Risks in Agriculture - A Key Binding Constraint

Post on 17-Nov-2014

1,102 views 3 download

transcript

RRRRRRRRiiiiiiiisssssssskkkkkkkkssssssss iiiiiiiinnnnnnnn AAAAAAAAggggggggrrrrrrrriiiiiiiiccccccccuuuuuuuullllllllttttttttuuuuuuuurrrrrrrreeeeeeee AAAAAAAA KKKKKKKKeeeeeeeeyyyyyyyy BBBBBBBBiiiiiiiinnnnnnnnddddddddiiiiiiiinnnnnnnngggggggg CCCCCCCCoooooooonnnnnnnnssssssssttttttttrrrrrrrraaaaaaaaiiiiiiiinnnnnnnntttttttt

DDDDDDDDeeeeeeeecccccccceeeeeeeemmmmmmmmbbbbbbbbeeeeeeeerrrrrrrr 22222222000000000000000066666666

In a Nutshell

IInn aa NNuuttsshheellll iiiiiiiissssssss ddddddddeeeeeeeessssssssiiiiiiiiggggggggnnnnnnnneeeeeeeedddddddd ttttttttoooooooo ssssssssttttttttiiiiiiiimmmmmmmmuuuuuuuullllllllaaaaaaaatttttttteeeeeeee iiiiiiiinnnnnnnntttttttteeeeeeeerrrrrrrreeeeeeeesssssssstttttttt aaaaaaaannnnnnnndddddddd iiiiiiiinnnnnnnnffffffffoooooooorrrrrrrrmmmmmmmm oooooooonnnnnnnn iiiiiiiissssssssssssssssuuuuuuuueeeeeeeessssssss aaaaaaaannnnnnnndddddddd ttttttttooooooooppppppppiiiiiiiiccccccccssssssss ooooooooffffffff iiiiiiiimmmmmmmmppppppppoooooooorrrrrrrrttttttttaaaaaaaannnnnnnncccccccceeeeeeee ttttttttoooooooo ssssssssuuuuuuuussssssssttttttttaaaaaaaaiiiiiiiinnnnnnnnaaaaaaaabbbbbbbblllllllleeeeeeee

aaaaaaaaggggggggrrrrrrrriiiiiiiiccccccccuuuuuuuullllllllttttttttuuuuuuuurrrrrrrraaaaaaaallllllll ddddddddeeeeeeeevvvvvvvveeeeeeeellllllllooooooooppppppppmmmmmmmmeeeeeeeennnnnnnntttttttt iiiiiiiinnnnnnnn CCCCCCCCaaaaaaaarrrrrrrriiiiiiiibbbbbbbbbbbbbbbbeeeeeeeeaaaaaaaannnnnnnn ccccccccoooooooouuuuuuuunnnnnnnnttttttttrrrrrrrriiiiiiiieeeeeeeessssssss........

TTTTTTTThhhhhhhhiiiiiiiissssssss iiiiiiiissssssss tttttttthhhhhhhheeeeeeee aaaaaaaaggggggggeeeeeeee wwwwwwwwhhhhhhhheeeeeeeerrrrrrrreeeeeeee kkkkkkkknnnnnnnnoooooooowwwwwwwwlllllllleeeeeeeeddddddddggggggggeeeeeeee aaaaaaaannnnnnnndddddddd iiiiiiiinnnnnnnnffffffffoooooooorrrrrrrrmmmmmmmmaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn aaaaaaaarrrrrrrreeeeeeee ccccccccrrrrrrrriiiiiiiittttttttiiiiiiiiccccccccaaaaaaaallllllll ffffffffoooooooorrrrrrrr ssssssssuuuuuuuucccccccccccccccceeeeeeeessssssssssssssss........

IIIIIIIInnnnnnnnffffffffoooooooorrrrrrrrmmmmmmmmaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn iiiiiiiissssssss cccccccceeeeeeeennnnnnnnttttttttrrrrrrrraaaaaaaallllllll ttttttttoooooooo oooooooouuuuuuuurrrrrrrr ddddddddeeeeeeeecccccccciiiiiiiissssssssiiiiiiiioooooooonnnnnnnnssssssss,,,,,,,, ssssssssoooooooocccccccciiiiiiiiaaaaaaaallllllll iiiiiiiinnnnnnnntttttttteeeeeeeerrrrrrrraaaaaaaaccccccccttttttttiiiiiiiioooooooonnnnnnnnssssssss aaaaaaaannnnnnnndddddddd eeeeeeeeccccccccoooooooonnnnnnnnoooooooommmmmmmmiiiiiiiicccccccc

aaaaaaaaccccccccttttttttiiiiiiiioooooooonnnnnnnnssssssss........ IIIIIIIItttttttt iiiiiiiinnnnnnnnffffffffoooooooorrrrrrrrmmmmmmmmssssssss aaaaaaaannnnnnnndddddddd eeeeeeeedddddddduuuuuuuuccccccccaaaaaaaatttttttteeeeeeeessssssss uuuuuuuussssssss ttttttttoooooooo tttttttthhhhhhhhoooooooosssssssseeeeeeee aaaaaaaattttttttttttttttrrrrrrrriiiiiiiibbbbbbbbuuuuuuuutttttttteeeeeeeessssssss tttttttthhhhhhhhaaaaaaaatttttttt wwwwwwwwiiiiiiiillllllll llllllll eeeeeeeemmmmmmmmppppppppoooooooowwwwwwwweeeeeeeerrrrrrrr

aaaaaaaannnnnnnndddddddd eeeeeeeennnnnnnnaaaaaaaabbbbbbbblllllllleeeeeeee uuuuuuuussssssss ttttttttoooooooo ssssssssuuuuuuuussssssssttttttttaaaaaaaaiiiiiiiinnnnnnnn oooooooouuuuuuuurrrrrrrrsssssssseeeeeeeellllllllvvvvvvvveeeeeeeessssssss aaaaaaaannnnnnnndddddddd fffffffflllllllloooooooouuuuuuuurrrrrrrriiiiiiiisssssssshhhhhhhh,,,,,,,, iiiiiiiinnnnnnnnsssssssstttttttteeeeeeeeaaaaaaaadddddddd ooooooooffffffff mmmmmmmmeeeeeeeerrrrrrrreeeeeeeellllllllyyyyyyyy eeeeeeeexxxxxxxxiiiiiiiissssssssttttttttiiiiiiiinnnnnnnngggggggg........

IIIIIIIItttttttt iiiiiiiissssssss tttttttthhhhhhhheeeeeeee ggggggggeeeeeeeennnnnnnneeeeeeeerrrrrrrraaaaaaaallllllll ooooooooppppppppiiiiiiiinnnnnnnniiiiiiiioooooooonnnnnnnn tttttttthhhhhhhhaaaaaaaatttttttt ffffffffaaaaaaaarrrrrrrrmmmmmmmmeeeeeeeerrrrrrrrssssssss aaaaaaaannnnnnnndddddddd ooooooootttttttthhhhhhhheeeeeeeerrrrrrrr ''''''''aaaaaaaaggggggggrrrrrrrriiiiiiiipppppppprrrrrrrreeeeeeeennnnnnnneeeeeeeeuuuuuuuurrrrrrrrssssssss'''''''' kkkkkkkknnnnnnnnoooooooowwwwwwww tttttttthhhhhhhheeeeeeeeiiiiiiiirrrrrrrr

rrrrrrrriiiiiiiisssssssskkkkkkkkssssssss aaaaaaaannnnnnnndddddddd pppppppprrrrrrrraaaaaaaaccccccccttttttttiiiiiiiicccccccceeeeeeee ssssssssoooooooommmmmmmmeeeeeeee ffffffffoooooooorrrrrrrrmmmmmmmm ooooooooffffffff rrrrrrrriiiiiiiisssssssskkkkkkkk mmmmmmmmaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt iiiiiiiinnnnnnnn tttttttthhhhhhhheeeeeeeeiiiiiiiirrrrrrrr ooooooooppppppppeeeeeeeerrrrrrrraaaaaaaattttttttiiiiiiiioooooooonnnnnnnnssssssss........

HHHHHHHHoooooooowwwwwwwweeeeeeeevvvvvvvveeeeeeeerrrrrrrr,,,,,,,, tttttttthhhhhhhheeeeeeee aaaaaaaannnnnnnnnnnnnnnnuuuuuuuuaaaaaaaallllllll iiiiiiiimmmmmmmmppppppppaaaaaaaaccccccccttttttttssssssss ooooooooffffffff ssssssssuuuuuuuucccccccchhhhhhhh ''''''''kkkkkkkknnnnnnnnoooooooowwwwwwwwnnnnnnnn'''''''' aaaaaaaannnnnnnndddddddd eeeeeeeexxxxxxxxppppppppeeeeeeeecccccccctttttttteeeeeeeedddddddd rrrrrrrriiiiiiiisssssssskkkkkkkkssssssss,,,,,,,,

eeeeeeeessssssssppppppppeeeeeeeecccccccciiiiiiiiaaaaaaaallllllll llllllllyyyyyyyy nnnnnnnnaaaaaaaattttttttuuuuuuuurrrrrrrraaaaaaaallllllll eeeeeeeevvvvvvvveeeeeeeennnnnnnnttttttttssssssss,,,,,,,, aaaaaaaarrrrrrrreeeeeeee uuuuuuuussssssssuuuuuuuuaaaaaaaallllllll llllllllyyyyyyyy sssssssseeeeeeeevvvvvvvveeeeeeeerrrrrrrreeeeeeee,,,,,,,, iiiiiiiimmmmmmmmppppppppaaaaaaaaccccccccttttttttiiiiiiiinnnnnnnngggggggg tttttttthhhhhhhheeeeeeee aaaaaaaaggggggggrrrrrrrriiiiiiiipppppppprrrrrrrreeeeeeeennnnnnnneeeeeeeeuuuuuuuurrrrrrrr iiiiiiiinnnnnnnn

mmmmmmmmuuuuuuuucccccccchhhhhhhh tttttttthhhhhhhheeeeeeee ssssssssaaaaaaaammmmmmmmeeeeeeee mmmmmmmmaaaaaaaannnnnnnnnnnnnnnneeeeeeeerrrrrrrr........ TTTTTTTThhhhhhhhiiiiiiiissssssss iiiiiiiimmmmmmmmppppppppllllllll iiiiiiiieeeeeeeessssssss tttttttthhhhhhhhaaaaaaaatttttttt rrrrrrrriiiiiiiisssssssskkkkkkkk mmmmmmmmaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt aaaaaaaannnnnnnndddddddd mmmmmmmmiiiiiiiittttttttiiiiiiiiggggggggaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn

ssssssssyyyyyyyysssssssstttttttteeeeeeeemmmmmmmmssssssss aaaaaaaarrrrrrrreeeeeeee eeeeeeeeiiiiiiiitttttttthhhhhhhheeeeeeeerrrrrrrr nnnnnnnnooooooootttttttt iiiiiiiinnnnnnnn ppppppppllllllllaaaaaaaacccccccceeeeeeee oooooooorrrrrrrr aaaaaaaaddddddddddddddddrrrrrrrreeeeeeeesssssssssssssssseeeeeeeedddddddd oooooooonnnnnnnn aaaaaaaannnnnnnn aaaaaaaadddddddd--------hhhhhhhhoooooooocccccccc bbbbbbbbaaaaaaaassssssssiiiiiiiissssssss........ IIIIIIIInnnnnnnn mmmmmmmmoooooooosssssssstttttttt

ccccccccaaaaaaaasssssssseeeeeeeessssssss,,,,,,,, tttttttthhhhhhhheeeeeeee iiiiiiiissssssssssssssssuuuuuuuueeeeeeee ooooooooffffffff ''''''''rrrrrrrriiiiiiiisssssssskkkkkkkk'''''''' iiiiiiiissssssss nnnnnnnnooooooootttttttt lllllllliiiiiiiinnnnnnnnkkkkkkkkeeeeeeeedddddddd ttttttttoooooooo tttttttthhhhhhhheeeeeeee iiiiiiiissssssssssssssssuuuuuuuueeeeeeee ooooooooffffffff ''''''''ooooooooppppppppppppppppoooooooorrrrrrrrttttttttuuuuuuuunnnnnnnniiiiiiiittttttttyyyyyyyy'''''''' aaaaaaaannnnnnnndddddddd rrrrrrrriiiiiiiisssssssskkkkkkkk

mmmmmmmmaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt,,,,,,,, eeeeeeeessssssssppppppppeeeeeeeecccccccciiiiiiiiaaaaaaaallllllll llllllllyyyyyyyy oooooooonnnnnnnn tttttttthhhhhhhheeeeeeee ffffffffaaaaaaaarrrrrrrrmmmmmmmm,,,,,,,, iiiiiiiissssssss bbbbbbbbaaaaaaaasssssssseeeeeeeedddddddd oooooooonnnnnnnn ttttttttrrrrrrrraaaaaaaaddddddddiiiiiiiittttttttiiiiiiiioooooooonnnnnnnnaaaaaaaallllllll kkkkkkkknnnnnnnnoooooooowwwwwwwwlllllllleeeeeeeeddddddddggggggggeeeeeeee aaaaaaaannnnnnnndddddddd

pppppppprrrrrrrraaaaaaaaccccccccttttttttiiiiiiiicccccccceeeeeeeessssssss,,,,,,,, aaaaaaaannnnnnnndddddddd ttttttttrrrrrrrreeeeeeeeaaaaaaaatttttttteeeeeeeedddddddd mmmmmmmmoooooooorrrrrrrreeeeeeee aaaaaaaassssssss aaaaaaaa ddddddddeeeeeeeeffffffffeeeeeeeennnnnnnnssssssssiiiiiiiivvvvvvvveeeeeeee rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnnsssssssseeeeeeee........

TTTTTTTThhhhhhhhiiiiiiiissssssss iiiiiiiissssssssssssssssuuuuuuuueeeeeeee ddddddddiiiiiiiissssssssccccccccuuuuuuuusssssssssssssssseeeeeeeessssssss rrrrrrrriiiiiiiisssssssskkkkkkkk iiiiiiiinnnnnnnn aaaaaaaaggggggggrrrrrrrriiiiiiiiccccccccuuuuuuuullllllllttttttttuuuuuuuurrrrrrrreeeeeeee,,,,,,,, wwwwwwwwiiiiiiiitttttttthhhhhhhh ssssssssppppppppeeeeeeeecccccccciiiiiiiiaaaaaaaallllllll ffffffffooooooooccccccccuuuuuuuussssssss oooooooonnnnnnnn tttttttthhhhhhhheeeeeeee ffffffffaaaaaaaarrrrrrrrmmmmmmmm........ IIIIIIIItttttttt

ssssssssyyyyyyyynnnnnnnntttttttthhhhhhhheeeeeeeessssssssiiiiiiiisssssssseeeeeeeessssssss tttttttthhhhhhhheeeeeeee wwwwwwwwiiiiiiiiddddddddeeeeeeee bbbbbbbbooooooooddddddddyyyyyyyy ooooooooffffffff llllllll iiiiiiiitttttttteeeeeeeerrrrrrrraaaaaaaattttttttuuuuuuuurrrrrrrreeeeeeee aaaaaaaannnnnnnndddddddd iiiiiiiinnnnnnnnffffffffoooooooorrrrrrrrmmmmmmmmaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn oooooooonnnnnnnn tttttttthhhhhhhhiiiiiiiissssssss ccccccccrrrrrrrriiiiiiiittttttttiiiiiiiiccccccccaaaaaaaallllllll

ttttttttooooooooppppppppiiiiiiiicccccccc iiiiiiiinnnnnnnnttttttttoooooooo aaaaaaaa ssssssssiiiiiiiimmmmmmmmpppppppplllllllleeeeeeee ffffffffoooooooorrrrrrrrmmmmmmmm tttttttthhhhhhhhaaaaaaaatttttttt ccccccccaaaaaaaannnnnnnn bbbbbbbbeeeeeeee mmmmmmmmoooooooorrrrrrrreeeeeeee rrrrrrrreeeeeeeeaaaaaaaaddddddddiiiiiiiillllllllyyyyyyyy uuuuuuuunnnnnnnnddddddddeeeeeeeerrrrrrrrssssssssttttttttoooooooooooooooodddddddd bbbbbbbbyyyyyyyy ssssssssttttttttuuuuuuuuddddddddeeeeeeeennnnnnnnttttttttssssssss

aaaaaaaannnnnnnndddddddd yyyyyyyyoooooooouuuuuuuunnnnnnnngggggggg ffffffffaaaaaaaarrrrrrrrmmmmmmmmeeeeeeeerrrrrrrrssssssss........ IIIIIIIItttttttt aaaaaaaallllllllssssssssoooooooo sssssssseeeeeeeeeeeeeeeekkkkkkkkssssssss ttttttttoooooooo ssssssssttttttttiiiiiiiimmmmmmmmuuuuuuuullllllllaaaaaaaatttttttteeeeeeee tttttttthhhhhhhhiiiiiiiinnnnnnnnkkkkkkkkiiiiiiiinnnnnnnngggggggg aaaaaaaannnnnnnndddddddd mmmmmmmmoooooooorrrrrrrreeeeeeee

ccccccccoooooooonnnnnnnncccccccceeeeeeeerrrrrrrrtttttttteeeeeeeedddddddd aaaaaaaannnnnnnndddddddd ccccccccoooooooollllllll lllllllleeeeeeeeccccccccttttttttiiiiiiiivvvvvvvveeeeeeee aaaaaaaaccccccccttttttttiiiiiiiioooooooonnnnnnnnssssssss aaaaaaaammmmmmmmoooooooonnnnnnnngggggggg tttttttthhhhhhhheeeeeeee mmmmmmmmoooooooorrrrrrrreeeeeeee eeeeeeeexxxxxxxxppppppppeeeeeeeerrrrrrrriiiiiiiieeeeeeeennnnnnnncccccccceeeeeeeedddddddd

aaaaaaaaggggggggrrrrrrrriiiiiiiipppppppprrrrrrrreeeeeeeennnnnnnneeeeeeeeuuuuuuuurrrrrrrrssssssss aaaaaaaannnnnnnndddddddd ppppppppoooooooollllllll iiiiiiiiccccccccyyyyyyyy mmmmmmmmaaaaaaaakkkkkkkkeeeeeeeerrrrrrrrssssssss........

AAAAAAAAnnnnnnnn iiiiiiiinnnnnnnntttttttteeeeeeeerrrrrrrrnnnnnnnneeeeeeeetttttttt sssssssseeeeeeeeaaaaaaaarrrrrrrrcccccccchhhhhhhh wwwwwwwwiiiiiiiillllllll llllllll yyyyyyyyiiiiiiiieeeeeeeelllllllldddddddd aaaaaaaannnnnnnn aaaaaaaallllllllmmmmmmmmoooooooosssssssstttttttt iiiiiiiinnnnnnnn--------eeeeeeeexxxxxxxxhhhhhhhhaaaaaaaauuuuuuuussssssssttttttttiiiiiiiivvvvvvvveeeeeeee llllllll iiiiiiiisssssssstttttttt ooooooooffffffff llllllll iiiiiiiinnnnnnnnkkkkkkkkssssssss ttttttttoooooooo tttttttthhhhhhhheeeeeeee

ttttttttooooooooppppppppiiiiiiiicccccccc........ TTTTTTTThhhhhhhheeeeeeee ffffffffoooooooollllllll lllllllloooooooowwwwwwwwiiiiiiiinnnnnnnngggggggg ppppppppuuuuuuuubbbbbbbbllllllll iiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnssssssss pppppppprrrrrrrroooooooovvvvvvvviiiiiiiiddddddddeeeeeeee uuuuuuuusssssssseeeeeeeeffffffffuuuuuuuullllllll iiiiiiiinnnnnnnnttttttttrrrrrrrroooooooodddddddduuuuuuuuccccccccttttttttiiiiiiiioooooooonnnnnnnnssssssss::::::::

-- IIIIIIIInnnnnnnnttttttttrrrrrrrroooooooodddddddduuuuuuuuccccccccttttttttiiiiiiiioooooooonnnnnnnn ttttttttoooooooo RRRRRRRRiiiiiiiisssssssskkkkkkkk MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt,,,,,,,, UUUUUUUUnnnnnnnniiiiiiiitttttttteeeeeeeedddddddd SSSSSSSSttttttttaaaaaaaatttttttteeeeeeeessssssss DDDDDDDDeeeeeeeeppppppppaaaaaaaarrrrrrrrttttttttmmmmmmmmeeeeeeeennnnnnnntttttttt ooooooooffffffff

AAAAAAAAggggggggrrrrrrrriiiiiiiiccccccccuuuuuuuullllllllttttttttuuuuuuuurrrrrrrreeeeeeee oooooooonnnnnnnn ((((((((hhhhhhhhttttttttttttttttpppppppp::::::::////////////////wwwwwwwwwwwwwwwwwwwwwwww........rrrrrrrrmmmmmmmmaaaaaaaa........uuuuuuuussssssssddddddddaaaaaaaa........ggggggggoooooooovvvvvvvv////////

ppppppppuuuuuuuubbbbbbbbssssssss////////11111111999999999999999977777777////////rrrrrrrriiiiiiiisssssssskkkkkkkkmmmmmmmmggggggggmmmmmmmmtttttttt........ppppppppddddddddffffffff))))))))

-- MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggiiiiiiiinnnnnnnngggggggg HHHHHHHHaaaaaaaazzzzzzzzaaaaaaaarrrrrrrrddddddddssssssss,,,,,,,, RRRRRRRReeeeeeeedddddddduuuuuuuucccccccciiiiiiiinnnnnnnngggggggg RRRRRRRRiiiiiiiisssssssskkkkkkkkssssssss aaaaaaaannnnnnnndddddddd IIIIIIIInnnnnnnnccccccccrrrrrrrreeeeeeeeaaaaaaaassssssssiiiiiiiinnnnnnnngggggggg IIIIIIIInnnnnnnnvvvvvvvveeeeeeeessssssssttttttttmmmmmmmmeeeeeeeennnnnnnnttttttttssssssss iiiiiiiinnnnnnnn

AAAAAAAAggggggggrrrrrrrriiiiiiiiccccccccuuuuuuuullllllllttttttttuuuuuuuurrrrrrrreeeeeeee:::::::: SSSSSSSSoooooooommmmmmmmeeeeeeee PPPPPPPPeeeeeeeerrrrrrrrssssssssppppppppeeeeeeeeccccccccttttttttiiiiiiiivvvvvvvveeeeeeee IIIIIIIIIIIIIIIICCCCCCCCAAAAAAAA--------CCCCCCCCTTTTTTTTAAAAAAAA 22222222000000000000000066666666........

IInn aa NNuuttsshheellll

11

RRiisskk-- UUnnddeerrssttaannddiinngg tthhee CCoonncceepptt In essence, “…there are things we know we know - known

knowns; we know there are some things we do not know - known unknowns; there are the ones we don’t know we don’t know - unknown unknowns.” Donald Rumsfeld

Risk means the possibility of loss or injury” (Websters’ Dictionary) and is “present when future events occur with measurable probability” (Frank H. Knight “Risk, Uncertainty and Profit, 1921)

Risks arise from uncertainty, the inability to foresee the future and from the possibility that alternative and even undesirable outcomes might occur.

An outcome is a consequence, result, or impact of some event, eg. a weather event such as rainfall, unusually hot weather, or high humidity can result in various outcomes for banana production.

Risk begins when “something happens”, an occurrence or event. Events can be external (outside of the entrepreneur’s control) or internal (from decisions made by the

entrepreneur). Risk increases when the probability of events occurring, all their potential outcomes and the cost of their negative outcomes are unknown.

Probability is the likelihood that any outcome will occur, eg., there is a 15, 30, or 60% probability that rain would fall. Probability is central to the definition of risk. As humans and especially as agricultural producers, we deal with and make daily decisions based on the probability, for example, of rain, disease, or achieving high yields.

IInn aa NNuuttsshheellll

22

Risk is not ‘uncertainty’. Uncertainty exists when the likelihood of future events is indefinite or incalculable” [F.Knight, 1921]. Since situations of uncertainty are either too irregular or too unique, uncertainty is not measurable and cannot be quantified or addressed through protective mechanisms. Faced with uncertainty, an entrepreneur must rely on his/her own experience and judgement. That decision can either bring profits or losses.

Risks are unavoidable, but they are manageable. There are risks involved in any investment: risks that the return will be lower than expected and risks that some or all of the money invested will not come back. Risk may not be completely eliminated, but it could be substantially reduced.

Risk can be quantified, either before an event occurs, (a priori), or by empirical observation. When enough instances of a given situation of uncertainty have occurred, enough time would have passed to convince people that the entrepreneur’s judgement is sound. Hence the uncertainty will have been transformed into a risk and can be measured. Measuring risk makes it possible to establish the institutions and protective mechanisms for mitigation.

It is impossible to realise a return on any investment without facing a certain degree of risk. Each

Agricultural entrepreneur (Agripreneur) must determine the ‘acceptable’ risk, based on personal levels of tolerance.

IInn aa NNuuttsshheellll

33

TToolleerraattiinngg RRiisskkss

The Agripeneur’s risk management choices reflect his/her level of risk tolerance. Understanding these choices is important in making risk management decisions that match or closely reflect the tolerance for risk.

..on a Scale of 1-5:

1. Retain – take the risk - push the envelope; make no protective arrangements (as in holding an un-priced commodity);

2. Shift – sell if off - make protective contractual arrangements, where someone else takes on some of the chance of a negative occurrence in exchange for a premium - insurance. The more of the risk that is shifted, the higher the premium.

3. Reduce – prevention is better- using good practices, such as, intercropping, irrigation (eg. instead of rain-fed production), selecting resistant varieties (eg. drought, pest, disease,) or securing marketing contracts to assure some guarantee of sales.

4. Self-insure – save for the rainy day – by keeping emergency reserves from funded from previous years’ profits to mitigate losses without burden a high premium.

5. Avoid – play it safe – by not selecting a particular enterprise; not pushing either end of planting windows; not increasing debt-to-asset ratio beyond your comfort level.

UUnnddeerrssttaannddiinngg rriisskk ttoolleerraannccee aanndd rriisskk mmaannaaggeemmeenntt rreessppoonnsseess aalllloowwss tthhee AAggrriipprreenneeuurr ttoo ((aa))

iiddeennttiiffyy aanndd eexxcclluuddee tthhoossee ooppttiioonnss tthhaatt iinnccrreeaassee eexxppoossuurree ttoo uunnaacccceeppttaabbllee rriisskkss,, ((bb)) sseelleecctt rriisskk mmaannaaggeemmeenntt sseerrvviicceess

tthhaatt bbeesstt ssuuiittss rriisskk ttoolleerraannccee lleevveellss,, ((cc)) ggeett vvaalluuee ffoorr mmoonneeyy ffrroomm iinnssuurraannccee pprreemmiiuummss aanndd tthhuuss sseelleecctt tthhee bbeesstt

ccoommbbiinnaattiioonn ooff rriisskk mmaannaaggeemmeenntt ssttrraatteeggiieess..

IInn aa NNuuttsshheellll

44

RRiisskk aanndd tthhee AAggrriiccuullttuurree BBuussiinneessss The business of agriculture is the cumulative result of decisions made independently by several individuals. They all face risks in investing time, effort and resources in any aspect of the agriculture business. All business starts and expands to make and increase profits. Faced with the absolute unpredictability of things, the entrepreneur’s judgement of risks in the operating environment will determine whether the outcome is profit or loss. Risk has always been a part of the agriculture business. It is present along the entire farm-to-table chain. But Agripreneurs now operate in an entirely new environment: � factors affecting production, supply and trade are substantially different. They go beyond raw materials and prices to technologies, information, product regulations etc;

� the substantial flows of ‘free’ donor funds have receded and are increasingly difficult to attract;

� information and capital are ‘flowing’ faster around the globe, removing

geographic constraints and increasing competition for financing;

� chain consolidation, new product development and new global entrants characterise today’s competitive and integrated world markets.

AAggrriiccuullttuurree ttooddaayy iiss aallrreeaaddyy ffuunnddaammeennttaallllyy ddiiffffeerreenntt tthhaann aa ddeeccaaddee aaggoo.. TThhee aaggrriiccuullttuurree bbuussiinneessss nnooww hhaass

nneeww rruulleess,, nneeww ssttaakkeess.. TThhee AAggrriipprreenneeuurr nnooww hhaass nneeww ooppppoorrttuunniittiieess aanndd mmoosstt ooff aallll,, nneeww rriisskkss!!

IInn aa NNuuttsshheellll

55

AAggrriiccuullttuurree’’ss RRiisskkss

Production Risks: These risks are known and present

in production along the entire supply chain. They affect expected

yields and actual output and impact on income gains or losses.

These include natural events (hurricanes, drought, pests and

diseases), prices (land, labour, equipment, machinery and capital),

standards and regulations (production and process methods,

quality and safety), equipment and technology efficiencies, market

dynamics (increasing scale, specialisation and chain consolidation) and strategic

risks (choosing inappropriate technology).

PPrroodduuccttiioonn rriisskkss ccaannnnoott bbee ccoommpplleetteellyy eelliimmiinnaatteedd,, bbuutt ccoouulldd bbee rreedduucceedd..

Marketing Risks:

These are known and present, especially in handling and

distribution. These include poor market information, marketing

strategies and skills, poor implementation and process

problems in distribution, weather conditions in export markets, disruptions in transportation,

rising costs of business, stringent standards and regulations. The

shift of power to the consumer and a demand-driven chain has escalated

these risks. They cannot be completely eliminated, but could be managed.

SSttrraatteeggiicc mmaarrkkeettiinngg ccaann ccrreeaattee aanndd ssuussttaaiinn ccoonnssuummeerr llooyyaallttyy ttoo aa pprroodduucctt aanndd ttrraannssffoorrmm pprroodduuccttiioonn aaccttiivviittiieess iinnttoo ffiinnaanncciiaall ssuucccceessss..

IInn aa NNuuttsshheellll

66

Institutional Risks: These relate to changes in government

policies and interventions. The structural adjustment programmes of the 1970s

and 1980s were serious national institutional risks which adversely

impacted agriculture in a direct and significant manner in affected Caribbean

countries. Other such risks include the adequacy and efficiency of business

development support for agriculture, including enforcement of safety, quality and environmental regulations and risk mitigation. These risks have legal and

social consequences that affect all investments and operations along the

entire production-marketing chain.

IInnssttiittuuttiioonnaall rriisskkss ggrreeaattllyy aaffffeecctt tthhee AAggrriipprreenneeuurr’’ss ddeecciissiioonn--mmaakkiinngg.

Personal Risks: These risks relate to the impact on

health and physical well-being in the process of carrying out the business of agriculture. Such risks are relatively high on the farm and can arise from

improper use of machinery and chemicals, lack of awareness of safe

practices and unavailability or inappropriateness of protective

equipment. Other human sources of risk are associated with labour and management dis-functions, such as,

health problems and industrial disputes, which disrupt the

production cycle and can lead to losses.

This ranks farm agriculture as among the three most hazardous occupations, alongside mining and construction.

IInn aa NNuuttsshheellll

77

Financial Risks: These risks relate to the ability to meet cash flow needs in a timely manner and to grow equity. They also include the rising costs and

increasing unavailability of financing, investment and capital

and the possibility of partial or full loss from natural or man-made

events. Cash flows are especially important given the variety of ongoing farm obligations (eg. cash input costs,

rentals, tax payments, debt repayment and family living expenses.

Since the substantial contraction of Caribbean traditional agricultural export industries and slow pace of agricultural diversification, it has become increasingly difficult to obtain adequate financing, at reasonable rates and terms,

particularly for primary production.

FFiinnaanncciiaall rriisskkss iinnccrreeaassee iinn tthhee aabbsseennccee ooff aaddeeqquuaattee mmiittiiggaattiinngg mmeecchhaanniissmmss aanndd pprrootteeccttiivvee aarrrraannggeemmeennttss ffoorr tthhee ootthheerr mmaajjoorr rriisskk ccaatteeggoorriieess,, ppaarrttiiccuullaarrllyy pprroodduuccttiioonn rriisskkss..

As Agripreneurs diversify their portfolio, introduce new product lines, enter new markets

and lose the protection of traditional industry barriers, managing risks, averting and reducing financial losses have

become an important part of managing an agricultural business and reducing the risk impact.

Agricultural risks have a significant

impact on investment worthiness and level and stability of earnings. All categories of agricultural risks affect the cost of

production and marketing, the price of the product and income derived from its sale. In all cases, the seriousness of

the risk depends on the nature and magnitude of the possible end consequences and their probabilities.

IInn aa NNuuttsshheellll

88

RRiisskk -- UUnnddeerrssttaannddiinngg tthhee IImmppaacctt Risks exist in all activities, at all levels of the agriculture value and supply chain. But the nature of the risk and the impact on the chain can lead to variable consequences and outcomes.

Who? ▪ The Individual. Such risks are isolated to an individual business. They will have adverse consequences on the enterprise, they may not necessarily affect the entire industry, chain or sector.

When? ▪ Everyday. Business faces normal risks on a regular basis. These risks may be short-lasting, such as, bad weather, fire, disease, poor equipment, industrial disputes, price spikes, loss of markets, product recalls, disruptions in export transportation, etc. However, over time, frequent and/or repeated occurrences will affect the profitability of a business.

Where? � The Industry/Chain. These risks can have an adverse impact on an individual farm/firm, an entire industry and in extreme cases, an entire chain and sub-sector (if a major industry eg. bananas). Such risks (pests, free trade agreement)

may originate from an external source (other country), with widespread and longer-lasting negative effects. How? ▪ Unexpected and Extreme. These risks can occur suddenly (Avain flu influenza, hurricane or volcano). They effects on the entire industry or sub-sector can be rapid and destructive, requiring an extreme response (such as total destruction of Avian Flu infected flock),

with long-term impacts on economic viability. These risks are, however, are generally rare.

IInn aa NNuuttsshheellll

99

MMaannaaggiinngg AAggrriiccuullttuurree’’ss RRiisskkss

In today’s environment, opportunities have increased, but so have the risks. Risk management must become a key element of the ‘new’ agriculture. Risk management means engaging in agriculture with confidence in a rapidly changing world.

Agripreneurs make decisions in a risky, ever changing environment. The consequences of their decisions are generally not known when these decisions are made, and outcomes may be better or worse than expected. Risky situations of concern are typically those in which there is a high possibility of adverse consequences, which, if they occur, would cause significant disruptions. Agripreneurs generally do not get into

risky situations unless there is a probability of making profits. Higher profits are typically associated with higher risks. It is to their advantage that these risky, but potentially profitable situations be managed as carefully as possible. The two primary aspects of risk management are: 1) anticipating that an unfavourable

event may occur and acting to reduce the probability of its occurrence; and

2) taking actions which will reduce the adverse consequences should the unfavourable event occur.

EEffffeeccttiivvee rriisskk mmaannaaggeemmeenntt iinnvvoollvveess aannttiicciippaattiinngg ppoossssiibbllee ddiiffffiiccuullttiieess aanndd ppllaannnniinngg ttoo rreedduuccee tthheeiirr

ccoonnsseeqquueenncceess.. EEffffeeccttiivvee rriisskk mmaannaaggeemmeenntt iiss nnoott aabboouutt rreeaaccttiinngg ttoo uunnffaavvoouurraabbllee eevveennttss aafftteerr tthheeyy ooccccuurr..

IInn aa NNuuttsshheellll

1100

RRiisskk MMaannaaggeemmeenntt –– oonn tthhee FFaarrmm Farmers, as managers, have the primary responsibility for managing the risks associated with their business. The typical farmer worldwide engages in a range of risk reduction activities but the choices and mix of options will depend on the specific situation.

Diversification Diversification - the combining of

different production options - is by its nature, a defensive strategy. It is

an effective way to reduce large year-to-year fluctuations in income

and financial risks. It can ensure adequate cash flow for meeting

production costs, debt obligations and family living expenses. However,

diversification is becoming increasingly costly, as capital

investment requirements become greater.

Insurance Management of yield or price risk, through crop insurance, shifts the

Agripreneur’s risk to others for a price, i.e., the insurance premium. Crop

insurance is a risk management tool that reduces the direct losses to the

producer and offers the opportunity for more consistent gains. Its benefits

include ensuring a reliable level of cash flow and allowing more flexibility in

business and marketing plans. If some part of the expected

production can be insured, then that part can be forward-priced with

greater certainty, creating a more predictable level of revenue.

IInn aa NNuuttsshheellll

1111

>>Risk Management – on the Farm

Contract Production Contract production is normally

associated with vertical integration, i.e., to coordinate all aspects of

production from farm to table. This is common in the poultry and livestock industries. A major advantage for the farm producer is that a market for the output and, often, a favorable price is

guaranteed. It also protects against future price reductions. A disadvantage

is that the producer loses the opportunity of benefiting from the

potential for future price increases, since the sale of the product is fixed by the contract. The loss of flexibility and

potential profit opportunities is the cost of receiving a predictable market for

sale of product and cash flow.

Innovation and New Technologies The science of crop and livestock production has evolved, offering

unprecedented possibilities, through innovation and new technologies.

Among these, agro-biotechnologies are seen as instruments for raising

productivity/yields and achieving competitiveness. For farmers who are

innovative and adopt new technologies, the potential benefits

include lower input costs, higher yields due to improved pest and disease control and varieties, more cost-

effective use of inputs and enhanced environmental quality. However, new

technologies must be evaluated to determine their appropriateness before

are they adopted.

IInn aa NNuuttsshheellll

1122

>>Risk Management – on the Farm

Management Plans Risk management risk begins with

sound integrated farm management planning which must define the goals and objectives of the enterprise and

develop business and marketing plans. A good understanding of production costs and marketing strategies are a

critical part of a sound farm management. Management decisions should consider the impacts they will

have on the production, financial, legal and human resource aspects of the

business. A strong business and marketing plan can significantly improve the possibilities for

accessing financing and investment.

Associations and Cooperatives Forming and participating in

associations and cooperatives provide members the opportunity to benefit from collective actions, such

as, joint input purchasing and marketing, obtaining financing and risk-sharing. Benefits may be in the form of enhanced stability of prices and incomes or reduced costs of risk

management. There has been an increased interest in cooperatives in

all aspects of the agriculture business as a risk management

strategy.

RRiisskk iinn aaggrriiccuullttuurree,, eessppeecciiaallllyy oonn tthhee ffaarrmm,, iiss mmoorree pprrooffoouunndd iinn tthhee ffoooodd cchhaaiinn.. BBuutt rriisskkss aarree aallssoo lliinnkkeedd ttoo ooppppoorrttuunniittiieess.. IInn aann eennvviirroonnmmeenntt ooff lleessss ggoovveerrnnmmeenntt iinntteerrvveennttiioonnss ((ssuuppppoorrtt)) aanndd mmoorree pprroodduucctt rreegguullaattiioonnss,, eeffffeeccttiivvee rriisskk mmaannaaggeemmeenntt ssttrraatteeggiieess aarree aann eesssseennttiiaall ccoonnddiittiioonn ffoorr ssuucccceessssffuull aanndd ccoommppeettiittiivvee eenntteerrpprriisseess,, ffiirrmmss aanndd iinndduussttrriieess iinn aaggrriiccuullttuurree..

In a Nutshell IInn aaggrriiccuullttuurree,, rriisskkss aarree uunnaavvooiiddaabbllee aanndd aarree pprreesseenntt aalloonngg tthhee eennttiirree ffaarrmm--ttoo--ttaabbllee vvaalluuee

cchhaaiinn..

Farmers, food processors, wholesalers, retailers, exporters, distributors, restaurants and any entrepreneur involved in the agriculture business has a responsibility to manage these risks.

In managing risks in agriculture, Agripreneurs must clearly:

- establish goals and priorities for their business in the face of risk and uncertainty;

- identify the sources and characteristics of their major risks;

- determine their levels of acceptable risks and tolerance to these risks;

- understand the potential impacts of these risks on the comparative advantage and competitive potential of their business;

- decide on the mix of management options that can be taken to substantially reduce these risks;

- identify actions needed by others, such as, the

specific industry, government, private financial institutions (eg. insurance, farmer pensions) etc, to complement the agripreneurs' risk tolerance levels and personal risk management plans.

By taking these and other complementary actions, risks can be quantified and although they are unavoidable, risks can be managed.

SSiinnccee rriisskk aanndd ooppppoorrttuunniittiieess aarree lliinnkkeedd,, tthhiinnkkiinngg aabboouutt rriisskk ccaann pprroovviiddee uusseeffuull iinnssiigghhtt iinnttoo wwhheerree ooppppoorrttuunniittiieess ffoorr aaggrriiccuullttuurree mmaayybbee ffoouunndd..

IInn aa NNuuttsshheellll

22

Issue #12 December 2006

ISSN-0245-4746 A2/TT/05/06

Prepared by the Trade Policy and Negotiations Programme

IICA Caribbean

Diana Francis Regional Specialist

and

Richard Rampersaud Research Assistant

Caribbean Regional Agricultural Policy Network (CaRAPN)

Printing: CTP Services & Supplies

This issue is printed with financing from the

Technical Centre for Agricultural and Rural Cooperation

For more information, please contact:

INTER-AMERICAN INSTITUTE FOR COOPERATION ON AGRICULTURE

OFFICE IN TRINIDAD AND TOBAGO #3 Herbert Street, Newtown, P.O.Box, 1318

Port of Spain, Trinidad and Tobago Tel: (868) 628-4403; 4079; 4079