Post on 24-May-2020
transcript
STRUCTURAL, PHYSIOLOGICAL AND
MOLECULAR CHARACTERISATION OF THE
AUSTRALIAN NATIVE RESURRECTION
GRASS TRIPOGON LOLIIFORMIS
(F.MUELL.) C.E.HUBB. DURING
DEHYDRATION AND REHYDRATION
Mohammad Reza Karbaschi
Submitted in fulfilment of the requirements for the degree of
Doctor of Philosophy
Centre for Tropical Crops and Biocommodities
Science and Engineering Faculty
Queensland University of Technology
November 2015
Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration i
Keywords
Arabidopsis thaliana; Agrobacterium-mediated transformation; Anatomy;
Anti-apoptotic proteins; BAG4; Escherichia coli; Bulliform cells; C4 photosynthesis;
Cell wall folding; Cell membrane integrity; Chaperone-mediated autophagy;
Chlorophyll fluorescence; Hsc70/Hsp70; Desiccation tolerance, Dehydration;
Drought; Electrolyte leakage; Freehand sectioning; Homoiochlorophyllous; Leaf
structure; Leaf folding; Reactive oxygen species (ROS); Resurrection plant;
Morphology; Monocotyledon; Nicotiana benthamiana; Photosynthesis; Physiology;
Plant tissue; Programed cell death (PCD); Propidium iodide staining; Protein
microarray chip; Sclerenchymatous tissue; Stress; Structure; Tripogon loliiformis;
Ubiquitin; Vacuole fragmentation; Kranz anatomy; XyMS+;
ii Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration
Abstract
Plants, as sessile organisms must continually adapt to environmental changes.
Water deficit is one of the major environmental stresses that affects plants. While
most plants can tolerate moderate dehydration (leaf water potential from -5 to -10
MPa) a small group of vascular plants can tolerate desiccation to an air-dry state (-
100 MPa) and beyond. Since the initial discovery of desiccation-tolerance in plants
in 1912 by Irmscher, scientists and plant botanists world-wide have been fascinated
by these unique plants, particularly how these land-plants can tolerate desiccation
and resurrect. Tripogon loliiformis is a largely uncharacterised Australian
desiccation-tolerant grass that resurrects from the desiccated state within 72 hours.
The work performed in this thesis involved a combination of structural, physiological
and molecular techniques to investigate the unique structural, physiological and
molecular features that enable T. loliiformis, and potentially other resurrection plants,
to tolerate desiccation. The molecular studies were performed using high-throughput
protein microarray technology which provided a platform for comparative analysis of
potential protein-protein interacting partners with the pro-survival/anti-apoptotic
protein, Bcl-2 associated athanogene 4 (BAG4). In addition to analysis of the BAG4
protein from Arabidopsis, a novel orthologue of AtBAG4 was isolated from T.
loliiformis and expressed, thus allowing an investigation of the roles of this protein
between desiccation sensitive (A. thaliana) and tolerant (T. loliiformis) plants.
Key observations included; i) a myriad of structural changes such as leaf
folding, cell wall folding and vacuole fragmentation that mitigate desiccation stress,
ii) potential role of sclerenchymatous tissue within rapid leaf folding and light
protection, iii) retention of approximately 70 % chlorophyll in the desiccated state,
iv) early shutdown of photosynthesis, 50 % at 80 % relative water content (RWC)
and ceasing completely at 70 % RWC, v) the possible contribution of bulliform cells
in leaf folding, water reserve and a key role in photosynthesis shut down by
dehydration, vi) a sharp increase in electrolyte leakage during dehydration, vii)
confirmation of membrane integrity by propidium iodide staining throughout
dehydration, desiccation and rehydration, and viii) the molecular demonstration of a
large number of proteins that possibly interact with BAG4 which mostly are related
Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration iii
to carbohydrate pathways involved in autophagy. Taken together, these results
demonstrate that T. loliiformis implements a range of structural and physiological
mechanisms, both early on and throughout the drying, that protect tissues from
mechanical, oxidative and irradiation stress. These results confirm that resurrection
plants actively participate in stress tolerance and provide insights into tolerance
mechanisms utilized by these unique land-plants for potential utilization in
enhancement of stress-tolerance in crop plants.
The protein results from protein microarray chip demonstrated that BAG4 has
anti-apoptotic properties due to its interaction with a large number of proteins
involved in autophagy (particularly carbohydrates). Detoxification and recycling of
damaged and unwanted proteins result in recovery of the cells and prevent apoptosis.
More proteins interacted with the TlBAG4 compared with AtBAG4 which might
suggest that the more binding sites exist on BAG4 from this resurrection plant which
in return might contribute in desiccation-tolerance. Although the exact involvement
of BAG4 protein with other proteins and its true involvement in autophagy remained
to be explored, this project for the first time suggested a potential role for BAG4 in
plant autophagy pathways. Furthermore, the data generated from the protein-protein
interaction of BAG4 using high-density protein microarrays provided a valuable
resource for uncovering the mechanisms/pathways that this protein influences for
future research.
iv Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration
Table of Contents
Keywords ................................................................................................................................................. i
Abstract ................................................................................................................................................... ii
Table of Contents ................................................................................................................................... iv
List of Figures ....................................................................................................................................... vii
List of Tables ......................................................................................................................................... ix
List of Abbreviations .............................................................................................................................. x
Statement of Original Authorship ........................................................................................................ xiv
Acknowledgements ............................................................................................................................... xv
CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW ................................................. 1
1.1 Introduction.................................................................................................................................. 1
1.2 Classification of land Plants based on their tolerance toward water deficit ................................. 2
1.3 Desiccation tolerance in plants .................................................................................................... 3 1.3.1 Evolutionary aspects ......................................................................................................... 3 1.3.2 Geographic distribution and ecology ................................................................................ 3 1.3.3 Desiccation-tolerant plants types ...................................................................................... 6
1.4 Impacts of water deficit on plants .............................................................................................. 11 1.4.1 Plant responses to water deficit ...................................................................................... 11 1.4.2 Water deficit response characteristics common among all plants .................................. 12
1.5 Structural aspects ....................................................................................................................... 12 1.5.1 Leaf surface structures .................................................................................................... 12 1.5.2 Reducing leaf surface area .............................................................................................. 13 1.5.3 Xylem tissue (in stem and root) ...................................................................................... 15
1.6 Physiological aspects ................................................................................................................. 16 1.6.1 Reactive oxygen species ................................................................................................. 16 1.6.2 Photosynthesis ................................................................................................................ 17 1.6.3 Respiration ...................................................................................................................... 18
1.7 Molecular responses to water deficit in plants ........................................................................... 19 1.7.1 Molecular responses to water deficit in desiccation-tolerant plants ............................... 19 1.7.2 Regulatory ...................................................................................................................... 20 1.7.3 Antioxidants ................................................................................................................... 21 1.7.4 Carbohydrates level in desiccation tolerant plants in resurrection plants ....................... 22 1.7.5 Proline and proteins ........................................................................................................ 25
1.8 Tripogon loliiformis (F.Muell.) C.E.Hubb. a native Australian resurrection grass .................... 28 1.8.1 Australian resurrection plants ......................................................................................... 28 1.8.2 Tripogon Roem. & Schult a genus of true grasses......................................................... 30 1.8.3 Tripogon loliiformis (F.Muell.) C.E.Hubb an Australian resurrection grass .................. 33
1.9 BAG, a family of pro-survival proteins ..................................................................................... 36 1.9.1 In animals ....................................................................................................................... 37 1.9.2 In plants .......................................................................................................................... 37
1.10 Conclusion, aims and objectives ................................................................................................ 38 1.10.1 Aims ............................................................................................................................... 38 1.10.2 Objectives ....................................................................................................................... 39
CHAPTER 2: GENERAL MATERIALS AND RESEARCH DESIGN........................................ 41
2.1 Research Design ........................................................................................................................ 41 2.1.1 Structural experiments .................................................................................................... 41
Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration v
2.1.2 Physiological experiments .............................................................................................. 44 2.1.3 Molecular experiments ................................................................................................... 46
2.2 General Materials ....................................................................................................................... 49 2.2.1 Sources of specialised reagents ....................................................................................... 49 2.2.2 Oligodeoxyribonucleotide synthesis ............................................................................... 49 2.2.3 Bacterial strains .............................................................................................................. 49 2.2.4 List of general solutions .................................................................................................. 49 2.2.5 Plant material .................................................................................................................. 50
CHAPTER 3: TRIPOGON LOLIIFORMIS DISPLAYS STRUCTURAL FEATURES AND
CHANGES THAT PROTECT IT DURING DEHYDRATION ..................................................... 53
3.1 Introduction ................................................................................................................................ 53 3.1.1 Structural features ........................................................................................................... 53 3.1.2 Structural changes ........................................................................................................... 53
3.2 Materials and methods ............................................................................................................... 54 3.2.1 Plant materials ................................................................................................................ 54 3.2.2 Methods .......................................................................................................................... 55
3.3 Results ........................................................................................................................................ 56 3.3.1 General structural observations ...................................................................................... 56 3.3.2 Structural changes ........................................................................................................... 63
3.4 Discussion .................................................................................................................................. 68
CHAPTER 4: PHYSIOLOGICAL RESPONSES OF TRIPOGON LOLIIFORMIS LEAVES
DURING DEHYDRATION AND REHYDRATION ...................................................................... 73
4.1 Introduction ................................................................................................................................ 73
4.2 Materials and methods ............................................................................................................... 74 4.2.1 Plant materials and dehydration and rehydration treatment ............................................ 74 4.2.2 Methods .......................................................................................................................... 74
4.3 Results ........................................................................................................................................ 76 4.3.1 Leaf water status and pigmentation ................................................................................ 76 4.3.2 Chlorophyll a fluorescence ............................................................................................. 77 4.3.3 Estimation of the membrane integrity............................................................................. 80 4.3.4 Photosynthesis rate ......................................................................................................... 83
4.4 Discussion .................................................................................................................................. 85
CHAPTER 5: PROTEIN-PROTEIN INTERACTION PROFILE OF BAG4 SUGGESTS A
POSSIBLE ROLE WITHIN CHAPERONE-MEDIATED AUTOPHAGY .................................. 90
5.1 Introduction ................................................................................................................................ 90 5.1.1 Programmed cell death ................................................................................................... 90 5.1.2 BAG4 .............................................................................................................................. 91 5.1.3 Protein microarray .......................................................................................................... 92
5.2 Materials and methods ............................................................................................................... 93 5.2.1 Polymerase chain reaction (PCR) ................................................................................... 95 5.2.2 Agarose gel electrophoresis ............................................................................................ 95 5.2.3 AtBAG4 and TlBAG4 .................................................................................................... 95 5.2.4 Preparation of bacterial glycerol stock ........................................................................... 96 5.2.5 Extracting plasmid DNA (Mini prep) ............................................................................. 96 5.2.6 Plasmid TOPO
® Cloning ................................................................................................ 97
5.2.7 Transformation of bacteria.............................................................................................. 99 5.2.8 Restriction enzyme digestion of plasmid DNA .............................................................. 99 5.2.9 Agrobacterium-infiltration of Nicotiana tabacum and N. benthamiana ....................... 100 5.2.10 Histochemical GUS assay ............................................................................................. 100 5.2.11 Protein extraction .......................................................................................................... 100 5.2.12 SDS PAGE ................................................................................................................... 101 5.2.13 Coomassie blue staining ............................................................................................... 101 5.2.14 Western blotting ........................................................................................................... 102
vi Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration
5.2.15 Protein microarray hybridisation (probing) and scanning ............................................ 102 5.2.16 Statistical analysis ........................................................................................................ 103 5.2.17 Bioinformics analysis ................................................................................................... 103 5.2.18 Quantitative real-time PCR analysis ............................................................................. 104
5.3 Results ..................................................................................................................................... 105 5.3.1 Generation of constructs for Agrobacterium-infiltration .............................................. 105 5.3.2 Agrobacterium transformation and infiltration of tobacco and N. benthamiana .......... 107 5.3.3 Protein extraction and purification ............................................................................... 109 5.3.4 Protein microarray hybridisation (probing) and scanning ............................................ 109 5.3.5 Statistical and bioinformatics analysis .......................................................................... 113 5.3.6 Generation of constructs for Agrobacterium-infiltration .............................................. 116
5.4 Discussion ................................................................................................................................ 118
CHAPTER 6: GENERAL DISCUSSION ...................................................................................... 125
6.1 Introduction.............................................................................................................................. 125
6.2 Structural and physiological features and changes of T. loliiformis leaves are to minimise
mechanical and oxidative stress dehydration and rehydration ............................................................ 125 6.2.1 Bulliform cells appear to play a significant role in gas exchange and leaf folding
during dehydration ........................................................................................................ 126
6.3 Tripogon loliiformis maintains its cellular integrity during dehydration and rehydration ....... 128 6.3.1 Increase electrolyte leakage is perhaps due to breakdown of macromolecules as
the result of autophagy during dehydration .................................................................. 129 6.3.2 Reduction of photosynthesis during early stages of dehydration plays a key role
in activation of autophagy procedure and increase in EL ............................................. 130 6.3.3 Plasma membrane is protected from mechanical damage during dehydration ............. 130 6.3.4 The possible protection of mitochondria structure during dehydration and
rehydration .................................................................................................................... 133
6.4 Protein-protein interaction profile of BAG4 suggest a key role in autophagy ......................... 134
6.5 Summary .................................................................................................................................. 136
REFERENCES .................................................................................................................................. 138
APPENDICES ................................................................................................................................... 156 Appendix A: Enriched GO terms for AtBAG4 and TlBAG4 .................................................. 156
Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration vii
List of Figures
Figure 1: The classification of the land plants (embryophytes) based on water deficit
tolerance and classification of desiccation-tolerant plants. ............................................... 5
Figure 2: A schematic structure of C4 (Kranz) type XyMS+. ......................................................... 32
Figure 3: A schematic demonstration of enzyme compartmentalisation and structural
characteristics in C4 biochemical NAD-ME type photosynthesis. ................................. 32
Figure 4: Distribution of Tripogon loliiformis in Australia (Orchard and Wilson, 2005). ............ 33
Figure 5: The top panel shows Tripogon loliiformis in its natural habitat while the bottom
panel shows this plant grown from seeds in glasshouse in in 65mm pots. ..................... 35
Figure 6: Freehand transverse sections of hydrated and dehydrated leaves of Tripogon
loliiformis leaves.................................................................................................................. 60
Figure 7: Environmental scanning electron microscopy (ESEM) images of representative
hydrated leaves of Tripogon loliiformis. ............................................................................ 61
Figure 8: Difference between the process of leaf folding in middle and base of fully grown
Tripogon loliiformis leaves using environmental scanning electron microscopy
(ESEM). ............................................................................................................................... 65
Figure 9: Differences in internal and external structures from apical to basal regions of
Tripogon loliiformis leaves. ................................................................................................ 66
Figure 10: Changes in internal structure and chlorophyll content during dehydration and
rehydration of Tripogon loliiformis leaves. ....................................................................... 67
Figure 11: Changes in water content during dehydration and rehydration in Tripogon
loliiformis leaves.................................................................................................................. 78
Figure 12: Changes in chlorophyll fluorescence during dehydration and rehydration in
Tripogon loliiformis leaves. ................................................................................................ 78
Figure 13: Demonstrating cell membrane integrity in leaves using conductivity
measurement during dehydration and rehydration in Tripogon loliiformis
leaves. .................................................................................................................................. 81
Figure 14: Confocal laser-scanning microscopy of propidium iodide (PI) stained
hydrated, dehydrated (air-dry), rehydrated and control leaves of Tripogon
loliiformis. ............................................................................................................................ 82
Figure 15: Changes in photosynthetic rate during dehydration and rehydration in
Tripogon loliiformis. ........................................................................................................... 84
Figure 16: The experimental design of molecular work procedure. ............................................... 94
Figure 17: The position of the gene in pYL436 vector after cloning. .............................................. 98
Figure 18: Restriction enzyme digestion of the pENTR and pYL436 for verification of the
insertion of the constructs. ............................................................................................... 106
Figure 19: Determination of the optimal Agrobacterium-transient expression system. .............. 108
Figure 20: Peptide construct before and after isolation. ................................................................ 110
Figure 21: Verification of expression, extraction and isolation of target proteins using
Coomassie blue staining and Western blotting. ............................................................. 111
Figure 22: The procedure of protein microarray chip hybridisation. .......................................... 112
Figure 23: The scanned Arabidopsis thaliana protein microarray slides hybridised with
AtBAG4 and TlBAG4 constructs. ................................................................................... 114
viii Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration
Figure 24: qRT- PCR results of TlBAG4 during dehydration and rehydration in Tripogon
loliiformis........................................................................................................................... 117
Figure 25: Comparison between human BAG4 BAG domain (hBAG4 BD) and
Arabidopsis thaliana BAG4 BAG domain (AtBAG4 BD). ............................................. 120
Figure 26: A schematic illustration of protein-protein interaction of AtBAG4 based on
experimental proven and bioinformatics prediction data based on string-
db.org. ............................................................................................................................... 121
Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration ix
List of Tables
Table 1: The best studied angiosperm resurrection plants [modified from Bartels and
Hussain (2011)]: .................................................................................................................... 9
Table 2: The occurrence of resurrection plants in various genera and families among
Australian angiosperms (Gaff, 1981). ............................................................................... 29
Table 3: Abbreviations and location/section of Tripogon loliiformis leaf structures ..................... 58
Table 4: The density of stomatal complex, gland and prickle hair on adaxial and abaxial
surface of the leaf per mm2. ............................................................................................... 62
Table 5: The sequences of primers used for amplification of AtBAG4, TlBAG4 and
forward and reverse universal M13 primers used for sequencing. ................................ 96
Table 6: The comparison between the number of spots with significant signal values
between AtBAG4 and TlBAG4 hybridised Arabidopsis thaliana protein results. ....... 115
Table 7: The pathway enrichment analysis of proteins with significant signal values from
AtBAG4 and TlBAG4 microarray protein results. ....................................................... 115
x Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration
List of Abbreviations
aa= amino acid(s)
APX = ascorbate peroxidase
ATP = adenosine-5’-triphosphate
bp = basepair(s)
CaMV = Cauliflower mosaic virus
cDNA = complementary DNA
CMA = Chaperone-mediated autophagy
CTCB = Centre for Tropical Crops and Biocommodities
dH2O = distilled water
DMSO = dimethyl sulfoxide
DNA = deoxyribonucleic acid
DT= desiccation tolerant
DTT = 1,4-dithiothreitol
DW = dry weight
EDTA = ethylenediaminetetraacetic acid
E. coli = Escherichia coli
EL = electrolyte leakage
ESEM= Environmental scanning electron microscopy
FAO = Food and Agriculture Organization
Fv/Fm = maximum photochemical quantum yield of Photosystem II
FW/DW = fresh-dry weight ratio
GFP = green fluorescent protein
GPS= global position satellite
LB = Luria-Bertani
mRNA = messenger RNA
MPa= megapascal
MS = Murashige & Skoog
NAD-ME= nicotinamide adenine dinucleotide-malic enzyme
N-terminal = amino-terminal
PBS = phosphate buffered saline
PCR = polymerase chain reaction
Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration xi
pH = log (proton concentration)
PI = propidium iodide
qRT-PCR = quantitative reverse transcription polymerase chain reaction
QUT = Queensland University of Technology
RPM = rounds per minute
RNA = ribonucleic acid
RNase = ribonuclease
ROS = reactive oxygen species
Rubisco = ribulose-1,5-bisphosphate carboxylase/oxygenase
RWC = relative water content
SDS = sodium dodecyl sulphate
SOD= superoxide dismutase
TE = Tris-EDTA
TEMED = Tetramethylethylenediamine
TW = turgid weight
Tween 20 = polyoxyethylene (20) sorbitan monolaurate
UV = ultra violet
WT = wild type
Plant structures:
ew = Epicuticular wax
bu = Bulliform cell
g = Gland
lo = Long cell
pa = Papilla
pr = Prickle hair
pr-bc = Prickle-hair basal cell
si-s = Saddle silica-cell
st = Stomatal complex
sh-n = Nodular short-cell
bs = Bundle sheath
m = Mesophyll
mv = Metaxyleme vessel
xii Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration
s = Sclerenchyma
p = Phloem
x = Xylem
XyMS+= Xylem mestome present
Units:
cm = centimetre(s)
⁰C = degree Celsius
d = day(s)
kDa = kilo Dalton(s)
g = gram(s)
h/hrs = hour(s)
l = litre(s)
M = molar
m = meter(s)
MW = molecular weight
min = minute(s)
mol = mole(s)
s = second(s)
V = volt(s)
vol = volume(s)
v/v = volume per volume
W = watt
w/v = weight per volume
Prefixes:
K = kilo
m = milli
μ = micro
n = nano
Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration xiii
xiv Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration
Statement of Original Authorship
The work contained in this thesis has not been previously submitted to meet
requirements for an award at this or any other higher education institution. To the
best of my knowledge and belief, the thesis contains no material previously
published or written by another person except where due reference is made.
Signature:
Date: _________________________
QUT Verified Signature
Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration xv
Acknowledgements
I wish to thank my supervisory team Professor Sagadevan G. Mundree, Dr
Tanya Scharaschkin and Dr Brett Williams who are not only fantastic supervisors but
also I consider them my family. There are no words that I can sufficiently use to
express my gratitude towards them. They changed me for ever. Sagadevan, you are a
special person from whom I have learnt a lot, you are a role model in many aspects
of my life. Tanya, it was from you that I learnt scientific thinking and discipline. You
helped me to start my scientific journey. Brett, a true blue mate. You are like a
brother to me and I always admire your intelligence, gentle, down-to-earth
personality and no ego.
My special thanks go to Professor Emeritus Acram Taji who was like an angel
in my life, coming up with a miracle each time and saving me whenever I was in
trouble. I remember I was reading your books in Iran and asking myself would it be
possible if I would ever meet you… who would have thought that you would become
the reason I undertook my PhD.
There are a number of the people who were my closest friend who were there
whenever I needed help and with them I was most comfortable, Grace, Isaac, Karma,
Melody, My Linh, Purnika, Thita, Trang and the rest of M5 gang, H1 friends and
abiotic friendly stress group . I hope that I will always have such good friends near
me, friends are relatives that you choose.
There are so many people in the lab that I would like to thank. Hao who was
my big brother in the lab, Maiko a friendly protein advisor, Dani the queen of the lab
and so many other colleagues who helped me whenever I was lost in the lab.
Finally and most of all, I would like to thank my parents who because of them I
was able to carry on with this course and complete this thesis.
Thank you all!
xvi Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon
loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration
Chapter 1: Introduction and Literature Review 1
Chapter 1: Introduction and Literature
Review
1.1 INTRODUCTION
At any given time, in any given year, there is always a part of the world that
is drought-declared. Combined with the additional pressure of feeding an ever
increasing global population that is expected to exceed nine billion by 2050
(Maxwell and Johnson, 2000), food security has become arguably one of the most
talked-about global concerns. More than one-third of the land in the world is located
in arid and semi-arid climates and in many countries, such as Australia, drought is
the major limitation for crop production (Gaff, 1981;Ali and Talukder, 2008). One
way to enhance food production during drought is to develop resilient crops. Genetic
engineering has emerged as a possible tool to produce drought-tolerant crops by
incorporating genes from plants which are able to tolerate drought into otherwise
susceptible crop plants (Ewen and Pusztai, 1999).
While most terrestrial plants are vulnerable to dehydration, certain plants
called “resurrection plants” can withstand periods of water deficit. The term
“resurrection plant” refers to those plants that use complex mechanisms that enable
them to lose over 85 % of their water and remain dormant until receiving water
(Gaff, 1971). There has been much interest in resurrection plants because they have
the potential to provide insights into drought-tolerance mechanism which has the
potential to be applied to agricultural crops.
Although molecular, physiological and to a lesser extent, structural responses
of resurrection plants to dehydration have been studied since 1912 (Irmscher), most
research has been limited to a small number of species, and these have been mainly
from southern Africa. Studying the resurrection behaviour of other species can
provide scientists with a new window of opportunity to understand this unique trait.
This PhD project examined one such species, T. loliiformis (F.Muell.) C.E.Hubb, that
is indigenous to Australia.
2 Chapter 1: Introduction and Literature Review
Tripogon loliiformis (family Poaceae) is an annual to short-lived perennial
resurrection grass (Gaff, 1981;Peterson et al., 2010). There has been very little
research carried out on this resurrection plant and our knowledge is limited mostly to
some ecological and general physiological studies (Gaff and Latz, 1978;Gaff and
McGregor, 1979;Gaff, 1981). Tripogon loliiformis possesses remarkable
characteristics that make it an ideal candidate as an experimental model for studying
the dehydration and rehydration responses (discussed at 1.8).
The aim of this study was to investigate the anatomical and physiological
response mechanisms of T. loliiformis during various stages of dehydration and
rehydration. Furthermore, a T. loliiformis orthologue of the well characterised anti-
apoptosis protein BAG4 (AtBAG4) from Arabidopsis thaliana was used in a protein
microarray for a comparative study with BAG4 from T. loliiformis (TlBAG4) in
order to understand the molecular interaction profile of this protein and to compare
the difference between TlBAG4 and AtBAG4. The outcomes of this project could
help provide further insight into abiotic stress tolerance and desiccation-tolerance
mechanisms. These outcomes also will be used as a platform for future studies on
this plant and could possibly be used to develop more tolerant crops.
1.2 CLASSIFICATION OF LAND PLANTS BASED ON THEIR
TOLERANCE TOWARD WATER DEFICIT
Most plants can be categorised into one of two groups: drought-sensitive plants
and drought-tolerant plants. Drought-sensitive plants, which include the majority of
agricultural crops, are vulnerable to even mild water deficit. Drought-tolerant plants
(also known as homioihydrous plants) can tolerate moderate levels of water deficit.
These plants keep their hydration level stable mainly through dehydration avoidance
mechanisms or pumping water from the soil via their deep root systems. However,
there is a third category, known as desiccation-tolerant plants, comprising plants that
can withstand extreme dehydration or desiccation and can lose over 85 % of their
relative water content RWC (Gaff, 1981;Hoekstra et al., 2001;Vicré et al., 2004a).
Although these plants are not of any significant agricultural importance, a better
understanding of the desiccation-tolerance mechanisms could be used to develop
drought-tolerant crops to meet the increasing global food demand.
Chapter 1: Introduction and Literature Review 3
1.3 DESICCATION TOLERANCE IN PLANTS
Desiccation-tolerance is defined as the ability of losing water to air-dry levels
and return to normal function after receiving water (Gaff, 1971). Although the
majority of plants are able to produce desiccation-tolerant seeds or spores, the ability
of tolerating desiccation in vegetative tissues is very rare (Bernacchia and Furini,
2004). Only a small portion of vascular plants and some non-vascular plants are able
to tolerate extreme desiccation and return to their normal metabolic function after
rehydration (Scott, 2000). These plants possess mechanisms and structures that
enable them to protect themselves against damage caused by extreme desiccation.
1.3.1 Evolutionary aspects
Desiccation-tolerance of vegetative tissues is thought to have evolved early in
the history of terrestrial plants as part of their adaptation to life on land (Oliver et al.,
2000a). While desiccation-tolerance remained common among prokaryotes (Potts,
1994) and nonvascular plants, this trait was subsequently lost possibly due to the
high energetic cost and/or the development of complex structures, such as the
evolution of vascular tissue, cuticle and stomata (Rascio and La Rocca, 2005).
However the genes related to desiccation-tolerance were maintained and these genes
are active in almost all land plants during reproduction. In vascular plants
desiccation-tolerance is mainly restricted to reproductive tissues such as spores,
pollen, orthodox seeds and some bulbs (e.g. Ranunculus bulbs). Desiccation-
tolerance in vegetative tissues appears to have ‘re-evolved’ independently, in
vascular plants, Selaginella, ferns, and at least eight times in angiosperms (Oliver et
al., 2000a;Proctor and Tuba, 2002).
1.3.2 Geographic distribution and ecology
Desiccation-tolerant plants are mostly small in size and slow-growing. They often
possess some features that are also exhibited by drought-tolerant plants (such as thick
cuticle, hairs or scales on leaves) (Gaff, 1981;Proctor and Tuba, 2002). Due to their
slow growth, these plants tend to grow where their resurrection capability is
optimally adaptive (Gaff, 1981). Desiccation-tolerant plants can mostly be found in
habitats where poor conditions, such as dryness, sporadic rain or shallow soil, limit
the growth of other plants (Iturriaga et al., 2000). In particular, on harsh
microhabitats of granitic and gneissic outcrops (inselbergs) of tropical and
4 Chapter 1: Introduction and Literature Review
subtropical regions, desiccation-tolerant vascular plants may become dominant
(Porembski and Barthlott, 2000;Bartels, 2005;Porembski, 2011). Most of the known
vascular desiccation-tolerant plants are from the southern hemisphere particularly,
from central and southern Africa and south-west Australia (Gaff, 1971; 1977;Gaff
and Latz, 1978). Desiccation-tolerant plants are classified in two groups: fully
desiccation-tolerant plants and modified desiccation-tolerant plants (Oliver and
Bewley, 1997) (Figure 1).
Chapter 1: Introduction and Literature Review 5
Figure 1: The classification of the land plants (embryophytes) based on water
deficit tolerance and classification of desiccation-tolerant plants.
Land plants can be divided into three main categories, i) drought-sensitive, ii) drought-
tolerant and iii) desiccation-tolerant. Desiccation-tolerant plants can be divided into
two categories of fully desiccation-tolerant plants and modified desiccation-tolerant
plants. Desiccation- tolerant plants can be further classified into two main categories,
poikilochlorophyllous (photosynthetic apparatus is lost during desiccation), and
homoiochlorophyllous (photosynthetic apparatus maintain during desiccation).
Land Plants (Embryophytes)
Drought sensitive Drought-tolerant Desiccation-tolerant
Homoiochlorophyllous
(Photosynthetic apparatus maintained)
Modified Desiccation-Tolerant Plants (Resurrection plants)
(Vascular)
Poikilochlorophyllous (Photosynthetic apparatus lost)
e.g. Tripogon loliiformis
Fully Desiccation-Tolerant Plants
(Non-vascular)
e.g. Xerophyta scabrida
e.g. Tortula ruralis
6 Chapter 1: Introduction and Literature Review
1.3.3 Desiccation-tolerant plants types
Fully desiccation-tolerant plants (poikilohydrous plants)
The ability of withstanding extreme desiccation is common among non-
vascular plants (Porembski and Barthlott, 2000). All the non-vascular desiccation-
tolerant plants are also called fully desiccation-tolerant plants. Fully desiccation-
tolerant plants have developed mechanisms to withstand very high rates of
dehydration but because they do not possess vascular tissue, their tolerance strategies
are different from those of vascular plants (Rascio and La Rocca, 2005). These plants
can dehydrate in a few minutes and remain in a dehydrated-dormant for up to 19
years (Alpert, 2000). They can also rehydrate quickly within minutes, and resume
normal function within a few hours (Alpert, 2000). Fully desiccation-tolerant plants
are mostly slow growing, possibly due to their constant readiness for any dehydration
which requires significant amounts of energy (Oliver, 2008). The small cell volume
and thick cell walls help to reduce physical stress during dehydration and rehydration
(Proctor and Tuba, 2002; Rascio and La Rocca, 2005). Fully desiccation-tolerant
plants are found from tropical to polar regions, on surfaces of rocks, shallow soils
and bark of the trees (Proctor and Tuba, 2002). Perhaps the most studied fully
desiccation-tolerant plant is Tortula ruralis which is a moss native to a wide range of
habitats (Schonbeck and Bewley, 1981;Oliver, 1991;Oliver et al., 1993;Tuba et al.,
1996a;Oliver et al., 2000b).
Modified desiccation-tolerant plants (resurrection plants)
All the vascular plants capable of tolerating extreme dehydration (below 13
% RWC) in their vegetative tissues are called modified desiccation-tolerant plants
(Gaff, 1971; 1977;Rascio and La Rocca, 2005;Toldi et al., 2009) or ‘resurrection
plants’ (personal communication with Professor Melvin Oliver). Modified
desiccation-tolerant plants tend to dehydrate and rehydrate more slowly than fully
desiccation-tolerant plants. If the time needed for inducing desiccation-tolerance is
not provided during dehydration, resurrection will not occur (Oliver, 1996). They can
tolerate less extreme desiccation and for a shorter duration (up to five years)
compared with fully desiccation-tolerant plants (Gaff, 1981;Alpert, 2000;Scott,
2000;Mundree et al., 2002).
Chapter 1: Introduction and Literature Review 7
Desiccation-tolerance in vegetative tissues of vascular plants has been found in
around one thousand ferns/fern allies and among some 400 angiosperms making up
less than 0.2 % of the total flora (Proctor and Pence, 2002;Rascio and La Rocca,
2005;Toldi et al., 2009;Bartels and Hussain, 2011;Porembski, 2011). Among
angiosperms, resurrection plants have been identified within both monocotyledonous
and dicotyledonous species while the majority are monocotyledons with few records
among the dicotyledons or other angiosperms (Gaff and Latz, 1978;Toldi et al.,
2009). Desiccation-tolerance within dicotyledons appears mainly in
Scrophulariaceae, Gesneriaceae and Myrothamnaceae families. Most resurrection
plants are herbaceous plants and the largest reported resurrection plant has been
Myrothamnus flabellifolia which is a small woody shrub (between 0.5 m and 1.5 m
tall) (Sherwin et al., 1998;Moore et al., 2007). No resurrection plant has been
reported among Gymnosperms and trees (Alpert, 2000). Desiccation-tolerance is
suggested to be a size limited trait as no resurrection plants has been reported over a
certain height (Bewley, 1982).
Among monocotyledonous plants, the resurrection trait appears in a wide range
of families that are not closely related to each other. Sometimes only one species in a
genus may be desiccation-tolerant (Gaff, 1981). Resurrection plants are mostly found
in arid and semi-arid areas of tropical and subtropical regions of the world,
particularly in Africa and Australia (Porembski and Barthlott, 2000;Rascio and La
Rocca, 2005;Toldi et al., 2009). However, they can also be found in humid forests
and temperate regions such as the resurrection grass, T. loliiformis that occurs in
tropical regions of Australia (Proctor and Tuba, 2002).
The following list includes the genera with resurrection species (number of
currently known desiccation-tolerant members in parentheses) based on Proctor and
Tuba (2002) with an update using Bartels and Hussain (2011) and Table 1
demonstrates the best studied angiosperm resurrection plants:
8 Chapter 1: Introduction and Literature Review
Angiosperms. Monocotyledons. Cyperaceae. Afrotrilepis (1), Carex (1),
Coleochloa (2), Cyperus (1), Fimbristylis (2), Kyllingia (1), Mariscus (1),
Microdracoides (1), Trilepis (1). Liliaceae (Anthericaceae). Borya (3). Poaceae.
Brachyachne (1), Eragrostiella (3), Eragrostis (4), Micraira (5), Microchloa (3),
Oropetium (3), Poa (1), Sporobolus (7), Tripogon (10). Velloziaceae. Aylthonia (1),
Barbacenia (4), Barbaceniopsis (2), Nanuza (1), Pleurostima (1), Vellozia (c. 124),
Xerophyta (c. 28). Dicotyledons. Myrothamnaceae. Myrothamnus (2). Cactaceae.
Blossfeldia (1). Acanthaceae. Talbotia (1), Gesneriaceae. Boea (1), Haberlea (1),
Ramonda (3), Streptocarpus (20). Scrophulariaceae. Chamaegigas (2),
Craterostigma (12), Ilysanthes (1), Limosella (1), Lindernia (< 30). Lamiaceae.
Micromeria (1), Satureja (1).
Chapter 1: Introduction and Literature Review 9
Table 1: The best studied angiosperm resurrection plants [modified from
Bartels and Hussain (2011)]:
Species Family Class Origin Poikilo/Homoi
Xerophyta viscosa Velloziaceae Monocot Southern Africa P
X. humilis Velloziaceae Monocot Southern Africa P
Mysothamnus
flabellifolia
Myrothamnaceae Dicot Southern Africa H
Sporobolus
stapfianus
Poaceae Monocot Southern Africa H
Eragrostis
nindensis
Poaceae Monocot Southern Africa P
Craterostigma
plantagineum
Scrophulariaceae Dicot Southern Africa H
C. wilmsii Scrophulariaceae Dicot Southern Africa H
Lindernia
brevidens
Linderniaceae Dicot East Africa H
Boea hygrometrica Gesneriaceae Dicot Africa, Asia
Australia
H
Haberlea
rhodopensis
Gesneriaceae Dicot Europe H
10 Chapter 1: Introduction and Literature Review
Classification of resurrection plants
Modified desiccation-tolerant plants can be divided into two groups depending
on whether or not they dismantle their photosynthetic apparatus during the
desiccation process. Those plants that retain their photosynthetic apparatus intact
during desiccation such as Sporobolus stapfianus and S. festivus are called
homoiochlorophyllous (Dingkuhn et al., 1999). Those that dismantle their
photosynthetic apparatus are called poikilochlorophyllous. All the resurrection
species of genera Eragrostis, Coleochloa and Borya are poikilochlorophyllous (Gaff,
1971;Proctor and Tuba, 2002) (Figure 1). The latter have to resynthesise their
chlorophyll following rehydration therefore it takes longer to recover their
photosynthetic activity (Müller, 2008). Poikilochlorophyllous plants can only be
found among monocots (Proctor and Tuba, 2002) (Figure 1). Some genera contain
homoiochlorophyllous and poikilochlorophyllous members, for example while S.
stapfianus and S. festivus retain considerable chlorophyll, S. pellucidus and S.
lampranthus do not retain chlorophyll during desiccation state (Gaff and Ellis,
1974;Gaff and Latz, 1978) providing a valuable ground for comparative study
between these two classes.
Chapter 1: Introduction and Literature Review 11
1.4 IMPACTS OF WATER DEFICIT ON PLANTS
Water deficit results in dehydration of the cells and this causes ion toxicity and
oxidative stress, and mechanical damage to the cell. Water loss leads to an increase
in concentration of free radicals and peroxides such as Clˉ, NO3ˉ, OHˉ and H2O2 in
the protoplasm. High concentrations of these components cause ion toxicity and
oxidative stress that can disrupt the cellular metabolism resulting in damaged
proteins, lipids, and DNA (explained in 1.6.1) (Mundree et al., 2002;Vicré et al.,
2004b;Rascio and La Rocca, 2005). Mechanical damage such as fusion of cell
membrane and loss of membrane integrity can be caused by severe dehydration
(Hoekstra et al., 2001).
1.4.1 Plant responses to water deficit
Non-desiccation-tolerant plants react to water deficit using mechanisms to
avoid dehydration or to reduce the damage caused by dehydration. These
mechanisms enable non-desiccation-tolerant plants to withstand moderate
dehydration (losses up to 60 % RWC of hydrated tissue) (Gaff, 1981). Desiccation-
tolerant plants have many common mechanisms with non-desiccation-tolerant plants
to limit damage during moderate dehydration (Gaff, 1981). After this stage DT plants
implement additional survival strategies to allow equilibration of their water content
to the level of the humidity of their surrounding environment (Hoekstra et al.,
2001;Vicré et al., 2004b;Toldi et al., 2009). These mechanisms allow desiccation of
vegetative tissues to air-dry levels and a seed-like state of anhydrases (life without
water) until more favourable conditions are encountered (Mundree et al.,
2002;Proctor and Tuba, 2002;Rascio and La Rocca, 2005).
While the majority of response mechanisms to moderate dehydration (above 60
% RWC) in desiccation-tolerant plants also occur in non-desiccation-tolerant plants,
desiccation-tolerant plants possess additional mechanisms to withstand severe
dehydration. The mechanisms of dehydration tolerance can also be classified into the
three groups: 1) structural responses, 2) physiological responses, 3) and molecular
responses.
Modified desiccation-tolerant plants and desiccation-sensitive plants possess
structural characteristics to avoid dehydration during environmental humidity
fluctuation. These characteristics can be seen regardless of environmental conditions.
12 Chapter 1: Introduction and Literature Review
For example, many plants store water in different parts, such as leaves, roots, tubers,
rhizomes or trunk. In some plants the rate of water loss is minimised through the leaf
surface, for example, by having leathery or needle-like leaves or leaves with thick
cuticle, hairs or scales. When water deficit is severe or lasts for an extended period,
these adaptations cannot prevent the plant from dehydration.
1.4.2 Water deficit response characteristics common among all plants
Moderate dehydration triggers a range of responses in plants. These responses
generally maintain the cell water content to avoid damage caused by dehydration and
protection against oxidative stress. These responses could be classified into three
main categories: 1) structural responses, 2) physiological responses, 3) and molecular
responses.
1.5 STRUCTURAL ASPECTS
Water deficit induces a number of structural changes in plants in order to
increase water use efficiency. The key changes include a reduction in canopy size
and root proliferation, increased cuticle thickness and trichome density as well as
reducing leaf surface area. Water uptake can be enhanced through root system
expansion and reducing the evapo-transpirational loss through reducing the canopy.
Reduction in canopy size can occur through reduction in the number and/or size of
the leaves and reduction in height of the plant loss which results in increasing
root/leaf ratio (Nagarajan and Nagarajan, 2010).
1.5.1 Leaf surface structures
An increase in the trichomes (such as macro-hairs) reduces the air-movement
over the surface as well as deflecting light, thus reducing surface evaporation, while
increased cuticle thickness is an established dehydration avoidance mechanism in
plants (Eglinton and Hamilton, 1967). Increased trichome number and cuticle
thickness may facilitate desiccation tolerance in resurrection plants by slowing down
the rate of dehydration, thus providing crucial time for implementation of desiccation
tolerance mechanisms. Furthermore, these structures may also aid tolerance by
mitigating light-induced damage of desiccated tissue.
Chapter 1: Introduction and Literature Review 13
Farrant et al. (2009) demonstrated that scale-less leaves of the fern Mohria
caffrorum during rainy season do not survive desiccation while scaled leaves that are
present during the dry season are desiccation tolerant. This study suggests that the
role of scales in desiccation-tolerance is through reducing dehydration rate and
masking the chlorophyll during dehydration and in the desiccated state. While there
are potentially other factors also involved in desiccation-tolerance in the leaves of M.
caffrorum during the dry season, the association of scales with desiccation tolerance
suggests their importance in desiccation-tolerance.
1.5.2 Reducing leaf surface area
While the above structural changes take a relatively long period of time, the
reduction of leaf surface area, a major morphological change that occurs during
environmental stress, happens in a short period of time. Reducing leaf surface area
occurs mostly through leaf folding and rolling (particularly among monocotyledons).
Leaf folding and rolling are two morphological changes which play a significant role
in stress-tolerance in higher plants (Kadioglu and Terzi, 2007;Kadioglu et al., 2012).
Leaf folding and rolling can be triggered by different biotic and abiotic stress factors.
Biotic stress factors such as viruses, bacteria, fungi and herbivores and abiotic stress
factors such as excessive radiation, heat, salts and dehydration (Reviewed by
Kadioglu et al., 2012).
Leaf rolling and folding could benefit the plant in two major ways during water
deficit. Firstly, it produces a micro-environment which increases the humidity close
to the leaf surface resulting in the reduction of transpiration rate (Clarke,
1986;Heckathorn and DeLucia, 1991;Tanimoto and Itoh, 2000). Secondly, leaf
folding and rolling reduces leaf surface area resulting in less exposure to the light.
This results in less heat (Schakel and Hall, 1979;Turner et al., 1986;Heckathorn and
DeLucia, 1991;Turgut and Kadioglu, 1998), radiation damage (O'Toole and Cruz,
1980;Corlett et al., 1994;Omarova et al., 1995;Turgut and Kadioglu, 1998), and
photosynthesis-induced oxidative stress (O'Toole and Cruz, 1980;Sarieva et al.,
2010).
Leaf rolling has been extensively studied in monocotyledons, particularly in
major true cereals including maize (Fernandez and Castrillo, 1999;Nelson et al.,
2002), rice (O'Toole and Cruz, 1980;Turner et al., 1986;Heckathorn and DeLucia,
14 Chapter 1: Introduction and Literature Review
1991;Ekanayake et al., 1993;Price et al., 1997;Dingkuhn et al., 1999;Tanimoto and
Itoh, 2000;Singh et al., 2011), wheat (Clarke, 1986;Omarova et al., 1995;Dingkuhn
et al., 1999;Sarieva et al., 2010), sorghum (Matthews et al., 1990;Corlett et al., 1994)
and barley (Turner and Stewart, 1986). Ctenanthe setosa has been used as a
monocotyledonous model plant for studying leaf rolling in a number of reports
(Turgut and Kadioglu, 1998;Kadioglu and Turgut, 1999;Terzi and Kadioglu,
2006;Nar et al., 2009). The majority of these reports, investigate the molecular and
physiological aspects and only a few look at the structural aspects of leaf rolling in
monocotyledons (Esau, 1965;Alvarez et al., 2008).
While leaf movement in eudicotyledons is known to be controlled mainly by
pulvini cells (Pedersen et al., 1993;Taya, 2003), in monocotyledons, leaf rolling is
believed to be controlled by bulliform cells in the presence or absence of colourless
cells which act as pivots. Loudetiopsis chrysothrix and Tristachya leiostachya are
prime examples of the latter phenomenon (Esau, 1965;Alvarez et al., 2008). Vecchia
et al. (1998) however argue that in S. stapfianus (Poaceae) dehydration of bulliform
cells does not result in any significant leaf folding or rolling. A possible correlation
between sclerenchymous tissue and leaf rolling has been suggested in two
independent molecular studies on mutant rice (Zhang et al., 2009) with defective
sclerenchyma cells and in mutant maize (Nelson et al., 2002) with different
sclerenchymous tissue distribution. Despite some progress, the exact role of
sclerenchymous tissue in leaf folding and rolling in monocotyledons is still not clear.
Reducing leaf surface area is particularly important in resurrection plants
(Gaff, 1981;Sherwin et al., 1998;Vander Willigen et al., 2003;Moore et al.,
2007;Georgieva et al., 2010). Reducing leaf surface area is a dehydration avoidance
mechanism which slows down the dehydration rate thus providing more time needed
for inducing desiccation-tolerance (Vecchia et al., 1998;Oliver et al., 2000a). Leaf
folding and rolling can also reduce the damage caused by excessive radiation during
desiccation. Furthermore, less light exposure reduces photosynthesis and lowers the
amount of reactive oxygen species (ROS) produced as a result of photosynthesis
during water deficit stress (Farrant, 2000;Farrant et al., 2003). Leaf folding has been
reported in a number of resurrection plants (Gaff, 1981;Sherwin et al., 1998;Vander
Willigen et al., 2003;Moore et al., 2007;Georgieva et al., 2010), however, the
Chapter 1: Introduction and Literature Review 15
mechanisms of leaf folding have not been well-studied in monocotyledons. Farrant et
al. (2003) demonstrated that the leaves of resurrection plant Craterostigma wilmsii
that were mechanically prevented from folding, could not survive desiccation.
1.5.3 Xylem tissue (in stem and root)
A mature xylem tissue is dead with rigid cell walls, therefore, during
desiccation these cells are dry and filled with air. Water refilling of the long air-filled
vessels seems to be a major challenge for the resurrection plants. This xylem refilling
problem might contribute to the height limitation of the resurrection plants
(Porembski and Barthlott, 2000;Proctor and Tuba, 2002). In a number of resurrection
plants it has been reported that the re-greening does not take place on the tip of the
leaves and stems. Sherwin et al. (1998) explains that the distal portion of some
branches of Myrothamnus abellifolius did not resurrect after ground watering,
however when these parts were cut and placed in water, rehydration took place
within 12 h. This explains that the lack of re-greening on these might be due to the
problem of water reaching the tip of the branches rather than tissue damage.
Myrothamnus abellifolius is the only resurrection plant with a woody stem. In
a study by Sherwin et al. (1998), it was revealed that root pressure was not sufficient
to refill the xylem (only 24 cm) of desiccated M. abellifolius; the capillary force
however, was enough to rise the water in the xylem tissue (to 2.12 m). This
unusually strong capillary force is due to very narrow xylem vessels (one of the
narrowest xylems among seed plants) (Sherwin et al., 1998).
There is little published data about the changes in roots during desiccation in
resurrection plants; however it seems that rehydration does not take place solely due
to root pressure. The rehydration of the leaves in resurrection plants has been
demonstrated to occur both by watering roots or directly to the leaves, even watering
of the excised leaves can lead to re-greening (Gaff and Latz, 1978). Furthermore, this
strengthens the idea that resurrection plants do not rely solely on root pressure for
rehydration. While the embolism of the xylem tissue is said to be an obstacle in
resurrection in some resurrection plants (Sherwin and Farrant, 1996), perhaps
capillary force combined with the root pressure makes the refilling of the xylem
tissue possible (Sherwin et al., 1998).
16 Chapter 1: Introduction and Literature Review
Protection of the vascular tissue during desiccation is another vital issue for the
survival of resurrection plants. No significant changes in the vascular tissue of M.
abellifolius during desiccation were observed (Sherwin et al., 1998), however
dehydration stress damaged the vascular tissue of barley (Pearce and Beckett, 1987).
Unusual knob-like structures that were observed on the outer surface of xylem
vessels of M. abellifolius are suggested to have a possible role in protection of xylem
vessels during dehydration (Sherwin et al., 1998).
1.6 PHYSIOLOGICAL ASPECTS
Plants display a variety of physiological responses at the cellular and whole-
organism levels during dehydration and rehydration. Some of the key changes
include photosynthesis, stomata closure, pigmentation and respiration. These changes
are mainly to prevent oxidative damage resulting from ROS accumulation during
dehydration.
1.6.1 Reactive oxygen species
Accumulation of ROS is one of the major problems during dehydration.
Reactive oxygen species such as superoxide, hydrogen peroxide and hydroxyl
radicals damage macromolecules in the protoplasm (Bowler et al., 1992;Smirnoff,
1993). Photosynthesis and respiration are the main sources of ROS during drying
resulting from the interruption of electron transport (Hendry and Grime,
1993;Smirnoff, 1993;Farrant, 2000;Mundree et al., 2002;Apel and Hirt, 2004b).
Reactive oxygen species are formed naturally as a byproduct of photosynthesis
and respiration and neutralised through antioxidants in the cell. During the stress
such as water deficit, however, the production of ROS exceeds the capacity of
antioxidant system (such as Mehler ascorbate peroxidase pathway), leading to rapid
increase in ROS concentration which is called “oxidative burst”. During water deficit
stress, the availability of the CO2 is restricted (stomata closure and/or low amount of
water), in this condition Rubisco favours oxygen over CO2 to pass the electron (Apel
and Hirt, 2004a). This leads to production of O2ˉ which can attack and produce other
reactive oxygen species such as Oˉ, OHˉ and H2O2. High concentrations of ROS can
cause ion toxicity and oxidative stress that can disrupt the metabolic procedure of the
Chapter 1: Introduction and Literature Review 17
cell and damage proteins, lipids, and DNA (Mundree et al., 2002;Vicré et al.,
2004b;Rascio and La Rocca, 2005). Reactive oxygen species also can activate the
apoptosis pathway and lead to tissue senescence.
In order to prevent ROS accumulation, resurrection plants stop photosynthesis
through different ways. The first step to reduce photosynthesis is through stomata
closure. Closed stomata limits the gas exchange and lowers CO2 level which in turn
reduces photosynthesis (Tuba et al., 1998). Lowering of the photosynthesis through
stomata closure is particularly effective in C3 plants. Furthermore, the closed stomata
reduces the water lose through transpiration. In a study by Moore et al., (2007) it was
shown that in Myrothamnus flabellifolia the stomata remained open irreversibly upon
desiccation for secretion of calcium salts. The steps step/s in reducing photosynthesis
in resurrection plants is through dismantlement of photosynthetic apparatus and/or
prevention of light-chlorophyll interaction through pigmentation and/or reducing leaf
surface area.
1.6.2 Photosynthesis
In comparison with mesophytes, resurrection plants respond to dehydration
faster and reduce photosynthesis relatively early from 80 % RWC and below
(Farrant, 2000). If dehydration continues, resurrection plants terminate
photosynthesis. In poikilochlorophyllous resurrection plants, chlorophyll pigments
are disintegrated and thylakoid membranes are dismantled to prevent the production
of ROS through photosynthesis. Homoiochlorophyllous resurrection plants retain
much of their photosynthetic apparatus but limit photosynthesis through shading,
pigmentation and/or reduction of leaf surface area (Hallam and Luff, 1980;Gaff,
1981;Sherwin and Farrant, 1998;Tuba et al., 1998;Farrant, 2000;Farrant et al., 2003).
Down-regulation of photosynthesis-related gene expression during early stages of
dehydration is also shown to be involved in limiting photosynthesis in the
resurrection plant Craterostigma plantagineum (Bernacchia et al., 1996;Bockel et al.,
1998).
Pigmentation of leaves during dehydration is very common among
homoiochlorophyllous resurrection plants such as in T. loliiformis, C. wilmsii and M.
flabellifolius (Gaff, 1981;Sherwin and Farrant, 1998;Farrant, 2000). Reducing leaf
surface area through leaf folding and rolling is also common among
18 Chapter 1: Introduction and Literature Review
homoiochlorophyllous resurrection plants. Farrant et al. (2003) demonstrated that the
leaves of homoiochlorophyllous resurrection plant C. wilmsii cannot resurrect if the
leaves were mechanically prevented from folding during desiccation as a result of
light-damage. The pigmentation on the exposed surfaces of the leaves and leaf
surface area prevent light-chlorophyll interaction and minimise light-induced
damage.
1.6.3 Respiration
Respiration has been shown to remain active until very low hydration levels in
some resurrection plants, perhaps for providing energy needed for protection
mechanisms when photosynthesis is shut down (Tuba et al., 1996b;Tuba et al.,
1997;Tuba et al., 1998;Farrant, 2000;Whittaker et al., 2004). Respiration has been
shown to be inhibited in the whole-plant under dehydration stress in desiccation
sensitive plants (Leprince et al., 2000). However, similar to resurrection plants
mitochondrial respiration remains active in seeds until very low hydration levels
(Benamar et al., 2003;Atkin and Macherel, 2009). Mitochondrial respiration resumes
very rapidly in seeds as well as in homoiochlorophyllous resurrection plants (Tuba et
al., 1998).
The quick resumption of mitochondrial respiration as well as a structural
observation by Farrant (2000) suggests that membrane integrity of mitochondria in
homoiochlorophyllous resurrection plants is preserved during dehydration.
Membrane integrity of the mitochondria has been shown to be protected during
desiccation in orthodox seeds (Benamar et al., 2003). While mitochondria in the
poikilochlorophyllous resurrection sedge Coleochloa setifera had fewer cristae
during desiccation (Bartley and Hallam, 1979), in four species of
poikilochlorophyllous resurrection plants from the Borya genus, mitochondria lost
some of the peripheral membrane and the number of cristae reduced (Gaff, 1981).
The resumption of respiration in poikilochlorophyllous resurrection plant X. scabrida
was shown by Tuba et al. (1998) after 24 h.
These studies suggest that homoiochlorophyllous resurrection plants maintain
their mitochondrial membrane integrity resulting in rapid resumption of respiration.
In contrast, poikilochlorophyllous resurrection plants lose at least a part of their
mitochondrial membrane integrity and resume the respiration with a delay. However
Chapter 1: Introduction and Literature Review 19
this area of study requires further research particularly on the resumption of
respiration in homoiochlorophyllous resurrection plants as the only work on
resumption of respiration in homoiochlorophyllous plants has been on a moss and
lichen and not on any vascular homoiochlorophyllous resurrection plants.
1.7 MOLECULAR RESPONSES TO WATER DEFICIT IN PLANTS
Molecular responses to moderate dehydration in plants play three main roles:
1) structural and osmoprotection, 2) oxidative and ion toxicity protection, 3) and
regulatory. During dehydration, cells produce various osmolytes to maintain water
content and to protect the structure of its components. Some of these molecules are
carbohydrates (sucrose in particular) and a range of hydrophilic proteins such as late
embryogenesis abundant (LEA) proteins and small heat shock proteins (HSPs)
(Almoguera et al., 1993;Rascio and La Rocca, 2005). Synthesis of antioxidants and
ion scavengers such as ascorbates, peroxidises and superoxide dismutases protect the
cell against ion toxicity and oxidative stress (Hara et al., 2004;Mhadhbi et al., 2011).
The molecular responses to water deficit are induced either directly by loss of
water or by regulatory signals (Rascio and La Rocca, 2005). Roots act as the primary
sensors to regulate plant responses (Tardieu, 1996). Abscisic acid (ABA) plays a
major regulatory role in vascular plants during water deficit (Bray, 2002;Osakabe et
al., 2014). This signal-molecule is produced in the roots and regulates numerous
molecular responses in the plant during water deficit such as, antioxidant production
and expression of most of the dehydration-related genes or triggers physiological
responses such as stomatal closure and root expansion (Guan et al., 2000;Rascio and
La Rocca, 2005;Geisler et al., 2006).
1.7.1 Molecular responses to water deficit in desiccation-tolerant plants
While molecular responses to dehydration in desiccation-tolerant plants have
many common components with desiccation sensitive plants, desiccation-tolerant
plants possess additional mechanisms to withstand severe dehydration. These
molecular responses in desiccation-tolerant plants in response to dehydration can be
roughly divided into four groups while some molecules can be in more than one
group; 1) regulatory molecules, 2) antioxidants, 3) carbohydrates and 4) proteins.
20 Chapter 1: Introduction and Literature Review
This section of the literature review discusses these four groups of molecular
responses in desiccation-tolerant plants.
1.7.2 Regulatory
During desiccation, regulation of responses is generally classified as ABA-dependent
and ABA-independent.
ABA-dependent signalling
Abscisic acid is the key signal molecule during severe dehydration just like
during moderate dehydration. ABA concentrations in leaf cells can increase by 3- to
20-fold upon desiccation (Gaff and Loveys, 1984;Dingkuhn et al., 1999;Bernacchia
and Furini, 2004;Dinakar et al., 2012). Several proteins have been identified to be
synthesised both by desiccation or induced by exogenous ABA-treatment in C.
plantagineum while the expression levels of these proteins declined after relief from
stress and ABA-treatment (Bartels et al., 1990;Piatkowski et al., 1990;Michel et al.,
1994). The desiccation sensitive callus of C. plantagineum turns desiccation-tolerant
when treated with exogenous ABA (Bartels et al., 1990). Similarly ABA is
accumulated in orthodox seeds and is involved in desiccation-tolerance and
dormancy of the seeds (del Carmen Rodríguez-Gacio et al., 2009). While the role of
ABA is well studied in desiccation-tolerance, the role of other plant hormones such
as jasmonic acid, ethylene, auxin and salicylic acid is not well understood. Most of
these hormones are related to senescence and breaking the dormancy which relieves
desiccation-tolerance, however they might have a role in resurrection and renewing
metabolism after receiving water.
ABA-independent signalling
Transcription factors control the responses at the cellular level by regulating
gene expression (Neale et al., 2000;Le et al., 2007). It is suggested that the re-
evolvement of desiccation-tolerance in the vegetative tissues of angiosperms is the
result of several genes which are active in dry reproductive tissues (e.g. seed and
pollen) (Oliver et al., 2000a). This might mean that specific transcriptional factors in
resurrection plants regulate the expression of these genes in the vegetative tissues. A
study using transcriptome analysis by next-generation sequencing revealed that
members of the NAC, NF-YA, MADS box, HSF, GRAS, and WRKY transcription
Chapter 1: Introduction and Literature Review 21
factor families play a key role in diverse physiological and molecular changes in
resurrection plants leading to desiccation-tolerance (Gechev et al., 2013). Phillips et
al. (2002) have found a new family of genes called Plastid Targeted Protein (CpPTP)
with a possible role in transcriptionally down-regulating the plastid genome during
desiccation by binding to DNA in C. plantagineum.
Small RNAs have shown to have an essential role in gene regulation for
environmental and developmental changes (Phillips et al., 2007). The role of small
RNAs in desiccation-tolerance have been revealed in C. plantagineum (Hilbricht et
al., 2008). It is expected more information about the role of small RNAs in
desiccation-tolerance be revealed in the near future. Some responses could be
independent of molecules and may be induced directly by dehydration such as the
expression of the XVSAP1 gene (Garwe et al., 2003). Even though XVSAP1 can also
be expressed through ABA signalling (Iyer et al., 2008).
1.7.3 Antioxidants
One of the main problems plants face during dehydration is the oxidative stress
due to accumulation of ROS. One of the key strategies for protecting the cell against
oxidative stress during the dehydration is by increasing the synthesis of antioxidants.
Enzymes such as catalases, superoxide dismutase (SOD), ascorbate peroxidase
(APX) and glutathione reductase act as ROS scavengers. Additionally, non-
enzymatic antioxidants such as ascorbate, glutathione, carotenoids, anthocyanins,
polyphenols, osmolytes, proteins (e.g. peroxiredoxin) and amphiphilic molecules
(e.g. tocopherol) also regulate ROS levels (Bowler et al., 1992;Navari-Izzo et al.,
1997;Noctor and Foyer, 1998;Sherwin et al., 1998;Sgherri et al., 2004). The
antioxidant activity needs to remain active until a low hydration level to protect the
cell from ROS produced by respiration (Sherwin and Farrant, 1998;Farrant, 2000).
Antioxidant activity must be particularly critical for homoiochlorophyllous
resurrection plants as the maintained chlorophyll could be a source of ROS
production during desiccation. Kranner et al. (2002) demonstrated an increased
accumulation of antioxidants in desiccated M. abellifolia. This study also showed the
amount of broken down antioxidant in the desiccated tissue has a direct relation with
the period of desiccation. In many homoiochlorophyllous resurrection plants leaves
22 Chapter 1: Introduction and Literature Review
are heavily pigmented mostly by anthocyanin (e.g. C. wilmsii and T. loliiformis) that
has antioxidative property and also protects the tissue from radiation from the sun
during desiccation (Gaff, 1981;Sherwin and Farrant, 1998). A novel member of the
vicinal oxygenase chelate (VOC) superfamily of metalloenzymes was found to
accumulate during both dehydration of vegetative tissues and dry seeds of X. humilis
(Mulako et al., 2008).
1.7.4 Carbohydrates level in desiccation tolerant plants in resurrection plants
Carbohydrate production is one of the main responses to water deficit in a wide
range of plants (Schakel and Hall, 1979). Sucrose content increases more than other
carbohydrates during water deficit stress (Schakel and Hall, 1979;Turner et al.,
1986). It has been suggested that carbohydrates have an osmoregulatory role during
minor water loss (Schakel and Hall, 1979). While carbohydrate production is one of
the major plant responses to dehydration, where accumulation of carbohydrate plays
a fundamental role in desiccation-tolerance in plants and other organisms. Non-
reducing oligosaccharides and sucrose in particular are the main carbohydrates
accumulated in seeds, pollen and in most of the plants that can tolerate desiccation.
In nearly all of the resurrection (vascular DT) plants studied to date as well as
other organisms that can withstand desiccation such as bacteria, fungi and yeast, the
levels of non-reducing disaccharides increase upon desiccation (Clarke, 1986;Crowe
et al., 1998;Nar et al., 2009;ElSayed et al., 2014). Carbohydrates play an important
part in structural protection during extreme dehydration. During extreme
dehydration, the viscosity of the cytoplasm increases dramatically (glassy state or
vitrified state), carbohydrate molecules form a protective layer around other
molecules and parts of the cell and act as a chaperone (Crowe et al., 1998). This
results in protection of these components from structural damage such as structural
damage to macromolecules, membrane fusion and molecular stability during severe
dehydration (Crowe et al., 1998;Bryant et al., 2001). A range of non-reducing
oligosaccharides (e.g. sucrose, sorbitol, trehalose and the raffinose family of
oligosaccharides) accumulate in resurrection plants mainly through breakdown of
starch during dehydration (Crowe et al., 1998;Mundree et al., 2000;Crowe et al.,
2001;Peters et al., 2007;ElSayed et al., 2014). Carbohydrate has also been shown to
protect membrane structure and preserving the fluidity of the plasma membrane in
Chapter 1: Introduction and Literature Review 23
dry seeds (Wang et al., 1999). Herein the role of some of these sugars in desiccation
tolerance is discussed.
Sucrose
Sucrose is the only cellular protection carbohydrate available in desiccated
tissues in fully desiccation tolerant mosses including Dicranum majus, Hookeria
lucens, Polytrichum commune, Racomitrium lanuginosum, Thuidium tamariscinum
and T. ruraliformis (O'Toole and Cruz, 1980). The sucrose level does not change
during dehydration and rehydration whether in the light or dark, while there is a
reduction in the amount of glucose and fructose (reducing carbohydrates) during
dehydration (O'Toole and Cruz, 1980). The sucrose content in the hydrated tissue of
desiccation tolerant mosses seems to be sufficient for protecting the cells during
desiccation (10 % of dry mass in T. ruralis). Furthermore, lack of change in its level
in desiccation appears to be a common feature in fully desiccated tolerant mosses
(O'Toole and Cruz, 1980). These characteristics could possibly explain the constant
readiness of facing desiccation in desiccation tolerant mosses. Furthermore, reducing
carbohydrates have shown to have browning and denaturising effects on proteins in
the anhydrous state (Turner and Stewart, 1986). Reduction in the amount of reducing
carbohydrates perhaps may help with reducing the chance of oxidative damage
during desiccation.
In modified desiccation-tolerant plants and also among all non-reducing
oligosaccharides, sucrose is the main product (Bianchi et al., 1991;Proctor and Tuba,
2002;Nar et al., 2009) and the predominant carbohydrate involved in mechanisms of
protection (Scott, 2000). However, there are exceptions such as a fern-ally
resurrection species Selaginella lepidophylla in which the main protectant
carbohydrate is trehalose (Alvarez et al., 2008). The concentration of sucrose can
increase up to 20 fold compared to hydrated state or 40 % of dry mass upon
desiccation (Dominy et al., 2008). Accumulation of sucrose is one of the last
preparations for cell protection for the desiccation period. This accumulation sucrose
starts below 20 % RWC in most of resurrection plants, while others start at below 60
% RWC (Toldi et al., 2009). This is when the cell is fully committed to a period of
dormancy and the concentration of sucrose coincides with the level of ABA.
24 Chapter 1: Introduction and Literature Review
In addition to the osmoregulatory role of sucrose in drying plants, it has been
suggested that sucrose can protect the integrity of the cell membrane by hydrogen
bonding to the polar head groups of phospholipid bilayers, and preventing damage or
fusion by replacing water and maintaining the spacing between them (Crowe et al.,
1998;Ghasempour et al., 1998). Suzuki et al. (1993) demonstrated that sucrose
stabilises enzymes to a great extent in the amorphous state. Sucrose (and other
carbohydrates accumulated during dehydration) could also be used as a source of
energy during rehydration and the recovery phase (Ghasempour et al., 1998).
Trehalose
Trehalose, is a rare non-reducing disaccharide found in desiccation tolerant
species from prokaryotes (Potts, 1994) to eukaryotes. Trehalose has been found to
accumulate in viable desiccated tissues of almost all studied modified desiccation-
tolerant species with occasional exceptions such as M. flabellifolius, X. villosa, S.
atrovirens and B. hygroscopica (Drennan et al., 1993;Iturriaga et al., 2000;Nar et al.,
2009). This carbohydrate is known to be one of the sources of energy and protection
in most living organisms and can be found in many organisms, including bacteria,
fungi (up to 10–25 % by dry weight in mushrooms), insects, invertebrates and
mammals however it is extremely rare in seed plants (Knapp, 1985;Crowe et al.,
1998;Hovakimyan et al., 2012). Certain crops transformed to produce trehalose have
shown tolerance to abiotic stressors that were associated with sustained plant growth
(Jang et al., 2003;Taya, 2003).
This non-reducing disaccharide has unique properties: it is the most stable
saccharide because of its high thermostability, a wide pH-stability range; does not
show Maillard reaction (non-enzymatic browning) with acids or proteins as it is a
non-reducing carbohydrate (Knapp, 1985); and anhydrous forms of trehalose readily
regain moisture to form the dehydrate. Trehalose also has diverse biological roles:
like sucrose, it is an effective protein stabiliser that preserves the integrity of
membranes during desiccation (Crowe et al., 1998). Trehalose is also a
transcriptional factor regulator (by attaching to protein's active site) and an allosteric
carbohydrate metabolism inhibitor (Zhang et al., 2009) it is also a regulator in a
various developmental stages particularly regulating metabolic responses during
stress (Paul et al., 2008;Gazzarrini and Tsai, 2014) including sucrose-starch balance
during dehydration (Lunn et al., 2014). Due to its chemically unreactive properties
Chapter 1: Introduction and Literature Review 25
trehalose has been suggested to accumulate to large concentrations without affecting
cellular metabolism (Toldi et al., 2009). These unique characteristics of trehalose
suggest it to be ideal as a protective carbohydrate during desiccation in resurrection
plants.
Raffinose
Raffinose family oligosaccharides (RFOs) have been reported to accumulate in
desiccated tissues of resurrection plants. They are good storage molecules and as
non-reducing carbohydrates they can accumulate in large quantities without
impacting critical metabolic processes (Peters et al., 2007). Stachyose is one of the
most important RFOs that contributes to 50 % of the carbohydrate in desiccated roots
of C. plantagineum (Bartels and Salamini, 2001;Norwood et al., 2003). Müller et al.
(1997) suggested the accumulation of raffinose in drying tissues of resurrection
plants might be a pre-adaptation strategy as raffinose can prevent sucrose
crystallisation. It has also been suggested that RFOs contribute in specific ROS
processes as well as disease prevention in plants (Van den Ende and Valluru, 2009).
The accumulation of non-reducing oligosaccharides seems to have a critical
role in desiccation-tolerance in different ways. Apart from the structural protection,
the non-reducing properties of these carbohydrates perhaps make them a chemically
stable carbohydrate during the oxidative stress (reducing) during dehydration.
Sucrose, trehalose and RFOs are known to have regulatory and ROS scavenging
roles in vascular plants (Paul et al., 2008;Van den Ende and Valluru, 2009;Gazzarrini
and Tsai, 2014), however to my knowledge these properties have not been
investigated in resurrection plants during drying.
1.7.5 Proline and proteins
Proline is a low-molecular-weight osmolytes which accumulates during water
deficit in plants. Accumulation of proline is involved with the osmotic adjustment in
the cell (Wahid and Close, 2007). In plants, calcium and auxin have been identified
in signalling mechanisms participating in water deficit-induced proline accumulation
(Farooq et al., 2009). Proline has been shown to increasingly accumulate during
severe dehydration (<40 % RWC and particularly <20 % RWC) and its concentration
reduced during rehydration in E. nindensis (Vander Willigen et al., 2004).
26 Chapter 1: Introduction and Literature Review
Furthermore, proline has been shown to accumulate in the small fragmented vacuoles
during desiccation and not the cytosol of the E. nindensis (Vander Willigen et al.,
2004). A proline-rich protein has also been shown to accumulate during desiccation
in S. stapfianus under severe dehydration (Neale et al., 2000). Perhaps proline is also
involved with the vitrification state and protection of the membrane and other
macromolecules in desiccation tolerant plants.
Protein production in desiccation sensitive plants ceases at mild levels of
dehydration. However in resurrection plants, protein production is essential during
dehydration and continues until the plant has reached an almost air-dry state (Bartels
et al., 1990;Gaff et al., 1997;Proctor and Pence, 2002). The soluble protein content of
S. stapfianus in desiccation-tolerant attached drying leaves doubles while it does not
change in detached desiccation sensitive drying leaves (Whittaker et al., 2004).
Furthermore, breakdown of the proteins for recycling the components for translation
of proteins involved in desiccation-tolerance seems to be essential in resurrection
plants (Griffiths et al., 2014).
While the majority of the proteins expressed in desiccation-tolerant plants are
similar to desiccation sensitive plants, proteomic comparison of S. stapfianus with a
closely related desiccation sensitive species, S. pyramidalis revealed a set of 12 novel
proteins that might be associated with desiccation-tolerance (Gaff et al., 1997).
Gechev et al. (2013) identified five transcriptional factors that are involved in
vegetative desiccation-tolerance. The main roles of these proteins expressed during
extreme dehydration in desiccation-tolerant plants can be categorised in at least one
of the following groups. 1) protein expression, 2) structural protection (chaperones),
3) osmotic adjustment (osmolytes) or 4) ROS scavenging. Here some of the key
proteins expressed during desiccation and their role in desiccation-tolerance are
discussed.
LEA proteins
Late-embryogenesis abundant (LEA) proteins (e.g. dehydrins) play a critical
role in establishing desiccation-tolerance in mature embryos (Close, 1996). They are
also expressed during osmotic stress as a response to ABA in plants and can also be
found in all other kingdoms (Proctor et al., 1998). High levels of LEA proteins in
viable desiccated tissues of plants as well as desiccation-tolerant animals have been
Chapter 1: Introduction and Literature Review 27
reported, showing the important role of this protein in desiccation-tolerance
(Tunnacliffe et al., 2005;Liu et al., 2009). Transgenic rice expressing a LEA protein
showed drought and salt-tolerance improvement (Xu et al., 1996;Chandra Babu et
al., 2004;Xiao et al., 2007). Late-embryogenesis abundant proteins are extremely
hydrophilic and resistant to denaturation (Proctor et al., 1998). They act as chaperone
or water hydration ‘shell’ around other molecules and protect them from denaturation
(Olvera-Carrillo et al., 2010). They can prevent unfavourable molecular interactions
or biochemical activities (Olvera-Carrillo et al., 2010).
HSPs
Small heat shock proteins (HSPs) accumulate to high quantities in desiccating
vegetative tissues in resurrection plants and believed to play a key role in acquiring
desiccation-tolerance (Alpert and Oliver, 2002;Gechev et al., 2013). These proteins
are also expressed during the final stages of the seed dehydration as well as in
response to heat stress in vegetative tissues (Singla et al., 1998;Kotak et al., 2007).
HSPs have shown to protect membrane and macromolecules from damaging effects
of desiccation (Sales et al., 2000). The protective ability of HSPs is believed to be
related to chaperone -like activities of these proteins (Alpert and Oliver, 2002).
Transgenic rice overexpression of HSP101 from Arabidopsis showed significant
improvement in growth at high temperature (Katiyar-Agarwal et al., 2003).
ELIPs
Early light-inducible proteins (ELIPs) have been observed to accumulate in
desiccated tissues of homoiochlorophyllous desiccation tolerant plants such as T.
ruralis, C. plantagineum, Haberlea rhodopensis and Selaginella tamariscina (Bartels
et al., 1992;Zeng et al., 2002;Liu et al., 2008;Gechev et al., 2012). ELIPs also
accumulate in plant tissues in response to various environmental stresses such as
high light, UV-B, methyl jasmonate, cold, low oxygen and CO2 concentration,
nutrient starvation, senescence (Zeng et al., 2002). ELIPs are mediated by ABA and
light (Bartels et al., 1992) and are thought to have a key role in protection/or
repairing of the photosystem (Ouvrard et al., 1996;Zeng et al., 2002). To my
knowledge only homoiochlorophyllous desiccation-tolerant plants accumulate ELIPs
in their desiccated tissues and this might explain the suggested role of ELIPs in
protection of photosystem during desiccation.
28 Chapter 1: Introduction and Literature Review
1.8 TRIPOGON LOLIIFORMIS (F.MUELL.) C.E.HUBB. A NATIVE
AUSTRALIAN RESURRECTION GRASS
1.8.1 Australian resurrection plants
Around 25 species of resurrection plants have been identified in Australia
(Gaff and McGregor, 1979). These plants can be found in all parts of Australia and in
every habitat. However these plants tend to be found mostly in shallow soils in areas
that experience intense and/or prolonged dry seasons, even if the area has high
annual rainfall (Gaff, 1981). The most suitable areas for resurrection plants in
Australia are in subtropical, most of the tropical and winter rainfall zone of South
Australia (Gaff, 1981).
Around 16 species of Australian resurrection plants are angiosperms (Gaff and
Latz, 1978). They occur in four families and eight genera (Table 1) which all but one
(Boea hygroscopica) species are monocots (Gaff, 1981). Therefore desiccation-
tolerance has probably evolved independently a number of times in Australia (Gaff,
1981).
Chapter 1: Introduction and Literature Review 29
Table 2: The occurrence of resurrection plants in various genera and families
among Australian angiosperms (Gaff, 1981).
The number of angiosperm resurrection species in various
genera and families in Australian
Family Genus
Number of
resurrection
species
Gesneriaceae
(Dicotyledonous) Boea 1
Boryaceae Borya 3
Cyperaceae
(Sedges) Fimbristylis 2
Poaceae
(True Grasses)
Eragrostiella 1
Micraira 6
Microchloa 1
Sporobolus 1
Tripogon 1
Total
4 8 16
Resurrection capability can be seen in five families and eight genera among 16
angiosperm species.
30 Chapter 1: Introduction and Literature Review
1.8.2 Tripogon Roem. & Schult a genus of true grasses
Tripogon Roem. & Schult (Poaceae: Chloridoideae) is a genus of true grasses
with approximately 40 recognised species in the world (Newmaster and Ragupathy,
2010;Peterson et al., 2010). Tripogon species are found mostly in tropical to
subtropical parts of Asia, Australasia, North America, South America and more
commonly in Africa and India (Phillips and Launert, 1971;Clayton et al., 2010
onwards). Desiccation-tolerant species of Tripogon have been found in: South
America (1), Africa (1), Malagassy, India and Australia (1) (Gaff, 1987) although it
seems no species of Tripogon genus has been identified as desiccation sensitive
(personal communication with Professor Donald Gaff). The only species of Tripogon
in Australia is T. loliiformis (F.Muell.) C.E.Hubb which is also a resurrection grass
(Gaff and Latz, 1978;Botanic Gardens Trust, 2011). Although most resurrection
plants are not agriculturally important T. loliiformis is palatable to stock (Gaff,
1981;Tothill and Hacher, 1996).
Some micro-morphological and internal structural characteristics of the genus
Tripogon have been identified in a few previous studies. Watson and Dallwitz (2004)
have recorded that on the abaxial leaf surface of Tripogon, the following structures
occur; long cells, stomatal complex, micro hairs and saddle-silica cells. They also
refer to the absence of papilla. However, these details were not conclusive based on
the micro-morphological observation that was performed in the first part of this
project. For example, notable gland cells that exist on the abaxial surface of T.
loliiformis had not been mentioned.
Micro-morphological description of the adaxial surface of some species of
Tripogon has only been mentioned in Rúgolo de Agrasar and Vega (2007). This
description is limited to the presence of epicuticular wax, long cell, macro hair,
prickle and short cell. This description lacks the existence of structures such as
stomatal complex and gland that have been observed on the adaxial surface of T.
loliiformis. This data did not cover the differences between the structures of tip to
base of the leaf. A lack of comprehensive detailed description of the micro-
morphological structure for Tripogon can be recognised in the literature.
Some internal structures of the Tripogon has been described by Watson and
Dallwitz (2004) for example; Tripogon has Kranz type XyMS+ (double sheath)
bundle structure (Figure 2) (Lang et al., 2004). XyMS+ (“double sheath") species
Chapter 1: Introduction and Literature Review 31
have a layer of mestome sheath (inner bundle) under the bundle sheath.
Physiologically it is known that this genus is a C4 grass with NAD-ME biochemical
structure (Figure 3) biochemical type (Anderson and Briske, 1990;Lang et al., 2004).
In NAD-ME species, carbon is fixed in aspartate in the mesophyll then aspartate is
decarboxylated by NAD-malic enzyme in the bundle sheath cell mitochondria, and
alanine is returned to the mesophyll cells for the next cycle. Tripogon has been
described to be diploid with 20 chromosomes (2n=20; x=10) (Kitajima and Butler,
1975;Lang et al., 2004).
32 Chapter 1: Introduction and Literature Review
Figure 3: A schematic demonstration of enzyme compartmentalisation and
structural characteristics in C4 biochemical NAD-ME type photosynthesis.
In NAD-ME species, Carbon is fixed in aspartate in the mesophyll then aspartate is
decarboxylated by NAD-malic enzyme in the bundle sheath cell mitochondria, and
alanine is returned to the mesophyll cells for the next cycle. CO2 released in bundle
sheath is used in Calvin cycle for producing carbohydrate mediated by Rubisco
enzyme inside chloroplast. Modified from (Jami et al., 2007).
Figure 2: A schematic structure of C4 (Kranz)
type XyMS+.
In C4 XyMS+ species the procambium gives rise
to xylem, phloem, and a mestome sheath;
associated ground meristem differentiates into C4
mesophyll tissue and the bundle sheath. XyMS+
(“double sheath") species have a layer of
mestome sheath (inner bundle) under bundle
sheath. Bundle sheath (bs); Mesophyll (m);
Mestome sheath (ms); Metaxylem vessel (mv);
Phloem (p); Xylem (x).
Chapter 1: Introduction and Literature Review 33
1.8.3 Tripogon loliiformis (F.Muell.) C.E.Hubb an Australian resurrection grass
Tripogon loliiformis (Five-minute Grass, Rye Beetle-grass) is a small tufted
annual to short-lived perennial grass native to Australia and New Guinea (The Plant
List, 2010;Clayton et al., 2010 onwards). In Australia it grows almost everywhere
except Tasmania, from tropical forests, temperate climates to arid and semi-arid
areas of central Australia (Figure 4) (Orchard and Wilson, 2005;Botanic Gardens
Trust, 2011). It grows in a wide range of habitats such as: rocky slopes, plateaux and
outcrops of granite and sandstone, on plains in red sand or sandy to clayey loams in
open Acacia woodlands especially mulga and flowers and fruits throughout the year
(Orchard and Wilson, 2005).
Figure 4: Distribution of Tripogon loliiformis in Australia (Orchard and Wilson,
2005).
Dots illustrate geographical locations of Tripogon loliiformis herbarium samples
collected in Australia.
Tripogon loliiformis has small leaves, 1-7.5cm long and 0.5-1.5 mm wide
which usually are bearded with a cilicate membrane ligule (0.1-2 mm); the flowering
culms range from 3.5-20 (-55) cm high with inflorescence composed of racemes
(Orchard and Wilson, 2005;Clayton et al., 2010 onwards). This plant is very
polymorphic particularly in the hairiness of the leaves and the size of the plant (Gaff
and Latz, 1978;Gaff, 1981). However all tested specimens have shown resurrection
capability (Gaff, 1981).
34 Chapter 1: Introduction and Literature Review
Resurrection characteristics of T. loliiformis and other Australian
resurrection plants
Tripogon loliiformis is considered a resurrection grass as its vegetative tissues
can withstand air-dry state (Figure 5). Our knowledge about T. loliiformis and other
Australian resurrection plants is mainly limited to species identification and
distribution. There have also been some studies on general anatomical and
physiological resurrection characteristics of these plants such as pigmentation,
photosynthesis status and changes in nitrogen content (Gaff and Latz, 1978;Gaff and
McGregor, 1979;Gaff, 1981). Among Australian resurrection plants, genus Borya
has received more attention (Gaff and McGregor, 1979;Gaff, 1981). There is a lack
of information about the roots structural responses and some anatomical responses
such as the change in epidermis, stomata, xylem and vacuole during dehydration.
The known dehydration responses of T. loliiformis are limited to its degree of
dehydration survival (Gaff and Latz, 1978) and its quick rehydration response upon
supply of water (Tothill and Hacher, 1996). Some of its physiological responses
during dehydration and rehydration are also known, such as: chlorophyll retention
(homoiochlorophyllous) (Gaff, 1981), production of pigment (Gaff, 1981) and
change in nitrogen level (Gaff and McGregor, 1979) during dehydration.
Chapter 1: Introduction and Literature Review 35
Figure 5: The top panel shows Tripogon loliiformis in its natural habitat while
the bottom panel shows this plant grown from seeds in glasshouse in in 65mm
pots.
(A) and (D) hydrated, (B) and (E) dehydrated and (C) and (F) rehydrated plants.
36 Chapter 1: Introduction and Literature Review
Tripogon loliiformis as an experimental model
Tripogon loliiformis has many characteristics which make it suitable to be used
as an experimental model plant for studying dehydration-tolerance. Some of these
characteristics are: 1) it exhibits most of the typical elements of resurrection plants,
including the ability to withstand severe desiccation in vegetative tissues, pigment
production during desiccation and quick rehydration (Gaff and Latz, 1978;Gaff,
1981), 2) it grows almost everywhere on the Australian mainland and grows in a
wide range of habitats (Orchard and Wilson, 2005), 3) it can reach maturity and
produce seeds in a relatively short period of time, 4) it can be grown relatively easily
under greenhouse conditions (Gaff, personal communication with Mundree), 5) it is
in the same family (Poaceae) as true cereals which are an important source of staple
food and 6) it is a diploid plant which makes it easy for molecular work.
Investigation of anatomical, morphological and molecular behaviour in T.
loliiformis as a model plant during different stages of dehydration and rehydration
would result in a better understanding of dehydration-tolerance mechanisms and the
interaction of each part with one another (from gene expression to physiological
responses and anatomical changes). This knowledge can provide a better insights
into the mechanism of dehydration-tolerance which could eventually contribute to
the development of drought-tolerant crops.
1.9 BAG, A FAMILY OF PRO-SURVIVAL PROTEINS
Dehydration in plants normally results in activation of programmed cell death
(PCD), however the vegetative tissues of resurrection plants avoid PCD, suggesting
that they might be utilising pro-survival (anti-apoptotic) molecules in order to
prevent apoptosis. The bcl-2-associated athanogene (BAG) family are considered
molecular chaperones and have anti-apoptotic (or pro-survival) properties, however,
their function is not limited to this. BAG proteins are an evolutionary conserved
family of multifunctional proteins. BAG proteins have been found in many
organisms from yeast to plants and animals (Doukhanina et al., 2006). These proteins
share a conserved region near the C terminus, known as the BAG domain containing
110–130 amino acids. The BAG domain interacts with the ATPase domain of heat-
Chapter 1: Introduction and Literature Review 37
shock protein Hsp70 (Hsc70) however, the N-terminal region is different among
different BAG members (Brive et al., 2001;Sondermann et al., 2001).
1.9.1 In animals
The first mammalian BAG (BAG1) was identified in a cDNA library screening
of mouse embryo designed to identify the binding partner of Bcl-2 using human Bcl-
2 as bait (Takayama et al., 1995). BAG1 was shown to have anti-apoptotic properties
suggesting it is involved in PCD. Later studies revealed the BAG family are
molecular chaperones (Briknarová et al., 2001). In humans, six members of the BAG
family (BAG1-6) have been identified, acting as chaperone regulators interacting
with Hsp70 chaperone proteins and form complexes with a variety of transcription
factors leading to regulation of a number of diverse processes ranging from
apoptosis, tumorigenesis, neuronal differentiation, stress responses, and the cell cycle
(Zeiner and Gehring, 1995;Wang et al., 1996).
1.9.2 In plants
Although BAG proteins had been extensively studied in animals, plant BAG
family had been unknown until 2003. This is at least partly due to the problems with
identification of the BAG family in plants. Plant cells can undergo programmed cell
death (PCD), the primary sequence of plant BAG does not have strong similarity with
animal BAG homologues and therefore it was not possible to be found using usual
bioinformatics tools. It has been suggested that this difference is mainly due to the
difference between animal and plant PCD regulators (Doukhanina et al., 2006). The
first identification of plant BAG family was by Yan et al. (2003) suggesting eight
proteins for Arabidopsis BAG family. Later this classification was refined by
Doukhanina et al. (2006) using bioinformatics functional similarity approach
[profile-sequence (PFAM) and profile-profile (FFAS) algorithms] that identified
seven homologs of BAG family in Arabidopsis (AtBAG1-7). Four of these have
domain organisation similar to animal BAGs (Figure 5) (Doukhanina et al., 2006).
Transgenic tobacco plants overexpressing AtBAG4 showed resistance toward a
number of abiotic stresses (Doukhanina et al., 2006). In another study by Hoang
(2014) rice plants overexpressing AtBAG4 and OsBAG4 (from rice) were shown to
be more tolerant to salinity stress than the wild type Nipponbare rice variety.
38 Chapter 1: Introduction and Literature Review
AtBAG6 was first identified in a calmodulin binding protein screening (Kang et al.,
2005) and plays a role in plant defence to necrotrophic pathogens. Williams et al.
(2010) revealed that the BAG family in Arabidopsis is very diverse and plant BAGs
have a cytoprotective role. That study also demonstrated that AtBAG7 is localised in
the endoplasmic reticulum (ER) and interacts directly in vivo with AtBiP2 (an ER
localised HSP70) which is a molecular chaperone. The same study demonstrated
AtBAG7 is an essential component for the proper maintenance of the unfolded
protein response (UPR) during heat and cold-tolerance. While plant BAGs, and
AtBAG4 in particular, have shown to be promising for conferring abiotic stress in
transgenic plants, plant BAGs are still not well characterised.
1.10 CONCLUSION, AIMS AND OBJECTIVES
Although molecular, physiological and to a lesser extent, structural responses
of resurrection plants to dehydration have been studied since 1912 (Irmscher), most
research has been limited to a small number of species, and these have been mainly
from southern Africa (Table 1). Studying the resurrection behaviour of other species
can provide us with new insights to understand this unusual behaviour. Tripogon
loliiformis (F.Muell.) C.E.Hubb is indigenous to Australia and possesses
characteristics to be considered as a good model plant for studying resurrection
behaviour. This PhD project has examined this species as a model for studying the
resurrection behaviours during dehydration and rehydration.
1.10.1 Aims
Based on the knowledge gap in the field the main aim of this project is to
address the following question:
What are the desiccation-tolerance mechanisms of Tripogon loliiformis
(F.Muell.) C.E.Hubb?
Some sub-questions that are raised by the main question are as follows:
1. What is the general hydrated leaf structure of T. loliiformis?
Chapter 1: Introduction and Literature Review 39
2. What are the structural changes of T. loliiformis during various stages of
dehydration and rehydration?
3. What are the physiological changes of T. loliiformis during various stages of
dehydration and rehydration?
4. What is the functional mechanism of BAG4?
5. What is the difference between the function between BAG4 from a
resurrection plant with a desiccation-sensitive plant?
1.10.2 Objectives
The objectives for this project based on the project questions identified above can
be formulated as:
1. Investigation of general micro-morphological and anatomical structure of T.
loliiformis hydrated leaves.
2. Investigation of micro-morphological and anatomical changes of T. loliiformis
during various stages of dehydration and rehydration.
3. Investigation of physiological responses of T. loliiformis during various stages
of dehydration and rehydration.
4. Investigation into protein-protein interaction of BAG4.
5. Investigation into the difference between the protein-protein interaction
between BAG4 protein from a resurrection plant and a desiccation-sensitive
plant.
40 Chapter 1: Introduction and Literature Review
Chapter 2: General Materials and Research Design 41
Chapter 2: General Materials and Research
Design
2.1 RESEARCH DESIGN
The objectives of this research project (discussed in section 1.10) can be
categorised under three main areas; structural, physiological and molecular
approaches. Together these approaches provide a detailed picture of resurrection
behaviour in Tripogon loliiformis during dehydration and rehydration. Likewise the
methods used in this experiment can be divided into three general categories.
2.1.1 Structural experiments
A combination of histological techniques were used to study the structure and
structural changes in T. loliiformis leaves. As the structure of this plant is not well
described particularly on adaxial surface, first surfaces as well as the internal
structures of this plant were observed from tip to the base of the leaves. Then
desiccated leaves were observed in order to study the structural changes during
desiccation.
One of the main challenges of studying structural changes during dehydration
and rehydration is to observe the plant tissues in their natural state. Conventional
methods of tissue preparation for internal plant structure investigation usually
involve possible tissue altering procedures such as fixation, hydration, dehydration,
infiltration, embedding in a solid matrix, sectioning and staining (Bewley, 1979).
Any changes in hydration level of samples result in artificial structure changes of
tissue. In order to observe the structure of the tissues in their closest to natural state,
techniques were optimised to suit the small and delicate leaves of T. loliiformis and
to have minimum impact on the hydration level of the tissue. These techniques
included techniques such as an improved freehand sectioning method developed for
sectioning of small, delicate plant materials, and environmental scanning electron
microscopy (ESEM) where plant tissue can be placed in the chamber (which filled
with air) without being fixed nor coated and can be observed in its natural hydration
state. The following flowchart demonstrates an overview of experimental design for
42 Chapter 2: General Materials and Research Design
the structural studies of this research project. The techniques used in the structural
studies are described in detail in section 3.2.
Chapter 2: General Materials and Research Design 43
Structural studies
General features Structural changes
External (morphology)
Internal (anatomy)
Whole leaf (folding)
Microscopic (cellular level)
Light microscopy Epidermal replica Freehand sectioning Environmental scanning electron microscopy (ESEM)
Chapter 2: General Materials and Research Design 44
2.1.2 Physiological experiments
The physiological observations were design to determine the integrity of the
cell during dehydration and rehydration, as well as observing the main physiological
changes during dehydration and rehydration. For determination of the cell integrity,
two main areas were monitored; 1) chlorophyll integrity and 2) the level of
membrane integrity. For measuring the level of chlorophyll integrity two parameters
were quantified; 1) chlorophyll fluorescence and 2) chlorophyll content. Chlorophyll
fluorescence was measured using the two parameters of maximum photochemical
efficiency (Fv/Fm) and quantum yield of PSII (ΦPSII) (discussed in section 4.3.2)
using MINI-PAM. Membrane integrity was assessed using two methods of
electrolyte leakage using a conductivity meter and propidium iodide staining.
The main physiological changes among resurrection plants that have been
shown to be involved are pigmentation and gas exchange. Physiological observations
of this project examined the changes in photosynthesis rate and pigmentation using
hydration level as reference. For measuring the photosynthetic rate CO2 assimilation
of the whole plant was measured during dehydration and rehydration (using LI-
COR). The accumulation of the pigmentation was observed using light microscopy.
The following flowchart demonstrates an overview of experimental design for
physiological studies part of this research project. The techniques used in the
molecular studies are described in detail at section 4.2.
Chapter 2: General Materials and Research Design 45
Physiological studies
Cell integrity Responses
Chlorophyll integrity
Membrane integrity
Photosynthetic rate
Hydration level
Chlorophyll fluorescence
Chlorophyll content
Propidium iodide Staining
Electrolyte leakage
Relative water content
CO2 assimilation rate
Fresh dry weight ratio
Chapter 2: General Materials and Research Design 46
2.1.3 Molecular experiments
The possible role of anti-apoptotic proteins in desiccation tolerance has not
been studied in previous research on desiccation-tolerant plants. In order to address
this, we focussed on understanding the role of bcl-2-associated athanogene 4
(BAG4), an anti-apoptotic protein, and its possible involvement in desiccation
tolerance. For addressing the objectives 4 and 5 (section 1.10.2), the molecular
studies part of this research project looked at one of these proteins called bcl-2-
associated athanogene 4 (BAG4). The molecular mechanism of this protein function
is still unknown. In order to understand the possible involvement of this protein in
desiccation-tolerance, first the function of this protein needed to be investigated. In
order to understand the function of BAG4, the proteins which interact with this
protein were identified to identify the pathway it is involved. After understanding the
pathway that this protein is involved in, the proteins that interactive with BAG4 from
T. loliiformis (as a desiccation-tolerant plant) were compared with proteins that
interacted with BAG4 from Arabidopsis thaliana (as a desiccation-sensitive plant).
This was done in order to understand the possible difference between the mechanism
this anti-apoptotic protein works in a resurrection plant as compared with a
desiccation-sensitive plant. The protein-protein interaction was investigated using a
protein microarray.
The technical procedures of the molecular studies can be divided into five main
areas; 1) protein expression, 2) protein purification, 3) verification, 4) protein
microarray and 5) data analysis. Proteins expression involved insertion of the BAG4
protein from A. thaliana (AtBAG4) and T. loliiformis (TlBAG4) in the expression
vector which was facilitated using TOPO® Cloning technique and transient
expression of the constructs in the leaves of Nicotiana benthamiana using
Agrobacterium-infiltration method. Protein purification involved extraction of the
total protein from infiltrated leaves and purification of the protein using IgG
sepharose beads. The verification techniques included PCR, agarose gel
electrophoresis, Mini prepping, transforming Escherichia coli and Agrobacterium
tumefaciens using heat shock and electroporation transformations, restriction enzyme
digestion, sequencing, histochemical GUS assay were used to determine the protein
expression, and the success of protein purification was assessed using SDS PAGE,
Coomassie blue staining and Western blotting techniques. Protein microarray
Chapter 2: General Materials and Research Design 47
involved hybridisation of the extracted proteins to the microarray chips and scanning
the hybridised chips using a GenePix scanner. Finally the statistical and
bioinformatics analysis were used to analyse the data. The techniques used in the
molecular studies are described in detail in section 5.2.
Chapter 2: General Materials and Research Design 48
Molecular studies
Protein expression
Data analysis
Vector constructio
n
Protein purification
Verification of results
Protein microarray
Transient expression
Protein extraction
IgG bead purification
Protein expression
Protein purificatio
n
Microchip Hybridisatio
n
Microchip scanning
Statistical analysis
Bioinformatics analysis
TOPO® cloning in
pENTR
LR Cloning in pYL436
Agro-transformation
Agro- infiltration
PCR Total protein extraction
IgG bead separation
Cleavage purification
Sequencing
Mini prepping
Restriction digestion
Histochemical
GUS assay
SDS PAGE
Coomassie blue staining
Western blotting
Microchip Hybridisation
Microchip scanning
Generating report file
Determining significant
signals
GO enrichment
Determination of significant protein
interactors
FDR
Chapter 2: General Materials and Research Design 49
2.2 GENERAL MATERIALS
2.2.1 Sources of specialised reagents
All the reagents used in this project were sourced from reputable scientific
supply companies such as Sigma Aldrich (Australia), Roche Diagnostics
(Switzerland) and Crown Scientific (Australia). IgG Sepharose beads were purchased
from GE healthcare Life Sciences (Australia) (product number 3420), Precession
protease was purchased from Amersham Biosciences (Sweden) (product number 27-
0843-01), c-Myc Monoclonal Antibody from Invitrogen (product number AHO0062)
and CY5-conjugated anti-mouse IgG from Invitrogen (Australia) (product number
R950-25).
2.2.2 Oligodeoxyribonucleotide synthesis
Oligonucleotides were synthesised by GeneWorks (QUT, CTCB) in a
concentration of 100 µM. The stock primers were diluted to 20 µM before PCR.
2.2.3 Bacterial strains
Agrobacterium tumefaciens strain AGL1 was used for inoculation of the plants
and Escherichia coli strain XL1-Blue was used for general plasmid cloning.
2.2.4 List of general solutions
EDTA: Ethylenediaminetetraacetic acid, pH 8.0
Luria-Bertani (LB) liquid growth media: 1 % (w/v) bacto-tryptone, 0.5 %
(w/v) bacto-yeast extract, 170 mM sodium chloride.
Luria-Bertani (LB) agar: LB liquid growth media solidified with 1.5 %
bacto-agar.
TE Buffer: 10 mM Tris-HCl, pH 8.), 1 mM EDTA.
Agarose gel loading dye (6X): 0.25 % (w/v) bromophenol blue, 50 % TE, 50
% glycerol
Propidium iodide (PI): 2.5 µg/mL in water
Tris-buffered saline (TBS) buffer: 50 mM Tris, 150 mM NaCl
50 Chapter 2: General Materials and Research Design
Washing buffer: 50 mM Tris HCl pH 7.5, 150 mM NaCl, 10 % Glycerol, 0.1
% Triton
Infiltration media: 10 mM MgSO4.7H2O, 9 mM MES, pH 5.6
Cleavage buffer: 50 mM Tris HCl pH 7.0, 150 mM NaCl, 1 mM EDTA, 1
mM DTT, 0.1 % Triton
SDS running buffer: 250 mM Tris, 1.92 M glycine, 1 % SDS
SDS sample loading buffer: 50 mM Tris (pH 6.8), 1 % SDS, 15 % Glycerol,
0.025 % Bromophenol blue, 10 mM DTT.
Super Optimal Broth (SOB/SOC medium): 2% vegetable peptone, 0.5%
yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM
glucose
TAE buffer: 0.04 M Tris – Acetate, 0.0001 M EDTA, pH 8.0
TTBS buffer: 50 mM Tris, 150 mM NaCl, 0.05 % Tween 20, pH 7.6 (adjusted
by HCl)
Blotting buffer: 25 mM Tris, 192 mM glycine, 10 % methanol
Blocking buffer: TTBS, 5 % (v/w) skim milk powder
Ponceau S staining solution: dH2O, 1 % (v/v) acetic acid (16.6 M), 0.5 %
(w/v)
2.2.5 Plant material
Tripogon loliiformis plants were collected from Charleville (GPS: S 26.42686.
E 146.25002) an arid area in the state of Queensland, Australia. Inbred seeds derived
from a single mother plant were collected and stored in the fridge until being used for
all the experiments (Queensland Herbarium voucher accession number: Williams
01). Seeds were germinated in a mixture of red soil and seedling germination media
(50 % by volume each) in 50 mm pots in relatively close density and were grown in
growth cabinets under a 12h photoperiod (cold white fluorescent light, light intensity
of 900±100 µmolm-2
s-1
) with day-night temperatures of 30-20C and watered two to
three times a week with tap water and fertilized once a month. Dehydration and
Chapter 2: General Materials and Research Design 51
desiccation was induced through withholding the water until plants reached an air-
dry state before rehydration through rewatering.
52 Chapter 2: General Materials and Research Design
Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration 53
Chapter 3: Tripogon loliiformis Displays
Structural Features and
Changes that Protect It During
Dehydration
3.1 INTRODUCTION
Leaf structure has been shown to play a significant role in plant stress
tolerance, especially drying (Gutschick, 1999). In this research project leaf structural
aspects are divided into two categories, 1) structural features and 2) structural
changes. Structural features such as leaf shape, trichomes and cuticle could be
permanent or as a response to environmental conditions, growing gradually and are
irreversible. Structural changes such as leaf folding are rapid responses to
environmental changes, quick and quite often are reversible. Plants structural
features and changes are to minimise radiation damage or reduce water loss rate
(dehydration avoidance).
3.1.1 Structural features
The tissues of desiccation-tolerant and -sensitive plants share many structural
aspects; however, there are structural changes unique to viable leaves of desiccation-
tolerant plants. These unique structural changes occur mainly at the cellular level and
are not observed in the leaves of desiccation-sensitive plants. These changes take
place during very low hydration levels and are believed to be mainly for maintenance
of cell membrane integrity and prevention of mechanical damage during extreme
dehydration (Farrant, 2000;Vander Willigen et al., 2003;Vander Willigen et al.,
2004). Some of these structural changes have, also, been observed in the seeds of
orthodox seeds.
3.1.2 Structural changes
Leaf folding and rolling remain the most obvious structural changes during
dehydration which have been reported in a number of resurrection plants (e.g. Gaff,
1981;Sherwin et al., 1998;Vander Willigen et al., 2003;Moore et al., 2007;Georgieva
et al., 2010). Leaf folding and rolling result in reduced leaf surface area. Reduced
54 Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration
leaf surface area is a mechanism used by plants that reduces dehydration rate, as well
as light-induced damage during dehydration and desiccation.
One of the major problems that resurrection plants face during extreme
dehydration is the extensive reduction in cell volume. Extensive shrinkage in cell
volume can lead to fusion of the cell membrane as the result of membrane folding on
itself or plasma membrane rupture as the result of tension between plasma membrane
and plasmodesmatal connections against the rigid cell wall (Cosgrove,
2000;Hoekstra et al., 2001). To minimize these mechanical stresses, resurrection
plants respond by structural changes at the cellular level. Cell wall folding and
vacuole fragmentation are two of the main such changes observed in several
resurrection plants (Iljin, 1957;Vertucci and Farrant, 1995;Farrant, 2000;Vander
Willigen et al., 2004).
In order to investigate the structural aspects of Tripogon loliiformis, the
research was designed to first build an understanding of general morphological and
internal structures (anatomy) of the leaf from apex to base in the hydrated state; after
which structural changes of the leaves in the desiccated state were investigated.
The two main objectives of research performed in this chapter were;
1. To characterise the general structural features of T. loliiformis leaves at the
hydrated state.
2. To determine the leaf structural changes during dehydration and desiccated.
3.2 MATERIALS AND METHODS
3.2.1 Plant materials
The third fully developed leaf of three month old plants was used in all
experimental work. Seven biological replicates were collected for each structural
experiment (n = 7). Separate sets of plants were used for each experiment due to the
destructive nature of the sampling process. Internal and external structures of apex
(top 5 mm), middle and base (bottom 3-5 mm) of leaves were observed at hydrated
and desiccated state for structural studies.
Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration 55
3.2.2 Methods
Internal structures, external structures and structural changes of T. loliiformis
leaves were investigated using a combination of well-established histological
methods, namely epidermal replica construction, freehand sectioning, light
microscopy and environmental scanning electron microscopy (ESEM) and
computerised data processing analysis.
Freehand sectioning
In order to observe the internal structures of the desiccated leaves in their
natural state, a modified freehand sectioning method was developed. This optimised
method requires the sample to be placed horizontally on a flat surface. Razor blade
was held in the right hand (if right handed) and the left hand was used to stabilise the
sample. Left hand was rested on the surface close to the sample with the index finger
holding the sample. The razor blade rested perpendicular to the fingernail and the
fingernail of the left hand alone determined and controlled which site on the sample
were cut and how thin the slice were taken. Sections were directly mounted onto a
glass slide in a drop of water. Samples were covered with a coverslip without
staining or processing. Sections from dry samples were mounted directly in
anhydrous DPX mounting agent to avoid rehydration. These sections were examined
under a Nikon Eclipse 50i light microscope with an attached Nikon DS-Fi1 camera
head and photographed at different magnifications. Two sections from the apex,
middle and the base of leaf blades for each biological replicate were used for data
analysis.
Epidermal replica production
Epidermal replica production (Hilu and Randall, 1984) was performed on
leaves of T. loliiformis by coating the surfaces of the leaf with a thin layer of clear
nail polish. After nail polish was dry, the dry nail polish surface (nitrocellulose) was
peeled using sticky tape. The tape was then placed onto a glass slide. The epidermal
layer was made visible by light microscopy.
Environmental scanning electron microscopy (ESEM)
Unprocessed freshly harvested leaves were used for ESEM. To minimise
dehydration a cold stage was used to bring the sample temperature down to 2C.
56 Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration
Double-sided sticky tape was used to mount the samples on the cold stage. For
observations of leaf folding and rolling during dehydration, ESEM was used, fresh
leaves were cut and mounted vertically on Blu-Tack® mound. This was placed over a
glass slide which was fixed to a cold stage (2˚C) in ESEM chamber using double-
sided sticky tape. The upper part and base of seven leaves were used for observation
of leaf folding and rolling respectively. All the ESEM observations were surveyed
using a FEITM
Quanta 200 ESEM.
Quantitative analysis of microscopy data
The density of specialised structures such as stomatal complexes, prickle hairs
and glands were calculated from the middle region of both abaxial and adaxial leaf
surfaces (Chen et al., 2001). Seven biological and two technical replicates were
randomly selected and photographed for observation of each region. Computer-
aided determination of structure counts and distance measurements were performed
using Nikon NIS Elements Basic Research software (Version 3.21).
3.3 RESULTS
3.3.1 General structural observations
Leaf structural features play a critical role in stress tolerance. General structural
observation was done using techniques including ESEM, freehand sectioning, light
microscopy, epidermal replica construction and computerised data processing
analysis using fresh T. loliiformis leaves. A number of cells and structures of the leaf
were identified from observation of internal and external structure of T. loliiformis
(Table 3).
Investigation into leaf anatomy of T. loliiformis
The observation of internal structures of the T. loliiformis leaves from apex to
the base revealed that the number of vascular bundles was found to increase from the
apex to the base of the leaf (3-11, respectively). On the adaxial surface, the
intercostal regions (the region between bundles) were composed of enlarged, thin-
walled bulliform cells (Figure 6A,B). These bulliform cells formed parallel stripes
between the vascular bundles (in intercostal regions), which in transverse section
Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration 57
forms groups of fan-shaped cells which in turn forms grooves during dehydration
(Figure 6C,D).
58 Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration
Table 3: Abbreviations and location/section of Tripogon loliiformis leaf
structures
Cell and Structure Type Abbreviation Location/section
Bulliform Cell bu Adaxial, Transverse
Bundle Sheath bs Transverse
Colourless Cell co Transverse
Epicuticular Wax ew Adaxial
Gland g Adaxial, Abaxial
Guard Cells gu Adaxial, Abaxial, Transverse
Hooked Trichome ho Adaxial, Abaxial, Transverse
Long Cell lo Adaxial, Abaxial, Transverse
Mesophyll m Adaxial, Abaxial, Transverse
Mestome Sheath/Inner Bundle Sheath ms Transverse
Metaxylem Vessel mv Transverse
Papilla pa Adaxial, Abaxial
Phloem p Transverse
Prickle-Hair pr Adaxial
Prickle-Hair Basal Cell pr-bc Adaxial
Sclerenchyma s Transverse
Short Cell sh Adaxial, Abaxial
Short Cell- nodular sh-n Adaxial, Abaxial
Silica Cell- saddle si-s Adaxial, Abaxial
Stomatal Complex st Adaxial, Abaxial, Transverse
Subsidiary Cell su Adaxial, Abaxial, Transverse
Xylem x Transverse
Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration 59
Vascular bundles demonstrated typical Kranz anatomy associated with C4
plants and characterised by XyMS+ (mestome present) (Figure 6B). The
chloroplasts in the bundle sheath cells exhibited centripetal distribution (Hatch et al.,
1975) (Figure 6A). Vascular tissue is surrounded by mestome sheath (also known as
inner bundle sheath), bundle sheath and mesophyll (Figures 6B and 10A). Bundle
sheath is a single layer of thick wall, large cells; however in the base of the leaf,
bundle sheath can have more than one layer of cells on adaxial side (data not shown).
On both the abaxial and adaxial sides, bundle sheath and mesophyll cells were
interrupted by sclerenchymatous tissue, except on the adaxial side of the apex and
middle regions of the leaf (Figures 6B, 9abc and 10A,B). A thick cuticle layer was
observed on both surfaces except over bulliform cells where it appeared as a thin
layer (Figure 10A-C).
Investigation into micro-morphological leaf structures of T. loliiformis
Micro-morphological structures of T. loliiformis leaves were observed using
epidermal replica production and ESEM. Previous studies have poorly described the
abaxial surface of Tripogon (Oliver et al., 2000a;Lang et al., 2004) with adaxial
surfaces of Tripogon have not been described in the literature. Adaxial and abaxial
surface structure of T. loliiformis leaves are remarkably different (Figure 7). There
are a number of features on the adaxial surface which do not exist on the abaxial
surface, namely bulliform cells, prickle-hairs, papillae and epicuticular wax.
Furthermore the structure from apex to base changes. For example there is a row of
hooked trichomes on midvein of the abaxial side of the apex which does not exist on
other parts of the leaf surfaces (except the edges of the leaf).
60 Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration
Figure 6: Freehand transverse sections of hydrated and dehydrated leaves of
Tripogon loliiformis leaves.
(A) and (B) hydrated and (C) and (D) dehydrated leaves. Arrows are pointing at the
pigmented abaxial surface of desiccated leaves. Bulliform cell (bu); Bundle sheath
(bs); Mesophyll (m); Sclerenchyma (s); Phloem (p) and Xylem (x). Scale bar at (A),
(B), (C) and (D) = 100 µm.
Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration 61
Figure 7: Environmental scanning electron microscopy (ESEM) images of
representative hydrated leaves of Tripogon loliiformis.
(A) and (B) show the adaxial surface and (C) and (D) show the abaxial surface.
White lines on the top of (A) and (C) indicate the position of side veins and black
lines indicates the position of midveins. Adaxial surface is covered with a thick layer
of epicuticular wax (B). Bulliform cell (bu); Gland (g); Long cell (lo); Papilla (pa);
Prickle hair (pr); Prickle-hair basal cell (pr-bc); Saddle silica-cell (si-s); Stomatal
complex (st); Nodular short-cell (sh-n). Scale bar (A) and (C) = 100 µm and in (B)
and (D) = 25 µm.
62 Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration
Adaxial surface
The adaxial surface structure appeared to be more complex than the abaxial
surface; and additionally the surface structure of the midvein differed significantly
from apex to the base of the leaf (Figures 7 and 9). Stomatal complexes were
organised in longitudinal rows parallel to the veins between the costal and intercostal
regions (Figure 7). However, on the adaxial surface of the midvein the stomatal
complexes occurred only on the costal regions of the upper part of the leaf (Figure
7A). The density of stomatal complexes was approximately 25 % higher on the
adaxial surface in comparison to the abaxial surface (Table 4).
Table 4: The density of stomatal complex, gland and prickle hair on adaxial and
abaxial surface of the leaf per mm2.
Stomatal
complex
Gland Prickle
hair
Adaxial 403±82.2 49.7±21.4 80.1±25.8
Abaxial 322.2±66.4 75±20.4 Absent
These numbers are means of 7 replicates with two reading from each replicate.
Three types of trichomes were observed on adaxial surface of T. loliiformis
leaves; namely prickle hair, macro-hair and gland. Prickle hairs occurred only on the
costal regions of the adaxial surface as a replacement to the saddle silica-cells
(Figure 7A,B). Prickle hairs are absent on the costal region of the midvein in the
apical and mid regions of leaves, where saddle silica-cells are absent (Figure 7A).
Macro-hairs are usually abundant on the adaxial surface, however, plants that were
grown under high humidity did not develop macro-hairs. The glands were of typical
Chloridoideae two-celled salt glands (Liphschitz and Waisel, 1974;Amarasinghe and
Watson, 1988) (Figure 7A). The gland density on the abaxial surface was
approximately 50 % higher than the adaxial surface (Table 4).
In T. loliiformis, short cells consisted of saddle silica-cells alternating with
nodular short-cells; no cork cells were however observed (Figure 7). On the adaxial
surface, each costal region was covered with one row of short cells (Figure 7A,B)
except on the midvein in the apical and mid regions of the leaves (Figure 7A). Long
Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration 63
cells (also called fundamental cells) dominated the costal regions of the adaxial
surface, and were covered with papillae (Figure 7A,B).The adaxial surface of the
leaves was covered by a thick platelet-type epicuticular wax based on the
classification of epicuticular wax by Barthlott et al. (1998) (Figure 7B). The non-
orientated platelets epicuticular wax crystalloids were well developed and covered all
cells.
Abaxial surface
Similar to the adaxial surface, stomatal complexes on abaxial surface of the T.
loliiformis leaves were organised in longitudinal rows parallel to the veins between
the costal and intercostal regions (Figure 7C,D). Salt glands were observed in the
intercostal regions of the abaxial surface (Figure 7C). Macro-hairs on the abaxial
surface were only observed in plants that were grown under low humidity (data not
shown). On the abaxial surface, there were two or more rows of short cells on each
vein (Figure 7C,D). Long cells made up the greatest proportion of the epidermal
cells were present on the abaxial surface. No papillae and prickle hairs were
observed on the abaxial surface. Hooked trichomes were observed on the edges of
the leaf and on the midvein close to the tip of the leaf on the abaxial surface.
3.3.2 Structural changes
Previous studies have shown substantial structural changes occur in
resurrection plants during desiccation. These changes have a significant role in
desiccation-tolerance by helping reduce mechanical and oxidative stress. Some of the
reported structural changes in resurrection plants during desiccation are leaf folding
and rolling, vacuole fragmentation, cell wall folding and changes in the structure of
chloroplast and mitochondria (Sherwin and Farrant, 1998;Farrant, 2000;Vander
Willigen et al., 2003;Vander Willigen et al., 2004).
Drying and desiccated leaves of T. loliiformis were observed for structural
changes using ESEM and freehand sectioning. These changes can be classified in
two main groups of 1) leaf folding and 2) internal structural changes. Leaf folding
can be divided into two types of tight folding and loose folding (or rolling)
respectively. Cell wall folding and vacuole fragmentation have been observed as
internal structural changes.
64 Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration
Leaf folding
Tripogon loliiformis undergoes a range of changes during dehydration and
rehydration (Figures 8 and 10). Leaf folding is the most apparent change and occurs
at around 65 % RWC (Figures 6 and 8). At the apex and middle of the leaf, leaf
folding is tight (Figure 8A-C), In contrast, folding was loose at the base of the leaf,
folding was loose (Figure 8D-F). A comparison between the anatomy of the midvein
from the apex to the base of the leaves revealed that tight and loose folding is
directly related to the absence or presence of sclerenchymatous tissue on adaxial side
of the midvein (Figure 10a-d). When the sclerenchyma is absent at the apex and
middle of the adaxial side of the leaf, leaf folding is tight (Figures 8A-C and 9 A,B),
while in the base of the leaf where the sclerenchyma on the adaxial side is developed,
tight folding does not occur (Figure 8D-F and 9c). The existence of
sclerenchymatous tissue is directly related to the occurrence of other structures
including silica cells and prickle hairs. It was evident that whenever
sclerenchymatous tissue was present, silica cells and prickle hairs were also evident
(Figure 9).
Changes in internal structure (anatomy)
Light microscopy of untreated leaves using freehand sectioning provided insights
into the internal structure of the leaves in their natural state during dehydration and
rehydration. Almost all the internal soft structures such as bulliform cells, mesophyll,
mestome sheath and young sclerenchymatous tissue showed varying degrees of cell
wall folding during desiccation state (Figure 10B). The cell wall folding also
resulted in shrinkage of the total volume (Figure 10B). Multiple smaller vacuoles
were observed in the bundle sheath cells, which were filled with pale orange-brown
components (Figure 10B). Following rehydration, cells returned to their original
state without any apparent injury (Figure 10C).
Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration 65
Figure 8: Difference between the process of leaf folding in middle and base of
fully grown Tripogon loliiformis leaves using environmental scanning electron
microscopy (ESEM).
(A), (B) and (C) images of tight leaf folding process in the middle region of a leaf
and (D), (E) and (F) loose folding (or rolling) in the base of a fully developed leaf.
Scale bar = 200 µm.
66 Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration
Figure 9: Differences in internal and external structures from apical to basal
regions of Tripogon loliiformis leaves.
Hydrated leaves were harvested, structural features of the leaves from apex to the
base made visible using environmental electron microscopy (ESEM) (left side) and
freehand sectioning (right side). Adaxial surface apical (A), middle (B) and basal (C)
regions of the leaf. Internal structure of apical (a), middle (b) and basal (c) regions of
the leaves using freehand sectioning. The white lines represent the side veins and
black lines represent the midveins. Midvein in adaxial (A) and (B) but protruded in
(C). Arrow is pointing at sclerenchymatous tissue on adaxial surface in (a), (b) and
(c). No sclerenchymatous tissue exist on adaxial part of the midvein in (A) and (B)
but exists in (C). Bulliform cell (bu); Bundle sheath (bs); Mesophyll (m);
Sclerenchyma (s); Stomatal complex (st); Nodular short-cell (sh-n); Saddle silica-cell
(si-s). Scale bar in (A), (B) and (C) = 200 µm and (a), (b) and (c) = 100 µm.
Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration 67
Figure 10: Changes in internal structure and chlorophyll content during
dehydration and rehydration of Tripogon loliiformis leaves.
Freehand transverse sections of hydrated (A), desiccated (B) and rehydrated (C)
leaves. (D) demonstrates the changes in relative chlorophyll content during
dehydration and rehydration. Dashed line in (A) indicates mestome sheath (me). (B)
White arrow pointing to fragments of vacuole, black arrow pointing to cell wall
folding in mestome sheath and sclerenchyma cell (down), red arrows pointing to
cuticle on abaxial surface (down) and cuticle on bulliform cells (up). Chlorophyll
extraction was performed using N,N-Dimethylformamide of three replicates
(explained at section 4.2.2). Bulliform cell (bu); Bundle sheath (bs); Mesophyll (m);
Mestom sheath (me); Metaxyleme vessel (mv); Sclerenchyma (s); Stomatal complex
(st); Long cell (lo); Phloem (p) and Xylem (x). Scale bar in (A), (B) and (C) = 10
µm.
68 Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration
3.4 DISCUSSION
Leaf structural mechanisms are important aspects of plant environmental stress
tolerance. This study has demonstrated that T. loliiformis has four significant
structural mechanisms that contribute to desiccation tolerance; i) bulliform cells with
large vacuoles, ii) structures on the surface such as trichomes and cuticle, iii) the
unique position of sclerenchymatous tissue and iv) leaf folding. Bulliform cells with
large vacuoles act as water storage units during dehydration (Vecchia et al., 1998).
The presence of epicuticular wax has been associated with dehydration avoidance in
plants (Eglinton and Hamilton, 1967). Macro-hairs and prickle hairs reduce air-
movement over the leaf surface and thus reduce dehydration rate. With the absence
of prickle hairs and macro-hairs on the abaxial surface, air movement increases,
leading to less heat absorbance. The lower heat absorbance property of the smooth
abaxial surface would likely lead to lower leaf temperature. The occurrence of
macro-hairs in T. loliiformis is an adaptation response to extreme environmental
conditions as macro-hairs are absent from leaves grown under high humidity. The
salt glands might dispose the increasing salt concentration during dehydration,
resulting in dehydration prevention ion toxicity.
Dehydration of the bulliform cells (also known as motor cells) is significant
strategy to reduce the surface area through leaf folding in T. loliiformi. In T.
loliiformis bulliform cells have a thin cuticle and cell wall on the adaxial side, which
facilitate water loss and folding. Alvarez et al. (2008) has described the cell walls of
the bulliform cells in two grass species as being rich in pectin. Furthermore, they
describe the bulliform cell walls as being thin and covered by a very thin cuticle.
These characteristics perhaps increase the plasticity of bulliform cell walls which
facilitates the folding. Furthermore, the strategic location of the bulliform cells on
both sides of veins, results in the formation of grooves during dehydration, and these
act as hinges on the sides of veins leading to leaf folding.
The presence/absence and position of sclerenchymatous tissue and other rigid
structures in the leaves of rice have been linked to leaf rolling (Zhang et al., 2009).
Consistent with these observations the changes in the midvein from the apex to the
base of the leaves showed that the absence of sclerenechymatous tissue and other
rigid structures on the adaxial surface facilitate tight leaf folding along the mid-vein
(Figure 9A-C). Where these hard structures appear on the adaxial side of the
Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration 69
midvein, leaf folding is loose (like rolling) as observed at the base of the leaf (Figure
9D-F). Bell and Columbus (2008) demonstrated that leaves of Monanthochloe
littoralis (Poaceae, Chloridoideae) have a V shape similar to folding structure even in
the hydrated state. This plant also lacks the sclerenchymatous tissue and other hard
structures on the adaxial surface of the midvein. Therefore we hypothesise that the
absence of a physical obstacle on the adaxial surface perhaps contributes in the
folding of the leaf at the midvein over adaxial surface.
In T. loliiformis, leaf folding is on the adaxial surface, exposing the abaxial
side to the stressful environment during dehydration. Importantly, the epidermal cells
on the abaxial surface have a thick cuticle (Figures 7,11) thus providing a protective
layer on the exposed surface. Thick-walled sclerenchymatous tissues partially
covered the abaxial surface under epidermis (Figure 7). It is evident that this rigid-
dead tissue shields the internal part of the leaf, protecting the chloroplasts from light
resulting in lowering light induced damage while the leaf is folded.
Cell wall folding reduces tension between the plasma membrane and the cell
wall, preventing the rupture of the cell membrane or cell wall collapse (Vertucci and
Farrant, 1995;Farrant, 2000;Vander Willigen et al., 2004). In Craterostigma wilmsii
cell wall folding resulted in a 78 % reduction in mesophyll cell area following
dehydration to 5 % RWC (Farrant, 2000). Cell wall folding also results in reducing
the overall leaf surface area to minimise light-induced damage. Vander Willigen et
al. (2004) reported that cell wall folding was observed only in thin walled cells such
as mesophyll and epidermis cells of the resurrection grass Eragrostis nindensis.
Although cell wall folding can be seen only in cells with thin wall, this phenomenon
has been associated with the change in chemical composition of the cell walls during
dehydration and it is not an uncontrolled collapse due to dehydration (Moore et al.,
2013).
Increased plasticity of cell walls during dehydration has been attributed to
biochemical changes of the cell wall such as an increase in alpha-expansins,
xyloglucan endotransglucosylases, pectinesterases, pectatelyases and arabinose-rich
polymers (Jones and McQueen-Mason, 2004;Rodriguez et al., 2010;Moore et al.,
2013). A reduction of glucose in the hemicellulose of drying C. wilmsii was reported,
while xyloglucans and unesterified pectins increased (Vicré et al., 1999). Expansins
are other components which increase cell wall flexibility by disrupting the hydrogen
70 Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration
bonds between hemicellulose and cellulose polymers during dehydration (Wu and
Cosgrove, 2000;Jones and McQueen-Mason, 2004;Moore et al., 2008). Different
degrees of cell wall folding have also been reported in different parts of many seeds
(Webb and Arnott, 1982;Roberts, 1986;Woodenberg et al., 2014). Cell wall folding
is important in preserving the structural integrity of the cells during extreme
dehydration and desiccation.
As reported here, fragmentation of the central vacuole has been observed in a
number of desiccation tolerant plants (Gaff et al., 1976;Bartley and Hallam,
1979;Hallam and Luff, 1980;Farrant, 2000;Vander Willigen et al., 2003;Vander
Willigen et al., 2004). Typically, vacuole fragmentation is accompanied by a
concomitant replacement of water with non-aqueous substances and is another
protection mechanism for the plasma membrane during desiccation (Vertucci and
Farrant, 1995;Farrant, 2000). Vacuoles are considered as the major water reservoir of
cells occupying up to 80 % of the cell volume (Alberts et al., 2010). When tissue
dehydrates, the vacuole plays a critical role in cell shrinkage (plasmolysis).
In some resurrection plants such as C. wilmsii, E. nindensis, M. flabellifolius
and X. humilis, the central vacuole is fragmented into multiple smaller vacuoles and
it is suggested that the water in the vacuoles is replaced by non-aqueous substances.
The non-aqueous substances are likely to include osmolytes such as sucrose, proline
and proteins however the exact nature of these compounds is still unknown (Vander
Willigen et al., 2004). Vander Willigen et al. (2004) reported that in Eragrostis
nindensis, these small vacuoles are of different electron density, suggesting the
distribution of metabolites is not uniform in each vacuole. Further,Vander Willigen
et al. (2004) demonstrated that bundle sheath cells with thick cell walls do not
display cell wall folding, however the vacuole in these cells were replaced by
multiple smaller vacuoles.
The fragmentation of the central vacuole and replacement of water with non-
aqueous osmolytes can alleviate mechanical stress by preventing shrinkage as well as
increasing the osmotic pressure (Vander Willigen et al., 2004). While these small
vacuoles constitute nearly 13 % of the total dry mass in dry leaves, they occupy over
30 % of the leaf tissue (Vander Willigen et al., 2004). Fragmentation of the vacuole
also changes the surface to volume ratio (Michaillat and Mayer, 2013), which could
possibly prevent extensive folding of the tonoplast and irreversible fusion during
Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration 71
desiccation. After rehydration the fragmented vacuoles coalesce into a single central
vacuole.
The structural features of T. loliiformis leaves share structural features of plants
from arid areas. These features contribute to desiccation-tolerance by providing the
needed time for developing desiccation-tolerance. Structural changes during
dehydration are to protect the plant against light induced and mechanical damage,
while leaf folding also results in reducing the rate of water loss. All of these features
show that leaf structure plays a critical role in desiccation tolerance in T. loliiformis
and possibly other resurrection plants.
72 Chapter 3: Tripogon loliiformis Displays Structural Features and Changes that Protect It During Dehydration
Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and Rehydration 73
Chapter 4: Physiological Responses of
Tripogon loliiformis Leaves
During Dehydration and
Rehydration
4.1 INTRODUCTION
Plants react to dehydration with a range of diverse physiological responses.
Physiological responses are particularly critical for desiccation-tolerance of
resurrection plants. Examples of physiological responses seen in resurrection plants
include changes in photosynthesis, stomata closure, pigmentation and respiration
(e.g. Hsiao, 1973;Farrant, 2000).
One of the main problems plants face during dehydration is oxidative stress
resulting from the accumulation of reactive oxygen species (ROS). This ROS
accumulation is mainly due to the disruption of the photosynthesis electron chain
during dehydration (mostly due to CO2 shortage). Accumulation of ROS can damage
macromolecules (particularly the photosynthetic apparatus), membranes and even
trigger apoptosis in high concentrations. Therefore, the integrity of macromolecules
and membranes is used as a benchmark for determining the level of cellular stress
and ROS damage.
Resurrection plants undergo many physiological changes during dehydration
and rehydration, many of which are designed to minimise water loss and oxidative
damage. Similar to desiccation-sensitive plants, water loss in resurrection plants is
regulated through tight control of stomatal complexes to slow down dehydration.
This provides the time needed for inducing desiccation-tolerance in the vegetative
tissues during dehydration. The accumulation of ROS is minimised mainly through
reducing photosynthesis. Resurrection plants are known to reduce their
photosynthesis faster than desiccation-sensitive plants (Farrant, 2000) perhaps as
they are primed for desiccation. There are a number of mechanisms that plants use to
reduce photosynthesis including, 1) stomatal closure (particularly effective on C3
plants), 2) down-regulation of photosynthetic related gene expression, 3) breaking
down the photosynthetic apparatus (more effective among poikilochlorophyllous
74 Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and
Rehydration
resurrection plants), 4) reducing light-chlorophyll interaction through pigmentation
of leaves and reduction in leaf surface area.
The two main objectives of this chapter were:
1. To characterise the main physiological changes that takes place during
dehydration and rehydration.
2. To determine level of oxidative damage as the result of oxidative stress
through examining the integrity of the photosynthesis apparatus, plasma
membranes and cell viability throughout dehydration, desiccation and
rehydration.
4.2 MATERIALS AND METHODS
4.2.1 Plant materials and dehydration and rehydration treatment
Plants derived from seeds of a single mother plant were grown for three
months before experiments commenced. Plants were dehydrated by withholding
water until an air-dry state was reached; rehydration occurred for three days. A
minimum of three (n=3) biological replicates were used for each experiment.
4.2.2 Methods
A series of physiological experiments has been conducted in order to monitor
the physiological changes and ROS damage during dehydration and rehydration. The
main physiological changes associated with desiccation tolerance including
chlorophyll integrity and photosynthetic rate were investigated using light
microscopy and photosynthetic rate measurement techniques. The integrity of the
cell membrane and chlorophyll were examined in order to determine the degree of
damage made by ROS on the cells. Cell membrane integrity was determined by
measurement of electrolyte leakage (EL) and confirmed using propidium iodide (PI)
staining. Chlorophyll integrity was tested though measuring chlorophyll content and
chlorophyll fluorescence. Changes in hydration levels have been observed through
RWC and Fresh-Dry weight ratio measurement.
Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and Rehydration 75
Water content
Relative water content was determined by the standard formula RWC (%) =
(FW-DW)/(TW-DW)*100 (Turner, 1981) [relative water content (RWC); fresh
weight (FW); turgid weight (TW)]. Total leaves from three plants were harvested
(n=3) every day and processed separately. To measure full turgor leaves were placed
in a plastic zip-lock bag with damp filter paper and incubated at 4C overnight. Dry
weight was measured following two days incubation in an oven at 70C.
Quantification of chlorophyll fluorescence and content
To investigate the impact of abiotic stresses and damage to chlorophyll during
dehydration and rehydration, the maximum photochemical quantum yield of
Photosystem II (PSII) (Fv/Fm) and effective photochemical quantum yield of PSII
(ΦPSII) were measured with a portable chlorophyll fluorometer PAM-2500 (Waltz
GmbH, Effeltrich, Germany). Measurements were performed on the third fully
expanded leaf from three leaves (n=3) attached to the plants. Maximum
photochemical efficiency (Fv/Fm) was determined on leaves that were dark-
acclimated for 30 minutes (Kitajima and Butler, 1975). Effective photochemical
quantum yield of PSII in the light adapted state was calculated as the average of the
first five readings using ΦPSII= (Fm′ – Fs)/Fm′ (Genty et al., 1989).
Five plants were used as biological replicates for the measurement of
chlorophyll content; replicates were normalised by dry weight. Extraction of
chlorophyll was done using N,N-Dimethylformamide (Inskeep and Bloom, 1985). To
minimise light and temperature-induced chlorophyll degradation all extracts were
kept on ice and in the dark. Total chlorophyll content were quantified by
spectrophotometric absorbance at 665 and 649 nm and calculated using the modified
formula described in Inskeep and Bloom (1985), total Chl = 17.90A649 + 8.08A665.
For statistical significance, the mean value of three technical replicated
measurements was used, for each biological replicate.
Validation of membrane integrity
Cell membrane integrity was determined by measurement of electrolyte
leakage using a conductivity meter (CM100-2, Reid & Associates CC, Durban,
South Africa). Briefly, three leaves from three biological replicates (plants (n=3))
were cut in 1 cm segments and washed two times in deionized water to remove
76 Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and
Rehydration
surface electrolytes. Residual surface water was removed and the leaf segments were
placed into provided 3.5ml wells that were filled by deionized water. Electrolyte
leakage was measured and calculated according the manufacturer’s instruction.
Propidium iodide (PI) is a membrane impermeable stain and an established
marker of cell membrane integrity. To investigate cell membrane integrity during
dehydration and rehydration three biological and technical replicates were stained
with PI at each hydration point, specifically, hydrated, desiccated and rehydrated.
Samples that had been boiled for 10 minutes in water to disrupt cell membranes
before staining were also included and served as positive staining controls.
Preparation of the PI solution and leaf staining was done as described in Rolny et al.
(2011). Stained leaves were mounted onto slides and examined under an A1Confocal
Microscope (Nikon, Japan). Green images representing nonspecific fluorescence
taken under 488 nm laser were used as contrast to red images as the result of PI
excitation under 561 nm laser.
Quantification of photosynthetic efficiency
Net photosynthesis (A) was measured using a whole Arabidopsis chamber and
a LI-COR 6400-XT InfraRed Gas Analyzer (IRGA) (John Morris Scientific,
Chatswood, NSW, Australia). To minimize erroneous readings due to soil-born CO2
contamination, chamber CO2 levels were maintained above ambient levels. To keep
the CO2 in the chamber above the ambient level, first the level of atmospheric CO2
was measured and then the CO2 supply for the chamber was set to be above that. To
monitor gas exchange through dehydration and rehydration, the same plant was
monitored daily; triplicate plants were assessed. Results are presented as the relative
mean value of photosynthesis rate compared to the photosynthesis rate of the
hydrated plant.
4.3 RESULTS
4.3.1 Leaf water status and pigmentation
Studies have shown that the time taken to dehydrate is vital for the potential of
resurrection plants to resurrect. Plants maintained their leaf RWC for the first few
days before losing approximately 80 % of their RWC within two days (day four and
Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and Rehydration 77
five). Plants reached an air-dry state (below 10 % RWC) on day six. Upon
rewatering at day six the water level in leaves rose gradually to around 40 % RWC
on day nine (Figure 11). Leaf folding took place at around 65 % RWC and leaves
developed an intense purple pigment intensifying to purple-black on abaxial surface
shortly after leaf folding was completed (Figures 6C,D and 10B). The pigmentation
was quickly lost as plants rehydrated. Plants dehydrated under low light intensity
usually did not develop pigmentation while they are able to resurrect (data not
shown). Desiccation tolerance is usually induced in young and increasingly mature
leaves, while senescing leaves normally do not resurrect. Approximately 30 % of the
total chlorophyll content was lost after dehydration and reconstruction of chlorophyll
after rehydration was slow (Figure 10D).
4.3.2 Chlorophyll a fluorescence
Photosynthesis is particularly sensitive to dehydration stress therefore the
health of the photosystem apparatus, commonly determined by measurement of
Chlorophyll a fluorescence from photosystem II (PSII) is considered a reliable
indicator of ROS levels and damage. To investigate the level of ROS damage during
dehydration and rehydration, the fluorescence of chlorophyll a was observed
throughout dehydration and rehydration; two chlorophyll a fluorescence parameters
were monitored 1) maximum photochemical quantum yield of Photosystem II
(Fv/Fm) (Figure 12A) and 2) effective photochemical quantum yield of PSII (ΦPSII)
(Figure 12B). As expected from a homiochlorophyllous plant the Fv/Fm and ΦPSII
showed similar trends and were almost steady throughout the dehydration and
rehydration period except during day five, six and seven. Severe dehydration during
these three days led to leaf folding. Leaf folding limited the light access to
chlorophylls and made an accurate chlorophyll fluorescence measurement
technically impossible.
78 Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and
Rehydration
Figure 11: Changes in water content during dehydration and rehydration in
Tripogon loliiformis leaves.
(A), changes in relative water content (RWC) and (B), changes in fresh-dry weight
ratio (FW/DW). Rewatering was taken place at day six and the soil was kept moist
for the following three days. Each measurement was done on leaves of three plants.
Figure 12: Changes in chlorophyll fluorescence during dehydration and
rehydration in Tripogon loliiformis leaves.
Triplicate plants were monitored for chlorophyll fluorescence throughout
dehydration and rehydration. Plants were assessed for (A), and (C), maximum
photochemical yield of photosystem II (Fv/Fm), and (B) and (D) for photochemical
Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and Rehydration 79
quantum yield of PSII (ΦPSII). (C) and (D) demonstrate the average chlorophyll
fluorescence versus relative water content.
80 Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and
Rehydration
4.3.3 Estimation of the membrane integrity
Two types of stress can cause the loss of membrane integrity during
desiccation. Firstly due to increasing tension between plasma membrane and
plasmodesmata connections against the rigid cell wall during severe dehydration
(mechanical damage). Secondly, oxidation and damage of macromolecules in the
membrane by ROS (oxidative stress). Membrane damage leads to the release of
electrolytes from the cells and the rate of electrolyte leakage is linked to the level of
membrane integrity and cell vitality. The level of membrane integrity during
dehydration and rehydration was determined by observation of changes in electrolyte
leakage (EL) and propidium iodide (PI) staining.
Consistent with leaf RWC, the level of electrolyte leakage during the first
three days was stable (Figure 13). As the leaf RWC dropped, the EL rate (ELR)
increased incrementally, by day five, the ELR was 2.5 fold higher than day four
before peaking at a 25 fold increase by day six. Upon rewatering, the ELR was
quickly reduced to approximately 1/3 by day 9 (three days post-watering). A
comparison between changes in RWC and EL shows that the level of EL started to
increase after RWC<90 % and EL rate accelerated sharply by reaching RWC< 60 %.
Two-thirds of the increased EL occurred below 20 % RWC (Figure 13). The
resurrection of T. loliiformis, despite the sharp increase in EL during extreme
dehydration, might suggest that increase in EL might not be the indicator of the
membrane integrity, or the membrane integrity is regained after rehydration. Further
verification of the membrane was needed to observe the integrity of the membrane
during dehydration and rehydration.
To further investigate membrane integrity dehydrating, desiccated and
rehydrated leaves were stained with propidium iodide (PI); hydrated leaves that had
their membranes disrupted by boiling were also included as controls. Propidium
iodide is a membrane impermeable DNA dye that stains the nuclear acid of the cells.
Cells with damaged membrane are permeable to PI and display strong nuclear
staining when excited by fluorescent light. As shown in figure 14, leaves from
hydrated, fully dehydrated and rehydrated plants were impermeable to PI and no
nuclear staining was observed. Contrastingly, PI permeated the boiled controls which
demonstrated strong nuclear staining (Figure 14).
Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and Rehydration 81
Figure 13: Demonstrating cell membrane integrity in leaves using conductivity
measurement during dehydration and rehydration in Tripogon loliiformis
leaves.
Changes in electrolyte leakage (EL) levels during dehydration and rehydration (A)
and in comparison with changes in relative water content (RWC) (B). Error bars
represent the square root of the standard deviation of the number of samples.
82 Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and
Rehydration
Figure 14: Confocal laser-scanning microscopy of propidium iodide (PI) stained
hydrated, dehydrated (air-dry), rehydrated and control leaves of Tripogon
loliiformis.
Leaves were harvested and stained with PI. Fluorescence was made visible by
confocal microscopy and excitation at 488 nm (left), 561 nm laser (middle) and
merged (right). Green fluorescence images are used as a contrast to red fluorescence
light which represents PI stained area. Stained nuclei can be seen stained as red in
red and merged images of control leaf (bottom). Control leaves were boiled for 10
minutes in order to disrupt the membrane integrity. Scale bar = 50 µm.
Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and Rehydration 83
4.3.4 Photosynthesis rate
One of the earliest responses of plants to a drop in RWC is the shutdown of
photosynthesis. To further investigate the photosynthetic responses of T. loliiformis
during dehydration we analysed gas exchange and CO2 assimilation using a LI-COR
IRGA. As shown in figure 15, net photosynthesis rate was very sensitive to changes
in hydration levels. At around 90 % RWC, photosynthesis declined by 20 % and
when RWC reached 80 %, photosynthesis was approximately half the level of
photosynthesis before dehydration. There was no measurable photosynthesis at
around 70 % RWC. Photosynthesis was resumed quickly after rehydration (Figure
15).
84 Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and
Rehydration
Figure 15: Changes in photosynthetic rate during dehydration and rehydration
in Tripogon loliiformis.
Error bars represent the square root of the standard deviation of the number of
samples. Three different replicates (n=3) were used for measuring the
photosynthesis.
Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and Rehydration 85
4.4 DISCUSSION
This study has demonstrated that T. loliiformis has two significant
physiological changes that contribute to desiccation tolerance. These include pigment
accumulation and shutting down the photosynthesis during dehydration.
Furthermore, this study demonstrated that T. loliiformis maintains the integrity of
membrane and much of its photosynthetic apparatus and cells remain viable
throughout dehydration, desiccation and rehydration.
The abaxial epidermis of T. loliiformis is heavily pigmented with anthocyanin
during dehydration (Figures 6D and 10B). This pigmented shield reduces the
excessive radiation injuries and free-radical formation caused by radiation (Bartels et
al., 1992). Dehydration-induced pigmentation is a common feature among
homoiochlorophyllous resurrection plants such as in Craterostigma wilmsii and
Myrothamnus flabellifolius (Sherwin and Farrant, 1998;Farrant, 2000). In T.
loliiformis, this pigmentation appears to be an adaptation response towards high
radiation. Although the pigmentation of the leaves helps with the prevention of
radiation damage during dehydration, the existence of pigmentation seems not
essential in resurrection plants as leaves that are not dehydrated under intense light
and have not produced pigmentation also resurrect (data not shown). Gaff et al.
(2009) also reported similar behaviour in Sporobolus stapfianus when purple
pigmentation was not produced under low light dehydration while plants still
resurrected.
Consistent with observations made by Gaff and McGregor (1979) these results
showed that T. loliiformis maintains most of its chlorophyll during desiccation
(Figures 6,10), which means this plant is a homoiochlorophyllous resurrection plant.
As a homoiochlorophyllous resurrection plant, photosynthesis-induced oxidative
stress is one of the major challenges during desiccation. Reducing light-chlorophyll
interaction through reducing leaf surface area by leaf folding and pigment
accumulation are two strategies that T. loliiformis utilizes to minimise the effect of
light-induced oxidative stress during dehydration. Furthermore, breakdown of 30 %
chlorophyll content could also help with photosynthesis-induced oxidative stress
during desiccation.
While the chlorophyll fluorescence could not be measured during severe
dehydration (when leaves were folded), the chlorophyll fluorescence rate before and
after leaf folding suggested that chlorophyll was protected and remained largely
86 Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and
Rehydration
intact from ROS damage during dehydration (Figure 12). Similar trends for
chlorophyll fluorescence during dehydration and rehydration with a lack of signal
during desiccation were reported in the resurrection plant Haberlea rhodopensis
(Gechev et al., 2013).
Despite increases in conductivity during dehydration, all leaves resurrected,
indicating that cell membranes remain structurally intact during dehydration. Similar
trends in electrolyte leakage (EL) rates were observed by Georgieva et al. (2012)
during dehydration and rehydration in the resurrection plant Haberlea rhodopensis
and increase in EL during desiccation has also been shown in three resurrection
plants Xerophyta humilis, Craterostigma wilmsii and Myrothamnus flabellifolius
(Farrant et al., 2003). This trend of EL in viable tissues of resurrection plants
indicates that the increase in EL during dehydration is not an indicator of membrane
integrity, as loss of membrane integrity is fatal to cells.
Furthermore, Georgieva et al. (2012) also showed that phospholipid
peroxidation did not occur during desiccation, which is an indication of protection
against oxidative damage and membrane integrity. Bajji et al. (2002) suggested the
increase in electrolyte conductivity under osmotic stress in durum wheat is due to an
increase in organic ions and not membrane damage. Rolny et al. (2011) demonstrated
the increase in EL in dark induced senescence in leaves of barley correlated with
ammonium accumulation due to macromolecules degradation; while the cell
membrane integrity was maintained. They suggested the main source of this
ammonium production is from the breakdown of chloroplast which contains up to 70
% protein in the mesophyll cells. The cell membrane integrity during dehydration
and rehydration in T. loliiformis was further proved to remain intact by propidium
iodide staining. A comparison between the staining level of hydrated, dehydrated and
rehydrated tissues with the control boiled sample showed that the cell membrane
remained largely intact (Figure 14).
Gaff and McGregor (1979) observed that during desiccation, non-protein based
nitrogen levels increased significantly in T. loliiformis and decreased during
rehydration while protein-based nitrogen reduced during dehydration and increased
during rehydration. This increase in non-protein based nitrogen and reduction in
protein-based nitrogen is due to the increase in ammonium as the result of protein
breakdown during dehydration, and the increase in protein-based nitrogen and
Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and Rehydration 87
reduction in non-protein based nitrogen during rehydration is likely due to the flush
of ammonium and the reconstruction of proteins during rehydration.
The increase in EL in T. loliiformis during desiccation is perhaps accompanied
with the breakdown of macromolecules particularly those of photosynthetic
apparatus. In T. loliiformis approximately one third of the chlorophyll is lost during
dehydration. While about two third of the soluble protein is degraded (Gaff and
McGregor, 1979). Therefore, we hypothesize that the main source of this increase in
EL during dehydration is from breakdown of macromolecules. The quick reduction
in EL after rehydration could be due to the electrolytes being flushed by water.
The initial EL increase was at around 90 % RWC, when the plant starts to
dehydrate. This degradation increases as dehydration continues and is accelerated
incrementally from 60 % to the point that 2/3 of the increase in EL took place under
20 % RWC. This perhaps means that the breakdown of macromolecules starts at very
early stages of dehydration as the plant starts to prepare for desiccation. Surprisingly,
the increase in proline concentration was also shown to occur in a very similar
pattern to EL in the resurrection grass E. nindensis (Vander Willigen et al., 2004).
Our speculation is that the accumulation of this amino acid during dehydration could
be in part from breakdown of macromolecules during dehydration.
The initial impact of dehydration on photosynthesis in T. loliiformis started at
the very early stages of dehydration with photosynthesis ceasing at relatively high
levels of hydration (Figure 15). Similar trends have also been reported in a number
of resurrection plants (Tuba et al., 1996b;Tuba et al., 1998;Farrant, 2000). Minor
dehydration triggered reduction in photosynthesis which was perhaps due to the
stomatal closure. In T. loliiformis plants maintained approximately 50 % of their
photosynthetic activity until 80 % RWC while the stomata are closed. Stomatal
closure reduces dehydration rate and provides the time needed for developing
desiccation tolerance and preparing for the desiccation phase. Unlike C3 plants, C4
plants can retain significant levels of photosynthesis while the stomata are closed
(Farquhar and Sharkey, 1982;Flexas and Medrano, 2002). This is due to the C4
photosynthetic mechanism which concentrates the CO2 around Rubisco so that even
the small amount of the CO2 which passes through the cuticle is enough for a
significant level of photosynthesis while the stomata are closed (Boyer et al.,
1997;Ristic and Jenks, 2002).
88 Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and
Rehydration
At around 70 % RWC photosynthesis stops and this coincides with the start of
leaf folding. Photosynthesis resumed quickly upon rehydration to a comparable level
of photosynthesis at same hydration level before dehydration. The quick resumption
of photosynthesis upon rehydration is typical of homoiochlorophyllous DT plants
due to maintaining a significant amount of the photosynthetic apparatus during
dehydration.
Physiological observations related to photosynthesis and electrolyte leakage
(EL) suggest that T. loliiformis is very sensitive to dehydration and starts to prepare
for desiccation at very early stages of dehydration. This quick response to
dehydration could be justifiable based on microhabitats that this plant is commonly
found at i.e. rocky outcrops and shallow rock-pan soils with limited water capacity.
The first response to dehydration is the closing of stomata which results in a
reduction in both photosynthesis as well as transpiration rate.
To conclude, physiological changes protect the plant against oxidative stress
caused by photosynthesis. The photosynthesis is reduced at early stages of
dehydration perhaps through stomatal closure, and later through leaf folding,
pigmentation of the leaves and partial degradation of chlorophyll. Chlorophyll is
protected from oxidative damage during dehydration and rehydration or is repaired
quickly after rehydration. Cell membrane integrity is largely maintained during
dehydration and rehydration. The increase in EL during dehydration is not related to
the loss of membrane integrity and perhaps is related to the release of organic
electrolytes produced during dehydration.
Chapter 4: Physiological Responses of Tripogon loliiformis Leaves During Dehydration and Rehydration 89
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 90
Chapter 5: Protein-protein Interaction
Profile of BAG4 Suggests A
Possible Role Within
Chaperone-mediated Autophagy
5.1 INTRODUCTION
Resurrection plants are unique in the ability of their vegetative tissue to tolerate
extreme desiccation but rejuvenate upon addition of water. This trait is reminiscent
of seeds and suggests that Tripogon loliiformis and potentially other resurrection
plants are able to implement effective cytoprotective measures that protect cells and
tissues throughout desiccation. Preliminary research of T. loliiformis shoots
throughout dehydration, desiccation and resurrection performed in the CTCB
suggests that during dehydration and desiccation, T. loliiformis suppresses apoptosis
and senescence pathways whilst promoting pro-survival autophagy pathways
(Williams et al., unpublished). The work performed in this chapter built upon these
interesting findings and was focused on the protein-protein interactions of the
established pro-survival protein, bcl-2-associated athanogene 4 (BAG4). To
investigate whether resurrection plants have evolved unique pro-survival pathways
compared to their desiccation sensitive counterparts, comparative studies of the
protein-protein interactions of BAG4 proteins isolated from Arabidopsis thaliana
(desiccation-sensitive) and T. loliiformis (desiccation-tolerant) were performed.
5.1.1 Programmed cell death
Programmed cell death (PCD) is an innate programme of molecular and
physiological pathways that leads to cell death (Williams and Dickman, 2008).
Programmed cell death is an everyday process and occurs in all multicellular
organisms, including plants, and depending on the context is sometimes triggered in
response to environmental stress. Senescence as a form of cell death occurs in the
vegetative tissues of desiccation-sensitive plants following extreme dehydration
stresses such as salinity and drought where it is thought to be a nutrient recycling
mechanism that benefits the overall plant/organism. Desiccation-tolerant plants avoid
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 91
senescence even during desiccation. The avoidance of senescence by resurrection
plants during dehydration suggests that these plants might acquire anti-apoptotic
(pro-survival) proteins during that period. The bcl-2-associated athanogene 4
(BAG4) is a molecular chaperone and is one pro-survival molecule that is known to
suppress apoptosis pathways (Doukhanina et al., 2006) and may also be involved in
the repression of senescence.
5.1.2 BAG4
BAG (Bcl-2-associated athanogene) is a family of chaperone regulators which
all share a conserved BAG domain (BD) and has 7 homologues in A. thaliana
(Doukhanina et al., 2006). AtBAG4, a multi-functional protein and remarkably
similar to its mammalian counterpart, is an important regulator of apoptotic-like cell
death in plants. AtBAG4 has been shown to be involved in cell death pathways in
response to a wide range of abiotic stresses as well as being involved in different
growth and given development processes (Doukhanina et al., 2006). Model plants
overexpressing AtBAG4 displayed increased tolerance against a range of abiotic
stresses including UV light, cold, oxidants, and salinity (Doukhanina et al., 2006).
Furthermore, mutant plants displayed a range of growth and developmental changes
including earlier flowering and shorter vegetative and reproductive phases,
producing more branched roots and inflorescences compared with wild-type controls
(Doukhanina et al., 2006). While BAG4 has shown to be involves in a wide range of
developmental stages and abiotic stresses, however the mechanism that this molecule
work is still unknown.
The cDNA of BAG4 from T. loliiformis was isolated and sequenced at Centre
for Tropical Crops and Biocommodities, Queensland University of Technology
(CTCB, QUT) (Williams, unpublished). This gene encodes a 274 aa protein,
however apart from basic sequence analysis the gene is largely uncharacterised. To
date, no BAG family members have been isolated from resurrection plant species.
Due to the observation that T. loliiformis “avoids” PCD even at the desiccation state
(pre-existing T. loliiformis tissues resurrect) and the pro-survival characteristics of
BAG4 proteins, it was feasible to compare protein-protein interaction between
desiccation sensitive and desiccation tolerant plants.
92 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
5.1.3 Protein microarray
The function of a particular protein is largely dictated by its surrounding
proteome and its protein-protein interactions (Waugh, 1954). Traditional methods
such as yeast two-hybrid, in addition to some of the newer fluorescent microscopy
methods enable researchers to study many of these protein-protein interactions.
However, these methods are either laborious, and require, at least to some degree, the
identities of the protein partners to be known or they are also limited in that they only
allow the investigation of single or several interacting proteins at any given time and
thus cannot be used at a large-scale without significant effort. The recent advent of
protein microarrays has emerged as a facile, yet effective means to systematically
analyse potential protein interactions of a given protein of interest. Due to its high
throughput nature, protein microarrays enable the investigation of entire protein-
protein interaction maps (Díez et al., 2012;Sutandy et al., 2013). In essence, protein
microarrays represent a large scale western blot that is performed on a chip that
could have an array of up to thousands of captured proteins. Despite significant
progress in the mammalian field, plant-based protein arrays until recently have not
been available. The recent development of a high-density Arabidopsis protein
microarray enables the study of protein-protein interaction in plants and provides
great potential for the elucidation of plant protein networks. Research reported in this
chapter focused on this investigation and involved the analysis of protein interactions
of AtBAG4 with TlBAG4 to determine whether the T. loliiformis BAG4 protein has
evolved a different suite of protein-protein interaction compared with the
desiccation-sensitive plant, Arabidopsis thaliana. To perform this investigation we
used A. thaliana microarray chips with 5000 proteins fixed on each slide.
The two main objectives of this chapter were:
1. To identify the protein interaction pattern of AtBAG4 and TlBAG4.
2. To investigate the difference between the protein interactions AtBAG4 and
TlBAG4.
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 93
5.2 MATERIALS AND METHODS
The molecular studies of this research project used a wide range of molecular
experiments and data analysis method to determine the protein-protein interaction of
BAG4. As was described in section 2.1.3 the technical procedures of the molecular
studies can be divided into five main areas; 1) protein expression, 2) protein
purification, 3) verification, 4) protein microarray and 5) data analysis. An overall
experimental design of molecular work is demonstrated in Figure 16.
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy 94
4 sticky tails at 5’ was added and the TAG sequence at 3’ was removed through PCR
Gene was inserted into pENTR vector through
TOPO® Cloning
Genes were inserted into pYL436 vector through LR Cloning
Agrobacterium tumefacients cells were transformed using
electroporation transformation
GUS in Nicotiana benthamiana was expressed through
Agrobacterium-infiltration
Proteins were separated and visualised using SDS Page electrophoresis and
Coomassie blue staining
Protein extraction and purification were done
by IgG sepharose beads
Plasmids was multiplied through transforming and culturing Escherichia coli using heat-shock transformation
Plasmid was extracted from E. coli through
mini prepping
Intactness of plasmid was verified through sequencing
and restriction digestion
Plasmid was multiplied through transforming and culturing E. coli
through heat-shock transformation
Plasmid was extracted from E. coli through
mini prepping
BAG4 was expressed in N. benthamiana through
Agrobacterium-infiltration
Intactness of plasmid was verified through restriction digestion
Existence of the target protein was verified
through Western Blotting
Successful infiltration was verified through
GUS staining
Purified protein was hybridised (probed) against
Arabidopsis protein array slide
The probed microarray was scanned using a Genepix
4300A slide scanner
The protein microarray scanned results was
statistically analysed
Statistical results of protein microarray was analysed by
bioinformatics tools
Figure 16: The experimental design of molecular work procedure.
95 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-
mediated Autophagy
5.2.1 Polymerase chain reaction (PCR)
Reactions were performed in a final volume of 20 µl and included Taq DNA
polymerase (5 units), 400 µM dNTPs 3 mM MgCL2, DNA Dye (Promega), 0.5 µl of
each primer (working concentration of primers was 20 µM), DMSO 10 % (v/v of
final concentration) and autoclaved dH2O. PCR was carried out either in a Peltier
Thermal Cycler – 200 (MJ research - USA) or in a Peltier Thermal Cycler (Gradient
Cycler - Bio-RAD - USA).
The PCR parameters used were;
Denaturation 94˚C 2 min
Denaturation 94˚C 30 sec
Annealing 50˚C 30 sec 30 cycles
Extension 72˚C 70 sec
Final extension 72˚C 10 min
5.2.2 Agarose gel electrophoresis
Agarose gels (1.5 % (w/v)) were made by dissolving agarose (Roche
diagnostics- USA) in 1 X TAE buffer containing 0.5 X SYBR Safe DNA gel stain
(Invitrogen – USA). The EasyCast Mini Gel System was used for casting and
running the gel. Once set, approximately, 12-20 µl of the amplicons including 6 X
bromophenol blue loading were loaded into the gel for electrophoretic separation and
visualisation. Electrophoreses was performed at 120 V for 30 mins unless otherwise
stated. All gels were viewed and photographed using a Syngene Geldocsystem (G-
box and GenSnap version 6.07) (Syngene - UK).
5.2.3 AtBAG4 and TlBAG4
The Arabidopsis thaliana (insert size 840 bp) and Tripogon loliiformis (insert
size 825 bp) BAG4 nucleotide sequences which were extracted from cDNA library
of A. thaliana and T. loliiformis by Dr Brett Williams (CTCB, QUT) and provided to
this project were PCR amplified using primers indicated in Table 5 to remove the
stop codon at the 3’ end and incorporate a 5’ CACC sequence to facilitate directional
Topo cloning.
96 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
Table 5: The sequences of primers used for amplification of AtBAG4, TlBAG4
and forward and reverse universal M13 primers used for sequencing.
Primers Sequence 5’ to 3’
AtBAG4 Forward caccatgatgcataattcaaccgaagaatc
AtBAG4 Reverse gtcaaatttctcccaatcttgagttacatt
TlBAG4 Forward caccatgacgggcggcagatcg
TlBAG4 Reverse gtcgaactgctcccagtcagtgttaacttg
Sequencing Forward gtaaaacgacggccag
Sequencing Reverse caggaaacagctatgc
5.2.4 Preparation of bacterial glycerol stock
Bacterial suspension culture was added to equal amount of 80 % glycerol in
Cryovials and snap-frozen before storing at -80˚C.
5.2.5 Extracting plasmid DNA (Mini prep)
Plasmid DNA extraction from Agrobacterium tumefaciens and Escherichia coli
was performed using the standard alkaline lysis method described in Sambrook et al.
(1989). Briefly, a single colony was used for inoculation of 3-4 ml of LB liquid
culture containing appropriate antibody. This liquid was then was incubated on a
shaking rack (225 rpm) at 37˚C overnight for E. coli and at 28 ˚C for 72 h for A.
tumefacient. The liquid culture (2ml for E. coli and 4 ml for A. tumefacient) was then
centrifuged for one minute at 6000 rounds per minute (RPM) at room temperature.
The pellet was resuspended in 100 µl of cold Solution 1 (50 mM glucose, 25 m M
Tris-HCl pH 8.0, 10 mM EDTA). Cells were lysed with the addition 200 µl of
Solution 2 (0.2 M NaOH, 1 % SDS) followed by gentle. Following lysis,
contaminating gDNA and proteins were removed with the addition of 150 µl of
Solution 3 (3M sodium acetate pH 4.7) and 150 µl of CHCL3:IAA (24:1) and
centrifugation at 14000 g for five minutes. The plasmid DNA was precipitated in a
new tube by adding two volumes of 100 % ethanol followed by centrifugation for
five minutes at 14000 g. Excess salts were removed from the plasmid DNA by 70%
ethanol wash. The pellet was air-dried and and dissolved in a final volume of 50 µl
dH2O containing 10 µl RNAse A (10 µg/ml). Plasmids that were used for sequencing
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 97
were extracted using a Wizard mini prep kit (Promega) according to manufacturer’s
instruction before sending to QUT - Central Analytical Research Facility (CARF)
Molecular Genetics laboratory for sequencing.
5.2.6 Plasmid TOPO® Cloning
TOPO® Cloning was performed according to manufacturers instructions (Life
Technologies) using the primary vector, pENTR and the pYL436 (Gateway-C-TAP)
destination vector that was purchased from the Arabidopsis Resource Center
(ABRC). As described, a 5’ (CACC) was added to both the At and TlBAG sequences
for directional cloning, the stop codon (TAG) was also removed from the 3’
sequence. After PCR the constructs were cloned into pENTR vector using TOPO®
Cloning reaction following the manufacturer’s protocol. The products were used to
transform supplied chemically competent E. coli cells using heat shock as described
in 5.2.7. Escherichia coli cells were cultured on the surface of LB media containing
100 µg/ml kanamycin.
Plasmid DNAs were extracted from positive colonies for further verification on
the target DNA using restriction enzyme digestion and sequencing. Plasmid DNA
was extracted using Wizard mini prep kit (Promega) and the insertion of the target
DNA was verified by using BglII and Sph1 restriction enzymes according to
manufacturer’s instruction and checked for sequence fidelity by sequencing.
After verification, the respective pENTR clones were used in an LR
recombination reaction was used performed, according to manufacturers’
instructions, to transfer the gene to the pYL436 vector (Figure 17). A similar
procedure to that used for the pENTR clones (restriction enzyme digestion and
sequencing) was used to verify the presence of the insert and the fidelity of the target
gene sequence.
98 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
Spectinomycin Gentamycin
Figure 17: The position of the gene in pYL436 vector after cloning.
35S promoter; TMV-omega, plant translational enhancer; attL1 and attL2,
recombination sites; BAG gene from Arabidopsis thaliana (AtBAG) or Tripogon
loliiformis (TlBAG); MYC (c-Myc); HIS; C, cleavage site; IgG; Spectinomycin and
Gentomycin coding antibody selection.
pYL436 (12600 bp)
35S AtBAG/TlBAG 9xMYC 6xHIS 3xC 2xIgG attL1 attL2 TMV-omega
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 99
Once constructed, each expression vector was transformed into Agrobacterium
tumefaciens Agl1 strain cells by electroporation as described in 5.2.7 and selection
on Spectinomycin (25 μg/ml) and Rifampicin (50 μg/ml). Following confirmation of
transformation, a glycerol stock was made from the recombinant Agrobacterium
culture.
5.2.7 Transformation of bacteria
Escherichia coli
The method described by Inoue et al. (1990) was used for transformation of
chemically competent E. coli XL1 Blue cells. Chemically competent cells were
collected from -80 ˚C and left on ice for 10 min. One hundred nanograms of each
plasmid construct was mixed with the bacterial culture in the tube. After 30 min
incubation on ice, tubes were heat shocked at 42 ˚C water for 90 seconds before
transferring on ice for five minutes. The culture was mixed with 500 µl SOC,
incubated at 37 ˚C for 30 min with shaking and spread onto LB media containing the
appropriate antibody overnight.
Agrobacterium tumefaciens
Electro-competent Agrobacterium tumefaciens strain Agl1 were transformed
using an EC100 electroporator (Thermo EC) following the method described by
Dower et al. (1988). Approximately 100 ng of plasmid DNA was mixed with 40 µl
of electro-competent A. tumefaciens cells and transferred to an ice-cold
electroporation cuvette (path length = 2 mm) (Bio-Rad). An electric pulse of 2800 V,
5 msec, 14 kV/cm. 25 µFD was used. The cells were immediately transferred from
the cuvette to a 2 ml tube containing 1 ml SOC and resuscitated by incubation at
28˚C for 2 hours with shaking. Cultures were spread onto LB agar culture containing
spectinomycin (25 μg/ml) and rifampicin (50 μg/ml) for 48-72 hrs at 28 ˚C.
5.2.8 Restriction enzyme digestion of plasmid DNA
Restriction enzyme digestion of plasmid DNA with Mlu1 and DraIII was done
following the manufacturer’s instruction using NEB3 buffer (100mM NaCl, 50mM
Tris-HCl, 10mM, MgCl2, 1mM, DTT, pH 7.9). This was incubated for 1-24 hrs at
37˚C before mixing with DNA Dye (Promega) and electrophoresis.
100 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
5.2.9 Agrobacterium-infiltration of Nicotiana tabacum and N. benthamiana
Wild type Nicotiana tabacum and N. benthamiana plants were grown in a
growth chamber under a 16 hrs photoperiod at 25˚C for at least four weeks prior to
infiltration. A two ml of culture of the recombinant Agrobacterium containing the
BAG4 expression cassettes as well as a control consisting of LB media containing
appropriate antibiotic was inoculated by the A. tumefaciens cells (strain Agl1)
containing pYL436 vector with the target genes and (pCAMBIA 2301 vector which
has a GUS gene in it) were used for GUS assay. Cultures were incubated at 28˚C for
48 hrs on a shaker for maximum density. Culture was increased to 10 ml with fresh
LB media containing appropriate antibody and 25 µM acetosyringone (final
concentration) and incubated for 16 hrs.
The culture was centrifuged at 4000 g for 10 min and the pellet was
resuspended and washed twice in 10 ml of infiltration media (10 mM MgSO4.7H2O,
9 mM MES, pH 5.6), before resuspension in 5 ml of infiltration media containing
100 µM acetosyringone. The OD600nm was measured and the culture was diluted to be
an OD600nm between 0.1 to 0.9. Cultures were infiltrated into the abaxial surface of
leaves using 1 ml needle-less syringes. Leaves were retained on the plant for three
days post-infiltration.
5.2.10 Histochemical GUS assay
Infiltrated leaves from N. benthamiana and N. tabacum (pCAMBIA 2301
vector) were used for GUS assay. Agrobacterium-infiltrated leaves were harvested
three days after infiltration and expression level was visualised by adding 5-bromo-4-
chloro-3-indolyl-β-glucuronide (X-gluc) (Progen Biosciences) incubation at 37˚C as
described by Jefferson et al. (1987). Following histochemical staining, chlorophyll
was removed from leaves by incubation in an ethanol:acetic acid solution (3:1)
solution for 48 h.
5.2.11 Protein extraction
The infiltrated region of each leaf was harvested and approximately two grams
were collated, snap-frozen and ground to a fine powder in liquid nitrogen prior to
homogenisation in extraction buffer (100 mM Tris-HCl pH 7.5, 150 mM NaCl, 10%
glycerol, 0.1 % Triton X-100, 1 mM PMSF and 1x complete protease inhibitor
cocktail (Sigma, St. Louise, MO, USA)). Homogenisation was completed by gentle
rotation at 4 ˚C for one hour. Cell debris was removed from the homogenates by
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 101
centrifugation at 4000 g at 2 ˚C. Further, removal of solids was performed by
centrifugation of the supernatant at 14000 g at 4 ˚C for 20 min. The total protein
extract was incubated with IgG Sepharose 6 Fast Flow beads (Amersham
Biosciences, Uppsala, Sweden) overnight at 4 ˚C with gentle rotation. Recombinant
protein containing the IgG tag was concentrated by centrifugation at 10-12000 rpm
for 3 min at 4 ˚C. The IgG beads and tagged protein were washed 3 times with 1.5 ml
of washing buffer (extraction buffer plus 350 mM NaCl). The recombinant protein
was eluted from the IgG beads through incubation with 12 µl (50 units) of 3C
protease (Precision protease; Amersham Bioshiences) in 500 µl of cleavage buffer
(50 mM Tris HCl pH 7.0, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.1 % Triton)
overnight in cold room with gentle rotation. Supernatant was snap-frozen and stored
at -20 ˚C.
5.2.12 SDS PAGE
SDS-PAGE (sodium dodecyl sulphate polyacrylamide) gel electrophoresis was
used to separate proteins. The protein extract was run on a gel made of 5 % stacking
gel (dH2O 2.916 ml, 1 M Tris pH 6.8 0.5 ml, 10 % SDS 40 µl, 40 % acryl/bis (29:1)
0.5 ml, 10 % ammonium persulphate 40 µl and TEMED 4 µl) and 12 % separation
gel (dH2O 4.135 ml, 1.5 M Tris pH 8.8 2.5 ml, 10 % SDS 100 µl, 40 % acryl/ bis
(29:1) 3.125 ml, 10 % ammonium persulphate 100 µl and TEMED 5 µl). Gels were
prepared using a Mini SDS-PAGE gel apparatus (Bio-Rad) according to the
manufacturers’ protocol. Equal amounts of sample and loading buffer were mixed
followed by a short spin and then heated for 10 minutes at 95 ˚C. A 12 µl aliquot was
loaded to each well and the gels were run for 1 h at 200V. Coomassie blue dye was
used for verification of proteins on the SDS page gel.
5.2.13 Coomassie blue staining
Previously separated proteins were fixed in the SDS gel with the application of
fixing buffer (50 % methanol and 10 % glacial acetic acid) for 1 h. Fixed gels were
stained in Coomassie blue solution (0.1 % Coomassie Brilliant Blue R-250, 50 %
methanol and 10 % glacial acetic acid) for at least 6 hrs with gentle agitation prior to
destaining in a 25 % methanol and 10 % glacial acetic acid solution for one minute
and incubation in 25 % methanol covered by facial tissue until the background
cleared. Images were captured using a Syngene Geldocsystem (G-box and GenSnap
102 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
version 6.07) (Syngene - UK) using ‘white background’ option. Gel was stored in
storage solution (5 % glacial acetic acid) until the background colour was removed.
5.2.14 Western blotting
After SDS gel electrophoresis, proteins were transferred to a nitrocellulose
membrane using a Mini SDS-PAGE gel apparatus tank (Bio-Rad). After preparing
the sandwich according to the manufacturers’ protocol, it was placed in the tank
filled with blotting buffer (25 mM Tris, 192 mM glycine, 10 % methanol) and
proteins transferred overnight at 15 V in the cold room. The following day the
apparatus was disassembled and stained with Ponceau Red S (0.1% (x/v) Ponceau S
(Sigma-Aldrich) in 1% (v/v) acetic acid) to verify the transfer of the protein to the
membrane. Ponceau Red S stain was washed off the membrane with tap water.
The membrane was blocked using blocking buffer (TTBS, 5 % (v/w) skim
milk powder) for 1 h with shaking. The blocking solution was discarded and 12 ml
of a diluted 1˚ antibody (mouse (monoclonal) anti-human c-myc unconjugated
antibody) (Invitrogen) solution (1 µg/ml in blocking solution) was added and the
membrane was incubated overnight at room temperature with gentle agitation.
Following incubation, the membrane was washed four times with TTBS (50 mM
Tris, 150 mM NaCl, 0.05 % Tween 20, pH 7.6 (adjusted by HCl)) (10 min each) with
gentle agitation. The membrane was incubated in 2˚ antibody (Goat Anti-Mouse IgG
(H+L) - HRP) (Life Technologies) solution (1 µl of 2˚ antibody in 100 µl blocking
solution, then 9 µl of that solution was mixed in 12 ml of blocking solution)
overnight at room temperature with gentle agitation. Following incubation the
nitrocellulose membrane was washed four times with TTBS as described above. The
chemiluminescent detection assay was performed according to the DIG (Roche)
protocol.
5.2.15 Protein microarray hybridisation (probing) and scanning
A high-density Arabidopsis protein microarray (Dinesh-Kumar Laboratory,
Department of Plant Biology & Genome Centre, University of California, Davis,
USA) with 5000 Arabidopsis ORFs was used to investigate protein-protein
interactions of At-BAG and Tl-BAG proteins. On these protein array slides, each
protein is arrayed in duplicate spots onto glass slides coated with nitrocellulose
polymer (FAST slides; Schleicher & Schuell) and multiple negative (empty) and
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 103
positive (Cy3 and Cy5) control spots are present. Slides were removed from storage
(-80 ˚C) and placed on ice in an enclosed container for 10 min.
Slides were blocked in blocking solution for 1-2 hours at room temperature and
washed in TBS-1% Tween (50 mM Tris, 150 mM NaCl, 1 % Tween), 3 times, 10
min each wash. Blocked slides were incubated with the eluted proteins (each slide
was treated with one of the proteins) for 1 h while the slides were covered with a
glass slide as hybridization slip. Hybridised slides were washed with TBS-1% Tween
for 10 min, three times. The slides were incubated with primary monoclonal anti-
cMyc IgG (Santa Cruz) diluted 1:2,500 in blocking solution for 1 h while the slides
were covered with a glass slide as hybridization slip. The slides were washed for 10
min in TBS-1% Tween, three times. This was then incubated in the secondary
antibody, Cy5-conjugated anti-mouse IgG (Jackson ImmunoResearch Laboratoires,
Inc.), for 1 hour and washed for 10 min in TBS-1% Tween, three times. Slides were
spin dried by spinning for 1 min at 1000 g inside a 50 ml falcon tube. Slides were
scanned using a Genepix 4300A slide scanner (Axon Instruments).
5.2.16 Statistical analysis
The scanned microarray images were subsequently processed following the
instructions described by Zhou-Da et al. (2008). The report file was generated using
Genepix software to obtain mean, median, and standard deviation of array spots and
background regions. The background intensity of each probe was subtracted from the
corresponding mean intensity and the resulted mean values were used for further
statistical analysis. The average, standard deviation and standard error of the mean
values of the Hsc70 and Ubiquitin spots (each has two replicates) were calculated
and 2* standard error was reduced from the average. All the mean values above this
point were considered as significant for the final analysis.
5.2.17 Bioinformics analysis
Enrichment of gene ontology (GO) terms
GO term enrichment was performed for the protein sets considered to
significantly interact with BAG4 obtained from each protein chip. Each gene set was
enriched using a Fisher’s exact test using the entire annotated transcriptome as a
reference. For statistical significance p-values were corrected according to Benjamini
104 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
and Hochberg (1995) and a critical false discovery rate (FDR) q-value of 0.05 was
applied.
Determination of significant protein interactors
The entrez GIs were filtered from the TAIR10 Geneidentifier database that was
downloaded from the Arabidopsis Resource Center (ABRC) website. GIs were
captured using the VLookup function in Excel and were then annotated using the
Kobas online server and Arabidopsis as the reference background. Annotated protein
lists were then used for identification of enriched pathways (KEGGS, Panther and
Biocyc) as well as Gene Ontologies, also performed using KOBAS. For statistical
significance p-values were corrected according to Benjamini and Hochberg and a
critical False Discovery Rate (FDR) q-value of 0.05 was applied.
5.2.18 Quantitative real-time PCR analysis
Superscript III Reverse Transcriptase (Invitrogen) was used to generate cDNA
from 0.8µg of Total RNA using an oligo (dT) (100ρmol) primer. Quantitative PCR
data was generated using a ViiA™7 Real-Time PCR System (Life Technologies) and
the SYBR Green PCR Master Mix kit (Applied Biosystems) according to the
manufacturer’s instructions using 300 µM primer and 1/100 dilution of cDNA and
standard cycling parameters. Gene specific primers for selected genes were designed
using Primer3 software (MIT) and data analysis was conducted using ViiA™ 7
Software v1.2.4 and ExpressionSuite Software v1.0.4 (Life Technologies). The T.
loliiformis homologue of Arabidopsis Actin, Eif and Ubi10 identified from the
annotated transcriptome were used for quantitative normalisation.
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 105
5.3 RESULTS
Apoptotic and anti-apoptotic proteins play a significant role in growth,
development and response to environmental stresses. Resurrection plants tolerate
desiccation and unlike many other land plants the cells maintain viability suggesting
that they might use anti-apoptotic proteins. An understanding of protein interaction
of these pro-survival proteins might shed light on the mechanism that resurrection
plants use their pro-survival proteins differently compared with desiccation-sensitive
plants. This information might help us in developing stress tolerant crops.
In order to study the protein-protein interaction of the AtBAG and TlBAG,
these proteins were expressed in the leaves of Nicotiana benthamiana through
Agrobacterium-infiltration and purified through IgG sepharose bead purification. The
purified proteins were hybridised against Arabidopsis protein microarray slides and
then scanned using a Genepix slide scanner; results were processed using statistical
and bioinformatics programmes (Figure 16)-(section 5.2.16).
5.3.1 Generation of constructs for Agrobacterium-infiltration
TOPO® Cloning was used to clone the At- and TlBAG4 genes into the target
vector. To facilitate directional cloning and expression of the protein fusion, the
respective BAG4 genes were PCR amplified and site-directed mutagenesis was used to
include four nucleotides (CACC) to the 5’ end of the gene and removal of the stop
codon from the 3’ end.
Constructs were first cloned into the primary “entry” vector (pENTR) by TOPO®
Cloning and then to the final expression vector pYL436 by LR cloning
(Gateway®
cloning). The pYL436 vector contained an IgG epitope and a 3C protease
cleavage site for protein purification as well as nine myc-C and hist tags for detection of
protein-protein interactions. All clones, both entry and destination, were verified by
restriction enzyme digestion and sequencing (Figure 18).
106 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
Figure 18: Restriction enzyme digestion of the pENTR and pYL436 for
verification of the insertion of the constructs.
Digestion of the pENTR constructs with Mlu1 resulting in three fragments of
approximately 1473 bp, 1117 bp and 932 bp (left). Restriction enzyme digestion of
pYL436 constructs with DraIII resulting in three fragments of approximately 7632
bp, 3510 bp and 620 bp (right). L, molecular weight standard ladder. White arrow is
pointing at 1000 bp line.
TlBAG4 TlBAG4 AtBAG4 AtBAG4 L L
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 107
5.3.2 Agrobacterium transformation and infiltration of tobacco and N.
benthamiana
To determine the optimal Agrobacterium-transient expression system both N.
benthamiana and N. tabacum leaves were infiltrated with recombinant
Agrobacterium harbouring the pCAMBIA 2301 vector. A GUS expression vector,
pCAMBIA 2301 is routinely used in molecular biology to quantify transgene
expression levels. Three days post-infiltration, leaves were histochemically assayed
for GUS expression. Since the sole purpose of GUS expression in N. benthamiana
and N. tabacum leaves was for the optimisation of the system and determination of
the best expression host, the levels of GUS expression obtained from pCAMBIA
2301 were estimated based upon visual comparison of the intensity of the blue
staining in the leaves instead of quantitative analysis. GUS assay results were
consistent with previous reports in the lab and revealed that N. benthamiana are more
suitable for expression of the genes using Agrobacterium-infiltration method (Figure
19). Based on these results all transient expression assay were performed in N.
benthamiana.
108 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
Figure 19: Determination of the optimal Agrobacterium-transient expression
system.
Leaves of Nicotiana tabacum (left) and Nicotiana benthamiana (right) plants were
infiltrated using Agrobacterium tumefaciens carrying the GUS expression vector
pCAMBIA 2301. Infiltrated leaves were harvested 3 days post-infiltration, GUS
expression was made visible through histochemical GUS assay.
Nicotiana benthamiana Nicotiana tabacum
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 109
5.3.3 Protein extraction and purification
Once the Agrobacterium-transient expression system was shown to be
working, N. benthamiana leaves were infiltrated using A. tumefaciens carrying the
binary expression vector pYL436 with the inserted target gene constructs. Infiltrated
leaves were harvested three days post-infiltration and total protein was extracted.
AtBAG4 and TlBAG4 constructs were isolated from the total protein extracts using
IgG sepharose beads; the cleavage site on the expressed peptide enables the isolation
of the target constructs from the total protein (Figure 20A). By separating the beads
from the solution and cutting the peptide from the cleavage site, peptides were
successfully released and isolated from the total protein (Figure 20B). The
expression, extraction and isolation were verified by Coomassie blue staining and
Western blotting (Figure 21).
5.3.4 Protein microarray hybridisation (probing) and scanning
Following expression and purification, the AtBAG4 and TlBAG4 proteins
were analysed by Arabidopsis protein chip for protein-protein interactions. Each
high-density Arabidopsis protein microarray slide has 5000 duplicated Arabidopsis
expressed protein spots. As controls, empty (negative) and Cy3 and Cy5 (positive)
spots were also present on the chip.
Independent Arabidopsis chips were hybridised with the AtBAG4 and TlBAG4
proteins. The primary antibody, anti-MYC IgG, detects the MYC peptide which is
originated from the added sequences to the BAG4 proteins (Figure 17B). Anti-MYC
IgG antibody is the target of 2˚ antibody which is an anti-IgG antibody attached to a
Cy5 fluorophore (Cy5-conjugated anti-mouse IgG) (Figure 22). This sandwich was
then detected by a scanner with the presence of Cy5 fluorescence indicative of
protein interaction.
110 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
A)
B)
Figure 20: Peptide construct before and after isolation.
A) The peptide expressed in the inoculated Nicotiana benthamiana leaves. B)
Isolated peptide eluted from IgG Sepharose beads after treatment with cleavage
enzyme. BAG protein from Arabidopsis thaliana (AtBAG) or Tripogon loliiformis
(TlBAG); MYC (c-Myc); HIS; C, cleavage site; and IgG.
AtBAG/TlBAG 9xMYC 6xHIS 3xC 2xIgG
AtBAG/TlBAG 9xMYC 6xHIS
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 111
Figure 21: Verification of expression, extraction and isolation of target proteins
using Coomassie blue staining and Western blotting.
A) Coomassie blue staining of SDS Page gel. B) Western blotting result of the gel
using mouse (monoclonal) anti-human MYC unconjugated antibody as 1˚ antibody
and goat Anti-mouse IgG as 2˚ antibody. At-B/Tl-B, protein solution after overnight
treatment of IgG sepharose beads; At-C/Tl-C, the elution after treatment of IgG
sepharose beads with cleavage enzyme; At-T/Tl-T, total extracted protein from
AtBAG4/TlBAG4 construct treated leaves; L, molecular weight standard ladder;
black arrows pointing at the bands related to cleavage enzyme; red arrows pointing at
the bands related to the constructs.
Tl-T Tl-B Tl-C At-T At-B At-C A
B
L
112 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
target protein
(BAG + MYC)
Reporter antibody
(anti-MYC IgG)
capture antibody
(Arabidopsis
protein library)
Sandwich
fluorophore
(Cy5-conjugated
anti-IgG)
A B C D
Figure 22: The procedure of protein microarray chip hybridisation.
Arabidopsis thaliana protein library consisted of 5000 proteins with 2-4 technical replicates as well as positive and negative controls
on each slide. Each slide is treated separately by our target proteins, Tl and AtBAG. BAG protein is attached to a MYC which is
treated by anti-human MYC. This is then treated with Cy5-conjugated anti-mouse IgG. Cy5 is a fluorophore and can be scanned (649
nm absorbance and 670 nm emission wavelength).
113 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-
mediated Autophagy
5.3.5 Statistical and bioinformatics analysis
For detection of the interacting proteins hybridised slides were scanned using a
GenePix 4300A scanner using 649 nm absorbance and 670 nm emission wavelength
for Cy5 fluorophore. The results of scanning of the hybridised slides showed a large
number of interactions which appeared to have a very similar pattern for both BAG4
proteins (Figure 23). The scanned data was processed using Genepix software and
the report file including mean, median, signal value and standard deviation of array
spots and background regions were maintained. The hybridisation data indicate that
the genes have far more possible interactions than what was suggested/predicted with
the bioinformatics tools. A list of 407 proteins, identified to be above the threshold
significance for AtBAG4 and 671 for TlBAG4 treatment as well as well as compared
AtBAG4 versus TlBAG4 signals can be found in Table 6.
Differential GO term distribution of a given gene set indicates the biological
processes and metabolic functions enriched within that sample. Therefore, once
filtered, each gene set was annotated using KOBAS and subjected to a Fisher’s exact
test for visualisation of differential GO term distribution. The entire annotated
Arabidopsis genome was used as a reference for comparison of the protein sets
within each cluster and enrichment of GO terms specific to that particular sample. A
full overview of the GO categories is presented in Appendix A.
Pathway analysis of the protein interactors can provide further information on
the potential roles that the BAG4 orthologues are playing in A. thaliana and T.
loliiformis. For each protein set, pathway enrichment analysis was calculated using
the online KOBAS server, a summary of the results is provided in Table 7. Briefly,
the interactome for both the Arabidopsis and T. loliiformis proteins were consistent
and largely involved in carbohydrate metabolism pathways.
114 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
Figure 23: The scanned Arabidopsis thaliana protein microarray slides
hybridised with AtBAG4 and TlBAG4 constructs.
Hybridised Arabidopsis protein microarray slides were scanned by a GenePix 4300A
scanner using 649 nm absorbance and 670 nm emission wavelength for Cy5
fluorophore.
115 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
Table 6: The comparison between the number of spots with significant signal values between AtBAG4 and TlBAG4 hybridised Arabidopsis
thaliana protein results.
The number of spots with significant signal value for AtBAG4 407
The number of spots with significant signal value for TlBAG4 671
The number of proteins shared between AtBAG4 and TlBAG4 405
The number of spots unique to AtBAG4 above the threshold 2
The number of spots unique to TlBAG4 above the threshold 266
Table 7: The pathway enrichment analysis of proteins with significant signal values from AtBAG4 and TlBAG4 microarray protein results.
116 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-
mediated Autophagy
5.3.6 Generation of constructs for Agrobacterium-infiltration
In order to investigate the possible role of TlBAG4 in T. loliiformis in
desiccation tolerance, the expression level of TlBAG4 during dehydration and
rehydration were observed. Changes in expression of TlBAG4 during dehydration and
rehydration were measured using quantitative reverse transcription polymerase chain
reaction (qRT-PCR). After withholding watering, total mRNA was extracted from T.
loliiformis plants in hydrated, 80 % RWC, 60 % RWC, 40 % RWC, 100 % RWC and
after resuming watering mRNA was extracted after 24 (68 % RWC) and 72 hours (87 %
RWC). Gene expression level remained relatively steady throughout dehydration and
rehydration (Figure 24).
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 117
Figure 24: qRT- PCR results of TlBAG4 during dehydration and rehydration in
Tripogon loliiformis.
The gene expression level of the TlBAG4 was observed during dehydration and
rehydration using qRT-PCR. Data was generated using three biological replicates
and three technical replicates. All measurements were normalised using three
housekeeping genes, Actin, Eif and Ubi10.
0
5
10
15
20
25
30
35
40
Hyd 80 % RWC 70 % RWC 60 % RWC 40 % RWC 10 % RWC 24 h Reh 72 h Reh
118 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
5.4 DISCUSSION
BAG4 has shown to promote abiotic stress-tolerance in transgenic plants
(Doukhanina et al., 2006;Hoang, 2014). To date, no studies have been performed on
a BAG4 homologue isolated from a resurrection plant. Furthermore, our knowledge
about the molecules that BAG4 interacts with is limited to Hsp70 and some
transcription factors. The broad impact and chaperone activity of BAGs suggest that
these proteins might interact with other proteins as well. Using high throughput
protein microarray technology we performed a comparative analysis of the protein-
protein interactions of BAG4, an anti-apoptotic (pro-survival) protein from T.
loliiformis, a resurrection plant, and BAG4 from A. thaliana, a desiccation sensitive
plant. This knowledge can provide us with a better insight into BAG4 performance
and possibly could be used to develop drought-tolerant crops.
The BAG domain shared among BAG proteins interacts with the ATPase
domain of Hsp70 (heat shock protein 70) proteins and regulates the chaperone
activity of them. The BAG domain (BD) of AtBAG4 has exceptional high structural
and charge similarities with human BAG4 (hBAG4) (Figure 25). The AtBAG4
protein is localised in cytoplasm and is known to interact with at least three other
proteins, i) Hsc70, an Arabidopsis heat shock protein; NBR1 (AT4G24690), ii) the
selective autophagy substrate with UBA (ubiquitin-associated) zinc-finger and PB1
domain-containing protein; and iii) a AT hook motif DNA-binding family protein;
and SNF7.1, a vacuolar protein sorting-associated protein 32-2 (Doukhanina et al.,
2006;Consortium, 2011). The interaction of AtBAG4 with Hsc70 was tested
experimentally by pulldown assay (Doukhanina et al., 2006) while yeast 2-hybrid
was used to prove the in vitro interaction of the other proteins with AtBAG4
(Consortium, 2011). Bioinformatic analyses using the predictive proteomics software
(STRING) suggests potential interaction of BAG4 with other proteins including;
AtBAG7; AtBAG5; ATBI1 (BAX inhibitor 1); BIP3, an ATP binding protein;
BZIP28, DNA binding/transcription factor, however these interactions have not been
verified by laboratory based experiments and based on the localisation of some of the
possible proteins interaction seems highly unlikely (Figure 26).
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 119
A
hBAG4 BD AtBAG4 BD
AtBAG4 BD
hBAG4 BD
B
AtBAG4 BD hBAG4 BD C
120 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
Figure 25: Comparison between human BAG4 BAG domain (hBAG4 BD) and
Arabidopsis thaliana BAG4 BAG domain (AtBAG4 BD).
(A) The helices shown as yellow ribbons compose a short antiparallel triple-
helix bundle in both human and Arabidopsis BDs. (B) secondary structure-based
sequence alignment of BDs from AtBAG4 and human BAG4. (C) comparison of the
BDs of AtBAG4 and human BAG4. A three dimensional homology model of the
AtBAG4 BD generated by the SWISS-MODEL web server was compared with the
reported structure of the human BAG4 BD. The residues on the surface of the human
BAG4 BD that are important for Hsc70 interaction are indicated and are compared
with the corresponding residues of the AtBAG4 BD. The water-accessible molecular
surfaces are coloured according to electrostatic potential (upper row) and
hydrophobicity lower row). In the electrostatic potential maps, the blue colour
intensity is proportional to positive charge, white to neutral, and red to negative. In
the hydrophobicity maps, the yellow colour intensity is proportional to the
hydrophobicity of the underlying residues. All molecules are oriented so that the
second and third helices (the Hsc70-binding surface) are facing up front. Modified
from Doukhanina et al. (2006).
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 121
Figure 26: A schematic illustration of protein-protein interaction of AtBAG4
based on experimental proven and bioinformatics prediction data based on
string-db.org.
The purple lines demonstrate the proven interactions and green lines
demonstrate the interaction predictions.
122 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
Although there was a risk that the BAG4 protein from T. loliiformis may not
bind to Arabidopsis proteins on the slide due to the high level of sequence
conservation at the protein level the risk was minimal. The presence of the Hsc70
and ubiquitin-associated (UBA) zinc-finger on the chip and their detection as
potential interactors with both At- and TlBAG4 was increasing the chance and the
AtBAG4 data correlated with experimental data from other labs. These results also
indicated that protein interactors for TlBAG were able to be detected using an
Arabidopsis chip.
Hsc70 is a constitutively expressed chaperone protein involved in facilitating
correct protein folding. It has also been shown to participate in disassembly of
clathrin-coated vesicle protein using the ATPase activity (Newmyer et al.,
2003;NCBI, 2014). The regulation of Hsc70 binding to substrate proteins is by ATP
binding and hydrolysis. The highest affinity of Hsc70 with protein substrates is
formed through the ADP-bound form (Agarraberes and Dice, 2001).
AtBAG4 also interacts with UBA (ubiquitin-associated) zinc-finger which is
associated with the ubiquitin pathway. The Ubiquitin–proteasome pathway (UPP) is
an important protein quality control mechanism as it is the primary cytosolic
proteolytic machinery for the selective degradation of various forms of damaged
proteins, particularly oxidised proteins (Shang and Taylor, 2011). Therefore the
presence of a fully functional UPP system is critical for the cell to cope with
oxidative stress. It comes as no surprise that ubiquitin-mediated protein degradation
pathway is involved in biotic and abiotic stresses (Cui et al., 2012). The role of
ubiquitination in PCD suppression has been shown in Arabidopsis (Marino et al.,
2013) where MYB30 a transcription factor that positively regulates the
hypersensitive cell death responses against biotic stress, is lead to proteasomal
degradation and down-regulation of its transcriptional activity.
Similar to animal cells, external ATP (eATP) (and internal ATP) plays
signalling role in higher plants (Chivasa et al., 2005). While the existence of eATP is
vital to plant cells, stress leads to an increase level of eATP in plants (Jeter et al.,
2004;Chivasa et al., 2005). The increased eATP leads to accumulation of ROS out of
cell membrane in a mechanism that is mediated by NADPH oxidase (Song et al.,
2006) Ca2+
and MAPK (Wong et al., 2007;Demidchik et al., 2009). The role of the
NADPH oxidase induced ROS (Ca2+
mediated) as a critical signalling factor in
regulation of various cell functions such as development, stress response,
Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated
Autophagy 123
programmed cell death and in plants is now understood (Pérez-Pérez et al., 2012;Xie
et al., 2014).
ROS stress and nutrient starvation could lead to apoptosis. Autophagy however
reduces the oxidative stress through degradation of damaged proteins which are
whether miss-folded or oxidated and recycles the unwanted proteins during
starvation result in reducing the stress and avoiding apoptosis. The results of protein
microarray hybridisation showed BAG4 interacts with a large number of proteins
which are involved in carbohydrate pathways related to production of ATP and
NADPH which results in activation of the autophagy. Furthermore BAG4 also
interacts with Hsc70 and UBA which are involved in protein degradation in
autophagy. Although the exact role of BAG4 in autophagy survival system is not
clear, the fact that it interacts with numerous members of the autophagy system
highlights its role in this system. The role of BAG4 in autophagy survival pathways
makes it anti-apoptotic protein. The fact that TlBAG4 interacts with more proteins
than AtBAG4 might mean the BAG4 from this resurrection plant might have an
active role in desiccation-tolerance.
To conclude, the protein microarray results suggest that the pro-survival
characteristic of BAG4 are as the result of interaction with proteins involved in
autophagy survival pathway. Although it appears that BAG4 interacts with a large
number of proteins that may also be involved in autophagy procedure, but the exact
role of BAG4 within autophagy pathways remains to be discovered. TlBAG4
appears to have more protein interaction than AtBAG4 which might mean that T.
loliiformis is using this protein differently than A. thaliana. However, the lack of
expression level during dehydration and rehydration suggests that TlBAG4 might not
be directly involved in desiccation tolerance in T. loliiformis. More molecular
experiments needs to be done in order to prove BAG4 interacts with these proteins
and these interactions are directly involved in autophagy. Although there needs to be
other experiments to prove the exact role of BAG4, however the results of high-
density protein microarray provided a valuable platform for future studies.
124 Chapter 5: Protein-protein Interaction Profile of BAG4 Suggests A Possible Role Within Chaperone-mediated Autophagy
Chapter 6: General Discussion 125
Chapter 6: General Discussion
6.1 INTRODUCTION
Since their discovery in 1912 biologists have been fascinated with the ability of
resurrection or desiccation-tolerant plants to withstand extreme environments. While
numerous studies have been conducted on these plants, the majority of experiments
have been limited to a small number of species, and these have been mainly from
southern Africa (Table 1). This study used T. loliiformis, an Australian native
resurrection grass as a new resurrection model plant to study desiccation-tolerance
mechanisms. Desiccation-tolerance mechanism has been observed from structural,
physiological and to some extent molecular perspectives using a wide range of
experiments. While T. loliiformis is an ideal model for the study of the unique
tolerance mechanisms of resurrection plants it also has some minor limitations. The
wide range of responses that it demonstrated during dehydration, desiccation and
rehydration, its small size and some of the structural changes during dehydration
were obstacles for some of the observation, particularly physiological experiments.
6.2 STRUCTURAL AND PHYSIOLOGICAL FEATURES AND CHANGES
OF T. LOLIIFORMIS LEAVES ARE TO MINIMISE MECHANICAL
AND OXIDATIVE STRESS DEHYDRATION AND REHYDRATION
Leaf structure plays a critical role during plant stress tolerance, particularly
during water deficit. This study characterised the structural features and changes that
are involved with desiccation-tolerance through leaf structural observation at
different hydration levels. A series of histological methods were optimised in order
to minimise their impact on the tissue in order to investigate the structures of this
plant in the natural state. Tripogon loliiformis possesses structural features that are
common among drought tolerant plants (e.g. thick cuticle, trichomes,
sclerenchymatous tissues and large vacuoles). These structural features facilitate
desiccation tolerance by reducing light damage as well as slowing down dehydration
and providing the much needed time for inducing desiccation tolerance.
126 Chapter 6: General Discussion
As a C4, NAD-ME grass with XyMs+ structure, T. loliiformis has general
physiological features of a drought tolerant plant. C4 plants are generally more
drought tolerant compared to C3 plants. Among C4 plants, NAD-ME type plants are
more tolerant to drought compared with other C4 types, NADP-ME and PEPCK
(Brown, 1999). Furthermore, the XyMS+ structure is a trait characteristically held by
plants grown in arid conditions (Prendergast and Hattersley, 1987).
The water efficiency of C4 plants lie in their ability to concentrate CO2 at the
site of fixation (bundle sheath cells). This increases the photosynthesis-related water
use efficiency of C4 plants by approximately three-fold when compared to their C3
counterparts (Long, 1999). The higher concentration of the CO2 around Rubisco
allows C4 plants to photosynthesize even with low stomatal conductance and hence,
reduces transpirational water loss (Farquhar and Sharkey, 1982;Conley et al., 2001).
This could particularly benefit C4 resurrection plants in two ways. Firstly, it allows
photosynthesis to take place while the stomata are closed, providing more energy as
well as crucial time required for inducing desiccation tolerance mechanisms.
Secondandly, the concentration of the CO2 around Rubisco minimizes the production
of ROS that would otherwise be produced as a result of the disruption of
photosynthesis caused by an incomplete electron transport chain because of low CO2
concentrations, which in turn is due to stomatal closure during dehydration.
Therefore, maintaining the integrity of the photosynthetic apparatus during
desiccation increases the ROS damage more significantly in C3 DT vascular plants
as compared with C4 DT vascular plants. The homoiochlorophyllous resurrection
angiosperms Haberlea rhodopensis and Ramonda serbica switch from C3 to
C4/CAM-type photosynthesis upon dehydration (Markovska et al., 1997;Gechev et
al., 2013). This is likely due to the advantage of C4/CAM photosynthesis over C3
during dehydration.
6.2.1 Bulliform cells appear to play a significant role in gas exchange and leaf
folding during dehydration
It has been suggested that CO2 passing through the cuticle is sufficient for
photosynthesis in C4 plants when the stomatal complexes are closed, because of
concentrations of CO2 around Rubisco (Farquhar and Sharkey, 1982). In T.
loliiformis the cuticle on both surfaces is thick except over the bulliform cells on
adaxial surface, therefore, the main route of CO2 to mesophyll should be through
127
bulliform cells when the stomata are closed. A reduction in wax thickness and an
increase in the number of bulliform cells has been reported on the adaxial leaf
surface of C4 grasses under lower CO2 while C3 grasses of same genus did not show
these changes (Tipping and Murray, 1999). This suggests a role for bulliform cells in
gas exchange in C4 photosynthesis. At around 70 % RWC, photosynthesis stops and
this coincides with the dehydration of bulliform cells. This could be explained as
when bulliform cells dry, the passage of CO2 is closed so this leads to a reduction of
photosynthesis. It appears that bulliform cells have a significant role in gas exchange
in T. loliiformis when the stomatal complexes are closed. This makes these structures
important in shutting down of the photosynthesis when they get dry through
restricting the CO2 absorption. Bulliform cells seem to play various roles during
different phases of dehydration. These cells have large vacuoles which act as a water
reserve. Bulliform cells also play an important role in leaf folding during the
dehydration when they act as pivot to facilitate leaf folding. Shortly after leaf folding
anthocyanin pigments accumulate on the exposed surface (abaxial surface) masking
the interior tissue and further reduces the light penetration. The last stage of the
oxidative protection is the anabolic breakdown of photosynthetic apparatus which
minimises ROS production during the prolonged desiccation state. All these
structural and physiological features and changes in T. loliiformis work together in a
synergy and protect this plant against mechanical and oxidative stresses during
extreme dehydration.
Structural changes during dehydration such as leaf folding, cell wall folding
and vacuole fragmentation result in slowing down of dehydration as well as
preventing the loss of membrane integrity (mechanical damage) and the production
of reactive oxygen spec (ROS) (oxidative stress). The tightness of the observed leaf
folding was associated with the pattern of sclerenchymatous tissue on adaxial
midvein. The absence of sclerenechymatous tissue and other rigid structures on the
adaxial surface facilitate leaf folding along the mid-vein tightly (Figure 8A-C),
while the presence of these rigid structures on the adaxial side of the midvein works
as a physical obstacle which leads to a loose leaf folding (like rolling) at the base of
the leaf (bottom 5 mm) (Figure 8D-F).
128 Chapter 6: General Discussion
6.3 TRIPOGON LOLIIFORMIS MAINTAINS ITS CELLULAR INTEGRITY
DURING DEHYDRATION AND REHYDRATION
The main objectives of physiological studies in T. loliiformis during
dehydration and rehydration were to characterise the physiological changes during
dehydration and rehydration and to observe the level protection of plasma membrane
and photosynthetic apparatus integrity during dehydration, desiccation and
rehydration. The integrity of plasma membrane and photosynthetic apparatus was
used as a benchmark for the level of oxidative stress as the result of ROS
accumulation. The results demonstrated that the physiological changes are mainly to
minimise the oxidative stress and as the result, the integrity of the plasma membrane
and photosynthetic apparatus was largely protected throughout dehydration,
desiccation and rehydration and cells remained viable.
Tripogon loliiformis plants subjected to water deficit maintained a hydration
level of over 80 % relative water content (RWC) before a sudden drop of RWC to
almost air-dry level within a short period of time. Withholding the RWC at high
hydration level is perhaps through the closure of stomata and the sudden dehydration
could be due to soil dryness or through opening of the stomata as has been reported
in the resurrection plant Myrothamnus flabellifolia (Moore et al., 2007). This quick
dehydration could benefit the plant by shortening the time that the plant remains at
intermediate moisture levels which is damaging to the cells because of potential
increased ROS production as a by-product of respiration (Leprince et al., 2000).
Typical of a homoiochlorophyllous resurrection plant, T. loliiformis maintains
much of its chlorophyll during dehydration (approximately 70 %). This makes
photosynthesis-induced oxidative stress a critical perturbation for T. loliiformis
during dehydration. Pigment accumulation and leaf folding during dehydration
minimise the light-chlorophyll interaction. The breakdown of a portion of the
chlorophyll could be due to reducing the stress to a manageable levels via reduced
accumulation of photosynthesis-induced ROS; while recycling of its components
could also be used for producing molecules needed for desiccation-tolerance. The
maintained chlorophyll leads to resumption of photosynthesis quickly upon
rehydration.
The chlorophyll fluorescence results during dehydration demonstrated that
while the majority of the chlorophyll is maintained during dehydration, the integrity
129
of the chlorophyll is also protected. The observed limitation in light access during the
measurement of chlorophyll fluorescence was the result of leaf folding and pigment
accumulation, also suggests that leaf folding and accumulation of pigments
significantly limit chlorophyll irradiation during dehydration. When the leaf is
folded, the vascular tissue and anthocyanin pigmentation shade the chloroplasts
which in return helps reduce light-induced damage and accumulation of ROS during
dehydration.
6.3.1 Increase electrolyte leakage is perhaps due to breakdown of
macromolecules as the result of autophagy during dehydration
Despite the increase in electrolyte leakage (EL) during dehydration the
integrity of the plasma membrane was maintained based on the propidium iodide
staining experiment. The increase in EL during dehydration has also been reported in
other resurrection plants (Farrant, 2000;Georgieva et al., 2012). This increase in
electrolyte leakage in resurrection plants during dehydration is perhaps partly from
organic ions such as ammonium as the result of the breakdown of the
macromolecules as has been observed in some desiccation sensitive plants under
stress (Bajji et al., 2002;Rolny et al., 2011). These macromolecules are most likely
from the photosynthetic apparatus such as chlorophyll. We recommend observation
of the changes in the concentration of the ammonium and chlorophyll content during
various stages of dehydration and rehydration against the changes in EL in this plant.
Apart from organic ions that perhaps are involved in the increased electrolyte
leakage during senescence and desiccation, there might be some other sources of
electrolytes that contribute to the increased EL during such periods. In neutral
solution, ATP is ionized and exists mostly as ATP4−
(Storer and Cornish-Bowden,
1976). The increased levels of eATP as a part of autophagy activation pathway
during senesced and desiccated tissues of desiccation-tolerant plants could play a
significant role in increased electrolyte leakage. Furthermore the accumulation of
ROS produced from NADPH in the extracellular space as the result of stress and/or
starvation can be another source of increased EL during stress and/or senescence,
which does not correspond to loss of membrane integrity. However, to prove this
hypothesis, one needs to measure the concentration of each species of the association
ions present in the mixtures. Perhaps this could be achieved through the method
130 Chapter 6: General Discussion
described in Storer and Cornish-Bowden (1976) for calculation of the true
concentrations of species present in mixtures of associating ions.
6.3.2 Reduction of photosynthesis during early stages of dehydration plays a
key role in activation of autophagy procedure and increase in EL
Photosynthesis in T. loliiformis appeared to be very sensitive in response
dehydration. Stomata closed and photosynthesis ceased at relatively high hydration
levels (Figure 15). The increase in electrolyte leakage (EL) corresponded with the
reduction in photosynthesis starting with the closure of stomata (~90 % RWC) and
acceleration of EL by shutting down of photosynthesis at around 70 % RWC (Figure
13). Coincides in EL could be related with autophagy which starts with the start of
ABA signalling and closure of stomatal complexes. When the photosynthesis stops
this leads to additional starvation which accelerates autophagy degradation of
macromolecules. As explained by Chen et al. (1994) the sugar resources of cell
exhaust quickly and cell starts breaking down the starch using amylase enzymes. The
breakdown of starch has also been observed in a number of resurrection plants during
low hydration levels. Furthermore, the preservation of mitochondrial structural
integrity as well as mitochondrial respiration which has been shown to remain active
observed in a number of resurrection plants until very low hydration level confirms
the respiratory activity (Tuba et al., 1997;Tuba et al., 1998;Farrant, 2000).
Mitochondrial respiration can provide ATP and NAHDPH for autophagy during very
low hydration levels. A further indication of the active autophagy during this period
is the increase in the levels of EL at the very low hydration level (Figure 13). Gaff
and McGregor (1979) have demonstrated that protein based nitrogen decreases
during dehydration, which could be due the amount of protein which is degraded
through autophagy during this time. Autophagy must be playing a critical role in
desiccation-tolerance by degradation and recycling of the damaged and unwanted
proteins (e.g. miss-folded and oxidated) during extreme dehydration.
6.3.3 Plasma membrane is protected from mechanical damage during
dehydration
The integrity of the plasmalemma is protected from mechanical damage during
dehydration through cell wall folding and fragmentation of the vacuole. As described
by Vander Willigen et al. (2004) for the resurrection grass Eragrostis nindensis, cell
131
wall folding was observed in thin walled mesophyll cells while bundle sheath cells
with thick cell walls showed vacuole fragmentation but no cell wall folding; in T.
loliiformis cell wall folding was also observed in mestome sheath cells (Figure 10B).
Fragmented vacuoles in bundle sheath cells were filled with a pale orange-brown
substance (Figure 10B). These components perhaps are the non-aqueous electron
dense substances described by Farrant (2000) and Vander Willigen et al. (2004)
which replaces water in fragmented vacuoles in order to prevent damage to the
plasmalemma during desiccation. While there is some speculation regarding the
nature of these non-aqueous materials, the exact composition of these material
remains unknown. Fragmentation of the vacuole also changes the surface to volume
ratio of vacuoles (Iljin, 1957;Michaillat and Mayer, 2013), possibly preventing the
extensive folding of the tonoplast and the irreversible fusion of tonoplasts during
desiccation. Cell wall folding and vacuole fragmentation have also been reported in
orthodox seeds (Roberts, 1986;Woodenberg et al., 2014).
Chen et al. (1994) have demonstrated an increase in the number of autophagy
vacuoles in the cells undergone autophagy. The observation of fragmented vacuoles
in the desiccated tissues of resurrection plants have been suggested to serve different
purposes and filled with components with different electron density (Farrant,
2000;Vander Willigen et al., 2003). Fragmented vacuoles appeared with different
sizes and colours in T. loliiformis (Figure 10B). We suggest some of these
fragmented vacuoles might be autophagy vacuoles (autophagosomes) for breaking
down and recycling of damaged and unwanted proteins during dehydration.
An increase in the proportion of unsaturated phospholipids in the membrane
might also lead to protection and increased membrane integrity during desiccation
and has been observed for a number of resurrection plants. Hoekstra (2005) reported
a negative correlation between the number of double bonds in polar lipids of
membranes and the longevity of desiccation-tolerant tissues. The phospholipid
content and the polyunsaturated lipid levels in the plasma membrane increased in
desiccation-tolerant attached dried leaves of Sporobolus stapfianus, but decreased in
desiccation-sensitive harvested detached dried leaves (Quartacci et al., 1997;Neale et
al., 2000). Increased levels of unsaturated fatty acids were also observed in all lipid
classes of Boea hygroscopica upon dehydration (Navari‐Izzo et al., 1995). The
reduction in the amount of unsaturated phospholipid in unviable tissues and increase
132 Chapter 6: General Discussion
in viable tissues might be linked to peroxidation of the membrane as the result of
oxidative stress during dehydration.
Unsaturated fats have less tendency to align compared to their saturated fatty
acid counterparts. Therefore an increase in unsaturated phospholipids may result in
increased membrane fluidity (Bartels and Hussain, 2011) or even reducing the
chance of membrane fusion during desiccation. However, the exact role of these
polyunsaturated lipids in desiccation-tolerance is unclear. Moon et al. (1995) and
Gombos et al. (1994) demonstrated unsaturated phospholipid compounds in
thylakoid membrane result in accelerating the recovery of the photosystem II protein
complex from cold photoinhibition. They suggest this phenomena is due to an
increase in membrane unsaturated phospholipids and subsequently increased
membrane fluidity. An increase in plasma membrane fluidity has also been observed
during dehydration in orthodox seeds of cucumber (Amritphale et al., 2000). It is
well known that during senescence a large decrease in cell membrane fluidity results
in membrane deterioration (Borochov et al., 1982;Thompson, 1988). Thus it seems
reasonable to suggest that increased membrane fluidity is a pro-survival strategy for
membrane protection during desiccation in resurrection plants. We further
recommend study of the role of membrane fluidity in desiccation-tolerance
particularly their possible role in preventing membrane fusion. These findings could
have possible implication in developing stress tolerant crop plants.
Based on the changes in chloroplast during dehydration, resurrection plants are
divided in two classes, homoiochlorophyllous and poikilochlorophyllous. Although,
the chloroplasts of both groups undergo changes, the chloroplasts of the
homoiochlorophyllous resurrection plants are significantly less affected than those
present in poikilochlorophyllous resurrection plants. In homoiochlorophyllous
resurrection plants various levels of the chlorophyll are maintained while the rest is
degraded (Gaff, 1981;Sherwin and Farrant, 1998). Some of the changes in
chloroplasts of homoiochlorophyllous resurrection plants during desiccation are in
inner membrane organisation and stacking. Chloroplasts become more round in the
homoiochlorophyllous resurrection plant C. plantagineum (Alamillo and Bartels,
2001). Changes in lipid protein ratio and changes in lipid ratio in thylakoid
membranes have also been reported (Quartacci et al., 1997;Navari-Izzo et al., 2000).
Poikilochlorophyllous resurrection plants on the other hand, lose all chlorophyll and
133
grana and the thylakoid membranes are at least partially degraded or turning to rows
of vesicles when desiccated (Gaff, 1981;Sherwin and Farrant, 1998). Dismantlement
or reduction of photosynthesis apparatus reduces the oxidative stress caused by ROS
accumulation by photosynthesis during water deficit stress.
6.3.4 The possible protection of mitochondria structure during dehydration and
rehydration
While photosynthesis is shutdown early in the dehydration process in
resurrection plants, respiration remains active until very low hydration levels,
providing desiccating tissues with much needed energy (Tuba et al., 1997;Tuba et al.,
1998;Farrant, 2000). The activity of respiration suggests that at least a portion of the
mitochondria remains intact until very low hydration levels. A number of changes
have been observed in mitochondria of desiccated tissues of some desiccation-
tolerant plants. In homoiochlorophyllous C. wilmsii mitochondria retained integrity
and the cristae remained well defined at 5 % RWC (Farrant, 2000). In the
poikilochlorophyllous resurrection sedge Coleochloa setifera, mitochondria were
present in aqueously fixed tissue but contained few cristae (Bartley and Hallam,
1979). In four species of poikilochlorophyllous resurrection plants from the Borya
genus, mitochondria lost some of the peripheral membrane and the number of cristae
were reduced (Gaff, 1981). Meanwhile, after re-greening, mitochondria had more
cristae but there were fewer mitochondria (Gaff, 1981).
These changes to the structure of mitochondria might take place in the near
desiccated state, when respiration is shutdown. It seems there might be a difference
in mitochondria structural changes between homoiochlorophyllous and
poikilochlorophyllous resurrection plants, however, a thorough structural comparison
has not been done in previous studies. Time limitations in this project prevented us
from further investigation the structural changes of chloroplast and mitochondria.
Here we recommend observations on structural changes of chloroplast and
mitochondria to be conducted using cryofixation transmission electron microscopy.
Cryofixation method minimises the structural changes that might occur as the result
of fixation procedure.
134 Chapter 6: General Discussion
6.4 PROTEIN-PROTEIN INTERACTION PROFILE OF BAG4 SUGGEST
A KEY ROLE IN AUTOPHAGY
The fact that desiccation tolerant plants avoid PCD during extreme dehydration
suggests that these plants might utilise pathways that suppress PCD. BAG4 is known
to suppress program cell death (PCD) and is considered an anti-apoptotic protein.
Furthermore, elucidating the molecular mechanisms that underlie the cellular
functions of BAG4 becomes an increasingly important task, particularly in light of
the growing evidence connecting BAG4 overexpression to stress tolerance in model
plants (Doukhanina et al., 2006;Hoang, 2014). The mechanism by which BAG4
facilitates stress tolerance and prevents apoptosis remains to be revealed. Identifying
the proteins that BAG4 interacts with can help to understand the anti-apoptotic
mechanism of this protein. The identification of partner proteins for BAG4 may help
to explain the diverse functions of this protein. This project used high throughput
protein microarray technology to look at the difference between the protein-protein
interactions of the BAG4 proteins from T. loliiformis (TlBAG4) as a desiccation
tolerant plant with A. thaliana (AtBAG4) as a desiccation sensitive plant to see if
they are different or similar.
Our knowledge about plant BAG4 biological pathways is very limited,
however the BAG domain (BD) of AtBAG4 on the residues that are important for
Hsc70 interaction as well as in the charge distribution are remarkably similar to BD
of human BAG4. It is reasonable to assume AtBAG4 interacts with Hsc70 in the
same manner hBAG4 interacts with Hsc70. This means our knowledge about
hBAG4-Hsc4 interactions and regulations could be applicable for AtBAG4-Hsc70.
The N-terminal of the AtBAG4 which interacts with other partners is different from
hBAG4. For understanding the interaction pattern of this site we can use the results
from Arabidopsis protein microarray data.
There are three main different forms of autophagic pathways for degradation of
proteins in lysosomes. Chaperone-mediated autophagy (CMA) is a selective
mechanism for the degradation of soluble cytosolic proteins which is different from
other lysosomal degradation as it is independent from vesicular traffic. In this
pathway proteins are individually recognised by a molecular chaperone attached to
Hsc70 and then this complex interacts with another complex on the membrane of the
lysosome. The protein is unfolded probably by the chaperone complex prior to
135
import inside the lysosome (Salvador et al., 2000;Klionsky, 2005). After entering the
lysosome the protein is degraded and the components are recycled (Majeski and Fred
Dice, 2004;Klionsky, 2005). Plants lack lysosomes and specialised autophagy in
specialised vacuolar (the lysosomal CMV).
There are co-chaperones that interact with Hsc70. These co-chaperones act as
chaperones themselves and regulate the activities of Hsc70 by interacting with its
ATPase domain (Majeski and Fred Dice, 2004). BAG family members including
BAG4 are known to interact with Hsc70 hence positively or negatively regulate
Hsc70 activity in the CMV pathway (Nollen et al., 2000;Alberti et al., 2003). Based
on the data that were generated by the Arabidopsis protein microarray chip as well as
previous studies, AtBAG4 interacts with Hsc70.
A large number of proteins have been identified to have possible interaction
with AtBAG4 based on their signal intensity from the data generated by protein
microarray experiment. Many of these proteins are involved in carbohydrate
pathways (Table 6 and Appendix A).
It seems that the contribution of BAG4 (and perhaps the other BAGs) to stress
tolerance and pro-survival activity is through interaction with proteins involved in
degradation of cytosolic damaged proteins. This is through interaction with proteins
involved in autophagy survival mechanisms. However the impact of BAG4 on the
activation of autophagy through this interaction remains to be revealed. The
degradation of the damaged proteins are perhaps involved with CMV vacuolar and
proteasomal degradation. This project has identified a list of proteins involved in
carbohydrate pathway proteins which perhaps involved in production of NADPH
oxidase induced ROS through production of eATP under stress and starvation
conditions. The list of proteins interacted with BAG4 also has a number of MAPK,
radiation related proteins, and ATP-binding proteins which suggest the plant
autophagy regulation is largely similar to animals. The list also include a number
proteins interacting with transcription factors as well as some metal binding proteins
involved in similar biotic and abiotic stress response as well as development which
their pathways can be investigated.
Despite the shortcoming of this project for providing enough evidence that T.
loliiformis is using the pro-survival protein BAG4 differently in comparison with A.
thaliana, as a desiccation sensitive plant, due to time limitations; however, the study
136 Chapter 6: General Discussion
of protein-protein interaction of BAG4 using high-density protein microarray has
shed light on the possible interaction of this chaperone protein. Furthermore, this
study provided a valuable resource for uncovering the mechanism that this protein
interacts with and pathways it operates. In order to validate the results of protein
microarray observations for protein interaction, further experiments such as co-
immunoprecipitation and/or yeast two hybrid and/or Bimolecular fluorescence
complementation (BiFC) need to be conducted with the candidate proteins.
6.5 SUMMARY
In summary, this work used a combination of structural, physiological and
molecular techniques to investigate the unique structural, physiological and
molecular features that enable T. loliiformis, and potentially other resurrection plants,
to tolerate desiccation. Tripogon loliiformis possesses structural and physiological
characteristics that are common among drought tolerant plants (e.g. thick cuticle,
trichomes and photosynthesis pathway). These features make this plant more
efficient with water usage. Structural changes during dehydration such as leaf
folding, cell wall folding and vacuole fragmentation result in the slowing down of
dehydration as well as preventing the loss of membrane integrity (mechanical
damage) and hence the production of ROS (oxidative stress). Physiological
observations related to photosynthesis and electrolyte leakage (EL) suggest that T.
loliiformis is very sensitive towards dehydration and starts to prepare for desiccation
at very early stages of dehydration. This quick response to dehydration could be
justifiable based on microhabitats that this plant is commonly found at i.e. rocky
outcrops and shallow rock-pan soils with limited water capacity. Bulliforms cells
seem to have a critical role in leaf folding and photosynthesis. The protein results
from protein microarray chip demonstrated that BAG4 has anti-apoptotic properties
due to its interaction with a large number of proteins involved in autophagy
(particularly carbohydrates related pathways leading to autophagy). Furthermore, the
data generated from the protein-protein interaction of BAG4 using high-density
protein microarrays provided a valuable resource for uncovering the
mechanisms/pathways that this protein influences for future research.
Chapter 6: General Discussion 137
138 References
References
Agarraberes, F.A., and Dice, J.F. (2001). A molecular chaperone complex at the
lysosomal membrane is required for protein translocation. Journal of Cell
Science 114, 2491-2499.
Alamillo, J.M., and Bartels, D. (2001). Effects of desiccation on photosynthesis
pigments and the elip-like dsp 22 protein complexes in the resurrection plant
craterostigma plantagineum. Plant Science 160, 1161-1170.
Alberti, S., Esser, C., and Höhfeld, J. (2003). Bag-1—a nucleotide exchange factor of
hsc70 with multiple cellular functions. Cell stress & chaperones 8, 225.
Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2010).
Molecular biology of the cell. New york: Garland science; 2008. Classic
textbook now in its 5th Edition.
Ali, M.H., and Talukder, M.S.U. (2008). Increasing water productivity in crop
production--a synthesis. Agricultural Water Management 95, 1201-1213. doi:
DOI: 10.1016/j.agwat.2008.06.008.
Almoguera, C., Coca, M.A., and Jordano, J. (1993). Tissue-specific expression of
sunflower heat shock proteins in response to water stress. The Plant Journal
4, 947-958. doi: 10.1046/j.1365-313X.1993.04060947.x.
Alpert, P. (2000). The discovery, scope, and puzzle of desiccation tolerance in plants.
Plant Ecology 151, 5-17.
Alpert, P., and Oliver, M.J. (2002). "Drying without dying," in Desiccation and
survival in plants, eds. M. Black & H.W. Pritchard. (Wallingford: CABI), 4-
31.
Alvarez, J.M., Rocha, J.F., and Machado, S.R. (2008). Bulliform cells in loudetiopsis
chrysothrix (nees) conert and tristachya leiostachya nees (poaceae): Structure
in relation to function. Brazilian Archives of Biology And Technology 51,
113-119.
Amarasinghe, V., and Watson, L. (1988). Comparative ultrastructure of microhairs in
grasses. Botanical Journal of the Linnean Society 98, 303-319. doi:
10.1111/j.1095-8339.1988.tb01705.x.
Amritphale, D., Sreenivasulu, Y., and Singh, B. (2000). Changes in membrane
fluidity and protein composition during release of cucumber seeds from
dormancy by a higher temperature shift. Annals of Botany 85, 13-18. doi:
10.1006/anbo.1999.0992.
Anderson, V.J., and Briske, D.D. (1990). Stomatal distribution, density and
conductance of three perennial grasses native to the southern true prairie of
texas. American Midland Naturalist 123, 152-159. doi: 10.2307/2425768.
Apel, K., and Hirt, H. (2004a). Reactive oxygen species: Metabolism, oxidative
stress, and signal transduction. Annu. Rev. Plant Biol. 55, 373-399.
Apel, K., and Hirt, H. (2004b). Reactive oxygen species: Metabolism, oxidative
stress, and signal transduction. Annual Review Of Plant Biology 55, 373-399.
Atkin, O.K., and Macherel, D. (2009). The crucial role of plant mitochondria in
orchestrating drought tolerance. Annals of Botany 103, 581-597.
Bajji, M., Kinet, J.M., and Lutts, S. (2002). The use of the electrolyte leakage
method for assessing cell membrane stability as a water stress tolerance test
in durum wheat. Plant Growth Regulation 36, 61-70. doi:
10.1023/a:1014732714549.
References 139
Bartels, D. (2005). Desiccation tolerance studied in the resurrection plant
craterostigma plantagineum. Integrative and Comparative Biology 45, 696-
701. doi: 10.1093/icb/45.5.696.
Bartels, D., Hanke, C., Schneider, K., Michel, D., and Salamini, F. (1992). A
desiccation-related elip-like gene from the resurrection plant craterostigma
plantagineum is regulated by light and aba. The EMBO Journal 11, 2771–
2778.
Bartels, D., and Hussain, S.S. (2011). "Resurrection plants: Physiology and
molecular biology," in Plant desiccation tolerance. Springer), 339-364.
Bartels, D., and Salamini, F. (2001). Desiccation tolerance in the resurrection plant
craterostigma plantagineum. A contribution to the study of drought tolerance
at the molecular level. Plant Physiology 127, 1346-1353. doi:
10.1104/pp.010765.
Bartels, D., Schneider, K., Terstappen, G., Piatkowski, D., and Salamini, F. (1990).
Molecular cloning of abscisic acid-modulated genes which are induced
during desiccation of the resurrection plant craterostigma plantagineum.
Planta 181, 27-34. doi: 10.1007/BF00202321.
Barthlott, W., Neinhuis, C., Cutler, D., Ditsch, F., Meusel, I., Theisen, I., and
Wilhelmi, H. (1998). Classification and terminology of plant epicuticular
waxes. Botanical Journal of the Linnean Society 126, 237-260. doi:
10.1111/j.1095-8339.1998.tb02529.x.
Bartley, M., and Hallam, N. (1979). Changes in the fine structure of the desiccation-
tolerant sedge coleochloa setifera (ridley) gilly under water stress. Australian
Journal of Botany 27, 531-545. doi: http://dx.doi.org/10.1071/BT9790531.
Bell, H.L., and Columbus, T.J. (2008). Proposal for an expanded distichlis (poaceae,
chloridoideae): Support from molecular, morphological, and anatomical
characters. Systematic Botany 33, 536-551. doi:
10.1600/036364408785679879.
Benamar, A., Tallon, C., and Macherel, D. (2003). Membrane integrity and oxidative
properties of mitochondria isolated from imbibing pea seeds after priming or
accelerated ageing. Seed Science Research 13, 35-45.
Benjamini, Y., and Hochberg, Y. (1995). Controlling the false discovery rate: A
practical and powerful approach to multiple testing. Journal of the Royal
Statistical Society. Series B (Methodological) 57, 289-300. doi:
10.2307/2346101.
Bernacchia, G., and Furini, A. (2004). Biochemical and molecular responses to water
stress in resurrection plants. Physiologia Plantarum 121, 175-181. doi:
10.1111/j.1399-3054.2004.00321.x.
Bernacchia, G., Salamini, F., and Bartels, D. (1996). Molecular characterization of
the rehydration process in the resurrection plant craterostigma plantagineum.
Plant Physiology 111, 1043-1050.
Bewley, J.D. (1979). Physiological aspects of desiccation tolerance. Annual Review
of Plant Physiology 30, 195-238.
Bewley, J.D.a.J.E.K. (1982). "Desiccation-tolerance," in Encycopedia of plant
physiology, ed. P.S.N. O.L. Lange, C. B. Osmond, and H. Ziegler. (Berlin:
Springer-Verlag), 325-378.
Bianchi, G., Gamba, A., Murelli, C., Salamini, F., and Bartels, D. (1991). Novel
carbohydrate metabolism in the resurrection plant craterostigma
plantagineum. The Plant Journal 1, 355-359.
140 References
Bockel, C., Salamini, F., and Bartels, D. (1998). Isolation and characterization of
genes expressed during early events of the dehydration process in the
resurrection plant craterostigma plantagineum. Journal of Plant Physiology
152, 158-166.
Borochov, A., Halevy, A.H., and Shinitzky, M. (1982). Senescence and the fluidity
of rose petal membranes: Relationship to phospholipid metabolism. Plant
Physiology 69, 296-299. doi: 10.1104/pp.69.2.296.
Botanic Gardens Trust (2011). Tripogon loliiformis (f.Muell.) c.E.Hubb. [Online].
Sydney, Australia. Available: http://plantnet.rbgsyd.nsw.gov.au [Accessed].
Bowler, C., Montagu, M.V., and Inze, D. (1992). Superoxide dismutase and stress
tolerance. Annual Review of Plant Physiology and Plant Molecular Biology
43, 83-116. doi: doi:10.1146/annurev.pp.43.060192.000503.
Boyer, J.S., Wong, S.C., and Farquhar, G.D. (1997). Co2 and water vapor exchange
across leaf cuticle (epidermis) at various water potentials. Plant Physiology
114, 185-191. doi: 10.1104/pp.114.1.185.
Bray, E.A. (2002). Abscisic acid regulation of gene expression during water-deficit
stress in the era of the arabidopsis genome. Plant, Cell & Environment 25,
153-161. doi: 10.1046/j.1365-3040.2002.00746.x.
Briknarová, K., Takayama, S., Brive, L., Havert, M.L., Knee, D.A., Velasco, J.,
Homma, S., Cabezas, E., Stuart, J., and Hoyt, D.W. (2001). Structural
analysis of bag1 cochaperone and its interactions with hsc70 heat shock
protein. Nature Structural & Molecular Biology 8, 349-352.
Brive, L., Takayama, S., Briknarová, K., Homma, S., Ishida, S.K., Reed, J.C., and
Ely, K.R. (2001). The carboxyl-terminal lobe of hsc70 atpase domain is
sufficient for binding to bag1. Biochemical and biophysical research
communications 289, 1099-1105.
Brown, R.H. (1999). "14 - agronomic implications of c4 photosynthesis," in C4 plant
biology, eds. R.F. Sage & R.K. Monson. (San Diego: Academic Press), 473-
507.
Bryant, G., Koster, K.L., and Wolfe, J. (2001). Membrane behaviour in seeds and
other systems at low water content: The various effects of solutes. Seed
Science Research 11, 17-25.
Chandra Babu, R., Zhang, J., Blum, A., David Ho, T.-H., Wu, R., and Nguyen, H.
(2004). Hva1, a lea gene from barley confers dehydration tolerance in
transgenic rice ( oryza sativa l.) via cell membrane protection. Plant Science
166, 855-862.
Chen, L.-Q., Li, C.-S., Chaloner, W.G., Beerling, D.J., Sun, Q.-G., Collinson, M.E.,
and Mitchell, P.L. (2001). Assessing the potential for the stomatal characters
of extant and fossil ginkgo leaves to signal atmospheric co2 change. American
Journal of Botany 88, 1309-1315.
Chen, M.H., Liu, L.F., Chen, Y.R., Wu, H.K., and Yu, S.M. (1994). Expression of
alpha-amylases, carbohydrate metabolism, and autophagy in cultured rice
cells is coordinately regulated by sugar nutrient. The Plant Journal : for cell
and molecular biology 6, 625-636. doi: 10.1046/j.1365-
313X.1994.6050625.x.
Chivasa, S., Ndimba, B.K., Simon, W.J., Lindsey, K., and Slabas, A.R. (2005).
Extracellular atp functions as an endogenous external metabolite regulating
plant cell viability. The Plant Cell Online 17, 3019-3034.
Clarke, J.M. (1986). Effect of leaf rolling on leaf water loss in triticum spp.
Canadian Journal of Plant Science 66, 885-891. doi: 10.4141/cjps86-111.
References 141
Clayton, W.D., Vorontsova, M.S., Harman, K.T., and Williamson, H. (2010
onwards). Tripogon [Online]. GrassBase - The Online World Grass Flora
Available: http://www.kew.org/data/grasses-db/www/gen00661.htm
[Accessed].
Close, T.J. (1996). Dehydrins: Emergence of a biochemical role of a family of plant
dehydration proteins. Physiologia Plantarum 97, 795-803.
Conley, M.M., Kimball, B., Brooks, T., Pinter, P., Hunsaker, D., Wall, G., Adam, N.,
Lamorte, R., Matthias, A., and Thompson, T. (2001). Co2 enrichment
increases water‐use efficiency in sorghum. New Phytologist 151, 407-412.
Consortium, A.I.M. (2011). Evidence for network evolution in an arabidopsis
interactome map. Science 333, 601-607. doi: 10.1126/science.1203877.
Corlett, J.E., Jones, H.G., Massacci, A., and Masojidek, J. (1994). Water deficit, leaf
rolling and susceptibility to photoinhibition in field grown sorghum.
Physiologia Plantarum 92, 423-430. doi: 10.1111/j.1399-
3054.1994.tb08831.x.
Cosgrove, D.J. (2000). Expansive growth of plant cell walls. Plant Physiology and
Biochemistry 38, 109-124.
Crowe, J.H., Carpenter, J.F., and Crowe, L.M. (1998). The role of vitrification in
anhydrobiosis. Annual Review of Physiology 60, 73-103.
Crowe, J.H., Crowe, L.M., Oliver, A.E., Tsvetkova, N., Wolkers, W., and Tablin, F.
(2001). The trehalose myth revisited: Introduction to a symposium on
stabilization of cells in the dry state. Cryobiology 43, 89-105. doi:
http://dx.doi.org/10.1006/cryo.2001.2353.
Cui, F., Liu, L., Zhao, Q., Zhang, Z., Li, Q., Lin, B., Wu, Y., Tang, S., and Xie, Q.
(2012). Arabidopsis ubiquitin conjugase ubc32 is an erad component that
functions in brassinosteroid-mediated salt stress tolerance. The Plant Cell
Online 24, 233-244.
Del Carmen Rodríguez-Gacio, M., Matilla-Vázquez, M.A., and Matilla, A.J. (2009).
Seed dormancy and aba signaling the breakthrough goes on. Plant signaling
& behavior 4, 1035-1048.
Demidchik, V., Shang, Z., Shin, R., Thompson, E., Rubio, L., Laohavisit, A.,
Mortimer, J.C., Chivasa, S., Slabas, A.R., Glover, B.J., Schachtman, D.P.,
Shabala, S.N., and Davies, J.M. (2009). Plant extracellular atp signalling by
plasma membrane nadph oxidase and ca2+ channels. The Plant Journal 58,
903-913. doi: 10.1111/j.1365-313X.2009.03830.x.
Díez, P., Dasilva, N., González-González, M., Matarraz, S., Casado-Vela, J., Orfao,
A., and Fuentes, M. (2012). Data analysis strategies for protein microarrays.
Microarrays 1, 64-83.
Dinakar, C., Djilianov, D., and Bartels, D. (2012). Photosynthesis in desiccation
tolerant plants: Energy metabolism and antioxidative stress defense. Plant
Science 182, 29-41. doi: 10.1016/j.plantsci.2011.01.018.
Dingkuhn, M., Audebert, A.Y., Jones, M.P., Etienne, K., and Sow, A. (1999).
Control of stomatal conductance and leaf rolling in o. Sativa and o.
Glaberrima upland rice. Field Crops Research 61, 223-236. doi:
10.1016/s0378-4290(98)00165-8.
Dominy, N.J., Grubb, P.J., Jackson, R.V., Lucas, P.W., Metcalfe, D.J., Svenning, J.-
C., and Turner, I.M. (2008). In tropical lowland rain forests monocots have
tougher leaves than dicots, and include a new kind of tough leaf. Annals of
Botany 101, 1363-1377. doi: 10.1093/aob/mcn046.
142 References
Doukhanina, E.V., Chen, S., Van Der Zalm, E., Godzik, A., Reed, J., and Dickman,
M.B. (2006). Identification and functional characterization of the bag protein
family in arabidopsis thaliana. The Journal of biological chemistry 281,
18793-18801.
Dower, W.J., Miller, J.F., and Ragsdale, C.W. (1988). High efficiency
transformation of e. Coli by high voltage electroporation. Nucleic acids
research 16, 6127-6145.
Drennan, P., Smith, M., Goldsworthy, D., and Van Staden, J. (1993). The occurrence
of trehalose in the leaves of the desiccation-tolerant angiosperm myrothamnus
flabellifolius welw. Journal of plant physiology 142, 493-496.
Eglinton, G., and Hamilton, R.J. (1967). Leaf epicuticular waxes. Science 156, 1322-
1335. doi: 10.1126/science.156.3780.1322.
Ekanayake, I.J., De Datta, S.K., and Steponkus, P.L. (1993). Effect of water deficit
stress on diffusive resistance, transpiration, and spikelet desiccation of rice
(oryza sativa l.). Annals of Botany 72, 73-80. doi: 10.1006/anbo.1993.1082.
Elsayed, A., Rafudeen, M., and Golldack, D. (2014). Physiological aspects of
raffinose family oligosaccharides in plants: Protection against abiotic stress.
Plant Biology 16, 1-8.
Esau, K. (1965). Plant anatomy [Online]. New York: Jonh Wiley and Son.
[Accessed].
Ewen, S.W.B., and Pusztai, A. (1999). Effect of diets containing genetically
modified potatoes expressing galanthus nivalis lectin on rat small intestine.
The Lancet 354, 1353-1354.
Farooq, M., Wahid, A., Kobayashi, N., Fujita, D., and Basra, S.M.A. (2009). "Plant
drought stress: Effects, mechanisms and management," in Sustainable
agriculture, eds. E. Lichtfouse, M. Navarrete, P. Debaeke, S. Véronique & C.
Alberola. Springer Netherlands), 153-188.
Farquhar, G.D., and Sharkey, T.D. (1982). Stomatal conductance and photosynthesis.
Annual review of plant physiology 33, 317-345.
Farrant, J.M. (2000). A comparison of mechanisms of desiccation tolerance among
three angiosperm resurrection plant species. Plant Ecology 151, 29-39.
Farrant, J.M., Lehner, A., Cooper, K., and Wiswedel, S. (2009). Desiccation
tolerance in the vegetative tissues of the fern mohria caffrorum is seasonally
regulated. The Plant Journal 57, 65-79.
Farrant, J.M., Vander Willigen, C., Loffell, D.A., Bartsch, S., and Whittaker, A.
(2003). An investigation into the role of light during desiccation of three
angiosperm resurrection plants. Plant, Cell & Environment 26, 1275-1286.
Fernandez, D., and Castrillo, M. (1999). Maize leaf rolling initiation.
Photosynthetica 37, 493-497. doi: 10.1023/a:1007124214141.
Flexas, J., and Medrano, H. (2002). Drought‐inhibition of photosynthesis in c3
plants: Stomatal and non‐stomatal limitations revisited. Annals of Botany 89,
183-189. doi: 10.1093/aob/mcf027.
Gaff, D., Bartels, D., and Gaff, J. (1997). Changes in gene expression during drying
in a desiccation-tolerant grass sporobolus stapfianus and a desiccation-
sensitive grass sporobolus pyramidalis. Functional Plant Biology 24, 617-
622.
Gaff, D., and Latz, P. (1978). The occurrence of resurrection plants in the australian
flora. Australian Journal of Botany 26, 485-492.
References 143
Gaff, D., and Mcgregor, G. (1979). The effect of dehydration and rehydration on the
nitrogen content of various fractions from resurrection plants. Biologia
Plantarum 21, 92-99.
Gaff, D., Zee, S., and O'brien, T. (1976). The fine structure of dehydrated and
reviving leaves of borya nitida labill; a desiccation-tolerant plant. Australian
Journal of Botany 24, 225-236. doi: http://dx.doi.org/10.1071/BT9760225.
Gaff, D.F. (1971). Desiccation-tolerant flowering plants in southern africa. Science
174, 1033-1034.
Gaff, D.F. (1977). Desiccation tolerant vascular plants of southern africa. Oecologia
31, 95-109.
Gaff, D.F. (1981). The biology of resurrection plants. Melbourne: University of
Western Australia Press.
Gaff, D.F. (1987). Desiccation tolerant plants in south america. Oecologia 74, 133-
136.
Gaff, D.F., Blomstedt, C.K., Neale, A.D., Le, T.N., Hamill, J.D., and Ghasempour,
H.R. (2009). Sporobolus stapfianus, a model desiccation-tolerant grass.
Functional Plant Biology 36, 589-599. doi:
http://dx.doi.org/10.1071/FP08166.
Gaff, D.F., and Ellis, R.P. (1974). Southern african grasses with foliage that revives
after dehydration. Bothalia 11, 305-308.
Gaff, D.F., and Loveys, B.R. (1984). Abscisic acid content and effects during
dehydration of detached leaves of desiccation tolerant plants. Journal of
Experimental Botany 35, 1350-1358. doi: 10.1093/jxb/35.9.1350.
Garwe, D., Thomson, J.A., and Mundree, S.G. (2003). Molecular characterization of
xvsap1, a stress-responsive gene from the resurrection plant xerophyta
viscosa baker1. Journal of Experimental Botany 54, 191-201.
Gazzarrini, S., and Tsai, A.Y.-L. (2014). Trehalose-6-phosphate and snrk1 kinases in
plant development and signaling: The emerging picture. Frontiers in Plant
Science 5. doi: 10.3389/fpls.2014.00119.
Gechev, T.S., Bergström, E., Thomas-Oates, J., Antonio, C., Mueller-Roeber, B.,
Schippers, J.H.M., Fernie, A.R., Toneva, V., Benina, M., Obata, T., Tohge,
T., Sujeeth, N., Minkov, I., Hille, J., Temanni, M.-R., and Marriott, A.S.
(2013). Molecular mechanisms of desiccation tolerance in the resurrection
glacial relic haberlea rhodopensis. Cellular and Molecular Life Sciences 70,
689-709. doi: 10.1007/s00018-012-1155-6.
Gechev, T.S., Dinakar, C., Benina, M., Toneva, V., and Bartels, D. (2012).
Molecular mechanisms of desiccation tolerance in resurrection plants.
Cellular and Molecular Life Sciences 69, 3175-3186.
Geisler, M., Kleczkowski, L.A., and Karpinski, S. (2006). A universal algorithm for
genome-wide in silicio identification of biologically significant gene
promoter putative cis-regulatory-elements; identification of new elements for
reactive oxygen species and sucrose signaling in arabidopsis. The Plant
journal : for cell and molecular biology 45, 384-398.
Genty, B., Briantais, J.M., and Baker, N.R. (1989). The relationship between the
quantum yield of photosynthetic electron transport and quenching of
chlorophyll fluorescence. Biochimica et Biophysica Acta (BBA) - General
Subjects 990, 87-92. doi: http://dx.doi.org/10.1016/S0304-4165(89)80016-9.
Georgieva, K., Doncheva, S., Mihailova, G., and Petkova, S. (2012). Response of
sun- and shade-adapted plants of haberlea rhodopensis to desiccation. Plant
Growth Regulation 67, 121-132. doi: 10.1007/s10725-012-9669-3.
144 References
Georgieva, K., Sárvári, E., and Keresztes, A. (2010). Protection of thylakoids against
combined light and drought by a lumenal substance in the resurrection plant
haberlea rhodopensis. Annals of Botany 105, 117-126. doi:
10.1093/aob/mcp274.
Ghasempour, H., Anderson, E., Gianello, R., and Gaff, D. (1998). Growth inhibitor
effects on protoplasmic drought tolerance and protein synthesis in leaf cells
of the resurrection grass, sporobolus stapfianus. Plant Growth Regulation 24,
179-183.
Gombos, Z., Wada, H., and Murata, N. (1994). The recovery of photosynthesis from
low-temperature photoinhibition is accelerated by the unsaturation of
membrane lipids: A mechanism of chilling tolerance. Proceedings of the
National Academy of Sciences 91, 8787-8791.
Griffiths, C.A., Gaff, D.F., and Neale, A.D. (2014). Drying without senescence in
resurrection plants. Frontiers in Plant Science 5, 36.
Guan, L.M., Zhao, J., and Scandalios, J.G. (2000). Cis-elements and trans-factors
that regulate expression of the maize cat1 antioxidant gene in response to aba
and osmotic stress: H2o2 is the likely intermediary signaling molecule for the
response. The Plant Journal 22, 87-95.
Gutschick, V.P. (1999). Biotic and abiotic consequences of differences in leaf
structure. New Phytologist 143, 3-18. doi: 10.1046/j.1469-
8137.1999.00423.x.
Hallam, N.D., and Luff, S.E. (1980). Fine structural changes in the mesophyll tissue
of the leaves of xerophyta villosa during desiccation. Botanical Gazette 141,
173-179. doi: 10.2307/2474849.
Hara, M., Fujinaga, M., and Kuboi, T. (2004). Radical scavenging activity and
oxidative modification of citrus dehydrin. Plant Physiology and Biochemistry
42, 657-662.
Hatch, M.D., Kagawa, T., and Craig, S. (1975). Subdivision of c,-pathway species
based on differing c4 acid decarboxylating systems and ultrastructural
features. Australian Journal of Plant Physiology 111-128.
Heckathorn, S.A., and Delucia, E.H. (1991). Effect of leaf rolling on gas exchange
and leaf temperature of andropogon gerardii and spartina pectinata.
Botanical Gazette 152, 263-268. doi: 10.1086/337888.
Hendry, G.a.F., and Grime, J.P. (1993). Methods in comparative plant ecology: A
laboratory manual. London: Chapman and Hall.
Hilbricht, T., Varotto, S., Sgaramella, V., Bartels, D., Salamini, F., and Furini, A.
(2008). Retrotransposons and sirna have a role in the evolution of desiccation
tolerance leading to resurrection of the plant craterostigma plantagineum.
New Phytologist 179, 877-887.
Hilu, K.W., and Randall, J.L. (1984). Convenient method for studying grass leaf
epidermis. Taxon 33, 413-415. doi: 10.2307/1220980.
Hoang, T.M.L. (2014). Engineering salinity tolerance in rice by exogenous
expression of cell death regulators. Thesis, Queensland University of
Technology.
Hoekstra, F.A. (2005). Differential longevities in desiccated anhydrobiotic plant
systems. Integrative and Comparative Biology 45, 725-733.
Hoekstra, F.A., Golovina, E.A., and Buitink, J. (2001). Mechanisms of plant
desiccation tolerance. Trends in Plant Science 6, 431-438.
Hovakimyan, M., Ramoth, T., Löbler, M., Schmitz, K.-P., Witt, M., Guthoff, R., and
Stachs, O. (2012). Evaluation of protective effects of trehalose on desiccation
References 145
of epithelial cells in three dimensional reconstructed human corneal
epithelium. Current eye research 37, 982-989. doi:
10.3109/02713683.2012.700754.
Hsiao, T.C. (1973). Plant responses to water stress. Annual review of plant
physiology 24, 519-570.
Iljin, W.S. (1957). Drought resistance in plants and physiological processes. Annual
Review of Plant Physiology 8, 257-274. doi:
doi:10.1146/annurev.pp.08.060157.001353.
Inoue, H., Nojima, H., and Okayama, H. (1990). High efficiency transformation of
escherichia coli with plasmids. Gene 96, 23-28.
Inskeep, W.P., and Bloom, P.R. (1985). Extinction coefficients of chlorophyll a and
b in n,n-dimethylformamide and 80% acetone. Plant Physiology 77, 483-485.
doi: 10.1104/pp.77.2.483.
Irmscher, E. (1912). U¨ ber die resistenz der laubmoose gegen austrocknung und ka¨
lte. Jahrb Wiss Bot 50, 387–449.
Iturriaga, G., Gaff, D.F., and Zentella, R. (2000). New desiccation-tolerant plants,
including a grass, in the central highlands of mexico, accumulate trehalose.
Australian Journal of Botany 48, 153-158.
Iyer, R., Mundree, S.G., Rafudeen, M.S., and Thomson, J.A. (2008). "Xvsap1, a
desiccation tolerance associated gene with potential for crop improvement,"
in Plant desiccation tolerance. Blackwell Publishing Ltd), 281-296.
Jami, S.K., Swathi Anuradha, T., Guruprasad, L., and Kirti, P.B. (2007). Molecular,
biochemical and structural characterization of osmotin-like protein from
black nightshade (solanum nigrum). Journal of Plant Physiology 164, 238-
252. doi: http://dx.doi.org/10.1016/j.jplph.2006.01.006.
Jang, I.-C., Oh, S.-J., Seo, J.-S., Choi, W.-B., Song, S.I., Kim, C.H., Kim, Y.S., Seo,
H.-S., Do Choi, Y., and Nahm, B.H. (2003). Expression of a bifunctional
fusion of the escherichia coli genes for trehalose-6-phosphate synthase and
trehalose-6-phosphate phosphatase in transgenic rice plants increases
trehalose accumulation and abiotic stress tolerance without stunting growth.
Plant physiology 131, 516-524.
Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W. (1987). Gus fusions: Beta-
glucuronidase as a sensitive and versatile gene fusion marker in higher plants.
The EMBO journal 6, 3901.
Jeter, C.R., Tang, W., Henaff, E., Butterfield, T., and Roux, S.J. (2004). Evidence of
a novel cell signaling role for extracellular adenosine triphosphates and
diphosphates in arabidopsis. The Plant Cell Online 16, 2652-2664.
Jones, L., and Mcqueen-Mason, S. (2004). A role for expansins in dehydration and
rehydration of the resurrection plant craterostigma plantagineum. FEBS
letters 559, 61-65.
Kadioglu, A., and Terzi, R. (2007). A dehydration avoidance mechanism: Leaf
rolling. The Botanical Review 73, 290-302. doi: 10.1663/0006-
8101(2007)73[290:adamlr]2.0.co;2.
Kadioglu, A., Terzi, R., Saruhan, N., and Saglam, A. (2012). Current advances in the
investigation of leaf rolling caused by biotic and abiotic stress factors. Plant
Science 182, 42-48. doi: 10.1016/j.plantsci.2011.01.013.
Kadioglu, A., and Turgut, R. (1999). Some biochemical changes during leaf rolling
in ctenanthe setosa (marantaceae). Acta Physiologiae Plantarum 21, 209-214.
doi: 10.1007/s11738-999-0034-8.
146 References
Kang, C.H., Jung, W., Kang, Y., Kim, J., Kim, D., Jeong, J., Baek, D., Jin, J., Lee, J.,
and Kim, M. (2005). Atbag6, a novel calmodulin-binding protein, induces
programmed cell death in yeast and plants. Cell Death & Differentiation 13,
84-95.
Katiyar-Agarwal, S., Agarwal, M., and Grover, A. (2003). Heat-tolerant basmati rice
engineered by over-expression of hsp101. Plant Molecular Biology 51, 677-
686. doi: 10.1023/A:1022561926676.
Kitajima, M., and Butler, W.L. (1975). Quenching of chlorophyll fluorescence and
primary photochemistry in chloroplasts by dibromothymoquinone.
Biochimica et Biophysica Acta (BBA) - Bioenergetics 376, 105-115. doi:
http://dx.doi.org/10.1016/0005-2728(75)90209-1.
Klionsky, D.J. (2005). The molecular machinery of autophagy: Unanswered
questions. Journal of cell science 118, 7-18.
Knapp, A.K. (1985). Effect of fire and drought on the ecophysiology of andropogon
gerardii and panicum virgatum in a tallgrass prairie. Ecology 66, 1309-1320.
Kotak, S., Vierling, E., Bäumlein, H., and Von Koskull-Döring, P. (2007). A novel
transcriptional cascade regulating expression of heat stress proteins during
seed development of arabidopsis. The Plant Cell Online 19, 182-195.
Kranner, I., Beckett, R.P., Wornik, S., Zorn, M., and Pfeifhofer, H.W. (2002).
Revival of a resurrection plant correlates with its antioxidant status. The Plant
Journal 31, 13-24.
Lang, Y.Z., Zhang, Z.J., Gu, X.Y., Yang, J.C., and Zhu, Q.S. (2004). A physiological
and ecological effect of crimpy leaf character in rice (oryza sativa l.). Ii.
Photosynthetic character, dry mass production and yield forming. Acta
Agronomica Sinica, 883–887.
Le, T.N., Blomstedt, C.K., Kuang, J., Tenlen, J., Gaff, D.F., Hamill, J.D., and Neale,
A.D. (2007). Desiccation-tolerance specific gene expression in leaf tissue of
the resurrection plant sporobolus stapfianus. Functional Plant Biology 34,
589-600.
Leprince, O., Harren, F.J., Buitink, J., Alberda, M., and Hoekstra, F.A. (2000).
Metabolic dysfunction and unabated respiration precede the loss of
membrane integrity during dehydration of germinating radicles. Plant
Physiology 122, 597-608.
Liphschitz, N., and Waisel, Y. (1974). Existence of salt glands in various genera of
the gramineae. New Phytologist 73, 507-513. doi: 10.2307/2431122.
Liu, M.-S., Chien, C.-T., and Lin, T.-P. (2008). Constitutive components and induced
gene expression are involved in the desiccation tolerance of selaginella
tamariscina. Plant and Cell Physiology 49, 653-663. doi:
10.1093/pcp/pcn040.
Liu, X., Wang, Z., Wang, L., Wu, R., Phillips, J., and Deng, X. (2009). Lea 4 group
genes from the resurrection plant boea hygrometrica confer dehydration
tolerance in transgenic tobacco. Plant Science 176, 90-98.
Long, S.P. (1999). "7 - environmental responses," in C4 plant biology, eds. R.F. Sage
& R.K. Monson. (San Diego: Academic Press), 215-249.
Lunn, J.E., Delorge, I., Figueroa, C.M., Van Dijck, P., and Stitt, M. (2014).
Trehalose metabolism in plants. The Plant Journal.
Majeski, A.E., and Fred Dice, J. (2004). Mechanisms of chaperone-mediated
autophagy. The International Journal of Biochemistry & Cell Biology 36,
2435-2444. doi: http://dx.doi.org/10.1016/j.biocel.2004.02.013.
References 147
Marino, D., Froidure, S., Canonne, J., Khaled, S.B., Khafif, M., Pouzet, C., Jauneau,
A., Roby, D., and Rivas, S. (2013). Arabidopsis ubiquitin ligase miel1
mediates degradation of the transcription factor myb30 weakening plant
defence. Nature communications 4, 1476.
Markovska, Y., Tsonev, T., and Kimenov, G. (1997). Regulation of cam and
respiratory recycling by water supply in higher poikilohydric plants —
haberlea rhodopensis friv. And ramonda serbica panč, at transition from
biosis to anabiosis and vice versa. Botanica Acta 110, 18-24. doi:
10.1111/j.1438-8677.1997.tb00606.x.
Matthews, R.B., Azam-Ali, S.N., and Peacock, J.M. (1990). Response of four
sorghum lines to mid-season drought. Ii. Leaf characteristics. Field Crops
Research 25, 297-308. doi: 10.1016/0378-4290(90)90011-y.
Maxwell, K., and Johnson, G.N. (2000). Chlorophyll fluorescence—a practical
guide. Journal of Experimental Botany 51, 659-668. doi:
10.1093/jexbot/51.345.659.
Mhadhbi, H., Fotopoulos, V., Mylona, P.V., Jebara, M., Elarbi Aouani, M., and
Polidoros, A.N. (2011). Antioxidant gene–enzyme responses in medicago
truncatula genotypes with different degree of sensitivity to salinity.
Physiologia Plantarum 141, 201-214.
Michaillat, L., and Mayer, A. (2013). Identification of genes affecting vacuole
membrane fragmentation in saccharomyces cerevisiae. PloS one 8, e54160.
doi: 10.1371/journal.pone.0054160.
Michel, D., Furini, A., Salamini, F., and Bartels, D. (1994). Structure and regulation
of an aba-and desiccation-responsive gene from the resurrection plant
craterostigma plantagineum. Plant molecular biology 24, 549-560.
Moon, B.Y., Higashi, S., Gombos, Z., and Murata, N. (1995). Unsaturation of the
membrane lipids of chloroplasts stabilizes the photosynthetic machinery
against low-temperature photoinhibition in transgenic tobacco plants.
Proceedings of the National Academy of Sciences 92, 6219-6223.
Moore, J., Nguema-Ona, E., Vicré-Gibouin, M., Sørensen, I., Willats, W.T.,
Driouich, A., and Farrant, J. (2013). Arabinose-rich polymers as an
evolutionary strategy to plasticize resurrection plant cell walls against
desiccation. Planta 237, 739-754. doi: 10.1007/s00425-012-1785-9.
Moore, J.P., Hearshaw, M., Ravenscroft, N., Lindsey, G.G., Farrant, J.M., and
Brandt, W.F. (2007). Desiccation-induced ultrastructural and biochemical
changes in the leaves of the resurrection plant myrothamnus flabellifolia.
Australian Journal of Botany 55, 482-491.
Moore, J.P., Vicré‐Gibouin, M., Farrant, J.M., and Driouich, A. (2008). Adaptations
of higher plant cell walls to water loss: Drought vs desiccation. Physiologia
plantarum 134, 237-245.
Mulako, I., Farrant, J., Collett, H., and Illing, N. (2008). Expression of xhdsi-1voc, a
novel member of the vicinal oxygen chelate (voc) metalloenzyme
superfamily, is up-regulated in leaves and roots during desiccation in the
resurrection plant xerophyta humilis (bak) dur and schinz. Journal of
experimental botany 59, 3885-3901.
Müller, C. (2008). "Resistance at the plant cuticle." (Dordrecht: Springer
Netherlands), 107-129.
Müller, J., Sprenger, N., Bortlik, K., Boller, T., and Wiemken, A. (1997).
Desiccation increases sucrose levels in ramonda and haberlea, two genera of
148 References
resurrection plants in the gesneriaceae. Physiologia Plantarum 100, 153-158.
doi: 10.1111/j.1399-3054.1997.tb03466.x.
Mundree, S.G., Baker, B., Mowla, S., Peters, S., Marais, S., Willigen, C.V.,
Govender, K., Maredza, A., Muyanga, S., Farrant, J.M., and Thomson, J.A.
(2002). Physiological and molecular insights into drought tolerance. African
Journal of Biotechnology 1, 28–38.
Mundree, S.G., Whittaker, A., Thomson, J.A., and Farrant, J.M. (2000). An aldose
reductase homolog from the resurrection plant xerophyta viscosa baker.
Planta 211, 693-700.
Nagarajan, S., and Nagarajan, S. (2010). Abiotic stress adaptation in plants.
Springer.
Nar, H., Saglam, A., Terzi, R., Várkonyi, Z., and Kadioglu, A. (2009). Leaf rolling
and photosystem ii efficiency in <i>ctenanthe setosa</i> exposed
to drought stress. Photosynthetica 47, 429-436. doi: 10.1007/s11099-009-
0066-8.
Navari-Izzo, F., Quartacci, M.F., Pinzino, C., Rascio, N., Vazzana, C., and Sgherri,
C.L. (2000). Protein dynamics in thylakoids of the desiccation-tolerant
plantboea hygroscopica during dehydration and rehydration. Plant physiology
124, 1427-1436.
Navari-Izzo, F., Quartacci, M.F., and Sgherri, C.L.M. (1997). Desiccation tolerance
in higher plants related to free radical defences. Phyton 37, 203–214.
Navari‐Izzo, F., Ricci, F., Vazzana, C., and Quartacci, M.F. (1995). Unusual
composition of thylakoid membranes of the resurrection plant boea
hygroscopica: Changes in lipids upon dehydration and rehydration.
Physiologia Plantarum 94, 135-142.
Ncbi (2014). "Hspa8 heat shock 70kda protein 8 [ homo sapiens (human) ]".).
Neale, A.D., Blomstedt, C.K., Bronson, P., Le, T.N., Guthridge, K., Evans, J., Gaff,
D.F., and Hamill, J.D. (2000). The isolation of genes from the resurrection
grass sporobolus stapfianus which are induced during severe drought stress.
Plant, Cell & Environment 23, 265-277.
Nelson, J.M., Lane, B., and Freeling, M. (2002). Expression of a mutant maize gene
in the ventral leaf epidermis is sufficient to signal a switch of the leaf's
dorsoventral axis. Development (Cambridge, England) 129, 4581-4589.
Newmaster, S.G., and Ragupathy, S. (2010). Ethnobotany genomics - discovery and
innovation in a new era of exploratory research. Journal of Ethnobiology and
Ethnomedicine 6, 2.
Newmyer, S.L., Christensen, A., and Sever, S. (2003). Auxilin-dynamin interactions
link the uncoating atpase chaperone machinery with vesicle formation.
Developmental Cell 4, 929-940. doi: http://dx.doi.org/10.1016/S1534-
5807(03)00157-6.
Noctor, G., and Foyer, C.H. (1998). Ascorbate and glutathione: Keeping active
oxygen under control. Annual review of plant physiology and plant molecular
biology 49, 249-279. doi: doi:10.1146/annurev.arplant.49.1.249.
Nollen, E.A., Brunsting, J.F., Song, J., Kampinga, H.H., and Morimoto, R.I. (2000).
Bag1 functions in vivo as a negative regulator of hsp70 chaperone activity.
Molecular and cellular biology 20, 1083-1088.
Norwood, M., Toldi, O., Richter, A., and Scott, P. (2003). Investigation into the
ability of roots of the poikilohydric plant craterostigma plantagineum to
survive dehydration stress. Journal of Experimental Botany 54, 2313-2321.
doi: 10.1093/jxb/erg255.
References 149
O'toole, J.C., and Cruz, R.T. (1980). Response of leaf water potential, stomatal
resistance, and leaf rolling to water stress. Plant Physiology 65, 428-432. doi:
10.1104/pp.65.3.428.
Oliver, M.J. (1991). Influence of protoplasmic water loss on the control of protein
synthesis in the desiccation-tolerant moss tortula ruralis ramifications for a
repair-based mechanism of desiccation tolerance. Plant Physiology 97, 1501-
1511.
Oliver, M.J. (1996). Desiccation tolerance in vegetative plant cells. Physiologia
Plantarum 97, 779-787. doi: 10.1111/j.1399-3054.1996.tb00544.x.
Oliver, M.J., and Bewley, J.D. (1997). "Desiccation-tolerance of plant tissues: A
mechanistic overview," in Horticultural reviews. John Wiley & Sons, Inc.),
171-213.
Oliver, M.J., Mishler, B.D., and Quisenberry, J.E. (1993). Comparative measures of
desiccation-tolerance in the tortula ruralis complex. I. Variation in damage
control and repair. American Journal of Botany 80, 127-136. doi:
10.2307/2445030.
Oliver, M.J., Tuba, Z., and Mishler, B.D. (2000a). The evolution of vegetative
desiccation tolerance in land plants. Plant Ecology 151, 85-100.
Oliver, M.J., Velten, J., and Wood, A.J. (2000b). Bryophytes as experimental models
for the study of environmental stress tolerance: Tortula ruralis and
desiccation-tolerance in mosses. Plant Ecology 151, 73-84.
Olvera-Carrillo, Y., Campos, F., Reyes, J.L., Garciarrubio, A., and Covarrubias,
A.A. (2010). Functional analysis of the group 4 late embryogenesis abundant
proteins reveals their relevance in the adaptive response during water deficit
in arabidopsis. Plant physiology 154, 373-390.
Omarova, E.I., Bogdanova, E.D., and Polimbetova, F.A. (1995). Regulation of
water-loss by the leaves soft winter-wheat with different organization of leaf
structure. Russian Journal of Plant Physiology 42, 383-385.
Orchard, E., and Wilson, A. (2005). Flora of australia Canberra: Australian
Biological Resources Study : CSIRO
Osakabe, Y., Osakabe, K., Shinozaki, K., and Tran, L.-S.P. (2014). Response of
plants to water stress. Frontiers in Plant Science 5. doi:
10.3389/fpls.2014.00086.
Ouvrard, O., Cellier, F., Ferrare, K., Tousch, D., Lamaze, T., Dupuis, J.-M., and
Casse-Delbart, F. (1996). Identification and expression of water stress- and
abscisic acid-regulated genes in a drought-tolerant sunflower genotype. Plant
Molecular Biology 31, 819-829. doi: 10.1007/BF00019469.
Paul, M.J., Primavesi, L.F., Jhurreea, D., and Zhang, Y. (2008). Trehalose
metabolism and signaling. Annu. Rev. Plant Biol. 59, 417-441.
Pearce, R., and Beckett, A. (1987). Cell shape in leaves of drought-stressed barley
examined by low temperature scanning electron microscopy. Annals of
botany 59, 191-195.
Pedersen, M., Johnsson, A., Mæhle, J., and Dalløkken, R. (1993). Short period leaf
movements in oxalis regnellii. Physiologia Plantarum 89, 277-284. doi:
10.1111/j.1399-3054.1993.tb00154.x.
Pérez-Pérez, M.E., Lemaire, S.D., and Crespo, J.L. (2012). Reactive oxygen species
and autophagy in plants and algae. Plant Physiology 160, 156-164. doi:
10.1104/pp.112.199992.
Peters, S., Mundree, S.G., Thomson, J.A., Farrant, J.M., and Keller, F. (2007).
Protection mechanisms in the resurrection plant xerophyta viscosa (baker):
150 References
Both sucrose and raffinose family oligosaccharides (rfos) accumulate in
leaves in response to water deficit. Journal of experimental botany 58, 1947-
1956.
Peterson, P.M., Romaschenko, K., and Johnson, G. (2010). A classification of the
chloridoideae (poaceae) based on multi-gene phylogenetic trees. Molecular
Phylogenetics and Evolution 55, 580-598.
Phillips, J., Hilbricht, T., Salamini, F., and Bartels, D. (2002). A novel abscisic acid-
and dehydration-responsive gene family from the resurrection plant
craterostigma plantagineum ncodes a plastid-targeted protein with DNA-
binding activity. Planta 215, 258-266.
Phillips, J.R., Dalmay, T., and Bartels, D. (2007). The role of small rnas in abiotic
stress. FEBS letters 581, 3592-3597.
Phillips, S.M., and Launert, E. (1971). A revision of the african species of tripogon
roem. & schult. Kew Bulletin 25, 301-322.
Piatkowski, D., Schneider, K., Salamini, F., and Bartels, D. (1990). Characterization
of five abscisic acid-responsive cdna clones isolated from the desiccation-
tolerant plant craterostigma plantagineum and their relationship to other
water-stress genes. Plant Physiology 94, 1682-1688. doi:
10.1104/pp.94.4.1682.
Porembski, S. (2011). "Evolution, diversity, and habitats of poikilohydrous vascular
plants," in Plant desiccation tolerance, eds. U. Lüttge, E. Beck & D. Bartels.
Springer Berlin Heidelberg), 139-156.
Porembski, S., and Barthlott, W. (2000). Granitic and gneissic outcrops (inselbergs)
as centers of diversity for desiccation-tolerant vascular plants. Plant Ecology
151, 19-28. doi: 10.2307/20050992.
Potts, M. (1994). Desiccation tolerance of prokaryotes. Microbiological reviews 58,
755.
Prendergast, H., and Hattersley, P. (1987). Australian c4 grasses (poaceae) - leaf
blade anatomical features in relation to c4 acid decarboxylation types.
Australian Journal of Botany 35, 355-382. doi:
http://dx.doi.org/10.1071/BT9870355.
Price, A.H., Young, E.M., and Tomos, A.D. (1997). Quantitative trait loci associated
with stomatal conductance, leaf rolling and heading date mapped in upland
rice (oryza sativa). New Phytologist 137, 83-91. doi: 10.1046/j.1469-
8137.1997.00818.x.
Proctor, M.C.F., Nagy, Z., Csintalan, Z., and Takács, Z. (1998). Water-content
components in bryophytes: Analysis of pressure-volume relationships.
Journal of Experimental Botany 49, 1845-1854. doi:
10.1093/jxb/49.328.1845.
Proctor, M.C.F., and Pence, V.C. (2002). "Vegetative tissues: Bryophytes, vascular
‘resurrection plants’ and vegetative propagules," in Desiccation and survival
in plants: Drying without dying, eds. M. Black & H.W. Pritchard.
(Wallingford, UK: CAB International), 207-237.
Proctor, M.C.F., and Tuba, Z. (2002). Poikilohydry and homoihydry: Antithesis or
spectrum of possibilities? New Phytologist 156, 327-349.
Quartacci, M.F., Forli, M., Rascio, N., Vecchia, F.D., Bochicchio, A., and Navari-
Izzo, F. (1997). Desiccation-tolerant sporobolus stapfianus: Lipid
composition and cellular ultrastructure during dehydration and rehydration.
Journal of Experimental Botany 48, 1269-1279. doi: 10.1093/jxb/48.6.1269.
References 151
Rascio, N., and La Rocca, N. (2005). Resurrection plants: The puzzle of surviving
extreme vegetative desiccation. Critical Reviews in Plant Sciences 24, 209-
225.
Ristic, Z., and Jenks, M.A. (2002). Leaf cuticle and water loss in maize lines
differing in dehydration avoidance. Journal of Plant Physiology 159, 645-
651. doi: 10.1078/0176-1617-0743.
Roberts, E.H. (1986). Seeds. Physiology of developement and germination (book).
Plant, Cell and Environment 9, 356-356. doi: 10.1111/1365-
3040.ep11611812.
Rodriguez, M.C.S., Edsgärd, D., Hussain, S.S., Alquezar, D., Rasmussen, M.,
Gilbert, T., Nielsen, B.H., Bartels, D., and Mundy, J. (2010). Transcriptomes
of the desiccation-tolerant resurrection plant craterostigma plantagineum.
The Plant Journal 63, 212-228. doi: 10.1111/j.1365-313X.2010.04243.x.
Rolny, N., Costa, L., Carrión, C., and Guiamet, J.J. (2011). Is the electrolyte leakage
assay an unequivocal test of membrane deterioration during leaf senescence?
Plant Physiology and Biochemistry 49, 1220-1227. doi:
http://dx.doi.org/10.1016/j.plaphy.2011.06.010.
Sales, K., Brandt, W., Rumbak, E., and Lindsey, G. (2000). The lea-like protein hsp
12 in saccharomyces cerevisiae has a plasma membrane location and protects
membranes against desiccation and ethanol-induced stress. Biochimica et
Biophysica Acta (BBA)-Biomembranes 1463, 267-278.
Salvador, N., Aguado, C., Horst, M., and Knecht, E. (2000). Import of a cytosolic
protein into lysosomes by chaperone-mediated autophagy depends on its
folding state. Journal of Biological Chemistry 275, 27447-27456.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular cloning. Cold spring
harbor laboratory press New York.
Sarieva, G.E., Kenzhebaeva, S.S., and Lichtenthaler, H.K. (2010). Adaptation
potential of photosynthesis in wheat cultivars with a capability of leaf rolling
under high temperature conditions. Russian Journal of Plant Physiology 57,
28-36. doi: 10.1134/s1021443710010048.
Schakel, K., and Hall, A. (1979). Reversible leaflet movements in relation to drought
adaptation of cowpeas, vigna unguiculata (l.) walp. Functional Plant Biology
6, 265-276. doi: http://dx.doi.org/10.1071/PP9790265.
Schonbeck, M.W., and Bewley, J.D. (1981). Responses of the moss tortula ruralis to
desiccation treatments. I. Effects of minimum water content and rates of
dehydration and rehydration. Canadian Journal of Botany 59, 2698-2706.
Scott, P. (2000). Resurrection plants and the secrets of eternal leaf. Annals of Botany
85, 159-166.
Sgherri, C., Stevanovic, B., and Navari-Izzo, F. (2004). Role of phenolics in the
antioxidative status of the resurrection plant ramonda serbica during
dehydration and rehydration. Physiologia Plantarum 122, 478-485. doi:
10.1111/j.1399-3054.2004.00428.x.
Shang, F., and Taylor, A. (2011). Ubiquitin–proteasome pathway and cellular
responses to oxidative stress. Free Radical Biology and Medicine 51, 5-16.
Sherwin, H., and Farrant, J. (1998). Protection mechanisms against excess light in
the resurrection plants craterostigma wilmsii and xerophyta viscosa. Plant
Growth Regulation 24, 203-210. doi: 10.1023/A:1005801610891.
Sherwin, H.W., and Farrant, J.M. (1996). Differences in rehydration of three
desiccation-tolerant angiosperm species. Annals of Botany 78, 703-710. doi:
10.1006/anbo.1996.0180.
152 References
Sherwin, H.W., Pammenter, N.W., February, E., Vander Willigen, C., and Farrant,
J.M. (1998). Xylem hydraulic characteristics, water relations and wood
anatomy of the resurrection plant myrothamnus flabellifolius welw. Annals of
Botany 81, 567-575.
Singh, S., Singh, T.N., and Chauhan, J.S. (2011). Living with limited water, part ii:
Dynamics of leaf rolling, leaf water homeostasis and water economy by
hybrid rice. Journal of Crop Improvement 25, 435. doi:
10.1080/15427528.2011.583559.
Singla, S.L., Pareek, A., and Grover, A. (1998). Plant hsp100 family with special
reference to rice. Journal of biosciences 23, 337-345.
Siqueiros-Delgado, M.E. (2007). Culm anatomy of bouteloua and relatives
(gramineae: Chloridoideae: Boutelouinae). Acta Botánica Mexicana 78, 39-
59.
Smirnoff, N. (1993). The role of active oxygen in the response of plants to water
deficit and desiccation. New Phytologist 125, 27-58. doi: 10.1111/j.1469-
8137.1993.tb03863.x.
Sondermann, H., Scheufler, C., Schneider, C., Höhfeld, J., Hartl, F.-U., and Moarefi,
I. (2001). Structure of a bag/hsc70 complex: Convergent functional evolution
of hsp70 nucleotide exchange factors. Science 291, 1553-1557.
Song, C.J., Steinebrunner, I., Wang, X., Stout, S.C., and Roux, S.J. (2006).
Extracellular atp induces the accumulation of superoxide via nadph oxidases
in arabidopsis. Plant Physiology 140, 1222-1232. doi:
10.1104/pp.105.073072.
Storer, A.C., and Cornish-Bowden, A. (1976). Concentration of mgatp2-and other
ions in solution. Calculation of the true concentrations of species present in
mixtures of associating ions. Biochem. J 159, 1-5.
Sutandy, F.X.R., Qian, J., Chen, C.-S., and Zhu, H. (2013). "Overview of protein
microarrays," in Current protocols in protein science. John Wiley & Sons,
Inc.).
Takayama, S., Sato, T., Krajewski, S., Kochel, K., Irie, S., Milian, J.A., and Reed,
J.C. (1995). Cloning and functional analysis of bag-1: A novel bcl-2-binding
protein with anti-cell death activity. Cell 80, 279-284.
Tanimoto, T., and Itoh, R. (2000). Effect of leaf rolling on transpiration and water
use efficiency in rice. Japanease Journal of Crop Science 69, 406-412.
Tardieu, F. (1996). Drought perception by plants
do cells of droughted plants experience water stress? Plant Growth Regulation 20,
93-104.
Taya, M. (Year). "Bio-inspired design of intelligent materials").
Terzi, R., and Kadioglu, A. (2006). Drought stress tolerance and the antioxidant
enzyme system in ctenanthe setosa. Acta Biologica Crscoviensia Series
Botanica 48, 89-96.
The Plant List (2010). "Tripogon".).
Thompson, J.E. (1988). "2 - the molecular basis for membrane deterioration during
senescence," in Senescence and aging in plants, eds. L.D. Noodén & A.C.
Leopold. Academic Press), 51-83.
Tipping, C., and Murray, D.R. (1999). Effects of elevated atmospheric co2
concentration on leaf anatomy and morphology in panicum species
representing different photosynthetic modes. International Journal of Plant
Sciences 160, 1063-1073. doi: 10.1086/314201.
References 153
Toldi, O., Tuba, Z., and Scott, P. (2009). Vegetative desiccation tolerance: Is it a
goldmine for bioengineering crops? Plant Science 176, 187-199.
Tothill, J.C., and Hacher, J.B. (1996). The grasses of southern queensland St Lucia,
Qld Tropical Grassland Society of Australia Inc., .
Tuba, Z., Csintalan, Z., and Proctor, M.C.F. (1996a). Photosynthetic responses of a
moss, tortula ruralis, ssp. Ruralis, and the lichens cladonia convoluta and c.
Furcata to water deficit and short periods of desiccation, and their
ecophysiological significance: A baseline study at present-day co2
concentration. New Phytologist 133, 353-361. doi: 10.2307/2558747.
Tuba, Z., Lichtenthaler, H.K., Csintalan, Z., Nagy, Z., and Szente, K. (1996b). Loss
of chlorophylls, cessation of photosynthetic co2 assimilation and respiration
in the poikilochlorophyllous plant xerophyta scabrida during desiccation.
Physiologia Plantarum 96, 383-388. doi: 10.1111/j.1399-
3054.1996.tb00448.x.
Tuba, Z., Protor, C.F., and Csintalan, Z. (1998). Ecophysiological responses of
homoiochlorophyllous and poikilochlorophyllous desiccation tolerant plants:
A comparison and an ecological perspective. Plant Growth Regulation 24,
211-217.
Tuba, Z., Smirnoff, N., Csintalan, Z., Szente, K., and Nagy, Z. (1997). Respiration
during slow desiccation of the poikilochlorophyllous desiccation tolerant
plant xerophyta scabrida at present-day co2 concentration. Plant Physiology
and Biochemistry 35, 381-386.
Tunnacliffe, A., Lapinski, J., and Mcgee, B. (2005). "A putative lea protein, but no
trehalose, is present in anhydrobiotic bdelloid rotifers," in Rotifera x.
Springer), 315-321.
Turgut, R., and Kadioglu, A. (1998). The effect of drought, temperature and
irradiation on leaf rolling in ctenanthe setosa. Biologia Plantarum 41, 629-
633. doi: 10.1023/a:1001817105685.
Turner, L.B., and Stewart, G.R. (1986). The effect of water stress upon polyamine
levels in barley (hordeum vulgare l.) leaves. Journal of Experimental Botany
37, 170-177. doi: 10.1093/jxb/37.2.170.
Turner, N. (1981). Techniques and experimental approaches for the measurement of
plant water status. Plant and Soil 58, 339-366. doi: 10.1007/BF02180062.
Turner, N.C., O'toole, J.C., Cruz, R.T., Namuco, O.S., and Ahmad, S. (1986).
Responses of seven diverse rice cultivars to water deficits i. Stress
development, canopy temperature, leaf rolling and growth. Field Crops
Research 13, 257-271. doi: 10.1016/0378-4290(86)90027-4.
Van Den Ende, W., and Valluru, R. (2009). Sucrose, sucrosyl oligosaccharides, and
oxidative stress: Scavenging and salvaging? Journal of Experimental Botany
60, 9-18. doi: 10.1093/jxb/ern297.
Vander Willigen, C., Pammenter, N.W., Jaffer, M.A., Mundree, S.G., and Farrant,
J.M. (2003). An ultrastructural study using anhydrous fixation of eragrostis
nindensis a resurrection grass with both desiccation-tolerant and -sensitive
tissues. Functional Plant Biology 30, 281-290.
Vander Willigen, C., Pammenter, N.W., Mundree, S.G., and Farrant, J.M. (2004).
Mechanical stabilization of desiccated vegetative tissues of the resurrection
grass eragrostis nindensis: Does a tip 3;1 and/or compartmentalization of
subcellular components and metabolites play a role? Journal of experimental
botany 55, 651-661. doi: 10.1093/jxb/erh089.
154 References
Vecchia, F.D., El Asmar, T., Calamassi, R., Rascio, N., and Vazzana, C. (1998).
Morphological and ultrastructural aspects of dehydration and rehydration in
leaves of sporobolus stapfianus. Plant Growth Regulation 24, 219-228. doi:
10.1023/a:1005853527769.
Vertucci, C.W., and Farrant, J.M. (1995). Acquisition and loss of desiccation
tolerance. Seed development and germination, 237-271.
Vicré, M., Farrant, J.M., and Driouich, A. (2004a). Insights into the cellular
mechanisms of desiccation tolerance among angiosperm resurrection plant
species. Plant, Cell & Environment 27, 1329-1340.
Vicré, M., Lerouxel, O., Farrant, J., Lerouge, P., and Driouich, A. (2004b).
Composition and desiccation-induced alterations of the cell wall in the
resurrection plant craterostigma wilmsii. Physiologia Plantarum 120, 229-
239.
Vicré, M., Sherwin, H., Driouich, A., Jaffer, M., and Farrant, J. (1999). Cell wall
characteristics and structure of hydrated and dry leaves of the resurrection
plant craterostigma wilmsii, a microscopical study. Journal of Plant
Physiology 155, 719-726.
Wahid, A., and Close, T.J. (2007). Expression of dehydrins under heat stress and
their relationship with water relations of sugarcane leaves. Biologia
Plantarum 51, 104-109. doi: 10.1007/s10535-007-0021-0.
Wang, M., Oppedijk, B.J., Lu, X., Van Duijn, B., and Schilperoort, R.A. (1996).
Apoptosis in barley aleurone during germination and its inhibition by abscisic
acid. Plant molecular biology 32, 1125-1134.
Wang, X., Zheng, G., Yang, S., and Jing, X. (1999). Effects of ultradry storage on
fluidity of plasma membrane of seed. Chinese Science Bulletin 44, 1008-
1014. doi: 10.1007/BF02886019.
Waugh, D.F. (1954). "Protein-protein interactions," in Advances in protein
chemistry, eds. K.B. M.L. Anson & T.E. John. Academic Press), 325-437.
Webb, M.A., and Arnott, H.J. (1982). Cell wall conformation in dry seeds in relation
to the preservation of structural integrity during desiccation. American
Journal of Botany 69, 1657-1668.
Whittaker, A., Martinelli, T., Bochicchio, A., Vazzana, C., and Farrant, J. (2004).
Comparison of sucrose metabolism during the rehydration of desiccation‐tolerant and desiccation‐sensitve leaf material of sporobolus stapfianus.
Physiologia Plantarum 122, 11-20. doi: 10.1111/j.1399-3054.2004.00346.x.
Williams, B., and Dickman, M. (2008). Plant programmed cell death: Can't live with
it; can't live without it. Molecular Plant Pathology 9, 531-544.
Williams, B., Kabbage, M., Britt, R., and Dickman, M.B. (2010). Atbag7, an
arabidopsis bcl-2-associated athanogene, resides in the endoplasmic
reticulum and is involved in the unfolded protein response. Proceedings of
the National Academy of Sciences of the United States of America 107, 6088-
6093.
Wong, H.L., Pinontoan, R., Hayashi, K., Tabata, R., Yaeno, T., Hasegawa, K.,
Kojima, C., Yoshioka, H., Iba, K., and Kawasaki, T. (2007). Regulation of
rice nadph oxidase by binding of rac gtpase to its n-terminal extension. The
Plant Cell Online 19, 4022-4034.
Woodenberg, W.R., Pammenter, N., Farrant, J.M., Driouich, A., and Berjak, P.
(2014). Embryo cell wall properties in relation to development and
desiccation in the recalcitrant-seeded encephalartos natalensis (zamiaceae)
dyer and verdoorn. Protoplasma, 1-14.
References 155
Wu, Y., and Cosgrove, D.J. (2000). Adaptation of roots to low water potentials by
changes in cell wall extensibility and cell wall proteins. Journal of
Experimental Botany 51, 1543-1553.
Xiao, B., Huang, Y., Tang, N., and Xiong, L. (2007). Over-expression of a lea gene
in rice improves drought resistance under the field conditions. Theoretical
and Applied Genetics 115, 35-46.
Xie, H.-T., Wan, Z.-Y., Li, S., and Zhang, Y. (2014). Spatiotemporal production of
reactive oxygen species by nadph oxidase is critical for tapetal programmed
cell death and pollen development in arabidopsis. The Plant Cell Online, tpc.
114.125427.
Xu, D., Duan, X., Wang, B., Hong, B., Ho, T.-H.D., and Wu, R. (1996). Expression
of a late embryogenesis abundant protein gene, hva1, from barley confers
tolerance to water deficit and salt stress in transgenic rice. Plant physiology
110, 249-257.
Yan, J., He, C., and Zhang, H. (2003). The bag-family proteins in arabidopsis
thaliana. Plant Science 165, 1-7. doi: http://dx.doi.org/10.1016/S0168-
9452(03)00121-3.
Zeiner, M., and Gehring, U. (1995). A protein that interacts with members of the
nuclear hormone receptor family: Identification and cdna cloning.
Proceedings of the National Academy of Sciences 92, 11465-11469.
Zeng, Q., Chen, X., and Wood, A.J. (2002). Two early light‐inducible protein (elip)
cdnas from the resurrection plant tortula ruralis are differentially expressed in
response to desiccation, rehydration, salinity, and high light. Journal of
Experimental Botany 53, 1197-1205. doi: 10.1093/jexbot/53.371.1197.
Zhang, G.-H., Xu, Q., Zhu, X.-D., Qian, Q., and Xue, H.-W. (2009). Shallot-like1 is
a kanadi transcription factor that modulates rice leaf rolling by regulating leaf
abaxial cell development. The Plant cell 21, 719-735. doi:
10.1105/tpc.108.061457.
Zhou-Da, X., Rui-Lian, J., Qiang, G., Hai-Pan, Z., Xue-Hui, S., Hei, L., Tie-Gang,
L., and Guo-Zhen, L. (2008). Drought-tolerant gene screening in wheat using
rice microarray. Chinese Journal of Agricultural Biotechnology 5, 43-48.
156 Appendices
Appendices
Appendix A: Enriched GO terms for AtBAG4 and TlBAG4
Appendices 157
Enriched GO Terms for Arabidopsis thaliana #Term Input
number Background number
P-Value Corrected P-Value
cytosol 102 1592 8.14E-16 1.70E-12 response to cadmium ion 42 442 4.06E-12 3.23E-09 chloroplast stroma 49 584 4.65E-12 3.23E-09 plastid stroma 49 600 1.12E-11 5.86E-09 response to metal ion 46 559 3.70E-11 1.54E-08 carboxylic acid metabolic process 88 1797 2.27E-08 7.88E-06 glycolytic process 21 184 5.15E-08 1.53E-05 small molecule metabolic process 116 2662 6.72E-08 1.75E-05 oxoacid metabolic process 89 1896 1.11E-07 2.36E-05 organic acid metabolic process 89 1897 1.13E-07 2.36E-05 single-organism carbohydrate catabolic process
32 433 3.01E-07 5.24E-05
pyruvate metabolic process 30 389 3.01E-07 5.24E-05 chloroplast part 58 1092 4.62E-07 7.41E-05 carbohydrate catabolic process 33 469 5.54E-07 8.25E-05 single-organism biosynthetic process
122 2978 6.48E-07 9.00E-05
plastid part 58 1115 8.61E-07 0.000112205 monocarboxylic acid metabolic process
63 1257 9.77E-07 0.000118379
monosaccharide metabolic process 32 460 1.02E-06 0.000118379 pigment metabolic process 26 328 1.11E-06 0.000122006 single-organism catabolic process 61 1215 1.36E-06 0.000141699 transferase activity, transferring one-carbon groups
16 143 2.42E-06 0.000239794
methyltransferase activity 15 129 3.21E-06 0.000304237 small molecule biosynthetic process
63 1317 4.03E-06 0.00034458
monosaccharide biosynthetic process
17 168 4.13E-06 0.00034458
organonitrogen compound biosynthetic process
49 931 4.26E-06 0.00034458
generation of precursor metabolites and energy
32 495 4.30E-06 0.00034458
gluconeogenesis 16 151 4.58E-06 0.000353385 antioxidant activity 14 117 5.00E-06 0.000372363 organic substance catabolic process
69 1504 5.52E-06 0.000396379
hexose biosynthetic process 16 154 5.76E-06 0.000399923 response to inorganic substance 63 1342 7.00E-06 0.000470914 hexose metabolic process 28 416 8.24E-06 0.000536655 glucose metabolic process 27 395 9.13E-06 0.000576393 response to salt stress 40 730 1.29E-05 0.000790313 oxidoreductase activity, acting on peroxide as acceptor
12 96 1.56E-05 0.000917837
organonitrogen compound metabolic process
65 1440 1.61E-05 0.000917837
carbohydrate kinase activity 7 27 1.66E-05 0.000917837
158 Appendices
catabolic process 76 1769 1.67E-05 0.000917837 single-organism metabolic process 176 4993 2.00E-05 0.001068718 alpha-amino acid metabolic process
31 519 2.53E-05 0.00132065
cellular amino acid metabolic process
38 707 3.08E-05 0.001565325
phosphofructokinase activity 5 11 3.17E-05 0.001571327 apoplast 22 315 4.34E-05 0.002101559 response to osmotic stress 40 779 5.03E-05 0.002328853 pigment biosynthetic process 19 252 5.44E-05 0.002441802 kinase activity 53 1152 5.75E-05 0.002441802 carboxylic acid biosynthetic process
48 1009 5.86E-05 0.002441802
organic acid biosynthetic process 48 1009 5.86E-05 0.002441802 peroxidase activity 11 94 6.04E-05 0.002468478 riboflavin metabolic process 4 6 6.88E-05 0.002656528 riboflavin biosynthetic process 4 6 6.88E-05 0.002656528 flavin-containing compound biosynthetic process
4 6 6.88E-05 0.002656528
secondary metabolite biosynthetic process
21 305 7.71E-05 0.002919908
sulfur compound biosynthetic process
27 453 8.36E-05 0.00311019
S-adenosylmethionine-dependent methyltransferase activity
10 81 8.62E-05 0.00315195
phosphotransferase activity, phosphate group as acceptor
5 15 0.000103515 0.003622995
response to cytokinin 18 243 0.000103676 0.003622995 6-phosphofructokinase complex 4 7 0.000106047 0.003622995 6-phosphofructokinase activity 4 7 0.000106047 0.003622995 nucleobase-containing compound kinase activity
6 26 0.000117082 0.003935457
lignan biosynthetic process 5 16 0.000133099 0.00433404 lignan metabolic process 5 16 0.000133099 0.00433404 flavin-containing compound metabolic process
4 8 0.000155953 0.00500009
calmodulin-dependent protein kinase activity
6 31 0.000270338 0.008536124
transferase activity, transferring phosphorus-containing groups
55 1294 0.000282013 0.008771881
protein phosphorylated amino acid binding
4 10 0.000303144 0.009155841
phosphoprotein binding 4 10 0.000303144 0.009155841 chloroplast 125 3560 0.000323895 0.009642814 organonitrogen compound catabolic process
20 320 0.000369104 0.010833989
secondary metabolic process 31 609 0.00037522 0.010860547 O-methyltransferase activity 5 21 0.0003883 0.010976794 phosphotransferase activity, alcohol group as acceptor
30 583 0.000389771 0.010976794
cellular amino acid biosynthetic process
26 477 0.000410442 0.011404827
Appendices 159
response to chemical 124 3552 0.000419375 0.011499717 anthocyanin-containing compound metabolic process
9 82 0.000426408 0.011540695
sulfur compound metabolic process
30 595 0.000533251 0.014067017
single-organism carbohydrate metabolic process
53 1274 0.000571521 0.014888118
cofactor metabolic process 27 517 0.000597176 0.015364373 plastid 125 3626 0.00062277 0.015827484 plastid envelope 28 547 0.00064207 0.016121384 response to molecule of fungal origin
6 38 0.000708643 0.017581105
heme metabolic process 5 25 0.000775116 0.018783034 structural constituent of cytoskeleton
5 25 0.000775116 0.018783034
alpha-amino acid catabolic process 12 151 0.000788018 0.018876195 cellular amino acid catabolic process
12 156 0.001025337 0.024009003
water transport 11 135 0.001061477 0.024308981 fluid transport 11 135 0.001061477 0.024308981 AMP binding 3 6 0.00112556 0.025496384 indole-containing compound metabolic process
11 137 0.001185569 0.026566936
sulfur amino acid biosynthetic process
17 281 0.001356692 0.030078141
phosphorus metabolic process 64 1681 0.001432674 0.031428353 chloroplast envelope 26 525 0.001516549 0.032921744 aminopeptidase activity 3 7 0.001578442 0.0339121 indole-containing compound biosynthetic process
10 123 0.001786529 0.037607341
carbohydrate metabolic process 56 1443 0.001831101 0.038160134 alpha-amino acid biosynthetic process
20 370 0.0019499 0.040233585
indoleacetic acid biosynthetic process
9 104 0.002007645 0.040776781
regulation of cytokinin-activated signaling pathway
3 8 0.00213059 0.040776781
peptide disulfide oxidoreductase activity
3 8 0.00213059 0.040776781
histidine phosphotransfer kinase activity
3 8 0.00213059 0.040776781
glutathione disulfide oxidoreductase activity
3 8 0.00213059 0.040776781
ubiquitin binding 3 8 0.00213059 0.040776781 small conjugating protein binding 3 8 0.00213059 0.040776781 indoleacetic acid metabolic process
9 105 0.002132759 0.040776781
regulation of anthocyanin metabolic process
5 34 0.00260712 0.048948095
protein histidine kinase binding 4 20 0.002643522 0.04918839
160 Appendices
Enriched GO Terms for Tripogon loliiformis #Term Input number Background
number P-Value Corrected
P-Value
cytosol 144 1592 1.27E-15 3.10E-12 response to cadmium ion 60 442 1.32E-13 1.61E-10 response to metal ion 67 559 9.62E-13 7.84E-10 chloroplast stroma 67 584 5.62E-12 3.43E-09 plastid stroma 67 600 1.64E-11 8.01E-09 carboxylic acid metabolic process
129 1797 3.08E-08 1.17E-05
single-organism carbohydrate catabolic process
47 433 3.34E-08 1.17E-05
small molecule metabolic process
174 2662 6.72E-08 2.05E-05
oxoacid metabolic process 132 1896 1.06E-07 2.59E-05 organic acid metabolic process
132 1897 1.09E-07 2.59E-05
carbohydrate catabolic process
48 469 1.21E-07 2.59E-05
single-organism biosynthetic process
189 2978 1.27E-07 2.59E-05
organonitrogen compound biosynthetic process
76 931 2.40E-07 4.52E-05
chloroplast part 85 1092 3.15E-07 5.49E-05 monosaccharide metabolic process
46 460 3.96E-07 6.45E-05
small molecule biosynthetic process
97 1317 5.04E-07 7.69E-05
response to inorganic substance
98 1342 6.27E-07 8.85E-05
glucose metabolic process 41 395 6.87E-07 8.85E-05 plastid part 85 1115 6.89E-07 8.85E-05 organonitrogen compound metabolic process
103 1440 7.95E-07 9.71E-05
hexose metabolic process 42 416 9.78E-07 0.000113755 pyruvate metabolic process 40 389 1.15E-06 0.000127884 response to osmotic stress 64 779 1.65E-06 0.000175088 cellular amino acid metabolic process
59 707 2.61E-06 0.000265751
response to salt stress 60 730 3.35E-06 0.000327259 carboxylic acid biosynthetic process
76 1009 3.80E-06 0.000343534
organic acid biosynthetic process
76 1009 3.80E-06 0.000343534
glycolytic process 24 184 4.43E-06 0.000386909 single-organism catabolic process
87 1215 5.11E-06 0.000429857
generation of precursor metabolites and energy
45 495 5.28E-06 0.000429857
pigment metabolic process 34 328 5.94E-06 0.000460021 monocarboxylic acid 89 1257 6.03E-06 0.000460021
Appendices 161
metabolic process organic substance catabolic process
102 1504 7.41E-06 0.000548562
alpha-amino acid metabolic process
46 519 7.64E-06 0.000548939
kinase activity 82 1152 1.13E-05 0.000768688 sulfur compound biosynthetic process
41 453 1.47E-05 0.00097033
response to chemical 204 3552 1.89E-05 0.00121674 secondary metabolite biosynthetic process
31 305 2.10E-05 0.001292435
cellular amino acid biosynthetic process
42 477 2.12E-05 0.001292435
sulfur compound metabolic process
49 595 2.35E-05 0.001368118
lignan biosynthetic process 7 16 2.41E-05 0.001368118 lignan metabolic process 7 16 2.41E-05 0.001368118 calmodulin-dependent protein kinase activity
9 31 2.48E-05 0.001376733
serine family amino acid metabolic process
26 236 2.73E-05 0.001464273
serine family amino acid biosynthetic process
23 194 2.76E-05 0.001464273
phosphotransferase activity, alcohol group as acceptor
48 583 2.84E-05 0.001477406
transferase activity, transferring one-carbon groups
19 143 3.33E-05 0.001695759
nucleobase-containing compound kinase activity
8 26 4.96E-05 0.002377786
cysteine biosynthetic process 22 191 6.01E-05 0.002821827 catabolic process 111 1769 6.40E-05 0.002925387 gluconeogenesis 19 151 6.47E-05 0.002925387 transferase activity, transferring phosphorus-containing groups
86 1294 6.86E-05 0.003012084
cysteine metabolic process 22 193 6.90E-05 0.003012084 single-organism metabolic process
269 4993 7.06E-05 0.003027542
pigment biosynthetic process 26 252 7.40E-05 0.003115768 hexose biosynthetic process 19 154 8.19E-05 0.003391393 monosaccharide biosynthetic process
20 168 8.44E-05 0.003436393
methyltransferase activity 17 129 9.23E-05 0.003695358 cofactor metabolic process 42 517 0.000112115 0.004417682 alpha-amino acid biosynthetic process
33 370 0.000120787 0.004683852
sulfur amino acid biosynthetic process
27 281 0.000160358 0.006121184
single-organism carbohydrate metabolic process
83 1274 0.000164208 0.006171697
phosphorus metabolic 104 1681 0.000170816 0.006322794
162 Appendices
process apoplast 29 315 0.000184065 0.006711506 response to oxidative stress 42 531 0.000190072 0.00682861 glucose catabolic process 25 255 0.000207097 0.007332432 protein phosphorylated amino acid binding
5 10 0.000228519 0.007862986
phosphoprotein binding 5 10 0.000228519 0.007862986 hexose catabolic process 25 258 0.000243667 0.008154508 monosaccharide catabolic process
25 258 0.000243667 0.008154508
secondary metabolic process 46 609 0.000255507 0.00843518 antioxidant activity 15 117 0.000303599 0.009889246 phosphofructokinase activity 5 11 0.00032133 0.0103225 response to carbohydrate 32 376 0.000325351 0.0103225 carbohydrate kinase activity 7 27 0.000357727 0.011204198 sulfur amino acid metabolic process
28 317 0.000432354 0.013370152
riboflavin metabolic process 4 6 0.000457526 0.013630941 riboflavin biosynthetic process
4 6 0.000457526 0.013630941
flavin-containing compound biosynthetic process
4 6 0.000457526 0.013630941
oxidoreductase activity, acting on peroxide as acceptor
13 96 0.000468122 0.01377858
chloroplast 193 3560 0.000497443 0.014420366 response to cytokinin 23 243 0.000567097 0.015924347 response to fructose 16 139 0.000575451 0.015975297 coenzyme metabolic process 31 374 0.000598671 0.016433177 phosphate-containing compound metabolic process
97 1615 0.000677498 0.018390307
6-phosphofructokinase complex
4 7 0.00069596 0.01848076
6-phosphofructokinase activity
4 7 0.00069596 0.01848076
monocarboxylic acid biosynthetic process
41 552 0.000717889 0.018858091
nucleotide kinase activity 5 14 0.000772992 0.02008958 plastid 194 3626 0.000859575 0.022104661 exopeptidase activity 10 66 0.000954063 0.024210692 protein folding 24 270 0.000979374 0.024210692 phosphotransferase activity, phosphate group as acceptor
5 15 0.000996507 0.024210692
flavin-containing compound metabolic process
4 8 0.001010578 0.024210692
ubiquitin binding 4 8 0.001010578 0.024210692 small conjugating protein binding
4 8 0.001010578 0.024210692
organonitrogen compound catabolic process
27 320 0.001015993 0.024210692
phenylpropanoid metabolic process
18 177 0.001020962 0.024210692
porphyrin-containing 20 208 0.001047881 0.024210692
Appendices 163
compound metabolic process protein metabolic process 157 2867 0.001050484 0.024210692 plastid envelope 40 547 0.001081631 0.024695564 carbohydrate metabolic process
87 1443 0.00110356 0.024772432
tetrapyrrole metabolic process
20 209 0.001105278 0.024772432
water transport 15 135 0.001164295 0.025624977 fluid transport 15 135 0.001164295 0.025624977 peroxidase activity 12 94 0.001209771 0.026317504 S-adenosylmethionine-dependent methyltransferase activity
11 81 0.001217306 0.026317504
structural constituent of cytoskeleton
6 25 0.001329251 0.028026242
indole-containing compound metabolic process
15 137 0.001330759 0.028026242
cis-trans isomerase activity 9 58 0.001456259 0.030407193 calcium ion binding 15 139 0.001516743 0.031137839 chloroplast envelope 38 525 0.001669301 0.033984183 vitamin metabolic process 11 85 0.001724978 0.03477267 isomerase activity 19 202 0.001736498 0.03477267 response to stress 192 3657 0.001980261 0.039014334