysing PMP22
regulatory elements in a promoter deletion study with transient transfection assays of
PMP22 promoter-driven lacZ reporter constructs. Furthermore, I established a system
with which to further analyse the initiation of myelin gene expression in cell culture.
Combined with a bioinformatics-based determination of conserved regulatory elements
and potential binding sites for transcription factors, these different approaches
contributed to a better understanding of the temporal and spatial regulation of PMP22.
Furthermore, these results provide the basis for further dissection of the molecular basis
responsible for late postnatal expression of PMP22 and the corresponding pathways
converging on the LMSE. These pathways may be important in myelin maintenance or in
demyelinating peripheral neuropathies.
SUMMARY - ZUSAMMENFASSUNG
7
2 ZUSAMMENFASSUNG
Aenderungen in der Kopienzahl für das Periphere Myelin Protein 22 (PMP22) haben
erhebliche Auswirkungen auf die Entwicklung und Erhaltung des peripheren
Nervensystems (PNS). Dies wurde offenkundig durch die Erforschung der genetischen
Mechanismen der hereditären Motorischen und Sensiblen Neuropathie Charcot-Marie-
Tooth Typ 1A (CMT1A), der Hereditären Neuropathie mit Neigung zu Druckparesen
(HNPP-Hereditary Neuropathy with liability to Pressure Pulsies) sowie dem Studium
von Tiermodellen mit veränderter PMP22 Kopienzahl. Diese Arbeiten zeigten, dass die
Regulation des PMP22 Genes einen essentiellen Aspekt darstellt, um die Rolle dieses
Proteins in der normalen Entwicklung sowie in der Entstehung von Neuropathien zu
verstehen.
Um die transkriptionellen Regulation von PMP22 zu analysieren, generierte ich zunächst
eine Maus, die als Transgen die 10 Kilobasen (kb) der 5’ Region des PMP22 Genes trägt.
Diese 10 kb grosse Region beinhaltet die beiden bekannten PMP22 Promoteren und ist
im Transgen mit einem LacZ Reportergen fusioniert. In der folgenden Analyse zeigte
ich, dass dieser Teil des PMP22 Gens die notwendigen Informationen enthält, um die
endogene Expression im PNS während der Entwicklung, der Regeneration und in
Tiermodellen für Periphere Neuropathien wiederzuspiegeln. Während der
Myelinisierung, der De- und Remyelinisierung wurde die Transgenexpression in
Schwann’schen Zellen, ebenso wie die Expression des endogenen PMP22, stark
reguliert. Dies zeigt, wie wichtig die Interaktion von Neuronen mit den Schwann’schen
Zell für die Regulation von PMP22 ist. Diese 10 kb grosse Region des PMP22 Gens
führt zudem zur Expression des Reportergens in sensorischen und motorischen
Neuronen des PNS.
Diese Resultate dienten als Basis für eine weitere Analyse der Elemente, die für die
spezifische, zeitliche und räumliche PMP22 Expression verantwortlich sind. Zu diesem
Zweck unterteilte ich die 10 kb der 5’ Region von PMP22. Die verschiedenen daraus
resultierenden cis-wirkenden Elemente analysierte ich als Fusion mit den
entsprechenden PMP22 Promotoren respektive mit dem heterologen hsp68 Promotor in
vivo. Als Reportergen wurde weiterhin das LacZ verwendet. Dies führte zur Entdeckung
SUMMARY - ZUSAMMENFASSUNG
8
von zwei verschiedenen Elementen. Das erste Element nannten wir das “späte
Myelinisierung- und Schwann’sche Zell-spezifisches” Element (LSME - late
myelinating Schwann cell specific element) welches 5’ vom Promoter 1 lokalisiert
wurde. Während der Myelinisierung ist das LSME verantwortlich für die starke und
spezifische Regulation der PMP22 Expression während der späten Phase der
Myelinisierung. Das zweite Element, lokalisierte ich zwei Kilobasen 5’ vom Promoter 2.
Es war zusammen mit Promotor 2 spezifisch in sensorischen Neuronen postnatal aktiv.
Die Aktivität dieser beiden Elemente reguliert offenbar verschiedene Aspekte der
endogenen PMP22 Expression.
Die in vivo Studien wurden ergänzt durch Zellkulturexperimente. Hier analysierte ich die
regulatorischen PMP22 Elemente in einer Promoterdeletionsstudie nach transienten
Transfektionen von PMP22 Promoter-lacZ Reporterkonstrukten. Zudem etablierte ich
ein System, mit welchem die Analyse der Initiation der Myelingenexpression in Zell-
kultur studiert werden kann. Die Resultate dieser verschieden Ansätze konnten mit
Bioinformatik-basierten Bestimmungen der konservierten, regulatorischen Elemente
sowie der potentiellen Bindungsstellen für Transkriptionsfaktoren kombiniert werden.
Diese verschiedenen Analysen bilden die Basis für das weitere Studium der molekularen
Mechanismen der Expression von PMP22 während der späten Phase der Myelinisierung
und der entsprechenden Signalwege an diesem LSME. Weitere Analysen werden zeigen,
ob die Signalwege an den indentifizierten LSME für die Erhaltung der Myelinschicht
oder bei der Pathogenese von demyelinisierenden, peripheren Neuropathien essentiell
sind.
MYELIN GENE REGULATION INTRODUCTION
9
3 INTRODUCTION
3.1 Origin and differentiation of Schwann cells
The trunk neural crest gives rise to melanocytes, neurones and peripheral glia. Among
the glia are the Schwann cell precursors, found in rat peripheral nerves at E14 to E15,
and in mouse nerves at E12 to E13. In a relatively abrupt transition between E16 and E17
(rat) or E14 and E15 (mouse), immature Schwann cells are formed while migrating into
the periphery along the axonal tracts. These then diverge around the time of birth to give
rise to myelinating and non-myelinating Schwann cells (Fig. 3-1). Here, their fate is
tightly controlled by axonal signals, e.g. by trophic factors such as neuregulin that
promote the survival of the Schwann cells and their precursors (for review see Jessen and
Mirsky, 1999; Lobsiger et al., 2002). Prospectively myelinating Schwann cells form a
1:1 relationship with axons prior to myelination. Schwann cells with this morphology are
often referred to as pro-myelinating Schwann cells. Larger calibre axons (1µm and more)
will be myelinated with each myelinating Schwann cell providing one myelin internode
(Fig. 3-2). The transition from the promyelinating to the myelinating stage is then
accompanied by a number of significant changes in the pattern of gene expression,
including the activation of a set of genes encoding myelin structural proteins and lipid
biosynthetic enzymes, and the inactivation of a set of genes expressed only in immature
or nonmyelinating Schwann cells. Smaller calibre axons remain unmyelinated and are
ensheathed in bundles of 5-30 axons by the non-myelinating Schwann cells (Friede and
Samorajski, 1968). Both types of Schwann cells are surrounded by a basement
membrane, which separates them from other components of the endoneurium in the
peripheral nerve and anchors them in the extracellular matrix.
The myelin sheath formed by Schwann cells can be of extremely large diameter,
consisting of up to 100 wrappings. Schwann cell myelin contains incisure (Schmidt-
Lantermann incisures) which traverse the compact myelin. These funnel-shaped domains
of uncompacted myelin contain remnants of cytoplasm and, similar to the paranodal
loops, contain different proteins than are found in compact myelin (for review see
Scherer, 1999; Scherer and Arroyo, 2002).
MYELIN GENE REGULATION INTRODUCTION
10
Figure 3-1: Diagrammatic representation of the development of Schwann cells inrat and mouse with their molecular markers (adapted with modifications fromJessen and Mirsky, 1999).
Upon nerve transection, or when dissociated and placed in tissue culture, myelinating
and non-myelinating Schwann cells undergo a reversion in molecular phenotype
comparable to that seen in immature nerves. In regenerating nerves, these Schwann cells
again differentiate into myelinating and non-myelinating Schwann cells. Thus the
Schwann cell molecular and morphological phenotype is reversible from the immature
Schwann cell state onwards.
���
������
�� �
���
�� �
�����
��� ���
���� ��
���� �����
���
���
��
��� ���
�����
����
���� ��� ���
���� ��
���
��� ���
��
��
!�
� ���
��
���
��
���
����
��� ���
���� ��" � ���
#$ #� #� ����� ��
MYELIN GENE REGULATION INTRODUCTION
11
Figure 3-2: Simplified and schematic anatomy of the spinal nerves of the peripheralnervous system. Abbreviations: DRG: Dorsal root ganglion, NMJ: Neuromuscularjunction
3.2 Genetic defects in myelin proteins are associated withhereditary peripheral neuropathies
The hereditary peripheral neuropathy Charcot-Marie-Tooth disease (CMT) comprises a
heterogeneous group of genetic human disorders that affect the peripheral nervous
system (PNS) with an estimated prevalence of 1:2500 (Skre, 1974). In recent years
mutations in up to ten genes have now been identified in humans as culprits in different
forms of CMT (reviewed by Berger et al., 2002; Maier et al., 2002b; Young and Suter,
2001), suggesting that there are different important players in the interplay between
Schwann cells and neurons. Three of the PNS myelin proteins, PMP22, Cx32 and MPZ,
have been linked to one of the most common forms of hereditary motor and sensory
neuropathies (HMSN), the Charcot-Marie-Tooth disease type 1 (CMT1; reviewed by
Suter et al., 1995).
In my thesis project, I focused on the gene encoding the peripheral myelin protein 22
(PMP22) which is the gene involved in the vast majority of patients affected by the
MYELIN GENE REGULATION INTRODUCTION
12
hereditary peripheral neuropathy Charcot-Marie-Tooth disease (CMT; subtype CMT1A;
reviewed in Maier et al., 2002b; Young and Suter, 2001; Suter and Snipes, 1995).
Patients suffering from CMT1A, the most common form, show slowed nerve conduction
velocities, reduced compound motor and sensory nerve action potentials, progressive
distal limb weakness, sensory loss, and decreased reflexes (Dyck et al., 1993).
Histologically, characteristic findings in these patients are progressive demyelination of
motor and sensory nerves associated with incomplete remyelination. In the majority of
the patients the autosomal-dominant CMT1A is due to an intrachromosomal duplication
on chromosome 17p11.2, leading to the presence of an extra copy of the gene for
peripheral myelin protein 22. The reciprocal deletion of the same DNA fragment has also
been identified in patients and is associated with hereditary neuropathy with liability to
pressure palsies (HNPP; Chance et al., 1993), which is usually not progressive but rather
characterized by temporary palsies after pressure trauma (Windebank, 1993; Amato et
al., 1996). In addition, PMP22 missense mutations have been found in some rare cases of
familial CMT1A without the usual chromosomal duplication (Roa et al., 1993; Naef and
Suter, 1999).
The findings derived from the genetics of CMT1A and HNPP, and the fact that the
PMP22 gene is neither disrupted by the CMT1A duplication nor mutated in these
patients, led to the suggestion that altered PMP22 gene dosage may be responsible for
these two frequent neuropathies. The observation that homozygous CMT1A duplication
patients are often more affected than heterozygous relatives supports this hypothesis
(Lupski et al., 1991; Kaku et al., 1993). Additional evidence that PMP22 is a dosage-
sensitive gene has been provided by accurate animal models in which mice and rats carry
variable numbers of the PMP22 gene (Adlkofer et al., 1995; Huxley et al., 1996; Magyar
et al., 1996; Sereda et al., 1996). In particular, a twofold increased PMP22 gene dosage
in transgenic rats led to a morphological phenotype comparable to CMT1A. Transgenic
mice retaining only one functional PMP22 allele develop, as expected from the
analogous human disease, a pathology comparable to HNPP, whereas mice lacking
PMP22 completely develop a demyelinating peripheral neuropathy reminiscent of severe
CMT1A (Adlkofer et al., 1995). Two different missense mutations in the PMP22 gene
have also been found in the allelic mouse mutants Trembler (Tr) and Trembler-J (Tr-J),
which initially implicated PMP22 as the critical gene within the CMT1A duplication.
MYELIN GENE REGULATION INTRODUCTION
13
Since these animals show a PNS-specific dismyelination, they have been proposed to be
suitable models for CMT1A (Suter et al., 1992a, b).
Taken together, these findings suggest that the PMP22 gene must be very tightly
regulated since already slightly higher or lower gene dosage (150% in CMT1A; 50% in
HNPP) lead to a disease phenotype.
Interestingly, a comparable phenomenon is observed for the proteolipid protein (Plp)
gene. Similar to the situation in CMT1A for PMP22 increased gene dosage resulting
from a duplication of the proteolipid protein (Plp) gene is one of the causes of the
Pelizaeus-Merzbacher disease (PMD) and leads to myelination abnormalities in the CNS
(reviewed by Anderson et al., 1999; Yool et al., 2000). Transgenic mice carrying extra
copies of the wild-type Plp gene provide a valid model of PMD. Variations in gene
dosage can cause a wide range of phenotypes from severe, lethal dysmyelination through
late-onset demyelination.
3.3 Transcriptional control of myelin genes
The extremely high and transient demand for newly synthesized myelin proteins during
nerve development and regeneration is accompanied by the coordinated expression of
genes which encode myelin components (reviewed by Toews et al., 1997). Deciphering
the molecular basis of this regulation is crucial for our understanding of the interplay
between neurons and glia cells in myelin formation in health and in diseases such as
multiple sclerosis and neuropathies.
In the PNS, two main strategies have been employed to address this issue. First, efforts
have been made to identify potential master regulators of myelin gene expression in
analogy to the transcription factor MyoD in muscle development (reviewed by Borycki
and Emerson, 1997). This search has proven to be quite difficult, although during the last
years, some candidates have been identified. These will be introduced in chapter 2.3.1
below.
The second approach involves the search for regulatory regions within myelin genes,
since cell-type specific transcriptional control mechanisms can be unravelled by the
MYELIN GENE REGULATION INTRODUCTION
14
identification and characterization of cis-acting control elements in genes preferentially
expressed in a given cell-type or tissue. A number of myelin genes have been studied
with regard to their transcriptional regulation. Sometimes this was done in transgenic
mice, more frequently in tissue culture systems by transient transfection and in vitro by
DNA binding studies. Each of these methods used in gene regulation studies has its
advantages and its limitations. Transgenic approaches, for instance, unequivocally
determine the capacity of a regulatory region to drive temporal and cell type-specific
expression. Therefore transgenic mice provide an excellent assay system to examine
gene regulation, in particular under conditions which require numerous developmental
and physiological signals for correct interactions (reviewed by Duchala et al., 1996).
This situation is obvious in the intensive axon-glia interactions in PNS development and
thus, regulation of myelin genes and their regulators are most accurately characterized in
vivo. Such studies have the disadvantage that they are time-consuming and labor-
intensive, and hardly suited for an in-depth fine-mapping analysis. By contrast, transient
transfections in tissue culture combined with in vitro DNA-binding experiments provide
an efficient tool for a rapid molecular dissection of a regulatory region (for example, see
Brown and Lemke, 1997). However, they do not always give a clear answer as to whether
the region under study is by itself sufficient to elicit the cell type-specific expression of
the gene to which it belongs. Furthermore such studies require a system in which the
gene of interest is expressed at reasonable levels compared to the expression in vivo
(compare also chapter 4.1 of this thesis). Especially when studying myelin genes there
are very often limitations due to the fact that Schwann cells do not myelinate in vitro
without co-culturing with neurons. Taking these limitations into consideration, a
combination of in vivo, tissue culture, and in vitro methods is likely to give the most
meaningful results. The region responsible for temporal and tissue-specific expression
can first be localized to a larger genomic fragment by transgenic techniques. Well-chosen
tissue culture systems and DNA-binding studies can then be used to map the potentially
important cis-acting elements within this region. Finally, the importance of these
elements should again be confirmed in vivo, for example by deleting the regulatory
element by homologous recombination in embryonic stem cells, which may result in the
generation of a cell-type specific allele or a cell type-specific null mutant in case of a cell
type- specific enhancer (for example see Ghazvini et al., 2002). In the past, some myelin
MYELIN GENE REGULATION INTRODUCTION
15
genes and their regulatory elements have been analyzed in separate studies both in
transgenic mice and in tissue culture. Some aspects of the transcription regulation of
myelin genes with the focus on those which are expressed during myelination in the PNS
are introduced below in chapter 3.3.2. They will give an idea about the variety of
potential regulatory mechanisms which might be involved in the transcriptional
regulation for PMP22.
3.3.1 Glial transcription factors and their function
Several transcription factors that exert a pivotal role in Schwann cells have been
identified as components of the molecular mechanisms initiating myelination. These
include the zinc finger protein Krox20/Egr-2 and the POU protein Oct-6/SCIP/Tst-1/
Pou3f1 (referred to Oct-6 in the thesis; reviewed by Zorick and Lemke, 1996; Zorick et al.,
1999). In support of this hypothesis, the generation of null mutant mice has revealed
important roles for these factors in the process of myelination. In both Krox20 and Oct-6
mutants, Schwann cells appear morphologically arrested at the promyelinating stage
(Bermingham et al., 1996; Jaegle et al., 1996; Topilko et al., 1994). Detailed analysis of
the Krox20 mutant showed severe defects in Schwann cell development resulting in an
hyperproliferation and presumed differentiation arrest at the promyelinating stage
(Topilko et al., 1994). Although Oct-6 mutant Schwann cells exhibit a phenotype similar
to that of Krox20 mutants during the first week after birth, myelination subsequently
resumes (Jaegle et al., 1996). This has led to the suggestion that Oct-6 is involved in the
timing of myelination, whereas Krox20 would be integral to the myelination program
(Jaegle and Meijer, 1998). Consistent with the latter hypothesis, genome expression
profiling studies in Schwann cells revealed that Krox20 regulates multiple genes
involved in myelin formation (Nagarajan et al., 2001). These results are reinforced by
clinical studies on patients with hypomyelinating neuropathies including congenital
neuropathies, Charcot-Marie-Tooth type 1, and Dejerine-Sottas syndrome (compare
chapter 3.2). Some of these patients carry dominant or recessive point mutations
affecting different domains of the Krox20 protein (Boerkoel et al., 2001; Timmerman et
al., 1999; Warner et al., 1998).
MYELIN GENE REGULATION INTRODUCTION
16
Additional transcription factors that may affect late steps in the differentiation of
Schwann cells and may be involved in myelin gene regulation include Pax-3, c-Jun,
Krox24/Egr-1 and Sox10 (reviewed by Scherer, 1997; Wegner, 2000a). Sox10 has been
identified as a common transcriptional modulator of Oct-6, Krox20 and Pax3 potentially
conferring cell specificity to interacting transcription factors in developing and mature
glia (Kuhlbrodt et al., 1998). Indeed, recent results suggest a crucial role of Sox10 in
peripheral glia development (Britsch et al., 2001; Paratore et al., 2001) and regulation of
the major PNS myelin protein MPZ by Sox10 has been demonstrated (Peirano et al.,
2000) (compare chapter 4.3).
Recently, it was shown that the POU domain transcription factor Brn-5/Pou6f1 has a
developmental expression pattern inverse to that of Oct-6, with Brn-5 stably expressed in
the adult myelinating Schwann cell, but virtually absent during promyelination (Wu et
al., 2001). Beside Brn-5, the discovery that another POU domain transcription factor
Brn-2/Pou3f2 is not restricted to CNS remyelination, but is expressed in a pattern similar
to that exhibited by Oct-6 during Schwann cell myelination of neonatal nerves and
during regeneration of crushed adult nerve, made this transcription factor to an additional
candidate for the regulation of myelin genes (Sim et al., 2002).
Besides the Schwann cell-specific transcription factors mentioned above binding sites
have been also identified for various groups of transcription factors such as AP-1, CREB,
STAT, NF-κB or several members of the nuclear receptor family, which are known to
translate extracellular signals used by many different cell-types into changes of gene
expression. These are well-described components of trans-acting factors in the
transcription machinery of myelinating glia and may also take part in the regulation of
myelin gene expression in the PNS (reviewed by Wegner, 2000a).
3.3.2 Transcriptional control elements in myelin genes
Much biological regulation takes place at the level of transcription initiation, where an
assortment of varied ‘enhancer’ and ‘silencer’ sequences serve as docking sites for
transcriptional activators and repressors, the precise combination of which controls gene
MYELIN GENE REGULATION INTRODUCTION
17
expression. Although inspection of myelin gene sequences has suggested the presence of many
transcription factor binding sites, so far only a few transcription factors have been documented to
bind to the promoter regions of myelin genes in vitro or in vivo. Nevertheless, the focus of the
following chapter is on myelin gene transcription in the PNS, in particular on the structure and
regulation of myelin gene promoters. An overview of regulation of glial transcription
with the corresponding references can be found in Tab 1. The topic is reviewed in more
detail in (Wegner, 2000a, b).
Myelin Protein Zero (MPZ/P0)
One of the best-analyzed myelin genes is the myelin protein zero gene (MPZ/P0), which
encodes a tetramer-forming 31-kilodalton (kDa) transmembrane glycoprotein of the
immunoglobulin superfamily with specific expression in the Schwann cell lineage. MPZ
expression starts early in these cells, possibly in neural crest cells already committed to a
glial fate (Hagedorn et al., 1999; Lee et al., 1997). It is massively upregulated in
Schwann cells during the onset of myelination. MPZ is a major myelin component
accounting for more than 50% of the protein in PNS myelin. It is actively involved in
stabilizing the myelin sheath by binding to other MPZ molecules in opposing
membranes via homophilic interactions (for review see Mirsky and Jessen, 1999;
Scherer, 1997).
Experiments on the 5’ flanking region of the rat MPZ gene have shown, both in culture
and in transgenic mice, that 1.1 kilobases (1kb) upstream of the transcription start site are
sufficient to drive expression in Schwann cells (Lemke et al., 1988; Messing et al.,
1992). However, transgene expression with this construct in mice was variable between
single Schwann cells and there was evidence of ectopic expression. Consistently, another
group could not express lacZ under control of a similar small pieces of the MPZ
promoter specifically in Schwann cells. A more consistent expression was obtained using
the complete mouse MPZ gene, including 6kb of 5’ flanking sequences plus all exons
and introns (Feltri et al., 1999). Nevertheless, the 1.1kb part of the MPZ promoter is
capable of recapitulating some essential features of MPZ expression, including low-level
expression during early phases of PNS development and increased expression in
myelinating Schwann cells. Mapping studies in Schwann cell cultures have been used to
dissect this 5’ flanking region into functional domains (Brown and Lemke, 1997). These
MYELIN GENE REGULATION INTRODUCTION
18
include (1) a core promoter, which has little activity on its own and which spans
positions -100 to +45 relative to the transcription start site (defined as +1); (2) a potently
activating proximal promoter region from position -350 to -100, which exhibits high
sequence conservation among rat, mouse and humans, and which is responsible for
greater than 50% of the activity of the MPZ promoter in Schwann cell cultures; and (3)
an accessory distal region from positions -910 to -315 which makes up for the rest of the
activity (Table 1).
Similarly structured promoters are also found in other myelin genes, for instances the P2
gene (Bharucha et al., 1993) and the myelin-associated glycoprotein gene (MAG)
(Grubinska et al., 1994; Laszkiewicz et al., 1997; Ye et al., 1994) (Table 1).
DNase footprinting of the MPZ promoter revealed the presence of numerous binding
sites in all three parts (Brown and Lemke, 1997). Some binding sites were occupied by
proteins from glial and nonglial cells, while others showed differential protection in one
cell type only. Most of the identified cis-acting elements in these experiments do not
correspond to known transcription factor binding sites, with the exception of a GC rich
binding site and CAAT boxes in the core promoter region. The GC-rich binding site is
recognized by Sp1 family proteins, and the CAAT boxes are recognized by NF-Y
(Brown and Lemke, 1997). Both CAAT boxes and GC-rich binding sites are found in a
number of other glial promoters (Table 1), including that of Oct-6 (Kuhn et al., 1991)
and Promoter 1 (see section below) of PMP22 (Suter et al., 1994),
Myelin Basic Protein (MBP)
Myelin basic proteins (MBP) occur both in myelinating Schwann cells and in
oligodendrocytes as multiple isoforms transcribed from the same gene. MBP are highly
charged proteins with high affinity for membranes and mediate the close apposition of
myelin membranes on their cytoplasmic sides. MBP makes up 3% of total myelin in the
PNS and 30% of total myelin protein in the CNS. The MBP gene is part of the larger
Golli-mbp gene, which is conserved between humans and rodents (Campagnoni et al.,
1993; Pribyl et al., 1993). Numerous transgene experiments have been carried out with
5’flanking regions, employing varying length ranging from 256bp to 6.5kb taken from
mouse or human MBP gene (reviewed by Ikenaka and Kagawa, 1995). Interestingly, all
the transgenes exhibited expression in cells of the oligodendrocyte lineage, although the
MYELIN GENE REGULATION INTRODUCTION
19
penetrance of transgene expression was lower for example in the transgenes containing
only 256bp (Goujet-Zalc et al., 1993). None showed expression in Schwann cells.
Nevertheless, this short proximal promoter region seems to contain the necessary
information for oligodendrocyte-specific expression with further upstream sequences
amplifying the effect. Expression of the transgenes comes on in the oligodendrocyte
lineage with the developmental profile typical of MBP. Most transgenes, however,
exhibit a decline in expression after peaking during the active myelination period, and do
not show the strong maintained level of expression seen for MBP during adulthood.
Comparable observations were also made with a transgene under the control of the
immediate 5’ flanking region of the CNP gene where the correct temporal expression of
the transgene was obtained only in oligodendrocytes (Gravel et al., 1998) (Table 1).
Together with the MBP transgenes, it was proposed that differential regulatory elements
may exist for oligodendrocyte-specific versus Schwann cell-specific expression and for
early versus late expression of myelin genes.
Indeed, a recent in vivo promoter study identified DNA elements responsible for MBP
expression in the PNS (Forghani et al., 2001). Evidence was provided for the
participation of multiple, widely distributed, positive and negative elements in the overall
control of MBP expression. Especially, all constructs bearing a 0.6 kb far- upstream
sequence, designated Schwann cell enhancer 1 (SCE1), expressed at high levels in
myelin-forming Schwann cells. In addition the 0.6 kb SCE1 alone shows robust targeting
activity independent of other MBP 5' flanking sequence.
The MBP promoter has also been extensively characterized in transient transfections and
in vitro using transcriptionally competent brain extracts. Taken together these studies
agreed with the in vivo analysis in that a comparatively short region preceding the
transcription start site was found to contain the information necessary for
oligodendrocyte-specific expression (Table 1). Using various methods to detect protein-
DNA interactions in vitro, this region was shown to contain numerous sites capable of
binding both ubiquitous and cell type-specific nuclear proteins (e.g. Devine-Beach et al.,
1990). Most of these binding activities are still poorly characterized at the molecular
level. However, it has been shown that this proximal promoter region contains response
elements for the thyroid hormone receptor (TR) (Farsetti et al., 1992; 1991) and for
members of the NF-I and Sp1 family of transcription factors (Aoyama et al., 1990;
MYELIN GENE REGULATION INTRODUCTION
20
Tamura et al., 1988) (Table 1). The latter two transcription factors are fairly ubiquitous
proteins and are generally believed to contribute to basal rather than to cell type-
dependent expression. Nevertheless, also an ubiquitous transcription factor like NF-I
may contribute to oligodendrocyte specificity by additional protein-protein and DNA-
protein interactions around the binding site of NF-I. Indeed, there are indications that the
NF-I site in the MBP promoter is part of a larger composite regulatory element, which is
flanked in the case of the human promoter on its 5’ site by a site for a not further
caracterized activity called MEBA (Taveggia et al., 1998). In the mouse promoter the 3’
flanking region is assumed to mediate binding of an activity called M1 (Aoyama et al.,
1990). Thus, one might speculate that such an NF-I centered nucleoprotein complex
could be an important determinant in creating the oligodendrocyte specificity of MBP
gene expression, without NF-I itself being oligodendrocyte specific.
TABLE 1: Regulatory regions of genes expressed in myelinating glia
(adapted with modifications from Wegner, 2000a)
Gene Expression Regulatory regions Binding sites Transgene (expression) Reference
P0 PNS Core: - 100 to + 45 TATA, CAAT, GC,Sox10, other fp
1.1 kb 5' flank (SC) Lemke et al., 1988;Prox: - 350 to - 100 Messing et al., 1992;Dist: - 915 to - 350 Brown et al., 1997
P2 PNS Core: - 293 to + 125 TATA, CAAT – Bharucha et al., 1993Prox: - 435 to - 293Dist: - 870 to - 435
PMP-22 PNS P1: - 298 to + 172 NFI, CAAT, TATA 10 kb 5' flanking (myelinating SC)
Suter et al., 1994ubiq. P2: - 352 to + 144 GC
L1 PNS, CNS Core: - 150 to + 118 NFI, GC, K-PaxhomeoproteinsNRSF
2.9 kb 5 Kallunki et al., 1997,1998;Enhancer: int 1 ex 1±4, int 1±3
Silencer: int 2 (CNS, PNS) Meech et al., 1999
MBP CNS, PNS Core: - 36 to + 12 TATA, GC, NFI, MEBA, 6.5±0.3 kb 59 e.g., Goujet-Zalc etal., 1993;Prox: - 256 to - 36 M1, TR, other FP Øank (OL, not SC)
FynRE: - 675 to - 647 STAT, C/EBP Tamura et al.,1990;Umemori et al., 1999
PLP CNS, (PNS) Core: - 186 to 1 87Promoter: - 1038 to
+ 87Enhancer: int 1
TATA, CAAT, MyT1,other fp
human: 4.2 kb 59 and1.5 kb 3' flank;mouse: 2.4 kb 5'flank, ex. 1,2, int 1(OL)
Nave and Lemke,1991; Berndt et al.,1992; Nadon et al.,1994; Wight et al.,1993, 1997
CNP CNS, PNS P1 TATA 4-kb 5' flank Gravel et al., 1998ubiq. P2 TATA (OL, early SC)
MAG CNS, PNS Core: - 138 to 1 21 GC, AP2 – Ye et al., 1994;Prox: - 583 to - 138 Grubinska et al.,
1994Dist: - 861 to - 583
Krox-20 PNS Immature SC element (immature SC, 5' flank)
SRE, CArG-1, CRE,AP-1, SP-1
Oct-6/Tst-1 PNS, CNS Core: - 93 + 49 TATA, CAAT, GC SC Enhancer, about 5kb 3' flank
Kuhn et al., 1991;Enhancer: - 5kb AP-1, ER Renner et al., 1996a
ubiq., ubiquitous expression; core, core promoter; prox, proximal promoter; dist, distal promoter; fp, footprinted region; SC, Schwann cell; OL, oligodendrocyte; ex,exon; int, intron.
Maier et al., 2002
' flank
review: Beckmann et al., 1997
Myelinating SC element (myelinating SC, 3' flank)
Ghislain et al., 2002
Mandemakers et al., 2000Ghazvini et al., 2002
MYELIN GENE REGULATION INTRODUCTION
21
Proteolipid Protein (PLP)
The promoter topology of the gene encoding the proteolipid protein (PLP) is quite
different from those described so far. PLP is a highly conserved myelin protein with four
transmembrane domains, and functions in oligodendrocyte development, myelin
compaction, and axonal integrity. It is expressed as the two splice-variants, PLP and DM-
20, which exhibit different developmental expression profiles and display non-redundant
functions (Nadon et al., 1994, and references therein). The major splice variant PLP
makes up 40% of total myelin protein in the CNS. PLP is also expressed in Schwann
cells, albeit at much lower levels (e.g. Garbern et al., 1997).
For the rat, mouse and human PLP promoters the proximal 186, 145, and 204 base pairs
(bp), respectively, have been described as sufficient to generate basal promoter activity in
transiently transfected cells (Berndt et al., 1992; Nave and Lemke, 1991; Wight et al.,
1993). This region appears to contain multiple start sites that are differentially used in
oligodendrocytes versus Schwann cells (Kamholz et al., 1992; Scherer et al., 1992). This
region as well as the sequences immediately upstream contain a number of protein
binding sites, as judged by DNase footprinting experiments and electrophoretic mobility
shift assays (EMSA) (Berndt et al., 1992; Nave and Lemke, 1991). However, even 1kb
immediately upstream of the transcription start site is not sufficient to direct
oligodendrocyte-specific expression of a transgene (Nadon et al., 1994). Instead, 4.2kb
of 5’flanking sequence from the human PLP gene were needed in combination with
1.5kb of 3’ flanking sequence to obtain oligodendrocyte-specific expression in transgenic
animals. Several additional transgenes with oligodendrocyte-specific expression were
generated using different regions from the mouse PLP gene, leading also to PNS specific
expression (reviewed by Ikenaka and Kagawa, 1995; Kagawa et al., 1994; Readhead et
al., 1994; Wight et al., 1993). One conclusion to draw from the sum of transgenic
experiments is to postulate the presence of multiple oligodendrocyte-specific regulatory
elements in the PLP gene, one in the 5’ flanking region and the other in intron 1 - at least
in the mouse sequence.
To assume the presence of regulatory element necessary for oligodendrocyte-specific
expression within intron 1 is not unreasonable, as important regulatory elements have
been found in intronic sequences of many genes. In the case of L1, for instance,
regulatory elements have been found both in intron 1 and in intron 2, each responsible
MYELIN GENE REGULATION INTRODUCTION
22
for a specific expression pattern (Kallunki et al., 1998; 1997; Meech et al., 1999). The L1
gene codes for an integral membrane protein of the immunoglobulin superfamily,
modulates neuron-neuron and neuron-glia interactions, and exhibits strong expression in
the PNS during embryonic development and later in non-myelinating Schwann cells.
Oct-6/SCIP
In the case of the Oct-6 gene regulatory elements were mapped as DNase I-
hypersensitive sites (HSS). A combination of two of the HSS was shown to act as Oct-6
Schwann cell-specific enhancer (SCE) and were located very distally to the gene
(Mandemakers et al., 2000). The SCE is sufficient to drive spatially and temporally
correct expression of Oct-6, during both normal peripheral nerve development and
regeneration. Because Oct-6 expression is under the control of axonal signals during
nerve development and regeneration, this SCE provides a cis-acting genetic element that
responds to converging signalling pathways to drive myelination in the PNS.
Consequently in a recent study an Oct-6 allele with reduced expression in Schwann cells
was generated through deletion of the SCE in the Oct-6 locus (Ghazvini et al., 2002).
Indeed, the analysis of mice homozygous for this allele reveals that rate-limiting levels of
Oct-6 in Schwann cells are dependent on the SCE and that this element does not
contribute detectably to Oct-6 regulation in other cell types.
Krox20/Egr-2
Analysis of cis-acting elements governing Krox20 expression with transgenes in
Schwann cells revealed the existence of two separate elements (Ghislain et al., 2002).
The first, designated immature Schwann cell element (ISE), was active in immature but
not myelinating SC, whereas the second, designated myelinating Schwann cell element
(MSE), was active from the onset of myelination through adulthood in myelinating SC.
In vivo sciatic nerve regeneration experiments demonstrated that both elements were
activated during this process, in an axon-dependent manner. Together the activity of
these elements reproduced the profile of Krox20 expression during development and
regeneration. The MSE was localised to a 1.3 kb fragment 35 kb downstream of Krox20.
The identification of multiple Oct-6 binding sites within this fragment suggested that
Oct-6 directly controls Krox20 transcription. The ISE was located in the -31/-4.5kb
MYELIN GENE REGULATION INTRODUCTION
23
region of the Krox20 gene. A series of four different overlapping fragments from this
region were tested in mouse transgenesis by fusion to a ß-globin minimal promoter/lacZ
reporter. Although regulatory sequences controlling Krox20 in the nerve roots were
identified, none of the constructs showed expression distally in the peripheral nerves.
Taken together, these data indicate that, although Krox20 is expressed continuously from
15.5 dpc in Schwann cells, the regulation of its expression is a biphasic, axon-dependent
process involving two cis-acting elements that act in succession during development. In
addition, they provide insight into the complexity of the transcription factor regulatory
network controlling myelination.
In vitro studies showed that the Krox-20 promoter contains two sequences similar to
serum response elements, with an CArG-box as an inner core element (CArG-1 and
CArG-2). CArG-1 is responsible for the serum and AP-1 responsiveness of Krox-20 via
PKC-dependent and -independent pathways, respectively (reviewed by Beckmann and
Wilce, 1997).
Peripheral Myelin Protein 22 (PMP22)
The 22 kDa hydrophobic glycoprotein PMP22 is predominantly expressed by
myelinating Schwann cells in peripheral nerves, where the PMP22 protein is
incorporated into compact myelin (Haney et al., 1996; Snipes et al., 1992; Welcher et al.,
1991). It accounts for 2-5% of the total protein found in isolated myelin preparations
(Pareek et al., 1993). The PMP22 molecule consists of an 18kDa polypeptide core, as
predicted from its primary amino acid sequence, and of carbohydrates, which are linked
to an asparagine residue. Some of the PMP22-bound glycosyl moieties carry the L2/
HNK-1 carbohydrate epitope, which has been implicated in intercellular recognition and
adhesion processes (Snipes et al., 1993).
Although PMP22 is found mainly in Schwann cells and seems to be required for correct
development of peripheral nerves, the maintenance of axons and the determination of
myelin thickness and stability (Adlkofer et al., 1997a; 1995), it is not myelin-specific.
Hence a more general role of PMP22 in cell biology has been proposed. Indeed, the
cDNA encoding PMP22 was first isolated from NIH3T3 fibroblasts as a growth arrest-
specific gene (gas-3) (Manfioletti et al., 1990; Schneider et al., 1988). The function of
PMP22 is unknown, but results from in vitro studies suggest that exogenously altered
MYELIN GENE REGULATION INTRODUCTION
24
PMP22 expression affects proliferation, cell shape, and spreading, as well as apoptotic
cell death of Schwann cells (Brancolini et al., 1999; 2000; Fabbretti et al., 1995; Zoidl et
al., 1995). On the other hand, studies of certain PMP22 mutations with an aberrant
intracellular trafficking (Naef and Suter, 1999; 1998) and association of PMP22 with
Calnexin (Dickson et al., 2002) propose a role of PMP22 in membrane organization in
the mechanism of myelin formation.
In the rat, two different PMP22 cDNAs, SR13 and CD25, have been isolated (Spreyer et
al., 1991; Welcher et al., 1991), and meanwhile analogous transcripts been described in
humans and mice (Suter et al., 1994; van de Wetering et al., 1999). These transcripts
consist of different 5’ untranslated regions, resulting from two alternatively transcribed
exons (Suter et al., 1994). The mapping of separate transcription start sites to each of
these exons indicated that PMP22 expression is regulated by two alternatively used
promoters. The relative expression of the alternative PMP22-transcripts is tissue specific,
and high levels of the exon 1A-containing transcript (CD25, 1A-PMP22) are coupled to
myelin formation. In contrast, transcripts containing exon 1B (SR13, 1B-PMP22) are
also present in non-neural tissues such as the lung, intestine, heart and skeletal muscle
(Suter et al., 1994). In addition, PMP22 transcripts were localized by in situ
hybridization in motor nuclei of certain cranial nerves in the brainstem and in the
motoneurons of spinal nerves localized in the ventral horn of the spinal cord (Parmantier
et al., 1995). During embryonic development PMP22 mRNA was also detected in a
variety of murine tissues (Baechner et al., 1995; Parmantier et al., 1997). Beside the
strong expression found in Schwann cells especially during myelination,
immunoreactivity for PMP22 has been described in dorsal root ganglia (DRG) neurons,
satellite cells, and in the spinal cord predominantly in the dorsal horn (De Leon et al.,
1994).
Recent studies characterized the transcriptional startpoints and methylation pattern in the
PMP22 promoters in tumour cell lines and in the peripheral nerve. They proposed
multiple transcriptional start points for exon 1B and proposed a third promoter in front of
exon 2, which seems to be active in the osteosarcoma and glioblastoma cell lines RH30
and SF763 (Huehne and Rautenstrauss, 2001; Huhne et al., 1999).
For PMP22, so far only initial in vitro studies have been performed on the human 5’
regulatory region, resulting in identification of a cAMP sensitive silencer element
MYELIN GENE REGULATION INTRODUCTION
25
between -0.3kb and -3. 5kb relative to the transcription start site of promoter 1 (Saberan-
Djoneidi et al., 2000) in the mouse Schwann cell line MSC80 (Boutry et al., 1992). In
the RT4-D6P2T schwannoma cell line a positive regulatory element (-105 to -43bp) was
described immediately upstream of the minimal promoter 1. This element forms a DNA-
protein complex in vitro (Hai et al., 2001).
3.4 Aim and motivation of the work
To improve our understanding of the mechanisms involved in CMT1A and HNPP and to
determine the molecular and cellular function of the dosage-sensitive gene PMP22, it is
important to determine the role of PMP22 transcriptional regulation during development
and in pathogenesis of the peripheral nervous system. Deciphering the molecular basis of
this regulation is crucial for our understanding of the interplay between neurons and glial
cells in myelin formation in health and in diseases like multiple sclerosis and
neuropathies. Furthermore, such studies may provide the rational basis for potential gene
therapeutic approaches to normalize PMP22 expression in CMT1A (Hai et al., 2001) and
will provide additional insights into the coordinate regulation of myelin genes.
To this end, I started with an additional characterisation of the PMP22 promoter in vitro
(see chapter 4 of the thesis). Second, I performed an extensive and systematic dissection
of the regulatory regions of PMP22 in transgenic mice as presented in chapter 5 and 6 of
the thesis. Finally, the results will be compared with a computer analysis of conserved
sequences and potential binding sites as presented in chapter 7.
26
MYELIN GENE REGULATION IN VITRO RESULTS PART 1
27
4 MYELIN GENE REGULATION IN VITRO
4.1 Aims and Experimental strategies
The following chapter describes the validation of different cell culture systems to study
PMP22 transcriptional regulation in cell culture. As discussed earlier, a cell culture
system does focus more on the cell intrinsic mechanism of a certain cell type, and
therefore neglects the fact that developing or myelinating Schwann cells integrate a
complex pattern of extracellular signals in addition to their cell intrinsic mechanisms in
the in vivo situation, which then finally results in their coordinate regulation of genes. On
the other hand a well-chosen cell culture system may allow, for example, a rapid
molecular dissection of a regulatory region, the determination of DNA-binding factors,
or the study of certain intracellular pathways by specific activation or inhibition. It is
possible to study certain mechanisms in ways that are either not possible with the
available techniques so far in vivo or are very time consuming. However, the results
obtained in a cell culture system should be confirmed in vivo whenever possible.
Consequently, our aim was to find a system in which some aspects of PMP22 gene
regulation could be studied and modulated in a fast and reliable way.
A classical and frequently used way to characterize and identify negative and positive
regulatory elements in promoter regions is to transiently transfect cell lines with reporter
constructs harbouring different fragments of the regulatory region of the gene. For
PMP22, initial experiments, performed with constructs specific for promoter 1 or
promoter 2 driven expression of PMP22, already indicated that promoter 2 of PMP22
shows stronger transcriptional activity in cultured Schwann cells than does the myelin
associated promoter 1 (Suter et al., 1994). To gain more insight into PMP22
transcriptional regulation in cultured Schwann cells, which correspond, based on their
molecular markers, to non-myelinating Schwann cells, we performed a more extensive
promoter deletion study, similar in design to previous studies of other myelin gene
promoters such as the Myelin basic protein (MBP) (Li et al., 1994; Miura et al., 1989;
Tamura et al., 1989), myelin protein zero (MPZ) (Brown and Lemke, 1997; Lemke et al.,
1988) or proteolipid protein (PLP) promoters (Berndt et al., 1992; Nave and Lemke,
MYELIN GENE REGULATION IN VITRO RESULTS PART 1
28
1991; compare also Tab. 1). The results obtained from such studies depend – among
other things – on the cell type in which the transfection studies are performed. In
principle two different strategies can be followed to select a cell type. Either one uses a
non-specific cell line where only basal promoter activity can be expected for the gene of
interest, and subsequently tries to modulate this basal activity by the cotransfection of
additional regulatory factors. The second approach is to choose a cell line which
resembles the cell type in which the gene of interest is as highly expressed as possible.
With this choice one anticipates that additional endogenous factors from the cell line
contribute to the complex transcriptional regulation of the gene. We decided to use the
second approach, using the mouse Schwann cell line MSC80 (Boutry et al., 1992) which
does express PMP22. As a second cell line we selected NIH3T3 fibroblasts, since
previous studies characterized PMP22 regulation in this cell type (Fabbretti et al., 1995;
Manfioletti et al., 1990; Zoidl et al., 1997). The results of this study are presented below
in section 4.2.
In the case of MPZ a successful identification of regulatory factors was possible in cell
culture either in cotransfection assays (Monuki et al., 1990; Zorick et al., 1999) or with
doxycycline-inducible expression of transcription factors in N2A cells (Peirano et al.,
2000). The latter study revealed a clear induction of MPZ expression specifically by
Sox10. We wondered whether we could find coregulation of PMP22 in this system. The
Sox10 induction can be performed in cell culture media with very low level of fetal calf
serum (FCS), an agent known from earlier studies to prevent upregulation of PMP22
when present at high concentrations (Suter et al., 1994). Similarly PMP22/gas3 is
upregulated upon growth arrest of the cells which can be induced by serum withdrawal
(Manfioletti et al., 1990; Schneider et al., 1988). In a first attempt we tried classical
cotransfection experiments with Krox20, Sox10, pax3, Oct-6/SCIP, Ski, and
combinations of these, together with a PM22-lacZ reporter construct (-10/0kb PMP22
lacZ, see Fig. 4-1). In the presence of 10% FCS, reporter gene expression was either not
influenced or inhibited by these factors. This corresponds to observations that others
have made in cell culture (e.g. Bharucha et al., 1994; Monuki et al., 1993). In the
absence of serum we faced the problem that Schwann cells are not efficiently
transfectable, as they stop proliferating after serum withdrawal. Therefore this system
MYELIN GENE REGULATION IN VITRO RESULTS PART 1
29
was not reliable, and the positive results obtained in certain experiments were not
reproducible (data not shown).
As a next system we analysed the regulation of PMP22 in N2A cells stably transfected
with a construct allowing induction of Sox 10 expression by doxycycline, as established
by Peirano and coworkers (2000). The results obtained in collaboration with this group
are presented in part 4.3 below.
While the in vivo experiments presented in chapters 5 and 6 were in progress, Nagarajan
and coworkers found a way to circumvent the low transfection efficiency in non-
proliferating Schwann cells in the absence of serum. They used an adenoviral system to
overexpress Krox20 in rat and mouse Schwann cells and could indeed observe
upregulation of different myelin genes including PMP22. Nagarajan et al., also presented
a list of Krox20-regulated genes identified in a whole genome expression study
(Nagarajan et al., 2001). We established this in vitro system in which PMP22 can be
upregulated directly by a transcription factor, and could reproduce the upregulation of
myelin genes by Krox20. In addition we confirmed our assumption that upregulation of
PMP22 is reduced in the presence of serum. With this system, we started to test Krox20-
regulated transcription factors, based in part on the published gene chip data (Nagarajan
et al., 2001) including other candidates from other gene profiling experiments (Araki et
al., 2001). The results, which still have preliminary character but for some candidates are
very promising for future studies, are presented in section 4.4 below.
4.2 Promoter Deletion study in MSC80 and NIH 3T3 cells
As a first step, we generated the basic PMP22 promoter construct (-10/0kb PMP22 lacZ)
using the sh ble-lacZ fusion gene driven by promoter 1, promoter 2 and upstream
sequences of the mouse PMP22 gene. Ten kb of 5’-flanking PMP22 DNA were used,
comprising 5.8 kb upstream of exon 1A including promoter 1, 2.3 kb between exon1A
and exon 1B including promoter 2, and 1.5 kb downstream of exon 1B with the first 43
bp of exon 2 (see Fig. 4-1). In a next step we generated additional reporter constructs
harbouring a 5’ deletion of the first 6kb region (-4/0 kb Pro2 lacZ), or the first 7kb region
(-3/0 kb Pro2 lacZ) leading to a reporter construct containing only promoter 2 with 1kb
MYELIN GENE REGULATION IN VITRO RESULTS PART 1
30
or 2kb sequences upstream of exon 1B, respectively (see Fig. 6-1). The deletion of exon
1A or the exon 1B with the associated promoter resulted in the constructs Del1AlacZ and
Del1BlacZ (see Fig. 4-1). In the Del1AlacZ construct we deleted the -230 bp to +330 bp
and in the Del1BlacZ construct the -170 bp to +410 bp region in relation to the
transscription start site as mapped by Suter, et al. (1994). All these construct were
transfected in the mouse Schwann cell line MSC80 (Boutry et al., 1992) and in NIH 3T3
cells. We used equimolar amount of each reporter construct and corrected for different
transfection efficiencies by cotransfection of a constant amount of SV40 luciferase
plasmid. The measured ß-gal activities are shown in relation to the SV40-lacZ expression
(set to a 100% in both cell lines; Fig. 4-1).
The mouse Schwann cell line (MSC80) is one of the few Schwann cell lines derived
from mice. It was established from purified mouse Schwann cell cultures using high
levels of fetal calf serum. Most of the MSC80 cells are bipolar or stellate (3-5 processes)
in shape, and express antigens of Schwann cells such as S-100 and laminin but also the
non-myelinating Schwann cell antigen GFAP. In vivo after transplantation in or at a
distance from a lysolecithin-induced lesion, MSC80 cells form myelin around the
demyelinated host axons (Boutry et al., 1992).
As a general finding, higher expression levels were seen in the MSC80 cell line
compared to the NIH3T3 fibroblasts. Highest relative reporter gene activity, with levels
about two fold above the SV40 promoter, can be found with the -10/0kb PMP22 lacZ
construct in MSC80 cells in the presence of forskolin. Forskolin increases the
intracellular levels of cAMP and is thought to mimic some aspects of axonal contact of
Schwann cells. In our experiment, forskolin increased PMP22 promoted reporter gene
expression about twofold in MSC80 cells, whereas in NIH 3T3 cells no consistent effect
of forskolin was observed.
The observation that deletion of promoter 2 and exon1B (construct Del1BlacZ, Fig. 4-1)
led to a complete loss of expression and that the deletion of exon 1A and its associated
promoter 1 (construct Del1AlacZ, Fig. 4-1) did not change expression levels
substantially, shows that mainly promoter 2 is active in the MSC80 cell line. The same
was observed in NIH 3T3 cells. Indeed, quantitative RT-PCR with RNA from MSC80
cells transfected with the -10/0kb PMP22 lacZ construct, using primers specific for
exons 1A or 1B and either the reporter or the endogenous gene, confirmed that promoter
MYELIN GENE REGULATION IN VITRO RESULTS PART 1
31
.
Figure 4-1: Activity of different PMP22-promoted reporter constructs in the mouseSchwann cell line MSC80 (grey bars) and in NIH3T3 fibroblast cells (black bars)(a), and mRNA expression levels of transfected lacZ constructs and endogenousPMP22 (b). (a) The relative expression of the lacZ reporter gene obtained 40 hoursafter transfection is shown for each construct in the presence (+) or absence (-) of20µM forskolin. The expression levels of the SV40 promoter in the absence offorskolin were defined as 100%. (b) mRNA expression levels of 1A-lacZ and 1B-lacZ transcripts derived from the transfected -10/0kb PMP22 lacZ construct andthe 1A-PMP22 and 1B-PMP22 transcripts of the endogenous PMP22 promoters inMSC80 cells, determined by quantitative RT-PCR (see Fig. 5-1). The cells weremaintained in DMEM containing 10%FCS. Error bars represent the SD of valuesobtained from three independent transfections.
10
0%
Promoter activity%SV40-LacZ (ß-gal activity/Luminescence)
1A 1B 2lacZ
-10/0 kb lacZ
1A 1B 2-4/0 kb Pro2 lacZ lacZ
1B-3/0 kb Pro2 lacZ 2lacZ
neg. control (pUT111) lacZ
1B 2Del1A lacZ lacZ
-170 +410
1A 2Del1B lacZ lacZ
-230 +330
SV40 lacZ lacZSV40F
orsko
lin 2
0µ
M
-
+
-
+
-
+
-
+
-
+
+
-
+
-
MSC80 cells
NIH 3T3 cells
0 50 100 150 200 250
10-6
10-5
10-4
10-3
10-2
10-1
log
[R
NA
]/[G
AP
DH
]
1A-la
cZ
1B-la
cZ
1A-P
MP
1B-P
MP
a
b
-
+
-
+
-
+
-
+
-
+
+
-
+
-
MYELIN GENE REGULATION IN VITRO RESULTS PART 1
32
2 is about 100 times more active than promoter 1, both for the transfected and the
endogenous gene (Fig. 4-1b, for details of the quantitative RT-PCR see Fig. 5-1 below).
The differential promoter activities also did not change considerably in MSC80 cells
upon addition of 10µM forskolin to the cell culture medium (data not shown). This is in
contrast to the situation in the sciatic nerve, where about four times more 1A-PMP22
than 1B-PMP22 mRNA was detected (compare Fig. 5-6). This supports the hypothesis
that promoter 1 is the myelin-associated promoter and therefore only basal levels of 1A-
PMP22 mRNA are detected in non-myelinating Schwann cells. In other words: the
myelin specific promoter 1 is active only at very basal levels in cultured Schwann cells.
4.3 Is PMP22 regulated by Sox10 in N2a cells?
Peirano et al., (2000) showed that MPZ can be upregulated by Sox10 in N2A
Neuroblastoma cells. We therefore asked whether PMP22 might be similarly regulated.
In collaboration with the group of M. Wegner (Erlangen), N2A neuroblastoma cells
expressing the reverse tetracycline-controlled transactivator (rtTA) and the cDNA of
Sox10 under control of a tetracycline-regulatable promoter were induced with
doxycycline or vehicle alone in DMEM Medium containing 0.5% FCS for 48 hours
before harvesting the RNA. A high induction of MPZ upon doxycycline induced
expression of Sox10 (+ Dox) compared to non-induced control (- Dox) can be observed
(Fig. 4-2a,b; Peirano et al., 2000; for technical review see Mansuy and Suter, 2000). In
contrast to MPZ neither a substantial upregulation of the very low levels of the 1A-
PMP22 mRNA derived from promoter 1 (Fig. 4-2b), nor of the 1B-PMP22 mRNA
derived from promoter 2 (Fig. 4-2c) can be detected by quantitative RT-PCR. As a
control, the total amount of PMP22 mRNA was determined with a different set of
TaqMan Primers specific for the translated region and detecting all PMP22 mRNA
species. Also in this case total levels of PMP22 mRNA did not show any upregulation, as
expected since the total PMP22 mRNA consists again mainly of 1B-PMP22 transcripts.
In fact, the opposite was the case: a weak inhibition of PMP22 expression was observed
MYELIN GENE REGULATION IN VITRO RESULTS PART 1
33
(Fig. 4-2e). As a conclusion, PMP22 seems not to be co-regulated with the myelin
protein zero under these conditions.
Figure 4-2: mRNA expression levels of Sox10 (a), Myelin Protein Zero (b, MPZ)and PMP22 (c, d, e) with (+Dox) or without (-Dox) doxycycline induction of Sox10in N2a cells, detected with semiquantitative (a,b) or quantitative (c-e) RT-PCR.
4.4 Screening for transcription factors upregulated uponKrox20 induced myelin gene expression
Schwann cells are well infectable with relatively low titres of adenovirus. In contrast to
retrovirus, adenovirus can also infect non-proliferating cells (Fig. 4-3a-c). Therefore
infection with adenoviral vectors offers a very efficient and reliable way to express, for
example, a transcription factor in nonproliferating Schwann cells. Nagarajan and
coworkers (2001) exploited this fact and studied changes in gene expression after
infection of rat Schwann cell with an adenovirus expressing Krox20 and eGFP under
control of a CMV promoter (Ehrengruber et al., 2000). They used microarrays in a
global analysis of gene expression in rat Schwann cells infected with an adenovirus
expressing Krox20, as compared to control-virus infected Schwann cells (Nagarajan et
al., 2001). Our hypothesis was that transcription factors regulated by Krox20 are directly
or indirectly involved in the regulatory network of myelin gene regulation. Based on the
published gene chip data, educated guesses and other gene profiling studies (Araki et al.,
2001), we started to confirm the Krox-20 regulation of our candidates. These included
the KRAB-zinc finger protein KZF-1 and KZF-1 like ((Bellefroid et al., 1998), accession
0
0.06
0.12
0
0.08
0.16
0
0.0001
0.00025
1B-P
MP
22/G
AP
DH
PM
P22
tot /
GA
PD
H
Dox +
a b c d
-+- +-+- +- +- +-
1A-P
MP
22/G
AP
DH
Sox10 MPZe
MYELIN GENE REGULATION IN VITRO RESULTS PART 1
34
Figure 4-3: Quantitative RT-PCR screening for Krox-20 regulated genes in ratSchwann cells upon infection with an adenovirus expressing Krox-20. (a-c) Highexpression levels of GFP encoded by the viral vector (taken as a surrogate formeasuring Krox20 directly) can be detected in nearly all rat Schwann cells infectedin DMEM medium in the presence of 10% FCS with a dilution of 1:100 (a) or 1:10(b) of the Adegr2GFP virus (Ehrengruber et al., 2000) after 48 hours. When theinfection was performed in defined N2 medium (c) with the same dilution of thevirus (1:10), weaker expression levels were observed, which nevertheless inducedthe upregulation of PMP22 and periaxin mRNA (d). (d) Differences in mRNAexpression levels (fold difference) of Krox20 versus control-virus infected Schwanncells, 30 hours (experiment 1), 24 or 48 hours (experiment 2) after infection, assayedwith triplicate measurement of the indicated TaqMan or SYBRGreen PCR(corresponding dissociation curve shown in the last column). Abbreviation: n.a.(ME): not applicated; dissociation curve done by M. Ehrengruber.
MYELIN GENE REGULATION IN VITRO RESULTS PART 1
35
number AF175222 and BC004747 for the mouse cDNA), the broadly expressed POU
domain transcription factor Brn-2 (Donahue and Reinhart, 1998; Schreiber et al., 1997),
the Iron responsive element binding protein (IREBP; accession number X61147), Egr1
and Egr3 to confirm the effect of specific induction of Egr2/Krox20 and the Schwann
cell marker S100 as a control which should show unchanged levels (Fig. 4-3d).
In the absence of serum and within 48 hours after infection, we could confirm the
upregulation of total PMP22 levels, and an upregulation of the 1B-PMP22 message. The
1A-PMP22 levels were strongly increased (20-80 fold), but it must be emphasized that
even the induced levels were still low. We did not observe a robust induction of PMP22
in the presence of serum. At least in experiment 2 we detected a seven-fold induction of
Periaxin expression (Fig. 4-3d).
In regard to the screening we could only confirm the two-fold up-regulation of Brn-2, but
not of KZF-1, which in the published gene chip analysis was upregulated about five-fold
(Nagarajan et al., 2001). No regulation was observed for IREBP. The negative first
derivative of the fluorescence vesus temperature curve of the PCR products (Fig. 4-3d)
shows only a single peak for IREBP, indicating that only one single product was
amplified. In the case of KZF-1 a more sensitive PCR might show different results since,
the gene was expressed at very low levels in cultured Schwann cells. In contrast to the
gene chip data where a five-fold upregulation of Egr1 was detected, we determined in our
experiment either unchanged or decreased levels of Egr1 upon Krox20 expression.
Expression levels of egr3 seem not to be influenced by Krox20 expression.
In principle, the system can be used to study the regulatory network of PMP22 gene
regulation in cell culture, since we are able to induce myelin gene expression in this in
vitro system. In addition, in the case of Brn-2 our screening approach revealed a valuable
candidate for further studies, as Brn-2 regulation in mice was confirmed in the meantime
by (Sim et al., 2002).
36
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
37
5 REGULATORY ELEMENTS ON THE -10/0KB PMP22LACZ TRANSGENE
5.1 Aims and Experimental strategies
Cultured Schwann cells without coculturing with neurons do not myelinate in vitro, so
that the Schwann cells do not integrate axonal signals into their transcriptional
regulation. Therefore a systematic dissection of the regulatory regions in transgenic mice
provides an excellent assay to study gene regulation involving numerous developmental
and physiological signals. Consequently, we examine the role of the PMP22 promoters
and their 5’ regulatory sequences on the transcriptional regulation of PMP22 in vivo
which is described in the following section of my thesis. To this end, we produced
transgenic mice in which promoters 1 and 2 drive expression of a lacZ reporter gene,
either in wildtype mice or in animal models for CMT1A.
Part of the following results have been published in:
Maier, M., Berger, P., Nave, K. A., and Suter, U. (2002). Identification of the Regulatory
Region of the Peripheral Myelin Protein 22 (PMP22) Gene That Directs Temporal and
Spatial Expression in Development and Regeneration of Peripheral Nerves.
Molecular and Cellular Neuroscience (MCN) 20: 93-109.
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
38
5.2 Generation of transgenic mice expressing the reporterlacZ gene under the control of the PMP22 genepromoters (-10/0 kb PMP22 LacZ)
Transgenic mouse lines were generated using the sh ble-lacZ fusion gene driven by
promoter 1, promoter 2 and regulatory sequences of the mouse PMP22 gene (Suter et al.,
1994). Ten kb of 5’-flanking PMP22 DNA were used including promoter 1 with exon1A,
promoter 2 with the corresponding exon 1B and 1.5 kb downstream of exon 1B with the
first 43 bp of exon 2 (Fig. 5-1) (Suter et al., 1994; van de Wetering et al., 1999). The sh
ble gene confers resistance to the antibiotics of the zeomycin group (Drocourt et al.,
Figure 5-1: Generation of PMP22 Promoter-sh ble-lacZ (-10/0kb PMP22 lacZ)transgenic mice. Diagram of the endogenous mPMP22 genomic locus and the -10/0kb PMP22 lacZ transgene. (a) Promoter 1 is located in front of the non-translatedexon 1A, Promoter 2 in front of the alternatively used exon 1B. All numbers refer tothe nucleotide +1 which was defined at the translation start codon on exon 2 (ATG).The specific forward and backward primers for the detection of the twoendogenous mRNAs, 1A-PMP22 (Pr1A and Pr2PMP22) and 1B-PMP22 areindicated (Pr1B and Pr2PMP22). (b) To generate a reporter transgene under thecontrol of the PMP22 promoters, the endogenous PMP22 sequence was replaced atthe translation start site with the coding sequence of a sh ble-lacZ fusion reportergene. The specific primers for the two transgenic mRNA species 1A-lacZ (Pr1A,Pr2lacZ), 1B-lacZ (Pr1B, Pr2lacZ) are indicated. The PMP22 TaqMan probe (blackrectangle with 5’ reporter and 3’ quencher dye modifications) used forquantification is located in the first half of exon 2 in a sequence common to all fourdifferent RNA transcripts.
1A 1B 2 3
1A-PMP221B-PMP22
1A-lacZ1B-lacZ
Pr1APr1B
Pr2PMP22
4 5ATG
Promoter1 Promoter2
1 kb
a
b
1A 1B
Pr1APr1B
Pr2lacZ
Promoter1 Promoter2 sh ble lacZ pA
ATG
-10kb
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
39
1990; Gatignol et al., 1988) and the addition of the Escherichia coli lacZ gene in frame
to the sh ble sequence allows monitoring of PMP22 gene expression. DNA extracted
from the tails of 85 offspring mice was analyzed by PCR for the presence of the
transgene which was detected in 25 animals. Expression of the transgene in innervating
peripheral nerves of the tail was analyzed on cross-sections derived from biopsies of the
founder animals. Three founders showed high lacZ expression levels and seventeen
showed a moderate or weak expression. Five founders were mated for further analysis
with B6D2F1 hybrid mice and stable lines with high (lines 48.4, 44.2, 49.3), moderate
(line 37.1) or low (line 45.2) expression levels were established. The expression levels
were confirmed on whole mount X-gal stainings of sciatic nerve in F1 animals (data not
shown) which were then bred again with hybrid mice. Lines 48.4 and 44.2 were analyzed
in detail and showed identical patterns of expression of the transgene both in the embryo
and adult. With all five lines, transgenic animals were fertile and appeared normal
throughout live.
5.3 Analysis of the first wave of -10/0kb PMP22 lacZexpression during embryonic development
ß-gal expressing cells were first detected at E10.5 in the limb buds of the developing
fore- (Fig. 5-2a, arrowhead) and hindlimbs as well as at the midbrain-hindbrain border
(Fig. 5-2a, arrow). The expression pattern at E11.5 (data not shown) was similar to that
seen at E12.5 (Fig. 5-2b). At E12.5 a prominent staining was detected in the lateral and
medial regions of the limbs (Fig. 5-2b, arrowhead). This expression of the -10/0kb
PMP22 lacZ transgene is consistent with the finding of endogenous PMP22 RNA by in
situ hybridization in the developing limbs (Baechner et al., 1995). Furthermore, we
detected ß-gal expression in the ventricular epithelium of the rhombencephalon, but
neither more rostrally in the myencephalon or prosencephalon, nor more caudally in the
alar plate of the spinal cord, either at E12.5 (Fig. 5-2b) or at E14.5 (Fig. 5-2c, d, f). These
results are in agreement with the endogenous expression pattern of the PMP22 gene in
the developing CNS as determined by (Parmantier et al., 1997). This is also true for some
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
40
weak X-gal staining that we detected in the neuroepithelium of the olfactory bulb and in
some tongue muscles (data not shown). The spatial expression pattern at E14.5 (Fig. 5-
2d,e) is similar to the pattern at E12.5. On whole-mount X-Gal stainings (Fig. 5-2c) or
sections of E14.5 embryos, we detected additional prominent staining in the outer ear
and scattered blue cells were found in the skin and in the retina of the eye (data not
shown). This finding contrasts to the data of (Baechner et al., 1995) who localized
endogenous PMP22 mRNA predominantly to the inner ear and the lens of the eye. How-
Figure 5-2: ß-gal expression during embryonic development of -10/0kb PMP22 lacZtransgenic mice. Whole mount X-gal stainings from embryonic day E10.5 (a), E12.5(b) and E14.5 (c). Histological X-Gal stainings of longitudinal (d) and transverse (e,f) cryosections at E14.5 at the levels of the embryo as indicated in (c). At E10.5 (a) ß-gal activity was detected in the outer and inner region of the limbs (arrowhead) andin the region of the midbrain-hindbrain boundary (arrow). At E12.5 (b) and E14.5(c, d, e, f) ß-gal activity could be detected most prominently in the limb muscles(arrowhead in b, d, e), in the roof of the midbrain (f), in the external ear (arrow inc) and in some scattered cells of the olfactory epithelia and epidermis. mv:mesencephalic vesicle. Scale bars: 500µm (a-e), 100µm (f).
ba cf
e
mv
fed mv
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
41
ever, the pattern of transgene expression was consistent in our transgenic lines (data not
shown). Thus, it is likely that negative regulatory elements that inhibit the expression of
the endogenous PMP22 gene in these areas are missing on our transgene.
In accordance with PMP22 mRNA in situ studies (Baechner et al., 1995; Parmantier et
al., 1997) a reduced expression of the transgene was observed in late embryonic
development (data not shown). At E16.5 and E18.5 remaining ß-gal expression could be
detected in the outer ear and in the limb muscles of -10/0kb PMP22 lacZ transgenic
animals.
5.4 -10/0kb PMP22 lacZ expression is strongly upregulatedin postnatal neurons and Schwann cells of peripheralnerves
The second wave of -10/0kb PMP22 lacZ transgene expression starts around birth. First
ß-gal positive cells in the DRG can be detected at E19.5 on whole mount stainings (data
not shown). An increasing number of ß-gal positive DRG neurons can be observed on
sections at postnatal day 1 (P1, Fig. 5-3a) and P5 (Fig. 5-3b, inset). At this age, X-gal
staining was also observed in the cartilage regions of the bones (Fig. 5-3b, asterisk), as
had been observed for PMP22 mRNA during late embryogenesis (Baechner et al., 1995).
Transgene expression in the muscles persisted throughout postnatal development, but in
contrast to the embryonic expression at E14.5, staining was detectable additionally in
muscles outside of the limbs and was more localized around single muscle fibers (Figs.
5-3a, b, arrowhead).
Postnatal day 10 (P10) was the first time at which ß-gal expressing cells were seen in the
ventral horn of the spinal cord (data not shown). At P21, the ß-gal activity was more
intense than at P10, and on sections through the thoracic and lumbar spinal cord (Fig. 5-
3c, d) a diffuse X-gal staining was additionally observed in the dorsal horn of the spinal
cord, mainly located in the area of lamina II. Also the dorsal column tracts, especially the
gracile fasciculus as well as some large cell bodies in the ventral horn of the gray matter,
were positive for ß-gal. These large, multipolar cells have been described to express
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
42
endogenous PMP22 mRNA and were identified as motor neurons by (Parmantier et al.,
1995).
Figure 5-3: Developmental appearance of ß-gal-positive cells in DRGs and spinalcords of -10/0kb PMP22 lacZ transgenic animals. X-Gal stainings of spinal cordcross-sections of P1 (a) and P5 (b) mice. Expression of lacZ starts around birth andis upregulated during the first postnatal week in the DRG (arrows in a, inset in b).During the first postnatal days, additional expression can be detected aroundmuscle fibers (arrowhead in a, b) and in the cartilage regions of the bones (asteriskin b). (c, d) At P21, lacZ expression is seen in the ventral horns of the grey matter insome motor neurons (mn), in the sensory neurons of the lamina II, in the dorsalcolumn neurons and in the ventral roots at thoracic level of the spinal cord (c) aswell as at lumbar level (d). (e) Immunohistochemical stainings of dissociated DRGsfrom E19 embryos. Neuro-filament (NF, red) and ß-galactosidase (ß-gal, green)were detected in the same cells. (f) X-Gal histochemistry on teased nerve fibers of aten week-old -10/0kb PMP22 lacZ transgenic mouse. Virtually all fibers with large(1, inset), medium (2, inset) and small (3, inset) caliber axons were enwrapped witha ß-gal positive Schwann cell, albeit with different level of expression. mn:motoneurons, vr: ventral roots, sn: sensory neurons, gt: gracile tract. Scale bar:200µm (a-d), 20µm (f)
1
2 3
��
��
b
c
��
��
a
��
d
NF ß-gal
e
��
*
f
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
43
DRG neurons give rise to a long peripheral axon and a shorter central axon. Depending
on the sensory input, the central axons terminate either directly in the dorsolateral region
of the spinal cord, or ascend ipsilaterally through the dorsal columns of the cord and
terminate in the dorsal column nuclei located in the lower medulla. Thus, it appears
likely that the dot-like X-gal staining found in lamina II and the staining in the dorsal
column tracts derive from ß-gal that has diffused into the projections of the sensory DRG
neurons since the cell soma of these neurons are strongly ß-gal positive. This
interpretation is supported by the analysis of longitudinally cut axons at places where
they are myelinated by ß-gal-negative oligodendrocytes (Fig. 5-4d, asterisk), for example
at the central-peripheral nervous system transition zone of the trigeminal nerve.
Additional evidence that the ß-gal positive DRG cells are neurons was provided by
analysis of the ß-gal expression of the different cell types in vitro. DRG from E19.5
embryos were dissected, enzymatically dissociated, and plated on collagen-coated cell
culture dishes. Staining of the mixed cell population after three days with antibodies
against ß-gal and neurofilament revealed localization of ß-gal immunoreactivity in DRG
neurons (Fig. 5-3e). All neurofilament positive cells on the cell culture plate also showed
immunoreactivity for ß-gal. In addition, X-gal staining of sister plates showed ß-gal
positive cells identified by morphology as neurons with variable staining intensities (data
not shown).
Transgene expression in Schwann cells of the sciatic nerve was first detected around P8
with a few scattered blue cells visible in whole mount preparations. During peak period
of myelination around P10, the number of stained Schwann cells as well as the staining
intensity increased dramatically (data not shown). At P21, ß-gal positive Schwann cells
were found in the spinal nerves (for sciatic nerve, see Fig. 5-3f) as well as in some
cranial nerves (for trigeminal nerve, see Fig. 5-4d). The staining intensity of the
Schwann cells was considerably stronger than that of the motor and DRG neurons, and
was maintained in old adult animals (up to 1 year of age). ß-gal positive Schwann cells
showed comparable staining intensity in the dorsal and ventral roots of the spinal cord
(Fig. 5-3c, only ventral roots visible on this section).
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
44
X-Gal stainings on teased nerve fibers of adult -10/0kb PMP22 lacZ transgenic animals
showed expression of the reporter gene in the majority of the fibers (Fig. 5-3f). Virtually
all Schwann cells are positive for X-Gal whether they enwrap relatively small (inset Fig.
5-3f, fiber No. 3), medium (inset Fig. 5-3f, fiber No. 2) or large caliber axons (inset Fig.
5-3f, fiber No. 1). Accumulation of cytoplasmatic ß-gal can be observed in regions with
increased Schwann cell cytoplasm, the paranodes (arrow in inset, Fig. 5-3f) and
Schmidt-Lanterman incisures (arrowheads in inset, Fig. 5-3f).
To confirm the onset of transgene expression and to quantitate the expression of the -10/
0kb PMP22 lacZ transgene, the ß-gal enzymatic activity was determined in homogenates
of the sciatic nerve at different time points (Fig. 5-5a). Strong upregulation of the
transgene was observed after P10. This confirms the rather late upregulation of the
transgene seen in X-gal stainings compared to what has been described for the
endogenous PMP22 mRNA in rat sciatic nerve (Suter et al., 1994). To compare the
transcriptional regulation of the endogenous PMP22 with the transgene in the sciatic
nerve of mice, transgene expression was determined directly on the mRNA level. For this
purpose, the levels of the exon 1A-containing-lacZ (1A-lacZ) mRNA and the exon 1B-
containing-lacZ (1B-lacZ) mRNA was determined by quantitative RT-PCR, and
compared with the expression of the exon 1A-containing-PMP22 (1A-PMP22) mRNA
and the exon 1B-containing-PMP22 (1B-PMP22) mRNA (Fig. 5-1). GAPDH mRNA
was used as an internal standard. The lacZ mRNA species in transgenic animals (Fig. 5-
5b) were compared to PMP22 mRNA from wildtype littermates (Fig. 5-5c) at different
time point during postnatal development. The quantitative RT-PCR for the lacZ mRNA
confirmed the delayed upregulation of the -10/0kb PMP22 lacZ transgene around P10
also at the transcriptional level. The expression profile of the endogenous PMP22 mRNA
in wildtype mice was similar to that found in rats during myelination (Suter et al., 1994)
with the main upregulation of endogenous PMP22 mRNA occuring between postnatal
days P1 and P10 during the onset of myelination (Fig. 5-5c).
We also compared the relative contributions of the endogenous promoters 1 and 2 to the
regulation by the exogenous promoters 1 and 2 of the transgene (in two different lines).
No significant difference in the ratio of 1A to 1B transcripts was seen for the lacZ-
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
45
containing transcripts compared to wildtype PMP22 mRNA (Fig. 5-6b, c). Furthermore,
the amount of endogenous PMP22 mRNA was similar in both wildtype and transgenic
mice, indicating that the expression of the reporter gene does not alter the endogenous
PMP22 mRNA levels (data not shown). This is consistent with the fact that no phenotype
was observed in the transgenic animals and indicates that the presence of additional
copies of the PMP22 promoter region in the genome does not have a major influence on
the transcriptional regulation of the endogenous PMP22 gene. The absolute abundance
of endogenous PMP22 and transgenic lacZ mRNA can therefore be compared directly
revealing that, at P21, the lacZ mRNA is approximately two orders of magnitude less
abundant than the PMP22 mRNA (Fig. 5-5b, c).
5.5 Transgenic ß-gal expression in sensory and motorneurons of cranial nerves
Serial transverse cryosections through the brainstem of three week-old -10/0kb PMP22
lacZ transgenic mice revealed that ß-gal positive cells can also be detected in several
cranial nerve nuclei of the brainstem (Fig. 5-4a, b, c). Except for the nuclei of the
occulomotor (nerve III), trochlear (nerve IV), abducens (nerve VI) and auditory nerve
(nerve VIII), where no signal was detected, all other motor and sensory nuclei of cranial
nerves showed a definitive X-gal staining. This is illustrated for the hypoglossal and
dorsal vagus nuclei (nerve XII and X, respectively, Fig. 5-4a), the motor nuclei of the
facial (VII) nerve (Fig. 5-4b), and the motor nuclei of the trigeminal (V) nerve (Fig. 5-
4c). This expression pattern of the transgene is in accordance with the endogenous
expression of PMP22 (Parmantier et al., 1995) which was found in the same subset of
nuclei of cranial nerves.
In Figure 5-4d, the different staining intensities of neuronal and Schwann cell expression
of the -10/0kb PMP22 lacZ reporter gene are illustrated for the trigeminal nerve at the
border between the central and peripheral nervous system (arrowhead in Fig. 5-4d). As
soon as the cranial nerve neurons are myelinated by Schwann cells the staining intensity
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
46
increased dramatically, and confirms that oligodendrocytes around these ß-gal positive
neurons do not express the transgene in detectable amounts.
Figure 5-4: ß-gal expression in spinal nerve nuclei in the brainstem of -10/0kbPMP22 lacZ transgenic mice. At P21, X-Gal staining is found in the hypoglossal (a,arrows) and dorsal vagus nuclei (a, arrowhead), in the motor nuclei of the facialnerve (b, arrows) and in the trigeminal nerve nuclei of the brainstem (c, arrows). Inaddition, expression of the transgene was detected in the sensory fibers of the spinaltrigeminal tract (a, asterisks) and in the region of the mesencephalic nuclei of thetrigeminal nerve (c, arrowheads). (d) The neuronal expression (d, asterisk) is muchweaker than the expression by myelinating Schwann cells as shown on longitudinalsections of the trigeminal nerve at the transition zone between the central andperipheral nervous system (arrowhead). Scale bar: 200µm
b
d
*c
a*
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
47
5.6 Tissue specificity of the -10/0kb PMP22 lacZ transgene
In a next step, we investigated whether transgene expression is also found in non-neural
organs. In earlier studies, endogenous expression of PMP22 mRNA outside the nervous
system was detected in small intestine, lung, to some extent in heart by RNase protection
assays (Suter et al., 1994) and in a variety of other tissues by RT-PCR (Parmantier et al.,
1995; van de Wetering et al., 1999). Since no specific staining was observed on sections
of heart, lung, intestine and liver (data not shown), we decided to use the sensitive
luminescence ß-gal assay. We determined the ß-gal activity in homogenates of brainstem,
lung, intestine, muscle, heart, liver and sciatic nerve in -10/0kb PMP22 lacZ transgenic
animals compared to background levels in wildtype animals (Fig. 5-6a). Beside the
strong promoter activity in the sciatic nerve, we detected ß-gal activity significantly over
background of non-transgenic littermates only in brainstem and muscle tissue, although
the expression levels were about four orders of magnitude lower than in the sciatic nerve.
ß-gal activity in lung, intestine and heart was not distinguishable from background and
was not detectable at all in liver.
To confirm the expression of endogenous PMP22 mRNA in these organs, quantitative
RT-PCR was performed. High expression of 1A- and 1B-PMP22 mRNA in the sciatic
nerve and lower expression levels of 1B-PMP22 mRNA in lung and intestine (Fig. 5-6b)
were observed, in accordance with data from the rat system (Suter et al., 1994). In
contrast, no lacZ mRNA was detectable in lung or intestine. Whether this is due to the
general low abundance of the lacZ mRNA at levels below the limit of reliable detection
with RT-PCR, or due to missing promoter activity remains open.
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
48
Fig. 5-5 Fig. 5-6
Figure 5-5: Temporal expression profile of ß-galactosidase in the sciatic nerveduring postnatal development. (a) ß-gal activity in homogenates from the sciaticnerve increases dramatically in parallel with myelination. Four to six sciatic nerveswere analyzed. (b) Total RNA was isolated from sciatic nerve of -10/0kb PMP22lacZ transgenic animals at postnatal days 0, 4, 8, 10, 21 and 60, and the amount oftransgenic 1A-lacZ or 1B-lacZ mRNA per GAPDH mRNA was determined byquantitative RT-PCR. Total mRNA levels correlate well with the regulation of lacZexpression. Error bars represent the SD of six values obtained from twoindependent experiments. ß-gal activities are shown in relative light unit(RLU)*106. (c) Endogenous levels of 1A-PMP22 and 1B-PMP22 transcripts asmeasured by quantitative RT-PCR.
Figure 5-6: Spatial distribution of PMP22 promoter activity. (a) ß-gal expressionlevels in organs of three week-old -10/0kb PMP22 lacZ transgenic animals andwildtype littermates. The highest expression levels by far were found inhomogenates of the sciatic nerve. About four orders of magnitude less but stillsignificant levels of activity could be detected in brainstem and muscle tissue. Errorbars represent the SD of the ß-gal activities/µg protein of three different animals.
0
2
4
6
8
0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 9 0 100
wildtype PMP22-lacZ
ß-g
al a
ctiv
ity/�
g p
rote
ina
days postnatal
0
4
8
1 2
0 1 0 2 0 3 0 4 0 5 0 6 0 7 0
1A-PMP221B-PMP22Total (1A+1B)
[PM
P22
mR
NA
] / [
GA
PDH
mR
NA
]
b
[lac
Z m
RN
A]
/ [G
APD
H m
RN
A]
0
0.01
0.02
0.03
0 1 0 2 0 3 0 4 0 5 0 6 0 7 0
days postnatal
1A-lacZ1B-lacZTotal (1A+1B)
days postnatal
c
a
b
0
4
8
1 21A-PMP22 1B-PMP22
[PM
P22
mR
NA
] /
[GA
PDH
mR
NA
][l
ac Z
mR
NA
] /
[GA
PDH
mR
NA
]
0
0.01
0.02
0.03
sciatic nerve
liver lung intestine
1A-lacZ Line 44.2
1B-lacZ Line 44.2
1A-lacZ Line 48.4
1B-lacZ Line 48.4
sciatic nerve
liver lung intestine
0
2
4
6
8
40000
sciaticnerve
brain-stem liver lung intes-
tine muscle heart
wildtype
ß-g
al a
ctiv
ity
[RLU
*102
]/�
g p
rote
in
PMP22-lacZ*
*
c
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
49
Asterisks indicate statistical significance between values of transgenic and wildtypeanimals (Mann-Whitney U test, P<0.05). (b, c) Comparison of the endogenousPMP22 promoter with the transgenic PMP22 promoter activities in differenttissues. (b) About 3-fold more exon 1A than 1B-containing endogenous PMP22mRNA was detected in the sciatic nerve of 3-week old wildtype mice. In othertissues with PMP22 expression, mainly the 1B mRNA was found. (b) A similar ratioof 1A- to 1B-lacZ messages derived from the transgenic promoters could bedetected in the two -10/0kb PMP22 lacZ transgenic lines 44.2 and 48.4, although theabundance of LacZ mRNA was approximately two orders of magnitude lower thanthe endogenous PMP22 mRNA. Error bars represent the SD of all values (n=4-6)obtained from two independent experiments
5.7 -10/0kb PMP22 lacZ transgene regulation in Schwanncells after loss of axonal contact and in regeneration.
After a crush lesion of peripheral nerves, the axons distal to the injury degenerate.
During regeneration, they are replaced by regenerating axons growing out from the nerve
stump. During this process called Wallerian degeneration, the Schwann cells that lost
their axonal contact, initially dedifferentiate and proliferate, and finally remyelinate the
regenerated axons. Using this experimental paradigm, we examined whether the -10/0kb
PMP22 lacZ transgene also contains the necessary DNA elements for regulation of the
reporter gene by axonal contact as described for the endogenous PMP22 gene. Strong
downregulation of PMP22 had been seen within two weeks after a nerve crush followed
by an increase of PMP22 mRNA and immunoreactivity during remyelination (Snipes et
al., 1992; Suter et al., 1994). To this end, we performed nerve crush experiments in adult
-10/0kb PMP22 lacZ transgenic mice and analyzed ß-gal expression 9, 14 and 80 days
after the nerve crush in the distal part of lesioned nerves. These data were compared to
transgene expression levels of the corresponding nerves in the non-lesioned contralateral
nerve (Fig. 5-7a). Significant down-regulation of the transgene was detected nine days
after injury, even more pronounced after 14 days, followed by an upregulation to
expression levels similar to the contralateral nerve after remyelination (80 days post
crush).
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
50
Figure 5-7: Regulation of the -10/0kb PMP22 lacZ transgene during Walleriandegeneration and after regeneration. Temporal regulation of ß-gal expression aftera nerve crush (a) and after nerve transsection (b) of adult -10/0kb PMP22 lacZanimals. (a) Nine and 14 days after nerve crush, reduced ß-gal levels were observedduring Wallerian degeneration. After regeneration (80 days), ß-gal levels similar tothe contralateral nerve were detected. (b) 60 days after a nerve cut, the ß-galactivity of the distal part of the lesioned nerve was dramatically reduced comparedto the equivalent segment of the contralateral nerve, indicating that high ß-gallevels depend on axonal contact and myelination of the Schwann cells. Error barsrepresent the SD of the values for 3-4 animals. Asterisks indicate statisticalsignificance between values of lesioned and contralateral nerve (Mann-Whitney Utest, P<0.05).
By cutting peripheral nerves, reinervation distal to the cut is prevented. Using this
approach, we analyzed transgene expression in Schwann cells without axonal contact in
the distal part of the remaining nerve. Sixty days after the nerve cut, a strong
downregulation of the transgene was observed compared to the normal expression levels
in the non-lesioned contralateral nerve (Fig. 5-7b), indicating that axonal contact and
remyelination is necessary for full transgene activity.
To know whether there is a distal-proximal gradient of the transgene expression along a
nerve, we prepared in parallel additional homogenates of the proximal part of the
unlesioned nerve. Taken all measurement together, no significant difference could be
detected between the expression of the transgene in distal versus the proximal part of
unlesioned nerves (data not shown).
a
0
2 0
4 0
6 0
8 0
100
120
140
9 14 80
crushed nerve, distalcontralateral nerve
ß-g
al a
ctiv
ity
[% o
f co
ntr
alat
eral
ner
ve]
0
2
4
6
8
contra-lateral
distal(cut)
ß-g
al a
ctiv
ity
[RLU
*106
]/µ
g p
rote
in
days post crush
*
**
b
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
51
5.8 Sciatic nerves of PMP22 mutant animals show reducedß-gal levels
In a next step, we examined how the -10/0kb PMP22 lacZ transgene is regulated in
animal models for inherited peripheral neuropathies such as the Trembler mutant (Tr),
which has a point mutation in the coding region of the PMP22 gene (Suter et al., 1992a,
b), or in animals deficient for PMP22 (Adlkofer et al., 1995). These animals show
demyelination and incomplete remyelination without acute injury to the nerves (Sancho
et al., 1999, 2001). We analyzed the ß-gal activity in sciatic nerve homogenates of -10/
0kb PMP22 lacZ transgenic animals heterozygous for the Tr mutation compared to the ß-
gal activity in -10/0kb PMP22 lacZ transgenic animals without the Tr mutation. The
presence of the Tr allele led to a drastic reduction of the ß-gal activity in the sciatic nerve
at the age of three weeks (P21, Fig. 5-8a) and in adult animals (P60 and P90, Fig. 5-8a).
X-gal staining on teased nerve fibers of -10/0kb PMP22 lacZ transgenic Tr showed a
general reduced staining in all nerve fibers (data not shown).
In the same way, we examined the effects of PMP22 deficiency on -10/0kb PMP22 lacZ
transgene expression. -10/0kb PMP22 lacZ transgenic and PMP22-deficient mice were
analyzed at P21 and P60 and showed a significantly reduced ß-gal activity of the
transgene in the sciatic nerve compared to age-matched -10/0kb PMP22 lacZ transgenic
animals without PMP22 deletion (Fig. 5-8b). To check whether the neuronal expression
pattern of the transgene is changed in animals deficient for PMP22, whole mount
stainings of spinal cord and brainstem slices were analyzed, but no obvious changes were
observed (data not shown). X-gal staining on teased fiber preparations of the same
animals showed an inhomogeneous staining. Along the same fiber, some internodes
showed a strong X-gal staining whereas others stained only weakly (data not shown). It
has been previously reported that focal hypermyelination and myelin degeneration
occurs in the peripheral nervous system of adult PMP22 deficient mice (Adlkofer et al.,
1995). Therefore, the intensity of X-gal staining is likely to reflect whether the
corresponding Schwann cell is in a demyelinating or remyelinating phase. In addition,
the stripe-like accumulation of ß-gal at non-compacted myelin regions as seen in
wildtype animals (Fig. 5-3f), was not visible in either of the PMP22 mutants, indicating
an altered architecture of the myelin sheath as described by (Neuberg et al., 1999).
-10/0KB PMP22 LACZ CONSTRUCT IN VIVO RESULTS PART II
52
Figure 5-8: Activity of the -10/0kb PMP22 lacZ transgene in PMP22-mutant mice.ß-gal activity in sciatic nerve homogenates of the -10/0kb PMP22 lacZ transgene ona Tr mutant (a) or PMP22-deficient (b) background. A strong reduction of ß-galexpression in the sciatic nerve was observed in both PMP22 mutants at postnatalday 21 and in adult animals. ß-gal activities are shown in RLU*106. Asterisksindicate statistical significance between values of PMP22 mutant and wildtypeanimals (Mann-Whitney U test, P<0.05).
a
0
1
2
3
4
5
ß-g
al a
ctiv
ity
/ µg
pro
tein
wt Tr
P21 P60 P90
* * *wt Tr wt Tr
b
0
2
4
6
8
wt PMP22-/-
P21 P60
wt PMP22-/-
**
ß-g
al a
ctiv
ity
/ µg
pro
tein
PROMOTER DELETION ANALYSIS IN VIVO RESULTS PART III
53
6 PMP22 PROMOTER DELETION ANALYSIS IN VIVO
Part of this chapter will be the basis for a publication:
Marcel Maier, Francois Castagner, Philipp Berger and Ueli Suter (2003). Dissection of
the Peripheral Myelin Protein 22 (PMP22) Promoter in vivo Reveals a Late Myelinating
Schwann Cell Specific Element, manuscript in preparation
In a search for the cis-acting regulatory elements that control PMP22 expression in the
peripheral nervous system (PNS), we analyzed the expression of PMP22 - regulated
reporter constructs in transgenic mice. In a previous study, we started our analysis with a
ten kilobase fragment upstream of exon 2 of the PMP22 locus (Fig. 6-1a, cf. part II;
Maier et al., 2002a; referred to as -10/0kb PMP22 lacZ (PMP22-lacZ) construct, Fig. 6-
1b). In figure 1 and for the rest of the text, base +1 was defined at the A of the translation
start codon on exon 2. The 10 kb fragment contained promoter 1 preceding the
nontranslated exon 1A, promoter 2 preceding the alternatively used exon 1B and the first
part of exon 2 to the translation start codon. The alternative use of the two promoters
results in two mRNA that encode the same protein and differ only in their 5’ non-coding
region (Suter et al., 1994). We have shown previously, using quantitative RT-PCR, that
both promoters are active on this transgene since both transgenic transcripts could be
detected in addition to the two endogenous mRNA species in the siatic nerve (Maier et
al., 2002a). Our analysis showed that this 10 kb fragment contains regulatory elements
that reflect endogenous PMP22 expression in Schwann Cells during late myelination, in
PNS sensory and motor neurons, as well as during Wallerian degeneration and
remyelination after nerve crush.
To further dissect the cis-acting regulatory elements of PMP22 in the PNS, several
additional transgenic mouse lines with subfragments of this 10 kb element fused to the sh
ble-lacZ fusion reporter gene or to a heterologous hsp68 promoter fused to lacZ were
generated. The different reporter constructs tested as transgenes in vivo can be split
roughly into two groups. The first group of constructs was used to dissect the regulatory
elements responsible for the expression of the reporter gene in Schwann cells during
PROMOTER DELETION ANALYSIS IN VIVO RESULTS PART III
54
Figure 6-1: Reporter constructs used in transgenic mice to map PNS specificelements in the PMP22 promoter. (a) Diagram of the endogenous mPMP22 genomiclocus with promoter 1 preceding the nontranslated exon 1A and promoter 2 in frontof the alternatively used exon 1B. All numbers refer to the nucleotide +1, defined asthe "A" of the translation start codon on exon 2. (b-h) Constructs containingdifferent parts of the 10 kb region 5’ to exon 2 (-10/0kb region) were used to derivetransgenic mice. The -10/0kb PMP22-lacZ construct (Fig. 6-1b) was used in aprevious study (Maier et al., 2002a; PMP22-lacZ) and its activity reflects endo-genous PMP22 expression in Schwann cells during late myelination, in sensory andmotor neurons of the PNS, and during remyelination after a nerve crush. For thisstudy 5’ sequences extending from -10 kb to -4 kb (c), from -6.5 kb to -4 kb (d), orfrom -10 kb to -6.5 kb (e), were inserted at nucleotide -120 bp upstream of exon 2,which was in turn fused to a sh ble-lacZ fusion reporter gene. (f) To determine thefunction of the regulatory elements upstream of the core promoter 1/exon 1A afragment extending from -10 kb to -4.3 kb was fused to the heterologous corepromoter of the hsp68 gene. (g, h). By fusing -3/0 kb (g) or -4/0 kb promoter regions(h) to the sh ble-lacZ fusion reporter gene, the region between -4 kb and -3 kb wasanalysed. tss: translation start site, Sa: Sal I, K: Kpn I, St: Stu I, N: Not I
1A 1Bzeo lacZ pA
-10/0 kb PMP22 lacZ (PMP22lacZ)
1 kb
2K
-4.29
-4.18
-4.13
-1.66
N
-1.51
+1
1A 2-10/-4 kb Pro1 lacZ
zeo lacZ pA
-0.12
-3/0 kb Pro2 lacZ (PMP22-1B-lacZ)
hsp lacZ pA
-10/-4 kb hsp lacZ
2-6.5/-4 kb Pro1 lacZ 1A
zeo lacZ pA
1A 1B 2-4/0 kb Pro2 lacZ
zeo lacZ pA
1B 2
-2.96zeo lacZ pA
-10/-6.5 kb Pro1 lacZ 1A 2
zeo lacZ pA
-6.56
-4.01
-4.33
1A 1B 2 3 4
ATG
Promoter 1 Promoter 2 5
genomic mPMP22
a
b
c
d
e
f
g
h
-3.91
St
tss 1 tss 2
-10.04
+17.9 +25.5
Sa
PROMOTER DELETION ANALYSIS IN VIVO RESULTS PART III
55
myelination. They contained fragments of the 6 kb region upstream of exon 1A either in
front of the endogenous PMP22 promoter 1 (-10/-4kb Pro1 lacZ, -6.5/-4kb Pro1 lacZ and
-10/-6.5kb Pro1 lacZ, Figs. 6-1c, d, e) or in front of a heterologous promoter (-10/-4kb
hsp lacZ, Fig. 6-1f). The second group (-3/0kb Pro2 lacZ; PMP-1B-lacZ in Maier et al.,
2002a), -4/0kb Pro2 lacZ, Figs. 6-1g, h) contained fragments of the 4 kb region
immediately upstream of exon 2 including promoter 2 regions but lacking promoter 1.
6.1 Late myelination Schwann cell specific elements(LMSE) reside in the 6 kb DNA fragment upstream ofpromoter 1
Four out of the five mouse lines transgenic for the -10/-4kb Pro1 lacZ construct (Figs. 6-
3a) showed robust expression of the reporter gene in Schwann cells during postnatal
development in spinal nerves (e.g. sciatic nerve; Fig. 6-2) as well as in some cranial
nerves (e.g. trigeminal nerve, data not shown). Detailed analysis of the temporal and
quantitative expression of the reporter gene by whole mount X-gal staining and in
homogenates of the sciatic nerve at postnatal day P4, P12, and P30, revealed an
upregulation of the transgene beginning around P12 (Fig. 6-3b). This is rather late
compared to the timing previously reported for the endogenous PMP22 mRNA in rat or
mouse sciatic nerve (Maier et al., 2002a; Suter et al., 1994). A similar late expression
had been observed previously with the -10/0kb lacZ reporter gene (Maier et al., 2002a),
suggesting that late myelination Schwann cell specific elements (LMSE) are localized in
the -10/-4kb region.
X-gal staining of teased fiber preparations from sciatic nerves showed expression of ß-
gal in many Schwann cells associated with large caliber axons (Fig. 6-3c). The
percentage of ß-gal positive internodes varied between 40 and 80% in lines 828 and 830,
and between 5 and 15% in lines 827, 829, 831. Typical for the ß-gal staining of Schwann
cells on teased fiber preparations was the accumulation of cytoplasmic ß-gal in regions
with substantial Schwann cell cytoplasm, at the paranodes (Fig. 6-3c, filled arrowhead),
and in Schmidt-Lantermann incisures or perinuclear regions (Fig. 6-3c, open
arrowheads). Consistent with the finding that preferentially Schwann cells associated
PROMOTER DELETION ANALYSIS IN VIVO RESULTS PART III
56
Figure 6-2: Spatial expression patterns of transgenic reporter constructs in theperipheral nervous system. Presence (+) or absence (-) of reporter gene expressionwas examined using the histochemical ß-galactosidase assay, as described inMaterials and Methods. The analysis included samples from the period of maximalmyelin gene expression in postnatal development (P21 to P60). "+" was defined bystaining that contrasted with failure to stain in age-matched non-transgeniccontrols. Motor neuron and sensory neuron expression was analyzed on sectionsand on whole mount preparations of spinal cord tissue, sensory neuron expressionin addition by whole mount staining of dorsal root ganglia (DRG). Expression inSchwann cells was judged on whole mount X-gal staining and/or on teased fiberpreparations of the sciatic nerve. If no transgene transmission was achieved onlythe founder animal was analyzed (indicated with F). Footnotes: ° only observed in founder animal; (+): not consistently observed indifferent animals of the same line; a: plus 13 transgenic founder mice positive and 6
-10/0 kb PMP22 lacZ*
-10/-4 kb Pro1 lacZ
-3/0 kb Pro2 lacZ*
-10/-4 kb hsp lacZ
-6.5/-4 kb Pro1 lacZ
-4/0 kb Pro2 lacZ
motor sensory(DRG, sp.c.)
Schwann Cellslarge caliber
axonssmall caliber
axons
Neurons
Line (L) orFounder (F) #
L37.1 + + ++ +L44.2 ++ ++ +++ +L48.4 ++ ++ +++ +L45.2 (+) + + +a
L08.1 (h) d - - - -L95.2 (h) - - - -L10.2 (h) - - - - L12.2 (h) - - - -L19.1 (h) - - - -c
L818 - +° - -L819 d - + - -L820 d - +° - - F821 d - + - -L822 - + - -L823 d - + - -L824 (+) + + +L825 - +° - -L826 - - - -
F827 d - - ++ -L828 - - ++ +°L829 - + + -L830 - - ++ -L831 - - (+) -
F853 - - + +°
L858 d - (+) + -L860 - (+) + -L861 - - (+) -
L887 - - - - L907 - - - -L909 - (+) - -b
-10/-6.5 kb Pro1 lacZ ongoing
PROMOTER DELETION ANALYSIS IN VIVO RESULTS PART III
57
negative for ß-gal in peripheral nerves on tail sections; b: plus 5 transgenic foundermice negative on whole mount staining; c: plus 23 transgenic founder mice negativeon tail sections and 2 negative on whole mount staining; d: Line shows uniquepattern of expression outside the PNS, attributed to enhancer trapping at the site oftransgene insertion; h: ß-gal enzymatic activity measured in homogenates of sciaticnerve, heart, intestine, liver, lung, muscle or brainstem did not show any activityabove background; *: published in (Maier et al., 2002a)
with large caliber axons were positive for ß-gal, the ventral roots (which contain mainly
large caliber axons, arrows in Figs. 6-3d, e, f) were more intensively stained than the
dorsal roots (filled arrowheads in Figs. 6-3d, e, f) on whole mounts of the lumbar spinal
cord at P21 (Fig. 6-3d) and P90 (Fig. 6-3e). Furthermore, this expression of the transgene
is maintained in older animals (in mice of line 830 up to 13 months of age; data not
shown)
In contrast to mice with the -10/0kb lacZ transgene, four out of five mouse lines
transgenic for the -10/-4kb Pro1 lacZ construct showed no expression in sensory
neurons, as determined on whole mount X-gal stainings of dorsal root ganglia (DRG,
open arrowhead, Fig. 6-3f), and in motor neurons located in the ventral horn of the grey
matter in the spinal cord (asterisk in Fig. 6-3g), along the entire anterior-posterior axis.
PROMOTER DELETION ANALYSIS IN VIVO RESULTS PART III
58
Figure 6-3: -10/-4kb Pro1 lacZ transgenic mice show high ß-gal expression inSchwann cells of predominantly large caliber fibers in peripheral nerves and inspinal cord nerve roots. (a) schematic depiction of the -10/-4 kb Pro1 lacZtransgene. (b) ß-gal enzymatic activity in homogenates of the sciatic nerve atpostnatal day P4, P12 and P30 is indicated in the bar diagram. Whole mount X-galstaining of pieces of the corresponding sciatic nerve from -10/-4 kb Pro1 lacZtransgenic mice of line 830 are shown above the graph. Onset of ß-gal expression isaround P12 and increases dramatically during the late phase of myelination (P30).ß-gal activities are shown in relative light unit (RLU)*105 /µg protein. (c) X-galstaining on teased sciatic nerve of a three week-old mouse of line 828. Mainly largecaliber axons are enwrapped with ß-gal positive Schwann cells which show thetypical accumulation of the cytoplasmic ß-gal in regions with increased Schwanncell cytoplasm (open arrowheads: perinuclear, filled arrowheads: paranodal). (d, e)In whole mount X-gal staining of the spinal cord of 21-day (d) and 90-day old (e)transgenic mice of line 828, ß-gal expression is found in ventral roots (arrows) and
0
4
8
12
16
P12 P30
ß-g
al a
ctiv
ity
[RLU
*105
]/µ
g p
rote
in
days postnatal
d e
1A 2
-10/-4 kb Pro1 lacZzeo lacZ pA
a
P4
P90
P21
P90
f g
P21
b c
P21
**
PROMOTER DELETION ANALYSIS IN VIVO RESULTS PART III
59
to a lesser extent in the dorsal roots (arrowheads) of the lumbar spinal cord (rootmodality was identified by the site of insertion into the spinal cord). (f) Wholemount staining of dorsal root ganglion (DRG) with attached dorsal (filledarrowhead) and ventral roots (arrow). (g) Staining of crossection through thethoracic spinal cord of three week old transgenic mice of line 828. In four out of fivelines transgenic for the -10/-4kb Pro1 lacZ construct, no neuronal expression of ß-gal was detected either in the DRG where the cell soma of sensory neurons arelocated (f, open arrowhead) or in the ventral horn of the grey matter where the cellbodies of motor neurons can be found (g, asterisks). Scale bars: 50µm (c), 500µm(d,e), 100µm (f,g)
6.2 The LMSE confer Schwann cell specificity to the non-cell type-specific hsp68 promoter and are functionalindependent of core promoter 1 and exon 1A
To examine whether the 6 kb element contained in the -10/-4kb Pro1 lacZ construct had
functions characteristic of an enhancer and could act independently of core promoter 1,
exon 1A, and exon 2 sequences, we generated a construct with a slightly shorter segment
extending from -10 kb to -4.29 kb fused to the 0.3 kb minimal promoter of the heat shock
protein hsp68 (Fig. 6-4a). Thus, the core promoter 1 of PMP22 up to -120 bp from the
transcription start site as mapped by Suter et al. (1994), was replaced by the minimal
promoter of hsp68. This promoter contains a TATA-box, an SP1 recognition site, a
CCAAT box, and three heat shock response elements with no elements contributing to
tissue-specific expression (Kothary et al., 1988; Kothary et al., 1989). This promoter has
been succesfully used before to characterize distal Schwann cell enhancer elements
(Forghani et al., 2001; Mandemakers et al., 2000) or a retinoic acid response element
(Rossant et al., 1991) in vivo.
All four founder animals carrying this -10/-4kb hsp lacZ transgene expressed ß-gal
specifically in Schwann cells as determined by whole mount staining of sciatic nerves.
The percentage of ß-gal positive internodes varied between 44% for founder 853, 11%
and 12% for founder 858 and 861, respectively, and about 1% for founder 860. In the
founder animal 858 and in F2 animals of this line, robust expression of the transgene
could be detected in many Schwann cells mainly associated with large caliber fibers (Fig.
PROMOTER DELETION ANALYSIS IN VIVO RESULTS PART III
60
6-4c, d). Thus, this line was used to determine the temporal expression pattern during
early postnatal development in homogenates of the sciatic nerve at P4, P12 and P30 (Fig.
6-4b). A late upregulation of the reporter gene around P12 was detected. This timing is
comparable to that observed in animals transgenic for the -10/-4kb Pro1 lacZ construct
(Fig. 6-3b) and for the -10/0kb lacZ construct (Maier et al., 2002a). Robust ß-gal
expression was detected in Schwann cells by whole mount staining of the lumbar spinal
cord with attached roots (Fig. 6-4e). No expression was observed in the DRG where the
cell soma of sensory neurons are located (empty arrowhead in Fig. 6-4f), whereas the
nerves were strongly positive. In contrast to line 858, especially in the F1 and F2 animals
of lines 860 and 861, a highly mosaic expression of the transgene in Schwann cells was
observed. About 12% of the internodes were positive for ß–gal in the sciatic nerve of the
founder animal 861 (Fig. 6-4g), but this number decreased dramatically in later
generations (F1 generation: about 1%; Fig. 6-4h), with only some 5-10 positive
internodes per sciatic nerve remaining in the F2 generation (Fig. 6-4i).
PROMOTER DELETION ANALYSIS IN VIVO RESULTS PART III
61
Figure 6-4: The 6 kb LSME targets expression in the context of a heterologoushsp68 promoter. (a) The 6 kb LSME was ligated to a 0.3 kb hsp68 minimalpromoter and used to derive -10/-4kb hsp lacZ transgenic mice. (b) Bar diagramshowing the developmental expression of the -10/-4kb hsp lacZ transgene asdetermined by ß-gal enzymatic activity in homogenates of the sciatic nerve atpostnatal day P4, P12 and P30. Whole mount X-gal staining of pieces of thecorresponding sciatic nerve from transgenic mice of line 858 are shown above thegraph. Onset of ß-gal expression was around P12 and increased dramaticallyduring the late phase of myelination (P30). ß-gal activities are shown in relativelight unit (RLU)*105 /µg protein. (c, d) Teased fiber preparation of the sciatic nerveof the founder animal (c) and of a F2 animal of line 858 (d) with ß-gal positiveinternodal segments mainly detected on large caliber axons. (e, f) ß-gal can still bedetected in the attached dorsal (arrowhead) and ventral roots (arrow) by a wholemount X-gal staining of the lumbar spinal cord (e) or of the DRG (f) in the 11
Founder 858
f
e
hsp lacZ pA
F1 L861
F2 L861
-10/-4 kb hsp lacZ
a
b
c
F858
F2 L858
d
gP12 P30ß-g
al a
ctiv
ity
[RLU
*105
]/µ
g p
rote
in
days postnatalP4
F861
h
i
0
1
2
3
4
5
PROMOTER DELETION ANALYSIS IN VIVO RESULTS PART III
62
month old founder animal of line 858. No neuronal expression was detected inanimals with this transgene in the DRG (empty arrowhead in f). (g, h, i) In contrastto line 858, in F1 animals (h) of line 861 only few and in F2 animals (i) only singleinternodes positive for ß-gal could be detected on teased fiber preparations of thesciatic nerve.
6.3 The 4 kb sequence upstream of exon 2, includingpromoter 2, contains elements directing expression insensory neurons
As a first step to analyze promoter 2 associated regulatory elements we generated
transgenic mouse lines using the -3/0 kb sequence fused to the sh ble lacZ reporter gene
(-3/0kb Pro1 lacZ transgene (Maier et al., 2002a; PMP-1B-lacZ); Fig. 6-1g). This
construct showed cell-line specific expression in transfection experiments in the mouse
Schwann cell line MSC80 compared to the fibroblast NIH 3T3 cell line (cf. part I). Out
of 33 PCR-positive founders, only six mice showed weak and unspecific expression of ß-
gal in cross-sections of tail biopsies (data shown). These six founders and another
randomly chosen four founders were mated with B6D2F1 hybrid mice. None of the F1
animals showed expression in Schwann cells or neurons, nor were consistent significant
levels of ß-gal activity detected with the sensitive luminescence ß-gal assay in heart,
intestine, lung, muscle and brainstem (data not shown).
In the next step, we wanted to determine the expression pattern directed by the 4 kb
between exon 1A and exon 2 in vivo (-4/0kb Pro2 lacZ, Figs. 6-1h and 6-5a). In whole
mount X-gal staining of the DRG of three founder mice (lines 818, 820, 825) and four
out of five lines (lines 819, 821, 822, 823; Fig. 6-2), we observed large ß-gal positive
cells suggestive of sensory neurons (Figs. 6-5b, c; arrow). A detailed analysis of the
temporal expression pattern of mice from line 822 showed that the transgene was already
detected at postnatal day P4 in the DRG (Fig. 6-5b) and was still highly expressed in a
one year-old animal (Fig. 6-5e). The temporal expression of this -4/0kb Pro2 lacZ
transgene therefore recapitulates the sensory neuron expression pattern of the -10/0kb
PMP22 lacZ construct (Maier et al., 2002a).
PROMOTER DELETION ANALYSIS IN VIVO RESULTS PART III
63
Figure 6-5: Developmental expression of the -4/0kb Pro2 lacZ transgene showsspecific expression in sensory neurons. (a) Schematic view of the -4 kb Pro2 lacZtransgene. (b) Expression of lacZ detected at postnatal day P4 by whole mountstaining of the dorsal root ganglion (DRG, arrow) in transgenic mice of line 822. (c)At P21, lacZ expression is seen both in the DRGs (arrow) and in the dorsal columntract (gt) of the thoracic spinal cord. (d) On a cross-section through the thoracicspinal cord of a 90 day old mouse of line 821 ß-gal can be detected in addition in thedorsal horn of the grey matter (d, empty arrowheads). (e) Expression of ß-gal ismaintained in a one year-old animal (founder of line 822) and can be detected inhigh amounts in the processes of the sensory neurons by a diffuse X-gal staining inthe dorsal roots (dr) of the lumbar spinal cord. (f, g) On a teased fiber preparationof the sciatic nerve of the founder animal of line 822, the diffuse staining seen indorsal roots and in the sciatic nerve can be localized to a subset of myelinated fibers(f: phase contrast, g: bright field microscopy of the same fibers). The typicalaccumulation of ß-galactosidase reaction product in cytoplasmic compartments ofthe Schwann cells such as the paranode (arrowhead) is not seen and therefore theweak staining most likely derives from neuronal expression of ß-galactosidase. (h)Immunohistochemical staining of dissociated DRG from P4 animals. Neurofilament(NF, red) and ß-galactosidase (ß-gal, green) were detected in the same cells, gt:gracile tract, vr: ventral roots, dr: dorsal root, Scale bar: 200 µm (b-e), 20µm (f-h)
NF
ß-gal
1B 2-4kb Pro2 lacZ zeo lacZ pA
gt
L821P4
b c d
a
hgt
g
f
F822
drvr
vr
dr
e
L822
L822
P21
P30
PROMOTER DELETION ANALYSIS IN VIVO RESULTS PART III
64
Additional evidence that the ß-gal-positive DRG cells are neurons was provided by the
analysis of the ß-gal expression of the different cell types in vitro. DRG from P4 animals
were dissected, enzymatically dissociated and the cells placed in culture for three days.
Staining of the mixed cell population with antibodies against ß-gal and neurofilament
revealed a co-localization in cells with a neuronal morphology (Fig. 5-5h). In addition,
X-gal staining of sister plates showed ß-gal positive cells indentified by morphology as
neurons (data not shown).
Additional staining was observed in the higher expressing lines, such as 821 and 822, in
the dorsal column of the spinal cord as shown for a 90-day old F2 animal of line 822
(Fig. 6-5c). DRG neurons give rise to a peripheral extensions and to central axons. The
latter either terminate directly in the dorsolateral region of the spinal cord or ascend
ipsilaterally through the dorsal columns of the cord and terminate in the dorsal column
nuclei located in the lower medulla. Indeed, in line 821 and in the founder animal of line
822, additional staining was detected in the dorsal horn of the spinal cord (empty
arrowheads in Fig. 6-5d), as also observed previously in mice transgenic for the -10/0kb
lacZ construct (Maier et al., 2002a). In these high expressing lines 821 and 822 we
detected an additional weak and diffuse staining in dorsal roots (Fig. 6-5e), on whole
mount stainings of the sciatic nerve (data not shown), and in a subset of fibers in teased
fiber preparations (Fig. 6-f, g). However, the typical accumulation of the cytoplasmic ß-
gal staining in regions with increased Schwann cell cytoplasm such as at the paranodes
(arrowhead in Fig. 6-5f, g) was not observed, and the staining was always continuous
over several internodes. This pattern is that expected if expression occurs only in the
peripheral extensions of the sensory neurons and not in Schwann cells. This is also
consistent with the ß-gal activity we could detect in the extensions of the DRG neurons
of the dorsal columns of the spinal cord.
COMPUTATIONAL ANALYSIS OF PMP22 PROMOTERS RESULTS PART IV
65
7 COMPUTATIONAL ANALYSIS OF CONSERVED
PROMOTER ELEMENTS AND REPETITIVE GENOMIC
REGIONS
The availability of extensive sequence data for both the human and mouse genome has
provided the opportunity to identify regulatory elements using global sequence
alignments as functionally important sequences are often conserved during evolution
(Hardison et al., 1997; Mandemakers et al., 2000).
As a first step, we compared mouse and human sequences (Fig. 7-1a) using either the
VISTA program (Mayor et al., 2000)(see Material & Methods for details concerning
software and sequences) or the PIPMaker software (data not shown) to facilitate the
delimitation of regulatory elements in the whole PMP22 gene locus. Scanning with a 100
bp window, regions with more than 75% sequence identity were noted between -23 kb
and +40 kb (Fig. 7-1a). Homologous regions further upstream (> -30 kb) (data not
shown) most likely belong to the mouse homolog of TEKT3, which is the gene upstream
of PMP22 on the human sequence (Inoue et al., 2001). In general, regions with more
than 75% identity within the PMP22 gene locus were mainly found in the -10/0 kb
region but in addition also between exon 2 and +10 kb and upstream of exon 5 at the 3’
end of the gene. With the RepeatMasker program we annotated the mouse DNA
sequence for interspersed repeats and low complexity DNA sequences and visualized
them with the PIPMaker software as different boxes above the diagram (Fig. 7-1a,b,
legend in the figure; for review see Smit, 1996).
In a second step we focused our analysis on the -10/0 kb regulatory region that we have
characterized previously in vivo (Fig. 6-1a) (Maier et al., 2002a), and performed a
pairwise sequence alignments of three species (murine, human, rat) (Dubchak et al.,
2000) using the VISTA program. The human/rat alignment is very similar to the human/
mouse alignment (Fig. 7-1b) since the mouse and rat sequences are more than 75%
identical over almost the whole region (data not shown). As reported earlier, a high
nucleotide sequence conservation surrounding both transcription start sites and regions
rich in CpG dinucleotide around promoter 2 can be observed on the PIP (Fig. 7-1b)
(Suter et al., 1994; van de Wetering et al., 1999). We grouped the remaining regions of
COMPUTATIONAL ANALYSIS OF PMP22 PROMOTERS RESULTS PART IV
66
Figure 7-1: Distribution of conserved DNA segments and repetitive DNA elementsin the mouse PMP22 gene locus combined with potential binding sites fortranscription factors. (a, b) Percent identity plot (PIP) generated using the VISTAalgorithm (Mayor et al., 2000) to compare the murine PMP22 genomic locus (AL592215) from -26 kb to +40 kb (a) or from -10.5 kb to +1bp (b) (horizontal axis; inrelation to the translation start codon (+1)) with the orthologous human sequences.The vertical axis indicates percent identity in a 100 bp window with a 31 bpresolution (a) or in a 50 bp window with a 15 bp resolution (b) of the plot. Regionswith >75% identical nucleotides are highlighted in gray. Note that the baseline is50%. The locations of coding exons (black rectangles), 5'- and 3'-untranslatedregions (U, open rectangles) and interspersed repeats (legend in the figure; Smit,1996) were identified using RepeatMasker software and are shown as differentboxes above the profile. Above the alignment for the -10/0kb PMP22 sequence (b)analyzed in the present study, conserved regions (CR) are numbered from 1 to 5. (c)
COMPUTATIONAL ANALYSIS OF PMP22 PROMOTERS RESULTS PART IV
67
Potential binding sites for transcription factors for which a binding matrix haspreviously been defined, and which are known to play a role in myelination or to beexpressed in Schwann cells: Krox20/Egr-2, Egr-1, Tst-1/Oct-6, Pax-3, Peroxisomeproliferator-activated receptor (PPAR), Progesterone receptor binding site (PREBS), cAMP-responsive element binding protein 1 (CREBP), Brn-2/Pou3f2. (d)Alignment with the PMP22 promoter driven constructs analyzed in the presentstudy. Sequencing of the -10/0kb PMP22 DNA segment used for the cloning of ourconstructs revealed that the repetitive region from -8.0 to -7.46 (in a, b) is missingcompared to the published mouse PMP22 sequence (AL 592215) (indicated with adotted line).
high identitiy of the human/mouse alignment into five conserved regions (CR, Fig. 7-1b).
In CR 1 two peaks of high identity were found, whereas CR 2 and CR 3 mark regions
with an overall identity above 50% but without larger regions above 75%.
The -10/0kb sequence was screened for potential binding sites with the Mat Inspector
program (Quandt et al., 1995). Among the 1080 putative elements identified, we selected
the specific transcription factors for which a binding matrix once had previously been
defined (for references see below and Material and Methods), and which were described
to be involved in myelination or to be expressed in Schwann cells (Wegner, 2000a; b).
The sites chosen are: Krox20/Egr-2 and Egr-1 (Swirnoff and Milbrandt, 1995), Tst-1/
Oct-6 (He et al., 1991), Pax-3 (Chalepakis and Gruss, 1995), Peroxisome proliferator-
activated receptor (PPAR) (Palmer et al., 1995), Progesterone receptor binding site (PRE
BS) (Nelson et al., 1999), cAMP-responsive element binding protein 1 (CREBP) (e.g.
Benbrook and Jones, 1994; Paca-Uccaralertkun et al., 1994), Brn-2/Pou3f2 (He et al.,
1989; Li et al., 1993) (Fig. 7-1c). Interestingly, many potential binding sites for Oct-6,
Brn-2, Egr-1 and Egr-2 are found in the -10.5/-9kb region although no longer stretches of
sequence similarity were found between the human and mouse sequence. Nevertheless,
we found potential binding sites for these transcription factors also on the corresponding
human sequence. In conserved regions, a potential binding site for Egr-2 can be found in
CR2 and for the progesterone receptor in CR1 and CR4.
In Fig. 7-1d the results from this computer screening are aligned to the PMP22-promoter
constructs analysed as transgenes.
68
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
69
8 DISCUSSION AND OUTLOOK
8.1 PART I: MYELIN GENE REGULATION IN VITRO
Commitment, differentiation and maturation of neural cells are dependent on complex
programs that determine specific patterns of gene expression. Thus, the elucidation of the
regulation of neural gene expression will provide important information on the cellular
mechanisms involved in the differentiation and maturation of the nervous system. In this
context, I have analyzed the regulation of the PMP22 gene. The gene is of particular
interest, because of its gene-dosage sensitivity, leading to hereditary peripheral
neuropathies, and because of its pivotal role in Schwann cell biology and myelination.
I tested the suitability of different cell culture systems for reliable studies of PMP22 gene
expression. I started with a classical in vitro promoter deletion analysis, by transfection
of constructs containing different fragment of the 10kb region upstream of exon 2 fused
to a lacZ reporter gene. I found that promoter 1 of PMP22 was active only at very basal
levels in the mouse Schwann cell line MSC80 or in cultured Schwann cells. On the other
hand, promoter 2 derived PMP22 expression was found in considerable amounts in those
cells. This is probably due to the fact that cultured Schwann cells without coculturing
with neurons do not myelinate in vitro, so that the Schwann cells do not integrate axonal
signals into their transcriptional regulation. This is in contrast to the in vivo situation in
the peripheral nerve, where promoter 1 derived 1A-PMP22 message is predominant
during myelination (Suter et al., 1994). Indeed, PMP22 expression in cultured Schwann
cells can be increased by addition of the adenylate cyclase activator forskolin, which can
mimic under certain conditions some aspects of axonal contact of Schwann cells (e.g.
Lemke and Chao, 1988; Trapp et al., 1988). This confirms the observation that promoter
1 is the myelin-associated promoter and very likely responsible for the expression levels
of PMP22 during myelination, which are much higher than the promoter 2-derived
constitutive expression levels in non-myelinating Schwann cells or other cell types.
Consequently, in my opinion, it is not reasonable to study promoter 1-associated
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
70
expression of PMP22 in cultured Schwann cells by studying, for example, promoter
deletion constructs of promoter 1 in transfections. Nevertheless, an extensive promoter
deletion study was performed by Hai et al., (2001) in the RT4-D6P2T rat schwannoma
cell line (Imada and Sueoka, 1978; Yamada et al., 1995). In this cell line, they detect
some expression of the promoter 1 associated 1A-PMP22 and high expression levels of
1B-PMP22 transcripts in RNase protection assays after addition of high forskolin
concentrations (50µM). In a promoter deletion study with constructs ranging from -3451
bp to -43 bp of the human sequence (relative to the transcription start site 1 on exon 1A,
Suter et al., 1994) directly fused to the luciferase reporter gene, they detected expression
levels in the range of the SV40 promoter activity (if the SV40 construct was also
transfected in equimolar amounts). The relative expression levels increased slightly with
each additional 5’ deletion up to -105 bp. The last deletion to -43 bp led to a complete
loss of reporter gene activity. My present interpretation of these results is, that they
reflect basal promoter activity that increases with each additional deletion of – at least in
these cells – negative acting ‘myelin specific elements’. This basal promoter activity is
abrogated with the deletion of the obviously essential -105/-43bp promoter region, which
is just upstream of the core promoter 1. Note that in vivo this sequence can be replaced
by a hsp68 minimal promoter without loss of cell type specificity (cf. part III). On the
other hand the differences in the results might also be due to the use of the human
promoter sequence, to the different cell line used, or due to the direct fusion of the
reporter gene to exon 1A so that a splicing event is not required for correct expression.
Another result from my promoter deletion analysis was that expression levels of the
PMP22 promoted reporter constructs were considerably higher in MSC80 cells
compared to NIH3T3 cells. For this comparison the SV40 promoter expression levels
serve as a standard with the assumption that the SV40 promoter is expressed at similar
levels in both cell types. If these different relative expression levels indeed can be
confirmed by measurement of the absolute expression levels, one could conclude that the
MSC80 cells contain certain factors which increase the low levels of PMP22 expression
and which are not abundant in NIH3T3 cells. It would be very interesting to identify
these factors which are differentially expressed in only one cell line. This could be done
for example on RNA levels using microarray technology or on protein levels using 2D-
gel electrophoresis and other proteomic approaches.
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
71
Another cell culture system in which PMP22 expression has been studied involves in
vitro myelination of DRG neurons by Schwann cells (Pareek et al., 1997). Unfortunately,
in vitro myelination systems of the PNS, especially with mouse tissue, are not very
reliable and nearly as time-consuming as in vivo experiments. In addition from my own
experience, they are not established to the degree that additional manipulations or
modifications are tolerated or can be reliably evaluated in a quantitative manner.
Therefore I did not present my initial in vitro myelination experiments to characterize the
-10/0kb PMP22 lacZ transgenic mice in the present thesis.
Since we did not have a cell culture system in which both promoters of PMP22 were
reliably expressed, I shought another setting in which PMP22 expression could be
induced e.g. by exogenously altered expression of transcription factors. This was done
successfully for the myelin protein zero (MPZ) in cotransfection experiments (Monuki et
al., 1990; Zorick et al., 1999) or with doxycycline induction of transcription factors in
N2A cells (Peirano et al., 2000). Unfortunately, I did not observe any upregulation of
PMP22 promoter-directed reporter gene expression by cotransfection of various
transcription factors (see chapter 4.1) nor did I see a co-regulation of PMP22 with P0 by
Sox10 in N2A cells (see chapter 4.3). At least in this setting, PMP22 seems not to be
regulated by Sox10. This is astonishing, since these two myelin genes have a comparable
temporal and spatial expression pattern, at least postnatally in myelinating Schwann
cells.
One may speculate why these systems are not working, but it must be realized that
complex interactions and combinations of known and of probably still unknown
regulatory factors finally lead to the correct temporal and spatial expression in a complex
organ like the PNS. In addition the cotransfected transcription factors are usually
strongly overexpressed and may therefore “overload” the physiology of the cell (e.g. the
RNA splicing machinery), and additionally required endogenous factors may not be
available in sufficient amounts.
Even so, Nagarajan and coworkers found a way to circumvent some of these problems.
Infection of cultured Schwann cells with adenovirus expressing Krox20 led to an
upregulation of myelin genes, with steady-state mRNA levels rising between 5-fold
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
72
(MBP) and 60-fold (for MPZ)(Nagarajan et al., 2001). This means that transcription of
myelin genes in their endogenous chromosomal context can be induced by the
overexpression of Krox20. I could reproduce this up-regulation of myelin genes, at least
in the absence of serum. The presence of 10% FCS in the cell culture medium prevented
a strong upregulation of PMP22. Possibly mitogens in the serum prevent the Schwann
cells from attaining a pro-myelinating-like phenotype and concomitant upregulation of
PMP22/growth arrest specific gene 3 (gas-3) (Zanazzi et al., 2001).
The expression levels of the myelin genes in cultured Schwann cells overexpressing
Krox20 are still much below the expression levels in myelinating Schwann cells. This
points to the fact that additional factors or signals are required for increased expression
of the myelin genes. A screening for those additional components could be performed,
for example by expression cloning, or also by treatment of Schwann cells with
membrane- and soluble fractions of DRG neurons since neuronal contact is described to
upregulate PMP22 expression. In any event, Krox20-infected Schwann cells may allow a
dissection of the regulatory network involved in the initiation of myelin gene expression
in vitro by studying co-regulated or target genes of Krox20. I tried to confirm by
quantitative RT-PCR the up-regulation of certain candidates previously identified in gene
expression profiling experiments (Araki et al., 2001; Nagarajan et al., 2001). I could
confirm only the upregulation of the POU domain transcription factor Brn-2 by Krox20.
Unfortunately, I could not confirm the upregulation of our additional candidates. This
could be due to slightly different cell culture conditions, a PCR which is not sensitive
enough, or to false positives in the gene chip analysis (the data presented in Nagarajan et
al., 2001 seem to derive from a single chip hybridisation experiment).
Indeed, in the meantime it has been shown that Brn-2 has an expression pattern similar to
that of Oct-6 during Schwann cell myelination and after nerve crush (Sim et al., 2002).
This makes Brn-2 an interesting candidate for further studies. That could be used to
dissect this regulatory network of Krox20-induced myelin gene regulation. For example
adenoviral overexpression in cultured Schwann cells could be used to ask whether Brn-2
is able to directly regulate myelin gene expression or whether it has a cooperative effect
if coexpressed with Krox20. Finally the target genes of Brn-2 could be identified using
microarray technology, as has been done for Krox20 (Nagarajan et al., 2001). New
candidates for further analysis might thus be discovered. Another possibility would be to
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
73
identify the pathways that are involved in the initiation of the PMP22 gene expression by
the addition of specific inhibitors, as has been done by Awatramani et al., (2002). Once
interesting pathways are identified, specific candidates could be blocked, for example by
RNA interference experiments.
8.2 PART II: REGULATORY ELEMENTS ON THE -10/0KB
PMP22 LACZ TRANSGENE
The development and proper function of peripheral nerves in vertebrates depend on
intimate interactions and continued signalling between Schwann cells and the associated
axon(s). In recent years much progress has been made in identifying components of cell-
cell interactions necessary in early stages of peripheral nerve development (Mirsky and
Jessen, 1999; Mirsky et al., 2002). In contrast, little is known about extracellular signals
and intracellular signalling pathways that initiate and regulate myelination. Earlier work
has indicated that the myelination program of Schwann cells is under the control of the
associated axon and correlates with axonal diameter (Aguayo et al., 1976a; b; Voyvodic,
1989). Whatever the exact nature of these signals might be, finally they must be relayed
to the Schwann cell nucleus where transcription factors coordinate the regulation of sets
of genes.
To start the dissection of the coordinate regulation of PMP22 in vivo I have produced
transgenic mice carrying both the lacZ reporter and the zeomycin resistance (sh ble)
genes driven by PMP22 promoter 1 and promoter 2 plus additional potential regulatory
domains in the 10 kb region 5` to the coding sequence of the PMP22 gene. I examined
the role of this region in the spatiotemporal transcriptional regulation of PMP22 with a
lacZ reporter gene in vivo during development, regeneration, and in animal models of
hereditary peripheral neuropathies. Consistent with the endogenous expression of
PMP22, by far the highest expression levels of the -10/0kb PMP22 lacZ transgene were
observed in Schwann cells of peripheral nerves during myelination (Haney et al., 1996;
Snipes et al., 1992; Spreyer et al., 1991; Welcher et al., 1991). Dramatic upregulation of
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
74
the transgene was observed around P8-10 during the most active phase of myelination.
Upregulation of the endogenous PMP22 gene, however, starts already with the initiation
of PNS myelination shortly after birth. The delayed upregulation of the transgene may
have various causes. First, reliable quantitative detection of the very low lacZ mRNA
levels in the sciatic nerve in the first postnatal days was not possible probably due to a
general low abundance of the lacZ mRNA as it has also been observed in other studies
(Feltri et al., 1999; Wight et al., 1993). This might be the result of decreased mRNA
stability or different post-transcriptional regulation of the lacZ mRNA compared to the
PMP22 mRNA (Bosse et al., 1999). Alternatively, regulatory elements for the early
PMP22 transcription could be missing within the 10 kb 5`-flanking region used in our
reporter study. This interpretation offers the hypothesis that the upregulation of PMP22
during myelination (and possibly also of other genes encoding myelin components) is
controlled on the molecular level by various distinct factors. On a speculative view, one
might envisage that some specific factors are important at myelination initiation while
others contribute to the exceptionally high gene expression that is required during the
peak of myelination or later during adulthood in myelin maintenance (cf. part III).
Annother possibility would be that the PMP22 transgene might interfere with
endogenous PMP22 expression, but I have not observed any evidence for this. In
particular, I have also not observed signs of delayed myelination as analysed at postnatal
day P4 on semithin sections through the sciatic nerve (data not shown). Furthermore the
ratio of 1A-LacZ to 1B-lacZ mRNA (transgenic) was similar to the ratio of 1A-PMP22
to 1B-PMP22 mRNA (endogenous) indicating that no important regulatory elements are
missing for similar relative promoter activities of the two transgenic promoters compared
to the two endogenous promoters at postnatal day 21.
The expression of the -10/0kb PMP22 lacZ transgene after nerve lesions and during
remyelination follows the spatio-temporal expression pattern of the endogenous PMP22
gene. These experiments strongly suggest that PMP22 transcriptional regulation in
Schwann cells is dependent on axonal contact and that full activity of the PMP22
promoters is dependent on myelination (Gupta et al., 1993; Spreyer et al., 1991). The
observations from cell culture experiments with -10/0kb PMP22 lacZ transgenic mice
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
75
are consistent with this notion: Schwann cells isolated from postnatal sciatic nerves
showed only very low ß-gal activity (data not shown).
To analyse the regulation of the -10/0kb PMP22 lacZ transgene in settings with impaired
myelination, demyelination and only limited remyelination (without actively severing
the axon, but see also Sancho et al., 1999), mice carrying the transgene were crossed
with Trembler (Tr) and PMP22-deficient mice. The drastically reduced levels of the -10/
0kb PMP22 lacZ transgene expression in the sciatic nerve of the resulting animals
(Fig.5-8) was likely due to the presence of fewer myelinating Schwann cells (Adlkofer et
al., 1995; Suter et al., 1992a), consistent with the reduced levels of PMP22 mRNA levels
in Tr mice (Garbay et al., 1995). Thus, the mutant Schwann cells are not capable of
maintaining the normal program regulating myelin gene expression, possibly due to
impaired axon-Schwann cell signalling (Sancho et al., 1999) or to an intrinsic failure to
differentiate.
The detection of the reporter gene product in sensory and motoneurons of peripheral and
cranial nerves confirms the expression of PMP22 mRNA found in motor neurons
(Parmantier et al., 1995) and in the DRG during early postnatal development (Parmantier
et al., 1997). These findings indicate that the control elements required for neuronal
expression are contained within the -10/0kb PMP22 lacZ transgene and are consistent
with the detection of low level PMP22 immunoreactivity in the DRG and the dorsal horn
of the spinal cord (De Leon et al., 1994).
The expression of the transgene during embryonic development was roughly consistent
with the previously described expression pattern of PMP22 mRNA (Baechner et al.,
1995; Parmantier et al., 1997). However, the relevance of the prominent ß-gal staining in
the outer ear, the limb muscle, and in the ventricular epithelium of the rhombencephalon
remain to be determined.
One of the potential benefits of this study was the generation of an experimental tool that
could be used to direct foreign gene expression reliably in Schwann cells and their
associated neurons to examine myelination and dysmyelination. The PMP22 gene
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
76
regulatory region used here proved to be very consistent in its expression pattern between
different lines, and was robust in the number of expressing founder animals. Importantly,
I could not detect consistent transgene expression in postnatal non-neural tissues such as
small intestine or lung, despite the fact that low levels of PMP22 mRNA had been found
before (Fig. 6-6; Patel et al., 1992; Taylor et al., 1995). This finding indicates that, on one
hand, the regulatory elements required for this non-neural PMP22 expression are
probably missing on our transgene (or that I am below the detection limit of the assay).
On the other hand, it makes this PMP22 regulatory region an even more valuable tool
due to its strict tissue specificity.
Furthermore, taking into account the strong upregulation of the reporter gene during
myelination, the -10/0kb PMP22 lacZ animals are a valuable tool to investigate potential
myelin gene regulatory factors that might also be involved in the pathogenesis of
hereditary peripheral neuropathies. Such an approach is currently being followed in
collaboration with R. Melcangi and his group. Currently, they are analysing the effect of
progesterone derivatives on the transgene expression and on PMP22 mRNA levels in
vivo. Previous in vitro and in vivo experiments have shown that certain progesterone
derivatives are able to influence PMP22 and P0 gene expression (Chan et al., 2000;
Desarnaud et al., 1998; reviewed by Magnaghi et al., 2001; Melcangi et al., 1999; 2001).
Indeed, initial experiments show, that the -10/0kb PMP22 lacZ transgene can be
upregulated by repeated administration of tetrahydroprogesterone (R. Melcangi, personal
communication). Since some conserved potential progesterone receptor binding sites are
found in the -10/0kb sequence (cf. part III), progesterone derivatives potentially could act
directly on the PMP22 gene promoter. To narrow down the sequence of the progesterone
responsive regions of the PMP22 promoter, different reporter transgenes (cf. part III)
could be tested for their response to progesterone derivatives. Since the reporter gene
allows a screening for different PMP22 regulatory factors in vivo, further studies will
focus on potential pathways involved in the progesterone-mediated PMP22 and PMP22
reporter transgene up-regulation in vivo.
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
77
8.3 PART III & IV: PMP22 PROMOTER DELETIONANALYSIS IN VIVO
The results of the detailed characterization of the -10/0kb PMP22 lacZ transgene show a
specific regulation and expression in Schwann cells and in a subset of peripheral
neurons. This justified further effort in delineating PNS specific elements.
To this end I generated a first group of transgenic mice containing different fragments of
the 6 kb region 5’ of Promoter 1 fused to both a lacZ reporter and a zeomycin resistance
(sh ble) gene. The transgenes contained the regulatory elements sufficient for expression
of the reporter gene during myelination in Schwann cells. In contrast to the expression
pattern of the previously characterized -10/0kb PMP22 lacZ transgenic mice I did not
observe neuronal expression of the reporter gene (cf. part II, Maier et al., 2002a). With
the fusion of this 6 kb fragment to a lacZ reporter gene with a minimal promoter of the
hsp68 gene, I showed that these cis-acting elements have enhancer-like properties, since
they are sufficient for expression of the reporter gene independent of the core promoter 1
and sequences of exon 1A. I analysed a second group of transgenic mice which
contained a 3 kb or a 4 kb fragment 5’ to exon 2 fused to the sh ble lacZ reporter gene.
Although I did not observe expression in the PNS with the 3 kb fragment, the 4 kb
fragment showed expression in sensory neurons of the PNS.
I observed strong upregulation of the transgenes with the myelin-specific Schwann cell
elements (-10/-4kb Pro1 lacZ and -10/-4kb hsp lacZ) around postnatal day 12, during the
most active phase of myelination and of expression of the endogenous PMP22 gene
(Haney et al., 1996; Snipes et al., 1992; Spreyer et al., 1991; Welcher et al., 1991). In
comparison with the endogenous PMP22 gene which begins upregulation with the
initiation of PNS myelination shortly after birth, the reporter constructs have a delayed
upregulation. This phenomenon was already observed with the 4 kb longer -10/0kb
PMP22 lacZ construct (Maier et al., 2002a) and could be due to missing regulatory
elements responsible for the early induction of PMP22. This interpretation offers the
exiting hypothesis that different regulatory mechanism are involved in different phases of
myelination and that these late myelinating specific pathways converge on this regulatory
DNA element. Consequently I termed this DNA element a late myelinating Schwann cell
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
78
specific element (LMSE), which I located in this study within the 6 kb region in front of
promoter 1. In the previous part (part II) I showed that the -10/0kb region in the -10/0kb
PMP22 lacZ construct contains the regulatory regions needed to reflect the
spatiotemporal expression of the endogenous PMP22 also after nerve lesions and during
remyelination. I have shown that the Schwann cells upregulate the transgene specifically
during myelination and have only very basal expression of the transgene without axonal
contact. So far I did not observe any difference in spatiotemporal expression of the -10/-
4kb Pro1 lacZ construct compared to the -10/0kb PMP22 lacZ transgene. In accordance
with this observation, the -10/-4kb Pro1 lacZ transgene is still highly expressed in one
year old animals. Therefore I assume that the LMSE contain the regulatory regions and
may bind transcription factors specifically involved in myelin maintenance and probably
also regeneration.
So far little is known about transcription factors specifically involved in remyelination or
myelin maintenance. Presumably these factors would be expressed at high levels in
myelinating Schwann cell. Recently, the POU domain transcription factor Brn-5 has
been shown to be expressed in increasing amounts in late Schwann cell development
(Wu et al., 2001), with an expression pattern inverse to that of SCIP/Oct-6. Therefore
Brn-5 could be involved in these regulatory mechanisms. So far no regulatory elements
have been described to be responsible specifically for expression in the late phase of
myelination. Only the previously characterized MBP Schwann cell enhancer (SCE1) has
been described to maintain expression of the reporter gene also in old adult animals, at
least in some lines (Forghani et al., 2001). For the myelin specific element (MSE) of the
Krox20 gene, which leads to specific expression in myelinating Schwann cells, it would
be very interesting to follow this aspect of expression since it has not been addressed so
far in old adult animals (Ghislain et al., 2002). However, the existence of elements
responsible for early- versus late expression of myelin genes has been discussed in the
case of oligodendrocyte-specific expression of MBP promoter-lacZ reporter genes. The
expression of certain constructs declined in old adult animals, whereas it was maintained
in constructs with different regulatory sequences (reviewed by Ikenaka and Kagawa,
1995). In the PNS, a similar phenomenon has been observed for CNP promoted lacZ
reporter gene expression, which only partially recreated endogenous CNP expression
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
79
since lacZ was only detected at early stages of development, but not in older adult mice
(Gravel et al., 1998; reviewed by Wegner, 2000a). Since not many transcription factors
involved in this type of regulation are known, a combination of the obtained
spatiotemporal expression pattern of the LMSE reporter constructs with whole genome
expression studies in the peripheral nerve, selecting for co-regulated genes with similar
expression profiles, may help to reveal new candidates involved in the late phase of
myelination, in myelin maintenance or regeneration.
The fact that the LMSE is sufficient for specific expression in Schwann cells in front of a
minimal hsp68 promoter in the -10/-4kb hsp lacZ construct shows that the LMSE has
enhancer-like characteristics and that the endogenous promoter 1 and exon 1A sequences
are not necessary for tissue specific expression since they can be replaced by the
unspecific hsp68 minimal promoter. By comparing at least three different lines of a given
construct I have tried to average out effects due to different expression levels of the
randomly integrated transgene, which depend on copy number and in many cases also on
the integration site. From such comparison, I observed one difference between the spatial
expression of ß-gal on teased fiber preparation of mice transgenic for the -10/-4kb Pro1
lacZ construct with animals transgenic for the -10/-4kb hsp lacZ. It was more difficult to
establish stable transgene-expressing lines with the latter construct since two out of three
lines showed a highly mosaic expression (variegation) in F1 and F2 generations. In
addition, Igot the impression that mosaic expression also of the -10/-4kb Pro1 lacZ was
more common than with the -10/0kb PMP22 lacZ transgene. The interpretation of these
observations may involve different explanations and mechanisms which are not clearly
distinguishable. Traditionally, enhancers have been thought to function by increasing the
rate of transcription initiation from a linked promoter. In recent years, it has been shown
that in some cases enhancers not so much influence the rate of transcription initiation, but
instead increase the chance that a linked promoter is activated at all. In this probabilistic
model, enhancers are thought to function through a mechanism that involves
modifications to the local chromatin configuration or relocation to an active centre within
the nucleus (Fiering et al., 2000; Hume, 2000). This model predicts that an enhancer
increases the percentage of cells in a population expressing the gene. In transgenic mice
experiments, such a mechanism might explain the often observed variegated expression
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
80
of the transgene (Elliott et al., 1995; Milot et al., 1996). Consequently, the loss of
enhancer activity could lead either to a smaller number of Schwann cells expressing the
reporter gene rather than a generally lower expression of the reporter gene in internodes
resulting in a less intense staining. So far intensities of different ß-gal stainings can be
compared, this is in fact what I observed, both, in the -10/-4kb Pro1 lacZ compared to the
-10/0kb PMP22 lacZ and in the -10/-4kb hsp lacZ compared to the -10/-4kb Pro1 lacZ
transgenes. In the first case, one can speculate that the -10/0 kb region acts as a stronger
enhancer than the -10/-4kb LMSE in Schwann cells by modulating the chance that the
linked promoter 1 is activated. Alternatively, one can argue that the LSME acts on both
PMP22 promoters instead of just promoter 1. In the second case, one may speculate that
some enhancer activity was lost due to the replacement of the endogenous promoter 1,
exon 1A and exon 2 sequences by the hsp68 promoter (cf. Fig. 7-1). Alternatively, one
can not exclude an effect due to the different reporter cassettes used. However, finally we
do not have enough data and the appropriate system to determine which of the
mechanisms discussed above dominate. The effects probably overlap, especially due to
the removal of the enhancer from its native context (Graubert et al., 1998; Sutherland et
al., 1997). These mechanisms can be taken apart to a certain degree with a system as
introduced in the section below.
A reproducible integration of the transgene always as a single copy at the same defined
genomic locus would have the advantage that absolute expression levels of different
transgenes can be compared (Guillot et al., 2000; Misra et al., 2001). This can be
achieved in ES cells, modified with a partially deleted HPRT locus. A transgene can be
inserted into the genome with a construct that allows reconstitution of the HPRT locus at
the same homologous recombination site in multiple transformants. This system may
allow to distinguish the different aspects of enhancers as mentioned above. In
collaboration with the groups of Alan C. Peterson and G. Jackson Snipes ES cells
containing a -21/0kb lacZ and a -11/0kb lacZ constructs are currently being tested for the
spatiotemporal expression pattern of the reporter gene in mice. Interestingly, preliminary
analysis of the -21/0kb lacZ construct indicates that there is no high expression levels of
ß-gal in sciatic nerves (G. Snipes, personal communication). The analysis of the -11/0kb
lacZ construct in mice will show whether this is due to the integration of a single copy of
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
81
the reporter gene, which might be expressed at levels too low to be detected, or whether
this is due to additional inhibitory elements upstream of the -10/0 kb fragment analysed
in the present study. The most rigorous way to test the function of these transcriptional
control elements in their native context would require specific deletion by homologous
recombination in embryonic stem cells. Such deletion could result in the generation of a
hypomorphic allele in case of the deletion of a cell-type specific enhancer (for example
see Ghazvini et al., 2002 with the Oct-6∆SCE/∆SCE mice). For PMP22, it would be of
interest to see whether mice with a deletion of the LMSE develop a myelination
phenotype caused by low expression of PMP22. This is likely since a reduction of
PMP22 expression leads to HNPP in humans (Chance et al., 1993) and to a HNPP-
comparable phenotype in mice heterozygous for the PMP22 deletion (Adlkofer et al.,
1997a).
To continue the dissection of the regulatory network of PMP22, it would be interesting to
assess whether the Oct-6∆SCE/∆SCE mice (Ghazvini et al., 2002) show delayed induction
of PMP22 mRNA during their delayed myelination. This is likely since Ghazvini et al.,
(2002) have shown that also Krox-20 and P0 expression is delayed in these mice. In this
case, it would be of interest to see if these animals completely compensate for the lower
PMP22 levels in old adult animals. This would provide some evidence that a different set
of regulatory factors is involved in myelin maintenance, or at least that Oct-6 is not the
rate-limiting transcription factor. Similar questions could be addressed with a tamoxifen-
inducible creERT2 transgene expressed in adult myelinating Schwann cells (e.g. a PLP
creERT2, a P0Cx32 creERT2 or a -10/0kb PMP22 creERT2 which all are under
construction) combined with a “floxed” allele for a transcription factor such as the
Krox20 (Taillebourg et al., 2002). These mice would recombine the Krox20 allele in
Schwann cells upon tamoxifen induction, which then should lead to a tissue-specific
ablation of Krox20 in adult myelinating Schwann cells.
Most mouse lines with the -10/-4kb hsp lacZ or -10/-4kb Pro1 lacZ transgene show
expression mainly in Schwann cells associated with large calibre fibres. This is in
contrast to the -10/0kb PMP22 lacZ construct, where ß-gal positive Schwann cells are
also associated with middle and small calibre fibres, albeit with clearly reduced ß-gal
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
82
levels. In agreement with this observation, the ventral roots of the lumbar spinal cord,
which contain only large calibre motor axons were more strongly stained than the dorsal
roots which contain the sensory axons (Figs. 6-3d, e). This could be explained by lower
expression levels of the transgenes, which would not be detectable in Schwann cells of
small calibre fibres. The latter already showed lower expression levels in -10/0kb PMP22
lacZ mice (Maier et al., 2002a). Alternatively this finding might be due to the lack of
additional positive regulatory elements outside the 6 kb LMSE element. If correct, this
may suggests a novel level of heterogeneity among Schwann cells that would be
correlated with the fiber diameter of the associated axon. Such molecular differences
between Schwann cells associated with motoneurons versus sensory neurons have been
described before (Martini et al., 1994).
The majority of transgenic mice lines carrying the -4/0kb Pro2 lacZ construct show
expression of the transgene specifically in sensory neurons Since the -3/0kb Pro2 lacZ
construct does not give rise to expression in the PNS (Maier et al., 2002a), it can be
concluded that regulatory elements located between -4 and -3 kb are necessary for
expression of the transgene in sensory neurons. In contrast to the neuronal expression in
the PMP -10/0 kb lacZ transgenic mice, no expression in motor neurons was observed,
suggesting that expression in motor neurons probably needs additional regulatory
elements located further upstream.
At this point it can be asked whether promoter 2-associated expression of PMP22 alone
is responsible for neuronal expression of PMP22, since in the CNS mainly 1B-PMP22/
SR13 messages are detected by RT-PCR (Parmantier et al., 1995). This could be
addressed by the isolation of RNA from purified DRG neurons which still show
expression of the -4/0kb lacZ transgene - at least in mixed cultures of dissociated DRG.
With the sensitive PMP22 TaqMan PCR a determination of the probably low expression
levels might be possible, although D'Urso et al., (1997) failed to detect PMP22 by
conventional RT-PCR in purified rat DRG neurons.
It is also possible that the -3/0 kb lacZ construct, which does not show any specific
expression as transgene, is silenced in vivo, for example by methylation. The previously
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
83
reported fact that many conserved CpG islands can be found around promoter 2 (van de
Wetering et al., 1999) and in front of exon 2 is consistent with such a possibility, since
methylation was proposed to be one regulatory mechanisms of promoter 2. In addition,
with the presence of CpG islands and the absence of a CCAAT box, promoter 2 shows a
structure typically found in promoters of house-keeping genes (van de Wetering et al.,
1999). It may therefore be that the -3/0kb Pro2 lacZ construct does not contain the
elements necessary to prevent silencing of the transgenic promoter 2.
Up to now, we focused our attention on the PNS expression of PMP22. But promoter 2
of PMP22 is active also in many non-neural tissues. Due to the broad PMP22 expression
pattern and due to the promoter structure as described above, promoter 2 was proposed to
be a constitutively active promoter (Suter et al., 1994, van de Wetering et al., 1999). So
far, I did not observe a consistent specific expression pattern of the transgenes analyzed
in the present in vivo promoter deletion study in non-neural tissues. This shows that the
transgenes did not contain the elements necessary for transgene specific expression in the
non-neural tissue in postnatal animals (data not shown). In combination with the results
from the -10/0kb PMP22 lacZ construct, which also did not show specific postnatal
expression in organs with high PMP22 mRNA levels such as small intestine and lung (cf.
Fig. 6-6, Suter et al., 1994), this indicates that I am missing regulatory elements
responsible for non-neural expression of PMP22 in the -10/0 kb region. As an inverse
interpretation I argued in the previous part (cf. part II), that this also could be due to the
presence of negative acting elements. In such a case, one would anticipate that a
dissection of the -10/0kb promoter region into subfragments would abrogate the effect of
negative acting elements in certain constructs. I did not observe such a phenomena and
therefore this interpretation is unlikely.
So far, no PMP22 promoter driven reporter construct completely reflected endogenous
PMP22 expression. The characterization of transgenic reporter constructs which contain
additional regions 5’ or 3’ to the previously characterized -10/0 kb genomic fragment,
will hopefully lead to the discovery of additional regulatory elements. Of special interest
would be those involved in the initiation of PMP22 expression in early development. The
detection of regions with high homology between mouse and human PMP22 genomic
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
84
sequences outside of the characterized -10/0 kb genomic fragment supports the
hypothesis that additional regulatory elements, for example between exon 2 and 3 or
downstream of exon 3 may contribute to PMP22 expression in early Schwann cells or in
non-neural tissues.
Our collaborators from the group of J. Snipes have shown that a -8.5/0kb PMP22 lacZ-
IRES-luciferase transgene with the rat promoter sequence shows only weak expression
in Schwann cells, but considerable expression in DRG (J. Snipes, personal
communication). The fact that many potential binding sites for Oct-6 and Brn-2 are
found in the -10/-8.5kb region and that the rat and mouse sequences are highly
conserved, make this element an attractive sequence to screen for binding of myelin
specific transcription factors. Further delineation of the 6kb LMSE with the -6.5/4kb
Pro1 lacZ and the -10/-6.5kb Pro1 lacZ construct is ongoing in our laboratory and will
hopefully answer the question of whether the LMSE can be taken apart further into
smaller segments. However, if it turns out that the -10/-6.5kb element leads to Schwann
cell expression, the indications from potential binding site would be confirmed and this -
10/-6.5kb or even the shorter -10/-8.5kb element indeed could be used to screen for
binding factors, for example with a yeast-one-hybrid system. Since this system was
successfully used only with short sequence elements (oligonucleotides)(Lehming et al.,
1994; Wang and Reed, 1993) the screening has to be performed only with subfragments
of the -10/-8.5kb element. If it is not possible to further narrow down the 6kb LSME,
potentially important regulatory regions on large sequence elements could be determined
by screening for DNaseI Hypersensitive sites (HSS). The challenge of these experiments
is to obtain enough starting material, since the most reasonable way to perform these
experiments is to take cell nuclei from myelinating Schwann cells. So far, at least the
isolation of nuclear extract from myelinating Schwann cells seems to be possible
(Forghani et al., 1999), and could be used for example also for electromobility shift
assays (EMSA). Classical EMSA permit the characterization of one or maybe a few
transcription factor at a time and for a DNA sequence usually between 20 bp and 300 bp.
Alternatively, if one can isolate sufficient amounts of nuclear extracts a new developed
system called “TranSignal Protein/DNA array” (Panomics, CA, USA) may allow
profiling the activities of multiple transcription factors simultaneously. With this system
PMP22 GENE REGULATION DISCUSSION & OUTLOOK
85
one screens for the binding of transcription factors to a mixture of oligonucleotides with
known consensus-binding site sequences. Nuclear extracts are incubated with a mixture
of biotin-labelled oligonucleotides, DNA/protein complexes allowed to form, and DNA/
protein complexes are isolated. The recovered DNA is hybridized to a prespotted
membrane with complementary sequences to those of the oligonucleotides. However,
this system has the disadvantage that one is limited to known consensus binding
sequences. Further evaluation of this system will reveal how reliable and useful it is.
Alternatively, one may use chromatin immunoprecipitation assays combined with PCR
amplification of potential target regions to confirm a binding of a specific transcription
factor to a certain promoter region (Sasaki et al., 2002).
In summary, I have used a transgenic approach to characterize the sequences within the
PMP22 gene that are involved in its tissue- and cell-type specific as well as temporal
regulation. It will be interesting to further delineate the regions of the PMP22 gene and
its binding partners required for cell-type specificity and for regulation by neuron-
Schwann cell interactions. This will be supported by ongoing complementary in vitro
approaches, including the mapping of PMP22 promoters by transfection, by analyzing
DNA-proteins interactions (Hai et al., 2001; Saberan-Djoneidi et al., 2000), or by using
adenoviral infections of Schwann cells with Krox20 to study the regulatory network
involved in the initiation of PMP22 transcriptional expression. I anticipate that such
studies will provide additional insights into the coordinate regulation of myelin genes in
conjunction with related studies analyzing other genes encoding myelin components.
Furthermore, taking into account the strong upregulation of the -10/-4kb Pro1 lacZ
reporter gene during myelination and its Schwann cell-specificity, this promoter segment
is a valuable tool to specifically express potential myelin gene regulatory factors that
might also be involved in the pathogenesis of hereditary peripheral neuropathies, or to
regulate PMP22 expression levels by antisense approaches (Hai et al., 2001; Maycox et
al., 1997).
86
EXPERIMENTAL METHODS
87
9 EXPERIMENTAL METHODS
9.1 Generation of reporter constructs
For the generation of a construct expressing sh ble-lacZ under the control of PMP22
regulatory regions (-10/0kb PMP22 lacZ), a 10 kb Sal I/Not I fragment from cosmid
pTCF-6.1 (Magyar et al., 1996) was fused to a Not I-Nco I PCR fragment containing the
first 42 bp of the exon 2 and a Nco I-Sac II fragment of the sh ble-LacZ fusion gene
(Cayla, Toulouse, France) reconstituting the original Kozak sequence and translation
start on exon 2. The sequence of the PCR fragment was controlled by DNA sequencing.
The resulting 14 kb reporter construct (-10/0kb PMP22 lacZ; SNlacZ; SNEx2zeolacZ;
PMP22- lacZ) was excised from the vector backbone with Sal I and Sac II.
Four fragments were ligated for the generation of the -10/-4kb Pro1 lacZ (1AlacZ)
reporter construct: 1) a 3.5kb Sal I (-10kb) /Kpn I (-6.5kb) fragment derived from a Sal I
/Not I PMP22 subclone that was used to generate the -10/0kb PMP22 lacZ construct
(Figs. 5-1, 6-1, PMP22lacZ in Maier et al., 2002a) a 2.6kb Kpn I (-6.5kb)/Not I fragment
using a Not I site introduced by PCR at -3.91 kb with the same Sal I /Not I subclone as
template 3) a Not I (-0.12kb) /Bgl II fragment, containing exon 2 sequences and the sh
ble-LacZ fusion gene (pUT111, Cayla, Toulouse, France); and 4) a Sal I /Bgl II fragment
containing the Bluescript vector II KS+ (Stratagene). Fragments (3) and (4) were derived
from the PMP22 -10/0kb lacZ (PMP22lacZ) construct. The resulting reporter construct
was released from the vector backbone with Sal I and Sac II digestion for pronuclear
injection.
The -6.5/-4kb Pro1 lacZ (∆1AlacZ) was generated by an intramolecular deletion of a
3.5kb Kpn I(-10.1kb)/Kpn I(-6.5kb) fragment of the -10/-4kb Pro1 lacZ construct. To
generate the -10/-6.5kb Pro1 lacZ (∆Pro1lacZ) construct a Sal I (-10kb)/Kpn I (overhang
blunt-ended with T4 DNA Polymerase) fragment was fused to a Stu I(-4.33kb)/Sal I
fragment of the -10/-4kb Pro1 lacZ construct. The -10/-6.5kb Pro1 lacZ and the -6.5/-4kb
Pro1 lacZ constructs were released with a Kpn I and Sac II digest.
The -10/-4kb hsp lacZ (hspAlacZ) construct was derived from a fusion of three
fragments: a 3.5 kb Sal I /Kpn I fragment (the same as used for the -10/-4kb Pro1 lacZ
construct), a 2.2 kb Kpn I /Sal I fragment in which the Sal I site was introduced by PCR
EXPERIMENTAL METHODS
88
at -4.29kb and a third Sal I /Sal I fragment containing the minimal 0.3kb hsp68 promoter
ligated to lacZ (clone p610ZA; R. Kothary, Universtity of Ottawa, Ottawa, Ontario,
Canada; (Forghani et al., 2001; Mandemakers et al., 2000) ). The sequence of all PCR
fragments was controlled by DNA sequencing. The resulting reporter construct was
excised from the vector backbone with Sma I and Sph I.
For the generation of the -3 kb Pro2 lacZ (PMP22-1B-lacZ; Maier et al., 2002) or -4 kb
Pro2 lacZ vector (1ABlacZ), a 7 kb respectively a 6 kb Sal I /Sac I fragment was
removed by Sal I and partial Sac I digest from the 5’ end of the -10/0kb PMP22 lacZ
(PMP22-lacZ) construct. The overhang was blunt-ended using T4 DNA polymerase and
the vector was intramolecularly ligated reconstituting the Sal I site. Both reporter
contructs were released with a Sal I and Sac II digest.
For the generation of the Del1AlacZ construct a Avr II(blunted)/Stu I deletion for
promoter 1 and Exon 1A was performed on a Kpn I/BamH I subclone of the -10/0 kb Sal
I/Not I fragment from cosmid pTCF-6.1 (Magyar et al., 1996) resulting in the plasmid
KBDel1A. The deletion was controlled by sequencing of the plasmid. In a next step a
3.0kb Kpn I/BamH I fragment of this KBDel1A plasmid was fused to a 6.3kb BamH I/
BamH I fragment, a 2.9kb BamH I/Sal I (containing the BS vector) and a 3.8 kb Sal I/
Kpn I fragment of the PMP22 -10/0kb lacZ construct.
For the generation of the Del1BlacZ construct a Bgl II/Avr II deletion for promoter 2 and
Exon 1B was performed on a BamH I/BamH I subclone (clone Bam2.3) of the PMP22
cosmid pTCF-6.1 (Magyar et al., 1996) resulting in the plasmid Bam2.3Del1B. The
deletion was controlled by sequencing of the plasmid. In a next step a BamH I/Not I
fragment of this Bam2.3Del1B plasmid was fused to a Not I/BamH I fragment
(containing BS vector and Exon1A) and a Not I/Not I fragment (containing the Ex2lacZ
cassette) of the PMP22 -10/0kb lacZ construct.
9.2 Generation of transgenic animals
The resulting reporter constructs were excised from the vector backbone as indicated,
purified by agarose gel electrophoresis, and electroeluted. The DNA was microinjected
into the pronucleus of fertilized eggs from B6D2F1 hybrid mice using standard
EXPERIMENTAL METHODS
89
procedures. The founder animals were screened by PCR on DNA isolated from tail
biopsies with primers complementary to the lacZ sequence (lacZs: 5’-CCCATTACGG-
TCAATCCGCCG-3', LacZas: 5’-GCCTCCAGTACAGCGC-GGCTG-3’). For further
analysis the founders were mated with B6D2F1 hybrid mice. PCR positive founder
animals and PCR positive animals of the subsequent F1 generation were screened for the
expression of ß-gal in peripheral nerves on 50 µm cross-sections of tail biopsies (see next
section).
9.3 ß-gal histochemical analysis
Expression of the lacZ gene was monitored by standard histochemical staining reactions
with 5-bromo-4-chloro-3-indolyl-ß-galactopyranoside (X-gal; AppliChem, Germany). In
the spinal cord and brainstem analysis, mice were anesthetized and perfused
intracardially with 0.9% NaCl followed by 0.5% glutaraldehyde in 0.1M phosphate
buffer (pH 7.4). Tissues were dissected out and postfixed for 10 (sciatic nerve) to 60 min
at 4°C in 2% formaldehyde, 0.2% glutaraldehyde in phosphate buffered saline (PBS),
pH7.4. The specimens were washed three times with 1x PBS, equilibrated in 30%
sucrose overnight, and embedded in O.C.T. compound (Tissue Tek) for cryostat
sectioning. 30 µm-cryostat sections were stained for several hours (sciatic nerve) or
overnight (embryos, spinal cord sections) in the X-gal staining solution (5mM
K3[Fe(CN)6], 5mM K4[Fe(CN)6], 2mM MgCl2 , 1mg/ml X-Gal, in 1x PBS).
Embryos were fixed for 1 hour in 2% formaldehyde, 0.2% glutaraldehyde, 0.1% sodium
deoxycholate, 0.02% NP-40 in 1xPBS, washed three times in 1x PBS, cryoprotected
over night in 30% sucrose, and stored at –80°C. Whole mount stainings were performed
before cryoprotection in modified X-Gal staining solution (5mM 5mM K3[Fe(CN)6],
5mM K4[Fe(CN)6 ], 2mM MgCl2 , 0.1% sodium deoxycholate, 0.02% NP-40, 2mg/ml
X-Gal in 1x PBS). E19, P1 and P5 animals were decapitated and the head and two pieces
of the body were processed individually.
Sciatic nerves were dissected, fixed, teased in PBS buffer as described in (Neuberg et al.,
1999), transferred to glass slides, briefly air-dried, and incubated in the X-gal staining
solution.
EXPERIMENTAL METHODS
90
Differences for part III:
Tissues were dissected out and fixed for 10 (sciatic nerve) to 45 min (spinal cord) in 2%
formaldehyde, 0.2% glutaraldehyde in phosphate buffered saline (PBS), pH7.4, at 4°C.
The specimens were washed three times with PBS and stained overnight in the X-gal
staining solution (5mM K3[Fe(CN)6], 5mM K4[Fe(CN)6], 2mM MgCl2 , 0.1% sodium
deoxycholate, 0.02% NP-40, 1mg/ml X-Gal, in 1x PBS) at 37°C. For X-gal staining of
teased sciatic nerve the nerves were fixed, the epineurium of the nerve was removed to
ensure penetration of the staining solution and stained overnight at 37°C. In a next step
the nerve was teased in PBS buffer as described in (Neuberg et al., 1999) and transferred
to glass slides and air-dried. Finally, teased fiber preparations were mounted in AF1
(Citifluor, Canterbury, UK) supplemented with DAPI (1:1000 Roche Diagnostics,
Switzerland). For the quantification of ß-gal positive internodes at least 100 DAPI-
stained nuclei corresponding to 100 internodes were counted for each animal and
analysed for associated X-Gal staining.
9.4 ß-gal solution assay
Organ samples (approx. 100mg) or 10-15mm of sciatic nerve from transgenic and
control mice were homogenized with a Polytron homogenizer in lysis buffer (0.1M
potassium phosphate buffer, pH 7.8; 0.2% Triton X-100, 0.5mM dithiothreitol). Cell
debris was removed by centrifugation and aliquots of each homogenate were stored at –
80°C. ß-gal activity was assayed in triplicates with the Galacto-StarTM kit (Tropix)
according to the manufacturers’ instructions. In brief, 10 µl of the lysate (or of a 1:50
dilution with lysis buffer in cases of very high ß-gal levels) were mixed with 100 µl of
reaction buffer. After 30-45 min the chemiluminescence was determined in a scintillation
counter (Canberra Packard SA). The amount of protein in each sample was measured
using the Bio-Rad DC protein assay in triplicate with BSA as a standard. The light
emission representing the enzymatic ß-gal activity (in relative light units RLU) was then
normalized to the amount of protein.
Differences for part III
EXPERIMENTAL METHODS
91
For each time point 4 - 6 sciatic nerves from transgenic and control mice were
homogenized individually with a Polytron homogenizer, ß-gal activity was assayed in
triplicates with the Galacto-StarTM kit (Tropix) according to the manufacturers’
instructions and as described above.
9.5 Quantitative analysis of PMP22 mRNA levels
Total RNA was isolated using TRIzol reagent (Gibco BRL) according to the
manufacturer’s recommendations. Briefly, nerves were homogenized in the presence of
TRIzol with a Polytron homogenizer (PT 1200, Kinematica AG, Switzerland). Insoluble
material was removed from the homogenate by centrigugation for 10 min at 4°C, the
supernatant extracted with chloroform and precipitated with isopropanol. 500 ng of total
RNA was reverse transcribed in a 20 µl reaction using 140U MMLV reverse transcriptase
(Promega), 2.5 µM random hexamer primers, 1 mM dNTP, 30U RNasin in 1x Promega
reverse transcription buffer.
Five different PCR reactions were performed with the TaqMan PCR system to analyze
five different transcripts (Fig. 5-1): The 1A-PMP22 transcript with the forward primers
Pr1A (5’-GAGGAAGGGGTTACACCATTG-3’) located on exon 1A and the PMP22
sequence specific backward primer Pr2PMP22 (5’-GCAACACTAGC-ACCGCGAT-3’)
located in the second half of exon 2, the 1B-PMP22 message with Pr1B (5’-
TGTGCCTGAGGCTAATCTGC-3’) located in exon 1B and the primer Pr2PMP22, the
1A-lacZ transcript with Pr1A and the Pr2lacZ (5’-GTGAGCACCGGAACGGC-3’)
which is specific for the sh ble-lacZ message, and the 1B-lacZ transcript with primers
Pr1B and Pr2lacZ. To standardize between different samples, GAPDH mRNA levels
were analyzed with the primers GAPDH-f (5’-TGTGTCCGTCGTGGATCTGA-3’) and
GAPDH-b (5’-CCTGCTTCACC-ACCTTCTTGA-3’). To measure in real time the
amount of amplified PCR product, the TaqMan system (AP Applied Biosystems) was
used with the following sequence specific probes: 5’-
TCCTCTGATCCCGAGCCCAACTCC-3’ (with 5’ FAM reporter and 3’ TAMRA
quencher dye modifications) located in the first half of exon 2 in the common sequence
for the 1A-PMP22, 1B-PMP22, 1A-lacZ and 1B-lacZ message, and 5’-
EXPERIMENTAL METHODS
92
CCGCCTGGAGAAACCTGCCAAGTATG-3’ (5’ VIC, 3’ TAMRA) specific for the
GAPDH message.
Purified PCR products were prepared as serial dilutions from 10-9 to 10-15 M for the
construction of the standard curves. Amplifications were performed in triplicate 25 µl
reactions for 40 cycles (denaturation at 95°C for 20s, annealing at 53°C for 30s,
elongation at 60°C for 60s) on the ABI Prism 7700 sequence detection system. The PCR
reaction contained 1mM MgCl2, 2.8% DMSO, 500nM forward and backward primers,
200nM TaqMan probe and 1 µl template from the RT reaction in addition to 12.5 µl 2x
TaqMan Universal PCR Master Mix (AP Applied Biosystems). The quantitation of gene
expression was performed as described in the User Bulletin #2, ABI PRISM 7700
Sequence Detection System, PE Applied Biosystems.
9.6 -10/0kb PMP22 lacZ x PMP22-/- and -10/0kb PMP22lacZ x Tr mice
To obtain -10/0kb PMP22 lacZ transgenic mice on a PMP22-deficient background (-10/
0kb PMP22 lacZ; PMP22-/-) in a first breeding -10/0kb PMP22 lacZ transgenic animals
Line 48.4 were mated with PMP22-/- females (Adlkofer et al., 1995). In a second
breeding -10/0kb PMP22 lacZ transgenic mice heterozygous for PMP22 (-10/0kb
PMP22 lacZ; PMP22 wt/-) were mated with PMP22-/- females. Homogenates of single
sciatic nerves of -10/0kb PMP22 lacZ / PMP22-/- animals were prepared as described
and compared with age-matched -10/0kb PMP22 lacZ transgenic animals without
PMP22 mutations. PCR analysis of PMP22-deficient mice has been reported elsewhere
(Sancho et al., 2001).
-10/0kb PMP22 lacZ transgenic animals with the Tr point mutation in the PMP22 gene
(Suter et al., 1992b) were obtained by mating -10/0kb PMP22 lacZ transgenic mice Line
48.4 with females heterozygous for the Tr mutation (Tr/+). ß-gal solution assays were
performed if possible with siblings otherwise with age-matched animals with or without
the PMP22 Trembler mutation at postnatal day 21 and in adult P60 and P90 animals.
PCR analysis of Tr mice has been reported elsewhere (Adlkofer et al., 1997b).
EXPERIMENTAL METHODS
93
9.7 Sciatic nerve transsection and crush
Using aseptic technique, the sciatic nerve of anesthetized (Ketamine 80mg/kg and
Xylazine 4mg/kg) adult (9-12 weeks old) -10/0kb PMP22 lacZ transgenic mice were
exposed at the sciatic notch. Nerves were doubly ligated, transsected with fine scissors
and the nerve-stumps were sutured at least five millimeter apart to prevent regeneration.
Nerve crush was produced by tightly compressing the sciatic nerve at the sciatic notch
with flattened forceps twice, each time for 10s; this technique causes the axons to
degenerate, but allows axonal regeneration. At varying times after nerve injury, 3-4
animals for each time point were sacrified, the distal nerve-stumps were removed, the
most proximal 4-5 mm trimmed off and further processed as described earlier. For
transsected nerves, the entire distal nerve-stump was taken just below the lesion. At each
time point the homogenate of the distal part of the lesioned nerve was compared with the
equivalent part of the contralateral unlesioned nerve.
9.8 Immunocytochemistry of dissociated dorsal root ganglia(DRG)
Dorsal root ganglia of E19 embryos were isolated, digested with 0.2% trypsin for 20
min, triturated after the addition of DMEM/10%FCS, washed once with DMEM/
10%FCS, and plated on poly-L-lysin coated plastic dishes (Corning) in 10%FCS/
DMEM/NGF (50ng/ml, Sigma). After 3 days, cells were washed, fixed for 10 min with
4% formaldehyde, incubated for 4-6 hours with blocking solution (10% NGS, 0.1%
Triton X-100, 1% BSA in 1x PBS) and stained with rabbit polyclonal antibodies against
ß-galactosidase (1:300, CN Kappel) for 12-14 hours and with mouse monoclonal
antibody against NF160 (1:500, Sigma) for 1 hour, washed with PBS and incubated for 1
hour with the secondary antibodies goat anti-mouse Cy3 and goat anti-rabbit FITC
(1:300, Jackson Laboratories). Immunoreactivity was visualized by conventional
fluorescence microscopy using a Hamamatsu Colour Chilled 3CCD Camera in
conjunction with Adobe Photoshop 5.0.
EXPERIMENTAL METHODS
94
Differences for part III
Dorsal root ganglia of postnatal day P4 mice were isolated and digested with 0.25%
trypsin and 0.3mg/ml collagenase type I (Worthington) in Ca2+/Mg2+ free Hank’s
Balanced Salt Solution for 45 min at 37°C. After the addition of 100µl FCS/ml to the
digestion mix, cells were triturated and further processed as discribed above.
9.9 Cell culture, transfection and reporter assays
Promoter deletion study in MSC80 and NIH3T3 cells
The mouse Schwann cell line MSC80 (Boutry et al., 1992) and the NIH 3T3 cell line
were transfected using SuperFect reagent (Qiagen, Switzerland) according to the
manufacturer’s recommendations. Equimolar amounts of -10/0kb PMP22 lacZ, -3/0 kb
Pro1 lacZ, -4/0 kb Pro1 lacZ, Del1AlacZ, Del1BlacZ, pSV-ß-galatosidase control vector
(Promega) or empty lacZ vector (pUT111, Cayla, Toulouse, France) were used as
reporter constructs and total amount of plasmids was kept constant by addition of empty
Bluescript Vector (Stratagene). The plasmid SV40Luciferase (pGL3-Promoter Vector,
Promega) was used as an internal control to assess transfection efficiency and for
normalization. Cells were maintained in DMEM supplemented with 10% FCS and
10µM forskolin if indicated. Fourty hours after transfection the cells were washed once
with 1x PBS, lysed in 1x reporter lysis buffer (Promega) and extracts were assayed for ß-
gal activity in microtiter plates in triplicate according to (Sambrook et al., 1989) and for
luciferase activity with the LucLite Plus Luminescence kit (Packard Biosciences).
Incucible Sox10 expression in N2A cells
RNA was extracted with the Trizol Method from N2A cells stably transfected with the
reverse tetracycline-controlled transactivator (rtTA, harboring the G418 resistance) and
the cDNA of Sox10 under an tetracycline-regulatable promoters (harboring a
hygromycin selection cassette). The cells were maintained in DMEM + 0.5% FCS and
Sox10 expression was induced for 48 hours with 5µg/ml Doxycylin. The generation of
this N2A cell line, the PCR Primers and cDNA Synthesis is described in (Peirano et al.,
EXPERIMENTAL METHODS
95
2000). To standardize between different samples, 18S rRNA levels were measured with a
predevelopped assay reagent from Applied Biosystems.
Screening for upregulated transcription factors with quantitative PCR
Subconfluent (40-60%) rat Schwann cells were infected overnight with the Adenovirus
Adegr2GFP and AdGFPSJS2 or AdGFPR1* (Ehrengruber et al., 2000) as control virus
either in DMEM Medium in the presence of 10% FCS or in defined N2 medium after 48
hours. Total RNA was isolated from the cells after 30, 24 or 48 hours as indicated with
the RNeasy Total RNA Purification Mini Prep Kit (Qiagen, Switzerland) according to the
manufacturers’ instructions. Homogenisation of cell lysates was done using the syringe
method by passing the lysate three to four times through a sterile plastic syringe fitted
with a 18-21 gauche needle. Reverse transcription was performed as described in section
9.5 above. SYBR Green PCR were performed at standard conditions as recommended by
Applied Biosystems (25mM MgCl2, 12mM dNTP (containing dUTP), Amp Erase,
AmpliTaq Gold, 500nM forward and backward primer, 3µl of 1:5 diluted RT reaction).
To standardize between different samples, 18S rRNA levels were measured with a
predevelopped assay reagent from Applied Biosystems with TaqMan PCR. The
Oligonucletides used in the quantitative SYBR Green PCRs are:
Oligo# Sequence (5’-3’) Primer/PCR Name
59 CACGGGCCAGGAGCG mrBrn2.1-f60 TTGGCAGCGTGGTGCAC mrBrn2.1-b61 GGCCTTGGGCATACTCAACA mrStAR-f62 CGTCCCCGTTCTCCTGC mStAR-b81 CACCTTACTTAGCACTTCATCTCCAT rSTAR-b63 CTGGTCAGCGTGACAAAGTACAG mKZF1-f64 TTATCACAATTGAAAAGCTTCTTTGG mKZF1-b65 GGGATCCTGTTCCTGCACAT m(r)totPMP-for66 TGCCAGAGATCAGTCGTGTGT m(r)tg+totPMP-b67 TCCACCATCGTCAGCCAATGGCT mr PMP22TqMprobe72 GGCCTCACACCCGCC Pro1C9973Tq-f73 GCCTTACCTGTCCCAGTTAGGG mrIREBP1-f74 ACTGTTGCCGATGCAGGTC mrIREBP1-b75 ACGAGCTGCACGGGCC mrBrn2.2nd-f76 TTGGCAGCGTGGTGCAC mrBrn2.2nd-b79 AAATTGCATGGAAAAGGGCA mTRIP8-f80 GTGGCCTCGCACGCA mTRIP8-b82 TCCTTACTCTTCAGTCAGCAAATAGCTA rKZF1-f83 TGGGCTATGTGATAATGGATCAAT rKZF1-b
EXPERIMENTAL METHODS
96
84 ACAACGAGCTCTCTCACTTCCTG mrS100ß-f85 CGTCCAGCGTCTCCATCAC mrS100ß-b90 CATGGGCAAATTCTCCATTGA mrEgr2-f91 TTGCAAGATGCCCGCAC mrEgr2-b92 AAGGAATCTTTGTCCGCGAG periaxin (L+S)_2 f93 CTCAAAGAACACACGGGCG periaxin (L+S)_2 r94 CTGGCAGAGCGGATAACAC rNAB2-f95 GTGTTCGAGGCAGTGCCAT rNAB2-b99 GGGAGCCGAGCGAACAA rEGR1-f101 CACCAGCGCCTTCTCGTTATCCC rEGR1-b102 TCTGTACCCCGAGGAGATCC rEGR3-f104 TCCATCACATTCTCTGTAGCCATC rEGR3-b108 CCCTGGCCATTGTGGTTTAC mrMPZ-f109 CCATTCACTGGACCAGAAGGAG mrMPZ-b
9.10 Sequence analysis and determination of potentialbinding sites
Global alignments of orthologous PMP22 loci were done with available murine
(accession number AL 592215.12) and human (AC 005703) sequences containing the
PMP22 gene loci, using VISTA homology plot software (http://www-gsd.lbl.gov/vista/
index.html; Dubchak et al., 2000; Mayor et al., 2000). The results obtained were
compared with the percent identity plot (PIP) constructed with Pipmaker software at
http://bio.cse.psu.edu/pipmaker (data not shown). The three species comparison of the -
10/0kb region was done with VISTA homology plot software with orthologous
sequences of mouse, human, and rat (AC 108967).
To screen the murine genomic DNA sequences for interspersed repeats and low
complexity DNA sequences, the RepeatMasker program was used (Smit, AFA & Green,
P RepeatMasker at http://ftp.genome.washington.edu/RM/RepeatMasker.html and
references therein).
Screening for potential binding site was performed on the mouse -10/0kb fragment (AL
592215.12) with the MatInspector software (Quandt et al., 1995) with all available
vertebrate matrices (core similarity: 0.75; matrix similarity: optimized; Matrix Family
Library Version 2.4 May 2002). The software is availabe online at http://
www.genomatix.de and is based on the TRANSFAC databases (Heinemeyer et al., 1998)
(http://transfac.gbf.de/).
REFERENCES
97
10 REFERENCES
Adlkofer, K., Frei, R., Neuberg, D. H., Zielasek, J., Toyka, K. V., and Suter, U. (1997a).Heterozygous peripheral myelin protein 22-deficient mice are affected by a progressivedemyelinating tomaculous neuropathy. J Neurosci 17: 4662-71.
Adlkofer, K., Martini, R., Aguzzi, A., Zielasek, J., Toyka, K. V., and Suter, U. (1995).Hypermyelination and demyelinating peripheral neuropathy in Pmp22- deficient mice.Nat. Genet. 11: 274-280.
Adlkofer, K., Naef, R., and Suter, U. (1997b). Analysis of compound heterozygous mice revealsthat the Trembler mutation can behave as a gain-of-function allele. J Neurosci Res 49:671-80.
Aguayo, A. J., Charron, L., and Bray, G. M. (1976). Potential of Schwann cells fromunmyelinated nerves to produce myelin: a quantitative ultrastructural and radiographicstudy. J Neurocytol 5: 565-73.
Aguayo, A. J., Epps, J., Charron, L., and Bray, G. M. (1976). Multipotentiality of Schwann cellsin cross-anastomosed and grafted myelinated and unmyelinated nerves: quantitativemicroscopy and radioautography. Brain Res 104: 1-20.
Amato, A. A., Gronseth, G. S., Callerame, K. J., Kagan-Hallet, K. S., Bryan, W. W., and Barohn,R. J. (1996). Tomaculous neuropathy: a clinical and electrophysiological study in patientswith and without 1.5-Mb deletions in chromosome 17p11.2. Muscle Nerve 19: 16-22.
Anderson, T. J., Klugmann, M., Thomson, C. E., Schneider, A., Readhead, C., Nave, K. A., andGriffiths, I. R. (1999). Distinct phenotypes associated with increasing dosage of the PLPgene: implications for CMT1A due to PMP22 gene duplication. Ann N Y Acad Sci 883:234-46.
Aoyama, A., Tamura, T. A., and Mikoshiba, K. (1990). Regulation of brain-specific transcriptionof the mouse myelin basic protein gene: function of the NFI-binding site in the distalpromoter. Biochem Biophys Res Commun 167: 648-53.
Araki, T., Nagarajan, R., and Milbrandt, J. (2001). Identification of genes induced in peripheralnerve after injury. Expression profiling and novel gene discovery. J Biol Chem 276:34131-41.
Awatramani, R., Shumas, S., Kamholz, J., and Scherer, S. S. (2002). TGFbeta1 modulates thephenotype of Schwann cells at the transcriptional level. Mol Cell Neurosci 19: 307-19.
Baechner, D., Liehr, T., Hameister, H., Altenberger, H., Grehl, H., Suter, U., and Rautenstrauss,B. (1995). Widespread expression of the peripheral myelin protein-22 gene (PMP22) inneural and non-neural tissues during murine development. J Neurosci Res 42: 733-41.
Beckmann, A. M., and Wilce, P. A. (1997). Egr transcription factors in the nervous system.Neurochem Int 31: 477-510; discussion 517-6.
Bellefroid, E. J., Sahin, M., Poncelet, D. A., Riviere, M., Bourguignon, C., Martial, J. A., Morris,P. L., Pieler, T., Szpirer, C., and Ward, D. C. (1998). Kzf1 - a novel KRAB zinc fingerprotein encoding gene expressed during rat spermatogenesis. Biochim Biophys Acta 1398:321-9.
REFERENCES
98
Benbrook, D. M., and Jones, N. C. (1994). Different binding specificities and transactivation ofvariant CRE's by CREB complexes. Nucleic Acids Res 22: 1463-9.
Berger, P., Young, P., and Suter, U. (2002). Molecular cell biology of Charcot-Marie-Toothdisease. Neurogenetics 4: 1-15.
Bermingham, J. R., Jr., Scherer, S. S., O'Connell, S., Arroyo, E., Kalla, K. A., Powell, F. L., andRosenfeld, M. G. (1996). Tst-1/Oct-6/SCIP regulates a unique step in peripheralmyelination and is required for normal respiration. Genes Dev 10: 1751-62.
Berndt, J. A., Kim, J. G., and Hudson, L. D. (1992). Identification of cis-regulatory elements inthe myelin proteolipid protein (PLP) gene. J Biol Chem 267: 14730-7.
Bharucha, V. A., Peden, K. W., Subach, B. R., Narayanan, V., and Tennekoon, G. I. (1993).Characterization of the cis-acting elements of the mouse myelin P2 promoter. J NeurosciRes 36: 508-19.
Bharucha, V. A., Peden, K. W., and Tennekoon, G. I. (1994). SV40 large T antigen with c-Jundown-regulates myelin P0 gene expression: a mechanism for papovaviral T antigen-mediated demyelination. Neuron 12: 627-37.
Boerkoel, C. F., Takashima, H., Bacino, C. A., Daentl, D., and Lupski, J. R. (2001). EGR2mutation R359W causes a spectrum of Dejerine-Sottas neuropathy. Neurogenetics 3: 153-7.
Borycki, A. G., and Emerson, C. P. (1997). Muscle determination: another key player inmyogenesis? Curr Biol 7: R620-3.
Bosse, F., Brodbeck, J., and Muller, H. W. (1999). Post-transcriptional regulation of theperipheral myelin protein gene PMP22/gas3. J Neurosci Res 55: 164-77.
Boutry, J. M., Hauw, J. J., Gansmuller, A., Di-Bert, N., Pouchelet, M., and Baron-VanEvercooren, A. (1992). Establishment and characterization of a mouse Schwann cell linewhich produces myelin in vivo. J Neurosci Res 32: 15-26.
Brancolini, C., Marzinotto, S., Edomi, P., Agostoni, E., Fiorentini, C., Muller, H. W., andSchneider, C. (1999). Rho-dependent regulation of cell spreading by the tetraspanmembrane protein Gas3/PMP22. Mol Biol Cell 10: 2441-59.
Brancolini, C., Edomi, P., Marzinotto, S., and Schneider, C. (2000). Exposure at the cell surfaceis required for gas3/PMP22 To regulate both cell death and cell spreading: implication forthe Charcot-Marie- Tooth type 1A and Dejerine-Sottas diseases. Mol Biol Cell 11: 2901-14.
Britsch, S., Goerich, D. E., Riethmacher, D., Peirano, R. I., Rossner, M., Nave, K. A.,Birchmeier, C., and Wegner, M. (2001). The transcription factor Sox10 is a key regulatorof peripheral glial development. Genes Dev 15: 66-78.
Brown, A. M., and Lemke, G. (1997). Multiple regulatory elements control transcription of theperipheral myelin protein zero gene. J Biol Chem 272: 28939-47.
Campagnoni, A. T., Pribyl, T. M., Campagnoni, C. W., Kampf, K., Amur-Umarjee, S., Landry, C.F., Handley, V. W., Newman, S. L., Garbay, B., and Kitamura, K. (1993). Structure anddevelopmental regulation of Golli-mbp, a 105-kilobase gene that encompasses the myelin
REFERENCES
99
basic protein gene and is expressed in cells in the oligodendrocyte lineage in the brain. JBiol Chem 268: 4930-8.
Chalepakis, G., and Gruss, P. (1995). Identification of DNA recognition sequences for the Pax3paired domain. Gene 162: 267-70.
Chan, J. R., Rodriguez-Waitkus, P. M., Ng, B. K., Liang, P., and Glaser, M. (2000). Progesteronesynthesized by Schwann cells during myelin formation regulates neuronal geneexpression. Mol Biol Cell 11: 2283-95.
Chance, P. F., Alderson, M. K., Leppig, K. A., Lensch, M. W., Matsunami, N., Smith, B.,Swanson, P. D., Odelberg, S. J., Disteche, C. M., and Bird, T. D. (1993). DNA deletionassociated with hereditary neuropathy with liability to pressure palsies. Cell 72: 143-151.
D'Urso, D., Schmalenbach, C., Zoidl, G., Prior, R., and Muller, H. W. (1997). Studies on theeffects of altered PMP22 expression during myelination in vitro. J Neurosci Res 48: 31-42.
De Leon, M., Nahin, R. L., Mendoza, M. E., and Ruda, M. A. (1994). SR13/PMP-22 expressionin rat nervous system, in PC12 cells, and C6 glial cell lines. J Neurosci Res 38: 167-81.
Desarnaud, F., Do Thi, A. N., Brown, A. M., Lemke, G., Suter, U., Baulieu, E. E., andSchumacher, M. (1998). Progesterone stimulates the activity of the promoters ofperipheral myelin protein-22 and protein zero genes in Schwann cells. J Neurochem 71:1765-8.
Devine-Beach, K., Lashgari, M. S., and Khalili, K. (1990). Myelin basic protein genetranscription. Identification of proximal and distal cis-acting regulatory elements. J BiolChem 265: 13830-5.
Dickson, K. M., Bergeron, J. J., Shames, I., Colby, J., Nguyen, D. T., Chevet, E., Thomas, D. Y.,and Snipes, G. J. (2002). Association of calnexin with mutant peripheral myelin protein-22ex vivo: a basis for "gain-of-function" ER diseases. Proc Natl Acad Sci U S A 99: 9852-7.
Donahue, L. M., and Reinhart, A. J. (1998). POU domain genes are differentially expressed inthe early stages after lineage commitment of the PNS-derived stem cell line, RT4-AC.Brain Res Dev Brain Res 106: 1-12.
Drocourt, D., Calmels, T., Reynes, J. P., Baron, M., and Tiraby, G. (1990). Cassettes of theStreptoalloteichus hindustanus ble gene for transformation of lower and higher eukaryotesto phleomycin resistance. Nucleic Acids Res 18: 4009.
Dubchak, I., Brudno, M., Loots, G. G., Pachter, L., Mayor, C., Rubin, E. M., and Frazer, K. A.(2000). Active conservation of noncoding sequences revealed by three-way speciescomparisons. Genome Res 10: 1304-6.
Duchala, C. S., Fuss, B., and Macklin, W. B. (1996). Use of Transgenic Systems to InvestigateOligodendrocyte Differentiation and Function. Methods 10: 478-88.
Dyck, P. J., Chance, P., Lebo, R., and Carney, J. A. (1993). Hereditary motor and sensoryneuropathies. In: Dyck PJ, Thomas PK, Grffin JW, Low PA, Poduslo JF, editors.Peripheral Neuropathy Philadelphia: Saunders, 1993:: 1094-1136.
Ehrengruber, M. U., Muhlebach, S. G., Sohrman, S., Leutenegger, C. M., Lester, H. A., andDavidson, N. (2000). Modulation of early growth response (EGR) transcription factor-dependent gene expression by using recombinant adenovirus. Gene 258: 63-9.
REFERENCES
100
Elliott, J. I., Festenstein, R., Tolaini, M., and Kioussis, D. (1995). Random activation of atransgene under the control of a hybrid hCD2 locus control region/Ig enhancer regulatoryelement. Embo J 14: 575-84.
Fabbretti, E., Edomi, P., Brancolini, C., and Schneider, C. (1995). Apoptotic phenotype inducedby overexpression of wild-type gas3/PMP22: its relation to the demyelinating peripheralneuropathy CMT1A. Genes Dev 9: 1846-1856.
Farsetti, A., Desvergne, B., Hallenbeck, P., Robbins, J., and Nikodem, V. M. (1992).Characterization of myelin basic protein thyroid hormone response element and itsfunction in the context of native and heterologous promoter. J Biol Chem 267: 15784-8.
Farsetti, A., Mitsuhashi, T., Desvergne, B., Robbins, J., and Nikodem, V. M. (1991). Molecularbasis of thyroid hormone regulation of myelin basic protein gene expression in rodentbrain. J Biol Chem 266: 23226-32.
Feltri, M. L., D'Antonio, M., Quattrini, A., Numerato, R., Arona, M., Previtali, S., Chiu, S. Y.,Messing, A., and Wrabetz, L. (1999). A novel P0 glycoprotein transgene activatesexpression of lacZ in myelin-forming Schwann cells. Eur J Neurosci 11: 1577-86.
Fiering, S., Whitelaw, E., and Martin, D. I. (2000). To be or not to be active: the stochastic natureof enhancer action. Bioessays 22: 381-7.
Forghani, R., Garofalo, L., Foran, D. R., Farhadi, H. F., Lepage, P., Hudson, T. J., Tretjakoff, I.,Valera, P., and Peterson, A. (2001). A distal upstream enhancer from the myelin basicprotein gene regulates expression in myelin-forming schwann cells. J Neurosci 21: 3780-7.
Forghani, R., Nesbitt, J., Snipes, J., Shooter, E. M., and Peterson, A. (1999). Preparation ofnuclear extracts from myelinating Schwann cells. J Neurosci Methods 89: 129-32.
Friede, R. L., and Samorajski, T. (1968). Myelin formation in the sciatic nerve of the rat. Aquantitative electron microscopic, histochemical and radioautographic study. JNeuropathol Exp Neurol 27: 546-70.
Garbay, B., Boiron-Sargueil, F., and Cassagne, C. (1995). Expression of the exon 1A-containingPMP22 transcript is altered in the trembler mouse. Neurosci Lett 198: 157-60.
Garbern, J. Y., Cambi, F., Tang, X. M., Sima, A. A., Vallat, J. M., Bosch, E. P., Lewis, R., Shy, M.,Sohi, J., Kraft, G., Chen, K. L., Joshi, I., Leonard, D. G., Johnson, W., Raskind, W.,Dlouhy, S. R., Pratt, V., Hodes, M. E., Bird, T., and Kamholz, J. (1997). Proteolipid proteinis necessary in peripheral as well as central myelin. Neuron 19: 205-18.
Gatignol, A., Durand, H., and Tiraby, G. (1988). Bleomycin resistance conferred by a drug-binding protein. FEBS Lett 230: 171-5.
Ghazvini, M., Mandemakers, W., Jaegle, M., Piirsoo, M., Driegen, S., Koutsourakis, M., Smit,X., Grosveld, F., and Meijer, D. (2002). A cell type-specific allele of the POU gene Oct-6reveals Schwann cell autonomous function in nerve development and regeneration. EmboJ 21: 4612-4620.
Ghislain, J., Desmarquet-Trin-Dinh, C., Jaegle, M., Meijer, D., Charnay, P., and Frain, M. (2002).Characterisation of cis-acting sequences reveals a biphasic, axon- dependent regulation ofKrox20 during Schwann cell development. Development 129: 155-66.
REFERENCES
101
Goujet-Zalc, C., Babinet, C., Monge, M., Timsit, S., Cabon, F., Gansmuller, A., Miura, M.,Sanchez, M., Pournin, S., Mikoshiba, K., and et al. (1993). The proximal region of theMBP gene promoter is sufficient to induce oligodendroglial-specific expression intransgenic mice. Eur J Neurosci 5: 624-32.
Graubert, T. A., Hug, B. A., Wesselschmidt, R., Hsieh, C. L., Ryan, T. M., Townes, T. M., andLey, T. J. (1998). Stochastic, stage-specific mechanisms account for the variegation of ahuman globin transgene. Nucleic Acids Res 26: 2849-58.
Gravel, M., Di Polo, A., Valera, P. B., and Braun, P. E. (1998). Four-kilobase sequence of themouse CNP gene directs spatial and temporal expression of lacZ in transgenic mice. JNeurosci Res 53: 393-404.
Grubinska, B., Laszkiewicz, I., Royland, J., Wiggins, R. C., and Konat, G. W. (1994).Differentiation-specific demethylation of myelin associated glycoprotein gene in culturedoligodendrocytes. J Neurosci Res 39: 233-42.
Guillot, P. V., Liu, L., Kuivenhoven, J. A., Guan, J., Rosenberg, R. D., and Aird, W. C. (2000).Targeting of human eNOS promoter to the Hprt locus of mice leads to tissue-restrictedtransgene expression. Physiol Genomics 2: 77-83.
Gupta, S. K., Pringle, J., Poduslo, J. F., and Mezei, C. (1993). Induction of myelin genes duringperipheral nerve remyelination requires a continuous signal from the ingrowing axon. JNeurosci Res 34: 14-23.
Hagedorn, L., Suter, U., and Sommer, L. (1999). P0 and PMP22 mark a multipotent neural crest-derived cell type that displays community effects in response to TGF-beta family factors.Development 126: 3781-94.
Hai, M., Bidichandani, S. I., Hogan, M. E., and Patel, P. I. (2001). Competitive binding oftriplex-forming oligonucleotides in the two alternate promoters of the PMP22 gene.Antisense Nucleic Acid Drug Dev 11: 233-46.
Hai, M., Bidichandani, S. I., and Patel, P. I. (2001). Identification of a positive regulatory elementin the myelin-specific promoter of the PMP22 gene. J Neurosci Res 65: 508-19.
Haney, C., Snipes, G. J., Shooter, E. M., Suter, U., Garcia, C., Griffin, J. W., and Trapp, B. D.(1996). Ultrastructural distribution of PMP22 in Charcot-Marie-Tooth disease type 1A. JNeuropathol Exp Neurol 55: 290-9.
Hardison, R., Slightom, J. L., Gumucio, D. L., Goodman, M., Stojanovic, N., and Miller, W.(1997). Locus control regions of mammalian beta-globin gene clusters: combiningphylogenetic analyses and experimental results to gain functional insights. Gene 205: 73-94.
He, X., Gerrero, R., Simmons, D. M., Park, R. E., Lin, C. J., Swanson, L. W., and Rosenfeld, M.G. (1991). Tst-1, a member of the POU domain gene family, binds the promoter of thegene encoding the cell surface adhesion molecule P0. Mol Cell Biol 11: 1739-44.
He, X., Treacy, M. N., Simmons, D. M., Ingraham, H. A., Swanson, L. W., and Rosenfeld, M. G.(1989). Expression of a large family of POU-domain regulatory genes in mammalian braindevelopment. Nature 340: 35-41.
Heinemeyer, T., Wingender, E., Reuter, I., Hermjakob, H., Kel, A. E., Kel, O. V., Ignatieva, E. V.,Ananko, E. A., Podkolodnaya, O. A., Kolpakov, F. A., Podkolodny, N. L., and Kolchanov,
REFERENCES
102
N. A. (1998). Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL.Nucleic Acids Res 26: 362-7.
Huehne, K., and Rautenstrauss, B. (2001). Transcriptional startpoints and methylation patterns inthe PMP22 promoters of peripheral nerve, leukocytes and tumor cell lines. Int J Mol Med7: 669-75.
Huhne, K., Park, O., Liehr, T., and Rautenstrauss, B. (1999). Expression analysis of the PMP22gene in glioma and osteogenic sarcoma cell lines. J Neurosci Res 58: 624-31.
Hume, D. A. (2000). Probability in transcriptional regulation and its implications for leukocytedifferentiation and inducible gene expression. Blood 96: 2323-8.
Huxley, C., Passage, E., Manson, A., Putzu, G., Figarella-Branger, D., Pellissier, J. F., andFontes, M. (1996). Construction of a mouse model of Charcot-Marie-Tooth disease type1A by pronuclear injection of human YAC DNA. Hum Mol Genet 5: 563-9.
Ikenaka, K., and Kagawa, T. (1995). Transgenic systems in studying myelin gene expression.Dev Neurosci 17: 127-36.
Imada, M., and Sueoka, N. (1978). Clonal sublines of rat neurotumor RT4 and celldifferentiation. I. Isolation and characterization of cell lines and cell type conversion. DevBiol 66: 97-108.
Inoue, K., Dewar, K., Katsanis, N., Reiter, L. T., Lander, E. S., Devon, K. L., Wyman, D. W.,Lupski, J. R., and Birren, B. (2001). The 1.4-Mb CMT1A duplication/HNPP deletiongenomic region reveals unique genome architectural features and provides insights into therecent evolution of new genes. Genome Res 11: 1018-33.
Jaegle, M., Mandemakers, W., Broos, L., Zwart, R., Karis, A., Visser, P., Grosveld, F., and Meijer,D. (1996). The POU factor Oct-6 and Schwann cell differentiation. Science 273: 507-10.
Jaegle, M., and Meijer, D. (1998). Role of Oct-6 in Schwann cell differentiation. Microsc ResTech 41: 372-8.
Jessen, K. R., and Mirsky, R. (1999). Schwann cells and their precursors emerge as majorregulators of nerve development. Trends Neurosci 22: 402-10.
Kagawa, T., Ikenaka, K., Inoue, Y., Kuriyama, S., Tsujii, T., Nakao, J., Nakajima, K., Aruga, J.,Okano, H., and Mikoshiba, K. (1994). Glial cell degeneration and hypomyelination causedby overexpression of myelin proteolipid protein gene. Neuron 13: 427-42.
Kaku, D. A., Parry, G. J., Malamut, R., Lupski, J. R., and Garcia, C. A. (1993). Nerve conductionstudies in Charcot-Marie-Tooth polyneuropathy associated with a segmental duplicationof chromosome 17. Neurology 43: 1806-8.
Kallunki, P., Edelman, G. M., and Jones, F. S. (1998). The neural restrictive silencer element canact as both a repressor and enhancer of L1 cell adhesion molecule gene expression duringpostnatal development. Proc Natl Acad Sci U S A 95: 3233-8.
Kallunki, P., Edelman, G. M., and Jones, F. S. (1997). Tissue-specific expression of the L1 celladhesion molecule is modulated by the neural restrictive silencer element. J Cell Biol 138:1343-54.
REFERENCES
103
Kamholz, J., Sessa, M., Scherer, S., Vogelbacker, H., Mokuno, K., Baron, P., Wrabetz, L., Shy,M., and Pleasure, D. (1992). Structure and expression of proteolipid protein in theperipheral nervous system. J Neurosci Res 31: 231-44.
Kothary, R., Clapoff, S., Brown, A., Campbell, R., Peterson, A., and Rossant, J. (1988). Atransgene containing lacZ inserted into the dystonia locus is expressed in neural tube.Nature 335: 435-7.
Kothary, R., Clapoff, S., Darling, S., Perry, M. D., Moran, L. A., and Rossant, J. (1989).Inducible expression of an hsp68-lacZ hybrid gene in transgenic mice. Development 105:707-14.
Kuhlbrodt, K., Herbarth, B., Sock, E., Hermans-Borgmeyer, I., and Wegner, M. (1998). Sox10, anovel transcriptional modulator in glial cells. J Neurosci 18: 237-50.
Kuhn, R., Monuki, E. S., and Lemke, G. (1991). The gene encoding the transcription factor SCIPhas features of an expressed retroposon. Mol Cell Biol 11: 4642-50.
Laszkiewicz, I., Grubinska, B., Wiggins, R. C., and Konat, G. W. (1997). Structuralcharacterization of myelin-associated glycoprotein gene core promoter. J Neurosci Res 50:928-36.
Lee, M., Brennan, A., Blanchard, A., Zoidl, G., Dong, Z., Tabernero, A., Zoidl, C., Dent, M. A.,Jessen, K. R., and Mirsky, R. (1997). P0 is constitutively expressed in the rat neural crestand embryonic nerves and is negatively and positively regulated by axons to generate non-myelin-forming and myelin-forming Schwann cells, respectively. Mol Cell Neurosci 8:336-50.
Lehming, N., Thanos, D., Brickman, J. M., Ma, J., Maniatis, T., and Ptashne, M. (1994). AnHMG-like protein that can switch a transcriptional activator to a repressor. Nature 371:175-9.
Lemke, G., and Chao, M. (1988). Axons regulate Schwann cell expression of the major myelinand NGF receptor genes. Development 102: 499-504.
Lemke, G., Lamar, E., and Patterson, J. (1988). Isolation and analysis of the gene encodingperipheral myelin protein zero. Neuron 1: 73-83.
Li, P., He, X., Gerrero, M. R., Mok, M., Aggarwal, A., and Rosenfeld, M. G. (1993). Spacing andorientation of bipartite DNA-binding motifs as potential functional determinants for POUdomain factors. Genes Dev 7: 2483-96.
Li, X., Wrabetz, L., Cheng, Y., and Kamholz, J. (1994). A novel cyclic AMP response element,CACTTGATC, mediates forskolin induction of the myelin basic protein promoter in therat Schwannoma line, D6P2T. J Neurochem 63: 28-40.
Lobsiger, C. S., Taylor, V., and Suter, U. (2002). The early life of a Schwann cell. Biol Chem 383:245-53.
Lupski, J. R., de Oca Luna, R. M., Slaugenhaupt, S., Pentao, L., Guzzetta, V., Trask, B. J.,Saucedo-Cardenas, O., Barker, D. F., Killian, J. M., Garcia, C. A., Chakravarti, A., andPatel, P. I. (1991). DNA duplication associated with Charcot-Marie-Tooth disease type 1A.Cell 66: 219-232.
Magnaghi, V., Cavarretta, I., Galbiati, M., Martini, L., and Melcangi, R. C. (2001). Neuroactivesteroids and peripheral myelin proteins. Brain Res Brain Res Rev 37: 360-71.
REFERENCES
104
Magyar, J. P., Martini, R., Ruelicke, T., Aguzzi, A., Adlkofer, K., Dembic, Z., Zielasek, J., Toyka,K. V., and Suter, U. (1996). Impaired differentiation of Schwann cells in transgenic micewith increased PMP22 gene dosage. J Neurosci 16: 5351-60.
Maier, M., Berger, P., Nave, K. A., and Suter, U. (2002a). Identification of the Regulatory Regionof the Peripheral Myelin Protein 22 (PMP22) Gene That Directs Temporal and SpatialExpression in Development and Regeneration of Peripheral Nerves. Mol Cell Neurosci 20:93-109.
Maier, M., Berger, P., and Suter, U. (2002b). Understanding Schwann cell-neurone interactions:the key to Charcot- Marie-Tooth disease? J Anat 200: 357-66.
Mandemakers, W., Zwart, R., Jaegle, M., Walbeehm, E., Visser, P., Grosveld, F., and Meijer, D.(2000). A distal Schwann cell-specific enhancer mediates axonal regulation of the Oct-6transcription factor during peripheral nerve development and regeneration. Embo J 19:2992-3003.
Manfioletti, G., Ruaro, M. E., Del Sal, G., Philipson, L., and Schneider, C. (1990). A growtharrest-specific (gas) gene codes for a membrane protein. Mol Cell Biol 10: 2924-30.
Mansuy, I. M., and Suter, U. (2000). Mouse genetics in cell biology. Exp Physiol 85: 661-79.
Martini, R., Schachner, M., and Brushart, T. M. (1994). The L2/HNK-1 carbohydrate ispreferentially expressed by previously motor axon-associated Schwann cells inreinnervated peripheral nerves. J Neurosci 14: 7180-91.
Maycox, P. R., Ortuno, D., Burrola, P., Kuhn, R., Bieri, P. L., Arrezo, J. C., and Lemke, G.(1997). A transgenic mouse model for human hereditary neuropathy with liability topressure palsies. Mol Cell Neurosci 8: 405-16.
Mayor, C., Brudno, M., Schwartz, J. R., Poliakov, A., Rubin, E. M., Frazer, K. A., Pachter, L. S.,and Dubchak, I. (2000). VISTA : visualizing global DNA sequence alignments of arbitrarylength. Bioinformatics 16: 1046-7.
Meech, R., Kallunki, P., Edelman, G. M., and Jones, F. S. (1999). A binding site forhomeodomain and Pax proteins is necessary for L1 cell adhesion molecule geneexpression by Pax-6 and bone morphogenetic proteins. Proc Natl Acad Sci U S A 96:2420-5.
Melcangi, R. C., Magnaghi, V., Cavarretta, I., Zucchi, I., Bovolin, P., D'Urso, D., and Martini, L.(1999). Progesterone derivatives are able to influence peripheral myelin protein 22 and P0gene expression: possible mechanisms of action. J Neurosci Res 56: 349-57.
Melcangi, R. C., Magnaghi, V., Galbiati, M., and Martini, L. (2001). Steroid effects on the geneexpression of peripheral myelin proteins. Horm Behav 40: 210-4.
Messing, A., Behringer, R. R., Hammang, J. P., Palmiter, R. D., Brinster, R. L., and Lemke, G.(1992). P0 promoter directs expression of reporter and toxin genes to Schwann cells oftransgenic mice. Neuron 8: 507-20.
Milot, E., Strouboulis, J., Trimborn, T., Wijgerde, M., de Boer, E., Langeveld, A., Tan-Un, K.,Vergeer, W., Yannoutsos, N., Grosveld, F., and Fraser, P. (1996). Heterochromatin effectson the frequency and duration of LCR-mediated gene transcription. Cell 87: 105-14.
REFERENCES
105
Mirsky, R., and Jessen, K. R. (1999). The neurobiology of Schwann cells. Brain Pathol 9: 293-311.
Mirsky, R., Jessen, K. R., Brennan, A., Parkinson, D., Dong, Z., Meier, C., Parmantier, E., andLawson, D. (2002). Schwann cells as regulators of nerve development. J Physiol Paris 96:17-24.
Misra, R. P., Bronson, S. K., Xiao, Q., Garrison, W., Li, J., Zhao, R., and Duncan, S. A. (2001).Generation of single-copy transgenic mouse embryos directly from ES cells by tetraploidembryo complementation. BMC Biotechnol 1: 12.
Miura, M., Tamura, T., Aoyama, A., and Mikoshiba, K. (1989). The promoter elements of themouse myelin basic protein gene function efficiently in NG108-15 neuronal/glial cells.Gene 75: 31-8.
Monuki, E. S., Kuhn, R., and Lemke, G. (1993). Repression of the myelin P0 gene by the POUtranscription factor SCIP. Mech Dev 42: 15-32.
Monuki, E. S., Kuhn, R., Weinmaster, G., Trapp, B. D., and Lemke, G. (1990). Expression andactivity of the POU transcription factor SCIP. Science 249: 1300-3.
Nadon, N. L., Arnheiter, H., and Hudson, L. D. (1994). A combination of PLP and DM20transgenes promotes partial myelination in the jimpy mouse. J Neurochem 63: 822-33.
Naef, R., and Suter, U. (1999). Impaired intracellular trafficking is a common disease mechanismof PMP22 point mutations in peripheral neuropathies. Neurobiol Dis 6: 1-14.
Naef, R., and Suter, U. (1998). Many facets of the peripheral myelin protein PMP22 inmyelination and disease. Microsc Res Tech 41: 359-71.
Nagarajan, R., Svaren, J., Le, N., Araki, T., Watson, M., and Milbrandt, J. (2001). EGR2mutations in inherited neuropathies dominant-negatively inhibit myelin gene expression.Neuron 30: 355-68.
Nave, K. A., and Lemke, G. (1991). Induction of the myelin proteolipid protein (PLP) gene in C6glioblastoma cells: functional analysis of the PLP promotor. J Neurosci 11: 3060-9.
Nelson, C. C., Hendy, S. C., Shukin, R. J., Cheng, H., Bruchovsky, N., Koop, B. F., and Rennie,P. S. (1999). Determinants of DNA sequence specificity of the androgen, progesterone,and glucocorticoid receptors: evidence for differential steroid receptor response elements.Mol Endocrinol 13: 2090-107.
Neuberg, D. H., Sancho, S., and Suter, U. (1999). Altered molecular architecture of peripheralnerves in mice lacking the peripheral myelin protein 22 or connexin32. J Neurosci Res 58:612-23.
Paca-Uccaralertkun, S., Zhao, L. J., Adya, N., Cross, J. V., Cullen, B. R., Boros, I. M., and Giam,C. Z. (1994). In vitro selection of DNA elements highly responsive to the human T- celllymphotropic virus type I transcriptional activator, Tax. Mol Cell Biol 14: 456-62.
Palmer, C. N., Hsu, M. H., Griffin, H. J., and Johnson, E. F. (1995). Novel sequence determinantsin peroxisome proliferator signaling. J Biol Chem 270: 16114-21.
Paratore, C., Goerich, D. E., Suter, U., Wegner, M., and Sommer, L. (2001). Survival and glialfate acquisition of neural crest cells are regulated by an interplay between the transcriptionfactor Sox10 and extrinsic combinatorial signaling. Development 128: 3949-61.
REFERENCES
106
Pareek, S., Suter, U., Snipes, G. J., Welcher, A. A., Shooter, E. M., and Murphy, R. A. (1993).Detection and processing of peripheral myelin protein PMP22 in cultured Schwann cells.J. Biol. Chem. 268: 10372-10379.
Pareek, S., Notterpek, L., Snipes, G. J., Naef, R., Sossin, W., Laliberte, J., Iacampo, S., Suter, U.,Shooter, E. M., and Murphy, R. A. (1997). Neurons promote the translocation ofperipheral myelin protein 22 into myelin. J Neurosci 17: 7754-62.
Parmantier, E., Braun, C., Thomas, J. L., Peyron, F., Martinez, S., and Zalc, B. (1997). PMP-22expression in the central nervous system of the embryonic mouse defines potentialtransverse segments and longitudinal columns. J Comp Neurol 378: 159-72.
Parmantier, E., Cabon, F., Braun, C., D'Urso, D., Muller, H. W., and Zalc, B. (1995). Peripheralmyelin protein-22 is expressed in rat and mouse brain and spinal cord motoneurons. Eur JNeurosci 7: 1080-8.
Patel, P. I., Roa, B. B., Welcher, A. A., Schoener-Scott, R., Trask, B. J., Pentao, L., Snipes, G. J.,Garcia, C. A., Francke, U., Shooter, E. M., and et al. (1992). The gene for the peripheralmyelin protein PMP-22 is a candidate for Charcot-Marie-Tooth disease type 1A. NatGenet 1: 159-65.
Peirano, R. I., Goerich, D. E., Riethmacher, D., and Wegner, M. (2000). Protein zero geneexpression is regulated by the glial transcription factor Sox10. Mol Cell Biol 20: 3198-209.
Pribyl, T. M., Campagnoni, C. W., Kampf, K., Kashima, T., Handley, V. W., McMahon, J., andCampagnoni, A. T. (1993). The human myelin basic protein gene is included within a 179-kilobase transcription unit: expression in the immune and central nervous systems. ProcNatl Acad Sci U S A 90: 10695-9.
Quandt, K., Frech, K., Karas, H., Wingender, E., and Werner, T. (1995). MatInd andMatInspector: new fast and versatile tools for detection of consensus matches innucleotide sequence data. Nucleic Acids Res 23: 4878-84.
Readhead, C., Schneider, A., Griffiths, I., and Nave, K. A. (1994). Premature arrest of myelinformation in transgenic mice with increased proteolipid protein gene dosage. Neuron 12:583-95.
Renner, K., Sock, E., Bermingham, J. R., Jr., and Wegner, M. (1996). Expression of thegene for the POU domain transcription factor Tst- 1/Oct6 is regulated by anestrogen-dependent enhancer. Nucleic Acids Res 24: 4552-7.
Roa, B. B., Garcia, C. A., Suter, U., Kulpa, D. A., Wise, C. A., Mueller, J., Welcher, A. A., Snipes,G. J., Shooter, E. M., Patel, P. I., and et al. (1993). Charcot-Marie-Tooth disease type 1A.Association with a spontaneous point mutation in the PMP22 gene. N Engl J Med 329: 96-101.
Rossant, J., Zirngibl, R., Cado, D., Shago, M., and Giguere, V. (1991). Expression of a retinoicacid response element-hsplacZ transgene defines specific domains of transcriptionalactivity during mouse embryogenesis. Genes Dev 5: 1333-44.
Saberan-Djoneidi, D., Sanguedolce, V., Assouline, Z., Levy, N., Passage, E., and Fontes, M.(2000). Molecular dissection of the Schwann cell specific promoter of the PMP22 gene.Gene 248: 223-31.
REFERENCES
107
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning: A laboratory manual.,Second Edition Edition: Cold Spring Harbor Laboratory Press).
Sancho, S., Magyar, J. P., Aguzzi, A., and Suter, U. (1999). Distal axonopathy in peripheralnerves of PMP22-mutant mice. Brain 122: 1563-77.
Sasaki, Y., Ishida, S., Morimoto, I., Yamashita, T., Kojima, T., Kihara, C., Tanaka, T., Imai, K.,Nakamura, Y., and Tokino, T. (2002). The p53 family member genes are involved in theNotch signal pathway. J Biol Chem 277: 719-24.
Scherer, S. S. (1997). The biology and pathobiology of Schwann cells. Curr Opin Neurol 10:386-97.
Scherer, S. S. (1999). Nodes, paranodes, and incisures: from form to function. Ann N Y Acad Sci883: 131-42.
Scherer, S. S., and Arroyo, E. J. (2002). Recent progress on the molecular organization ofmyelinated axons. J Peripher Nerv Syst 7: 1-12.
Scherer, S. S., Vogelbacker, H. H., and Kamholz, J. (1992). Axons modulate the expression ofproteolipid protein in the CNS. J Neurosci Res 32: 138-48.
Schneider, C., King, R. M., and Philipson, L. (1988). Genes specifically expressed at growtharrest of mammalian cells. Cell 54: 787-93.
Schreiber, J., Enderich, J., Sock, E., Schmidt, C., Richter-Landsberg, C., and Wegner, M. (1997).Redundancy of class III POU proteins in the oligodendrocyte lineage. J Biol Chem 272:32286-93.
Sereda, M., Griffiths, I., Puhlhofer, A., Stewart, H., Rossner, M. J., Zimmermann, F., Magyar, J.P., Schneider, A., Hund, E., Meinck, H.-M., Suter, U., and Nave, K. A. (1996). A rattransgenic model for Charcot-Marie-Tooth disease. Neuron 16: 1049-1060.
Sim, F., Zhao, C., Li, W., Lakatos, A., and Franklin, R. (2002). Expression of the POU-DomainTranscription Factors SCIP/Oct-6 and Brn-2 Is Associated with Schwann Cell but NotOligodendrocyte Remyelination of the CNS. Mol Cell Neurosci 20: 669.
Skre, H. (1974). Genetic and clinical aspects of Charcot-Marie-Tooth's disease. Clin Genet 6: 98-118.
Smit, A. F. (1996). The origin of interspersed repeats in the human genome. Curr Opin GenetDev 6: 743-8.
Snipes, G. J., Suter, U., and Shooter, E. M. (1993). Human peripheral myelin protein-22 carriesthe L2/HNK-1 carbohydrate adhesion epitope. J. Neurochem. 61: 1961-1964.
Snipes, G. J., Suter, U., Welcher, A. A., and Shooter, E. M. (1992). Characterization of a novelperipheral nervous system myelin protein (PMP-22/SR13). J Cell Biol 117: 225-38.
Spreyer, P., Kuhn, G., Hanemann, C. O., Gillen, C., Schaal, H., Kuhn, R., Lemke, G., and Muller,H. W. (1991). Axon-regulated expression of a Schwann cell transcript that is homologousto a 'growth arrest-specific' gene. Embo J 10: 3661-8.
Suter, U., Moskow, J. J., Welcher, A. A., Snipes, G. J., Kosaras, B., Sidman, R. L., Buchberg, A.M., and Shooter, E. M. (1992a). A leucine-to-proline mutation in the putative first
REFERENCES
108
transmembrane domain of the 22-kDa peripheral myelin protein in the trembler-J mouse.Proc Natl Acad Sci U S A 89: 4382-6.
Suter, U., Snipes, G. J., Schoener-Scott, R., Welcher, A. A., Pareek, S., Lupski, J. R., Murphy, R.A., Shooter, E. M., and Patel, P. I. (1994). Regulation of tissue-specific expression ofalternative peripheral myelin protein-22 (PMP22) gene transcripts by two promoters. JBiol Chem 269: 25795-808.
Suter, U., Welcher, A. A., Ozcelik, T., Snipes, G. J., Kosaras, B., Francke, U., Billings, G. S.,Sidman, R. L., and Shooter, E. M. (1992b). Trembler mouse carries a point mutation in amyelin gene. Nature 356: 241-244.
Suter, U., and Snipes, G. J. (1995). Biology and genetics of hereditary motor and sensoryneuropathies. Annu Rev Neurosci 18: 45-75.
Sutherland, H. G., Martin, D. I., and Whitelaw, E. (1997). A globin enhancer acts by increasingthe proportion of erythrocytes expressing a linked transgene. Mol Cell Biol 17: 1607-14.
Swirnoff, A. H., and Milbrandt, J. (1995). DNA-binding specificity of NGFI-A and related zincfinger transcription factors. Mol Cell Biol 15: 2275-87.
Taillebourg, E., Buart, S., and Charnay, P. (2002). Conditional, floxed allele of the Krox20 gene.Genesis 32: 112-3.
Tamura, T., Aoyama, A., Inoue, T., Miura, M., Okano, H., and Mikoshiba, K. (1989). Tissue-specific in vitro transcription from the mouse myelin basic protein promoter. Mol Cell Biol9: 3122-6.
Tamura, T., Miura, M., Ikenaka, K., and Mikoshiba, K. (1988). Analysis of transcription controlelements of the mouse myelin basic protein gene in HeLa cell extracts: demonstration of astrong NFI- binding motif in the upstream region. Nucleic Acids Res 16: 11441-59.
Tamura, T., Sumita, K., Hirose, S., and Mikoshiba, K. (1990). Core promoter of the mousemyelin basic protein gene governs brain- specific transcription in vitro. Embo J 9: 3101-8.
Taveggia, C., Pizzagalli, A., Feltri, M. L., Grinspan, J. B., Kamholz, J., and Wrabetz, L. (1998).MEBA derepresses the proximal myelin basic protein promoter in oligodendrocytes. JBiol Chem 273: 27741-8.
Taylor, V., Welcher, A. A., Program, A. E., and Suter, U. (1995). Epithelial membrane protein-1,peripheral myelin protein 22, and lens membrane protein 20 define a novel gene family. JBiol Chem 270: 28824-33.
Timmerman, V., De Jonghe, P., Ceuterick, C., De Vriendt, E., Lofgren, A., Nelis, E., Warner, L.E., Lupski, J. R., Martin, J. J., and Van Broeckhoven, C. (1999). Novel missense mutationin the early growth response 2 gene associated with Dejerine-Sottas syndrome phenotype.Neurology 52: 1827-32.
Toews, A. D., Hostettler, J., Barrett, C., and Morell, P. (1997). Alterations in gene expressionassociated with primary demyelination and remyelination in the peripheral nervoussystem. Neurochem Res 22: 1271-80.
Topilko, P., Schneider-Maunoury, S., Levi, G., Baron-Van Evercooren, A., Chennoufi, A. B.,Seitanidou, T., Babinet, C., and Charnay, P. (1994). Krox-20 controls myelination in theperipheral nervous system. Nature 371: 796-9.
REFERENCES
109
Trapp, B. D., Hauer, P., and Lemke, G. (1988). Axonal regulation of myelin protein mRNA levelsin actively myelinating Schwann cells. J Neurosci 8: 3515-21.
Umemori, H., Kadowaki, Y., Hirosawa, K., Yoshida, Y., Hironaka, K., Okano, H., and Yamamoto,T. (1999). Stimulation of myelin basic protein gene transcription by Fyn tyrosine kinasefor myelination. J Neurosci 19: 1393-7.
van de Wetering, R. A., Gabreels-Festen, A. A., Kremer, H., Kalscheuer, V. M., Gabreels, F. J.,and Mariman, E. C. (1999). Regulation and expression of the murine PMP22 gene. MammGenome 10: 419-22.
Voyvodic, J. T. (1989). Target size regulates calibre and myelination of sympathetic axons.Nature 342: 430-3.
Wang, M. M., and Reed, R. R. (1993). Molecular cloning of the olfactory neuronal transcriptionfactor Olf-1 by genetic selection in yeast. Nature 364: 121-6.
Warner, L. E., Mancias, P., Butler, I. J., McDonald, C. M., Keppen, L., Koob, K. G., and Lupski,J. R. (1998). Mutations in the early growth response 2 (EGR2) gene are associated withhereditary myelinopathies. Nat Genet 18: 382-4.
Wegner, M. (2000a). Transcriptional control in myelinating glia: flavors and spices. Glia 31: 1-14.
Wegner, M. (2000b). Transcriptional control in myelinating glia: the basic recipe. Glia 29: 118-23.
Welcher, A. A., Suter, U., De Leon, M., Snipes, G. J., and Shooter, E. M. (1991). A myelinprotein is encoded by the homologue of a growth arrest- specific gene. Proc Natl Acad SciU S A 88: 7195-9.
Wight, P. A., Duchala, C. S., Readhead, C., and Macklin, W. B. (1993). A myelin proteolipidprotein-LacZ fusion protein is developmentally regulated and targeted to the myelinmembrane in transgenic mice. J Cell Biol 123: 443-54.
Windebank, A. J. (1993). Inherited recurrent focal neuropathies. In: Dyck PJ, Thomas PK, GrffinJW, Low PA, Poduslo JF, editors. Peripheral Neuropathy.
Wu, R., Jurek, M., Sundarababu, S., and Weinstein, D. E. (2001). The POU gene Brn-5 isinduced by neuregulin and is restricted to myelinating Schwann cells. Mol Cell Neurosci17: 683-95.
Yamada, H., Komiyama, A., and Suzuki, K. (1995). Schwann cell responses to forskolin andcyclic AMP analogues: comparative study of mouse and rat Schwann cells. Brain Res 681:97-104.
Ye, P., Laszkiewicz, I., Wiggins, R. C., and Konat, G. W. (1994). Transcriptional regulation ofmyelin associated glycoprotein gene expression by cyclic AMP. J Neurosci Res 37: 683-90.
Yool, D. A., Edgar, J. M., Montague, P., and Malcolm, S. (2000). The proteolipid protein geneand myelin disorders in man and animal models. Hum Mol Genet 9: 987-92.
Young, P., and Suter, U. (2001). Disease mechanisms and potential therapeutic strategies inCharcot- Marie-Tooth disease. Brain Res Brain Res Rev 36: 213-21.
REFERENCES
110
Zanazzi, G., Einheber, S., Westreich, R., Hannocks, M. J., Bedell-Hogan, D., Marchionni, M. A.,and Salzer, J. L. (2001). Glial growth factor/neuregulin inhibits Schwann cell myelinationand induces demyelination. J Cell Biol 152: 1289-99.
Zoidl, G., Blass-Kampmann, S., D'Urso, D., Schmalenbach, C., and Muller, H. W. (1995).Retroviral-mediated gene transfer of the peripheral myelin protein PMP22 in Schwanncells: modulation of cell growth. Embo J. 14: 1122-1128.
Zoidl, G., D'Urso, D., Blass-Kampmann, S., Schmalenbach, C., Kuhn, R., and Muller, H. W.(1997). Influence of elevated expression of rat wild-type PMP22 and its mutantPMP22Trembler on cell growth of NIH3T3 fibroblasts. Cell Tissue Res 287: 459-70.
Zorick, T. S., and Lemke, G. (1996). Schwann cell differentiation. Curr Opin Cell Biol 8: 870-6.
Zorick, T. S., Syroid, D. E., Brown, A., Gridley, T., and Lemke, G. (1999). Krox-20 controlsSCIP expression, cell cycle exit and susceptibility to apoptosis in developing myelinatingSchwann cells. Development 126: 1397-406.
ACKNOWLEDGMENTS
111
11 ACKNOWLEDGMENTS
I would like to thank:
Prof. Dr. Ueli Suter for giving me the opportunity to work in his group and for his
scientific and personal support over the years.
Prof. Dr. Peter Sonderegger for spending time reading my thesis.
Ned Mantei for his time and patience correcting my thesis, his availability in the lab with
a lot of good advice, and for all the bike t(r)ips.
Prof. Martin Schwab, Suzie Atanasoski, Philipp Berger, Sara Sancho, Verdon Taylor and
Lukas Sommer for all the helpful and rewarding discussions and advice.
Annick Bonnet, Axel Nieman, Pit Young, Sonja Bonneick, Francois Castagner, Dino
Leone, Christian Paratore, Yves Benninger, Johanna Buchstaller for being nice friends
and collegues, for numerous helps and interesting discussions.
All the collegues of the Suter lab and of the IZB institute for the stimulating and nice
working atmosphere.
Last but not least, I thank my parents and Carina for their continous help and endless
support.
CURRICULUM VITAE
112
12 CURRICULUM VITAE
Name Marcel Maier Date of Birth 23rd May, 1974Citizenship SwissSex maleMarital status single
Home Address Alte Sulzbacherstr. 22, 8610 Uster, SwitzerlandPhone: +41 (0)1 940 70 78
Present Address Buchfinkenstrasse 6, CH-8052 Zürich, SwitzerlandPhone: +41 (0)1 301 08 58, E-mail: mamai11@hotmail.com
Education and Awards
1981-1987 Primary School, Uster, Switzerland1987-1993 High School, Kantonsschule Zürcher Oberland, Wetzikon, Switzerland
Degree obtained: Matura type C (natural science)
1991 Award of the Swiss Organisation "Science and Youth" for a thesis inthe area of ecological investigation of dragonflies
1993-1998 Study of biology at the Swiss Federal Institute of Technology (ETH)Zürich, Switzerland ; Courses and examinations in: math, chemistry,physics, biochemistry, molecular biology, physiology, neurobiologyand cell biology
May 1998 Diploma, Dipl. Natw. ETH in cell biology, immunology, molecularbiology, biochemistry and genetics at the Swiss Federal Institute ofTechnology (ETH) Zürich, Switzerland
1999-2002 Ph.D. student, Institute of Cell Biology, ETH Zürich, SwitzerlandArea of research: Molecular and Cellular NeurobiologyTitle of the Project: Transcriptional regulation of the CMT1A-diseasegene Peripheral Myelin Protein (PMP22)
2002 ASN Young Investigator Education Enhancement Award for theAmerican Society of Neurochemistry (ASN) Meeting
Scientific Training and Research experience
1999-2002 Postgraduate courses and exams in different areas of neurobiology atthe Neuroscience Center Zürich, University of Zürich, Switzerland
1999-2002 Ph. D. training in laboratory techniques and methods:
CURRICULUM VITAE
113
molecular biology: standard DNA cloning techniques, RNAtechniques, DNA extractions, Northern and Southern blot, quantitativereal time (RT)-PCR (TaqMan), In situ RNA Hybridisationcell biology: immunohistochemistry, classical histological stainings,semithin sections, electron microscopycell culture: standard cell culture techniques, primary mouse Schwanncell cultures, DRG explant cultures/in vitro myelination,cotransfection studies & reporter gene assays, adenoviral infectionsanimal experiments: establishing and maintaining transgenic mouseand rat lines, performing sciatic nerve crushes
2001 Training in laboratory animal experiments (LTK Module 1) at theInstitute of Laboratory Animal Sciences, University of Zürich,Switzerland: Handling and treatment of animals, welfare and ethicalissues
Additional professional skills and acitivites
1993-1996 Leader of Boy Scout troop with ca. 50 members
September Training in clinical chemistry and analysis at the Hospital - October 1996 Lachen, Switzerland during military service.
December 1998 General assistant in the Management unit of the information - February 1999 technology department at Union Bank of Switzerland (UBS),
Zürich
Languages
German: mother tongueEnglish: fluent written and spoken; 5 years during high school; First Certificate
1993; 1996: 1 month English language course in San Diego, USASpanish: intermediate; 1 year during high school, 1998: 1 month Spanish
language course in Couzco, Peru French: intermediate; 6 years during High School
Conferences and presentations
D-BIOL Symposium ETHZ 2000 and 2002, Davos, Switzerland. Maier M., Berger P.and Suter U. Promoter analysis of the CMT1A- disease gene PMP22 in vivo.
American Society for Neurochemistry, 33rd annual meeting, 2002. Florida, USASelection for oral presentation: Maier M., Berger P., Nave K.-A. and Suter U. Promoteranalysis of the CMT1A- disease gene PMP22 in vivo. (J Neurochem. 2002 Jun;81(Suppl. 1):77)
CURRICULUM VITAE
114
Publications
Maier M., Wildermuth H. (1991), Oekologische Beobachtungen zur Emergenz einigerAnisopteren an Kleingewässer. Libellula 10 (3/4): 89-104
Maier M., Berger P., Nave K.-A and Suter U.(2002), Identification of the RegulatoryRegion of the Peripheral Myelin Protein 22 (PMP22) Gene that Directs Temporal andSpatial Expression in Development and Regeneration of Peripheral Nerves. Mol. CellNeurosci (2002); 20(1):93-109
Maier M., Berger P. and Suter U. (2002), Understanding Schwann Cell-NeuronInteractions: The Key to Charcot-Marie-Tooth Disease ? J Anat (2002), 200; 357-366
Maier M., Castagner F., Berger P. and Suter U. (2003). Dissection of the PeripheralMyelin Protein 22 (PMP22) Promoter in vivo Reveals a Late Myelinating Schwann CellSpecific Element, in preparation
Referees
Prof. Ueli Suter, Ph. D., Head of Institute for Cell Biology, HPM E39, ETH Hönggerberg, CH-8093 Zürich, Switzerland, Phone: +41 1 633 34 32; Fax: +41 1 633 11 90, e-mail: usuter@cell.biol.ethz.ch
Prof. Peter Sonderegger, Department of Biochemistry, University of Zürich, Winterthurerstr. 190, CH-8057 Zürich, Switzerland, Phone: +41 1 635 55 41; Fax: +41 1 635 68 31e-mail: pson@bioc.unizh.ch