Post on 12-Mar-2018
transcript
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 1 of 154
GAIL (India) Limited (A Government of India Undertaking)
A Navratna Company GAIL Bhawan A V A Road Rajahmundry
TENDER NO. GAIL/RJY/C&P/SR20036987/RAO
BIDDING DOCUMENT FOR HIRING OF PROJECT MANAGEMENT
CONSULTANCY (PMC) SERVICES FOR DESIGN & CONSTRUCTION OF KESANAPALLI (W) to
PONNAMANDA PIPELINE
DOMESTIC COMPETITIVE BIDDING
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 2 of 154
TABLE OF CONTENTS
SL NO SECTION NO DESCRIPTION
1.0 I INVITATION FOR BID (IFB) 2.0 II INSTRUCTIONS TO BIDDERS
3.0 III GENERAL CONDITIONS OF CONTRACT
4.0 IV FORMS & FORMATS
5.0 V PART A: SCOPE OF WORK
PART B: SPECIAL CONDITION OF CONTRACT
6.0 VI PRICE SCHEDULE
7.0 VII ATTACHMENTS ATTACHMENT-I : CONTRACT AGREEMENT FORM
ATTACHMENT-II: PERFORMANCE EVALUATION ATTACHMENT-III: AGEREED TERMS & CONDITIONS ATTACHMENT-IV: INTEGRITY PACT
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 3 of 154
SECTION I
INVITATION FOR BIDS (IFB)
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 4 of 154
GAIL (India) Limited (A Govt. of India Undertaking)
A Navratna Company GAIL Bhawan A V A Road Rajahmundry
INVITATION FOR BID (IFB) Ref.: GAIL/RJY/C&P/SR20036987/RAO Dated: 09.03.2012 Sub: HIRING OF PROJECT MANAGEMENT CONSULTANCY (PMC ) SERVICES
FOR KSP (W) to PONNAMANDA PIPELINE Dear Sirs, GAIL (India) Limited, Rajahmundry, invites bids on Domestic Competitive Bidding basis for HIRING OF PROJECT MANAGEMENT CONSULTANCY (PMC) SER VICES FOR KSP (W) to PONNAMANDA PIPELINE , under single stage two envelopes system from competent agencies meeting the Bidder’s Eligibility Criteria as stated in the detailed Bid Document attached. Bids, submitted on line shall only be considered for processing. 1.0 BRIEF SCOPE OF WORK
11..11 TThhee bbrriieeff ddeessccrriippttiioonn ooff tthhee pprroojjeecctt iiss aass uunnddeerr::
GGAAIILL ((IInnddiiaa)) LLiimmiitteedd iinntteennddss ttoo iimmpplleemmeenntt 1100"" xx 44..55 kkmmss.. ((aapppprrooxx..))
KKeessaannaappaallllii((WW)) ttoo PPoonnnnaammaannddaa PPiippeelliinnee aalloonnggwwiitthh tteerrmmiinnaall uupp--
ggrraaddaattiioonn aatt KKeessaannaappaallllii((WW)) aanndd PPoonnnnaammaannddaa tteerrmmiinnaallss ffoorr
ttrraannssppoorrttiinngg NNaattuurraall GGaass ttoo GGAAIILL--TTaattiippaakkaa aanndd ffuurrtthheerr ttoo ootthheerr
ccuussttoommeerrss aalloonngg ppiippeelliinnee rroouuttee iinn KKGG BBaassiinn rreeggiioonn..
11..22 TThhee bbrriieeff ssccooppee ooff sseerrvviicceess iiss aass ppeerr sseeppaarraattee sseeccttiioonn oonn tthhee ““SSccooppee ooff
WWoorrkk”” ooff tthhiiss BBiidd DDooccuummeenntt,, bbuutt nnoott lliimmiitteedd ttoo tthhee ffoolllloowwiinngg::
TThhee PPrroojjeecctt MMaannaaggeemmeenntt CCoonnssuullttaanntt ((PPMMCC)) iiss bbeeiinngg aappppooiinntteedd ffoorr
eexxeeccuuttiinngg tthhee pprroojjeecctt rriigghhtt ffrroomm DDeessiiggnn ttoo CCoommmmiissssiioonniinngg && pprroojjeecctt
cclloosseeoouutt oonn ttoottaall aanndd ssiinnggllee ppooiinntt rreessppoonnssiibbiilliittyy bbaassiiss.. TThhiiss sseeccttiioonn iiss ttoo
bbee rreeaadd iinn ccoonnjjuunnccttiioonn wwiitthh ""SSccooppee ooff wwoorrkk””.. TThhee PPMMCC PPrroojjeecctt
MMaannaaggeerr wwiillll bbee tthhee ""EEnnggiinneeeerr--iinn--CChhaarrggee"" ffoorr tthhee ssaaiidd PPrroojjeecctt.. TThhee
ssccooppee ooff wwoorrkk ooff tthhee PPMMCC iiss bbrrooaaddllyy ddeeffiinneedd uunnddeerr tthhee ffoolllloowwiinngg
hheeaaddss bbuutt nnoott lliimmiitteedd ttoo::
[[aa]] BBaassiicc EEnnggiinneeeerriinngg && HHyyddrraauulliicc SSTTUUDDYY..
[[bb]] DDeessiiggnn && DDeettaaiilleedd EEnnggiinneeeerriinngg..
[[cc]] CCaarrrryyoouutt aallll nneecceessssaarryy ccaallccuullaattiioonnss aanndd ccoonndduucctt aallll aapppprroopprriiaattee
ddeessiiggnn pprroocceedduurree aanndd aannaallyyssiiss,, aass rreeqquuiirreedd,, ttoo ooppttiimmiizzee tthhee ssiizziinngg
aanndd sseelleeccttiioonn ooff tthhee eeqquuiippmmeenntt aanndd ssppeecciiffiiccaattiioonn ooff mmaatteerriiaallss..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 5 of 154
[[dd]] PPrreeppaarree oovveerraallll ddeessiiggnn bbaassiiss..
[[ee]] PPrreeppaarraattiioonn ooff MMaatteerriiaall TTaakkee--ooffffss ((MMTTOO)),, MMaatteerriiaall RReeqquuiissiittiioonn
((MMRR))..
[[ff]] PPrreeppaarraattiioonn ooff iitteemm--wwiissee ccoosstt eessttiimmaattee ffoorr eeaacchh MMaatteerriiaall RReeqquuiissiittiioonn
aanndd TTeennddeerr..
[[gg]] PPrreeppaarraattiioonn ooff ddrraawwiinnggss,, MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPrroojjeecctt
DDooccuummeenntt IInnddeexx..
[[hh]] PPllaannnniinngg && SScchheedduulliinngg..
[[ii]] IIddeennttiiffyy aallll tthhee iinntteerrffaaccee ppooiinnttss // bbaatttteerryy lliimmiittss aanndd iinnccoorrppoorraattee
tthheemm oonn rreelleevvaanntt ddrraawwiinnggss aanndd ddooccuummeennttss..
[[jj]] RReevviieeww aanndd aapppprroovvaall ooff ddeessiiggnn // ddrraawwiinnggss // ddooccuummeennttss ssuubbmmiitttteedd
bbyy vveennddoorrss // ccoonnttrraaccttoorrss // ssuupppplliieerrss..
[[kk]] TThhee ccoonnssuullttaanntt sshhaallll pprroovviiddee aallll tteecchhnniiccaall ddooccuummeennttss ffoorr lliiaassiioonniinngg
aassssiissttaannccee wwiitthh ssttaattuuttoorryy aauutthhoorriittiieess lliikkee RR&&BB,, SSPPCCBB ((SSttaattee
PPoolllluuttiioonn CCoonnttrrooll BBooaarrdd)),, FFoorreesstt aauutthhoorriittiieess,,iirrrriiggaattiioonn,, CCCCOOEE ((CChhiieeff
CCoonnttrroolllleerr ooff EExxpplloossiivveess)) ffoorr oobbttaaiinniinngg vvaarriioouuss ssttaattuuttoorryy
ppeerrmmiissssiioonnss..
[[ll]] PPrreeppaarraattiioonn ooff TTeennddeerr DDooccuummeennttss,, iinnvviittee bbiiddss,, eevvaalluuaattiioonn ooff uunn--
pprriicceedd aanndd pprriiccee bbiiddss,, rreeccoommmmeennddaattiioonn ffoorr aawwaarrdd ooff jjoobb aass ppeerr
GGAAIILL''ss CC&&PP PPrroocceedduurree,, aassssiissttaannccee dduurriinngg nneeggoottiiaattiioonnss iiff ssiittuuaattiioonn
aarriisseess.. PPrreeppaarraattiioonn ooff LLeetttteerrss ooff IInntteenntt,, WWoorrkk OOrrddeerrss // PPuurrcchhaassee
OOrrddeerrss,, CCoonnttrraacctt DDooccuummeennttss // AAggrreeeemmeennttss,, PPuurrcchhaassee RReeqquuiissiittiioonnss
((PPRR''ss))..
[[mm]] TTeennddeerriinngg && OOrrddeerriinngg,, iinncclluuddiinngg PPuurrcchhaassee ooff aallll eeqquuiippmmeennttss aanndd
mmaatteerriiaallss,, CCuussttoommss CClleeaarraannccee aanndd TTrraannssppoorrttaattiioonn ooff mmaatteerriiaallss //
eeqquuiippmmeennttss ttoo ssiittee,, eettcc..
[[nn]] IInnssppeeccttiioonn // EExxppeeddiittiinngg ooff eeqquuiippmmeennttss // mmaatteerriiaallss bbeeiinngg
mmaannuuffaaccttuurreedd bbyy vveennddoorrss iinncclluuddiinngg ccoonnttrraaccttoorr--ssuupppplliieedd iitteemmss..
[[oo]] MMaannaaggeemmeenntt ooff CCoonnssttrruuccttiioonn SSttoorreess aanndd SSttoorreess AAccccoouunnttiinngg..
[[pp]] CCoonnssttrruuccttiioonn MMaannaaggeemmeenntt && SSuuppeerrvviissiioonn
[[qq]] QQuuaalliittyy AAssssuurraannccee aanndd QQuuaalliittyy CCoonnttrrooll..
[[rr]] PPrroojjeecctt CCoommmmiissssiioonniinngg..
[[ss]] RReevviieeww aanndd aapppprroovvaall ooff ''AAss--BBuuiilltt DDooccuummeennttss // DDrraawwiinnggss''..
[[tt]] PPrroojjeecctt CCoosstt CCoonnttrrooll,, MMaannaaggeemmeenntt && MMoonniittoorriinngg..
[[uu]] CCoonnssttrruuccttiioonn ssuuppeerrvviissiioonn iinncclluuddiinngg cceerrttiiffiiccaattiioonn ooff ccoonnttrraaccttoorr’’ss
bbiillllss..
[[vv]] RRiisskk MMaannaaggeemmeenntt ooff tthhee PPrroojjeecctt aalloonngg wwiitthh ddeettaaiilleedd RRiisskk AAnnaallyyssiiss..
TThhee RRiisskk MMaannaaggeemmeenntt PPllaann ((RRMMPP)) && DDiissaasstteerr MMaannaaggeemmeenntt PPllaann
((DDMMPP)) aarree aallssoo ttoo bbee pprreeppaarreedd bbyy tthhee CCoonnssuullttaanntt..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 6 of 154
[[ww]] HHeeaalltthh && SSaaffeettyy MMaannaaggeemmeenntt..
[[xx]] PPrroojjeecctt CClloosseeoouutt..
2.0 SALIENT FEATURES OF BIDDING DOCUMENT: (i) Type of Enquiry
: Domestic Competitive Bidding basis
(ii) Bid Document No. : GAIL/RJY/C&P/SR20036987/RAO (iii) Tender Fee (Non-
refundable) : NOT APPLICABLE
(iv) Bid security/EMD/SD : Not applicable (v) Time Schedule : 08 months (including 02 months for project closure) (vi) Bid Evaluation Criteria : As per Clause no. 3.0 of IFB (vii) Bid Document on Website : From 09.03.2012 to 10.04.2012 (viii) Date, Time & Venue of Pre-
Bid Meeting : 1100 hrs. IST on 20.03.2012
GAIL (India) Limited GAIL Bhawan A V A ROAD RAJAHMUNDRY-533103
(ix) Bid Submission Date & Time
: 10.04.2012 Up to 1400 hrs. (IST)
(x) Date and Time of Opening of Un-priced Bids at GAIL’s Rajahmundry Office
: At 1500 hrs. (IST) on 10.04.2012 (If the particular day happens to be a declared holiday in GAIL, Rajahmundry, the next working day shall be considered)
(xi) Price Bid Opening : Public Opening; Date, Time & Venue shall be intimated later.
(xii) Evaluation & Comparison of Bids
: As per Clause No. 31.0 of ITB.
(xiii) Contact person : GAIL (India) Limited GAIL BHAWAN A V A ROAD RAJAHMUNDRY-533103 Shri Jan Mohammad, Chief Manager (C&P) Ph: 0883-2400720/21/22 Extn: 380 E-mail: j_mohammad@gail.co.in Shri T N M Rao, Manager (C&P) Ph: 0883-2400720/21/22 Extn: 382 E-mail: tnmrao@gail.co.in
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 7 of 154
2.1 Bidders are requested to attend the Pre-Bid Meeting so that their queries, if any, related to the Bid Document and Scope of work can be addressed during the meeting..
If any of the days specified above happens to be a holiday in GAIL, the next working day shall be implied.
2.2 The bid will be submitted in two parts as follows:
PART- I (PART – A)
UN-PRICED BID
Complete with all technical details other than price (i.e. including price schedule WITH PRICES BLANKED OUT), Proforma on Agreed Terms and Conditions as enclosed at Attachment-III and original tender document, duly sealed and signed on every page.
PART-II (PART B - PRICED BID: 2 copies) Price bid should contain only the prices, without any condition whatsoever
Bids complete in all respects should reach the office of Manager (C&P), GAIL (India) Limited, AVA Road, Rajahmundry-533 103, on or before the due date & time. Bids received after the due date and time is liable to be rejected. Bids received through Fax/E-mail will not be acceptable. Bidder(s) are advised to quote strictly as per terms and conditions of the tender documents and not to stipulate any deviations/exceptions. Once quoted, the Bidder shall not make any subsequent price change, even if any deviation or exception may be specifically stated in the bid. Such price changes shall render the offer liable for rejection
3.0 BID EVALUATION CRITERIA
11..00 TTEECCHHNNIICCAALL CCRRIITTEERRIIAA
[[11..11]] TThhee bbiiddddeerr sshhoouulldd hhaavvee llaatteesstt vvaalliidd IISSOO 99000000 CCeerrttiiffiiccaattiioonn oorr eeqquuiivvaalleenntt
eessttaabblliisshheedd QQuuaalliittyy MMaannaaggeemmeenntt SSyysstteemm cceerrttiiffiiccaattiioonn iinn PPMMCC sseerrvviicceess ooff
PPiippeelliinnee jjoobbss..
[[11..22]] TThhee bbiiddddeerr sshhoouulldd hhaavvee eexxppeerriieennccee aass PPrroojjeecctt MMaannaaggeemmeenntt CCoonnssuullttaanntt iinn
DDeessiiggnn,, EEnnggiinneeeerriinngg,, PPllaannnniinngg,, PPrrooccuurreemmeenntt,, IInnssppeeccttiioonn,, QQuuaalliittyy CCoonnttrrooll
AAssssuurraannccee,, CCoonnssttrruuccttiioonn aanndd CCoommmmiissssiioonniinngg ooff ““hhiigghh pprreessssuurree HHyyddrrooccaarrbboonn
CCaarrbboonn SStteeeell PPiippeelliinnee”” aass ddeettaaiilleedd uunnddeerr SSll.. NNoo.. ##33..00,, BBiidd EEvvaalluuaattiioonn
MMeetthhooddoollooggyy ,,SSuubb ssll.. NNoo.. :: [[AA]],, tthhaatt hhaass bbeeeenn ssuucccceessssffuullllyy ccoommmmiissssiioonneedd
dduurriinngg tthhee llaasstt 55 yyeeaarrss rreecckkoonneedd ffrroomm tthhee bbiidd dduuee ddaattee..
[[11..33]] TThhee eexxppeerriieennccee ooff tthhee bbiiddddeerr ffoorr PPrroojjeecctt MMaannaaggeemmeenntt CCoonnssuullttaannccyy sseerrvviicceess aass
ppeerr aabboovvee rreeqquuiirreemmeenntt mmuusstt bbee ooff tthheeiirr oowwnn aanndd nnoott wwiitthh tthhee ssuuppppoorrtt ooff
aannootthheerr ppaarrttyy//ppaarreenntt ccoommppaannyy//ssuubbssiiddiiaarryy //ppaarrttnneerr ffiirrmm// ggrroouupp ffiirrmm// bbaacckk--uupp
ccoonnssuullttaanntt eettcc..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 8 of 154
[[11..44]] BBiiddddeerr sshhaallll ffuurrnniisshh nneecceessssaarryy ddooccuummeennttaarryy eevviiddeenncceess ii..ee.. aatttteesstteedd ccooppyy ooff
IISSOO CCeerrttiiffiiccaattee,, ccooppyy ooff wwoorrkk oorrddeerrss,, ccooppyy ooff ccoommpplleettiioonn cceerrttiiffiiccaatteess aanndd aallll
ootthheerr nneecceessssaarryy ddooccuummeennttss ttoo aasscceerrttaaiinn tthhee ssttiippuullaatteedd qquuaalliiffiiccaattiioonn ccrriitteerriiaa.. IInn
tthhee aabbsseennccee ooff ssuucchh rreeqquuiissiittee ddooccuummeennttss,, GGAAIILL rreesseerrvveess tthhee rriigghhtt ttoo rreejjeecctt tthhee
bbiidd wwiitthhoouutt mmaakkiinngg aannyy rreeffeerreennccee ttoo tthhee bbiiddddeerr..
[[11..55]] AAllll tthhee ddooccuummeennttss mmuusstt bbee aatttteesstteedd bbyy GGaazzeetttteedd ooffffiicceerr oorr NNoottaarryy ppuubblliicc..
22..00 FFIINNAANNCCIIAALL CCRRIITTEERRIIAA
NNiill
33..00 BBIIDD EEVVAALLUUAATTIIOONN MMEETTHHOODDOOLLOOGGYY
TThhee bbiiddss ooff bbiiddddeerrss ttoo mmeeeett tthhee aabboovvee BBEECC TTeecchhnniiccaall CCrriitteerriiaa uunnddeerr ##11..00,, sshhaallll bbee
eevvaalluuaatteedd aass ppeerr tthhee ffoolllloowwiinngg eevvaalluuaattiioonn mmeetthhooddoollooggyy,, uunnddeerr tthhrreeee ssuubb ccllaauusseess wwiitthh
ffoolllloowwiinngg aass mmaaxxiimmuumm ssccoorreess::
[[AA]] CCoonnssuullttaanntt’’ss SSppeecciiffiicc EExxppeerriieennccee aanndd JJoobb VVoolluummee 5500 mmaarrkkss
[[BB]] KKeeyy PPeerrssoonnnneell DDaattaa 4400 mmaarrkkss
[[CC]] KKnnoowwlleeddggee BBaassee ooff PPMMCC 1100 mmaarrkkss
[[AA]] CCOONNSSUULLTTAANNTT’’SS SSPPEECCIIFFIICC EEXXPPEERRIIEENNCCEE AANNDD JJOOBB VVOOLLUUMMEE
SSll..
NNoo..
BBiiddddeerr EEvvaalluuaattiioonn PPaarraammeetteerr MMiinniimmuumm
SSccoorree
rreeqquuiirreedd
MMaaxxiimmuumm
SSccoorree
aassssiiggnneedd
AA.. CCoonnssuullttaanntt’’ss ssppeecciiffiicc eexxppeerriieennccee aanndd jjoobb vvoolluummee ::
PPaasstt EExxppeerriieennccee ooff OOnn--sshhoorree PPiippeelliinnee jjoobbss iinn hhyyddrrooccaarrbboonn
sseeccttoorr ddoonnee iinn llaasstt 55 yyeeaarrss ffrroomm tthhee bbiidd dduuee ddaattee..
TThhee nnuummbbeerr ooff oorrddeerrss eexxeeccuutteedd bbyy tthhee bbiiddddeerr wwhhiicchh aarree
ssaammee oorr aabboovvee tthhee BBEECC rreeqquuiirreemmeenntt wwiitthh rreessppeecctt ttoo ssiizzee &&
lleennggtthh dduurriinngg tthhee llaasstt 55 yyeeaarrss rreecckkoonneedd ffrroomm tthhee bbiidd dduuee
ddaattee aass ddeettaaiilleedd bbeellooww::
3300 5500
SSuubb ssll..
NNoo.. AA
CCrriitteerriiaa ffoorr
[[AA]] CCoonnssuullttaanntt’’ss ssppeecciiffiicc eexxppeerriieennccee aanndd jjoobb vvoolluummee
EEvvaalluuaattiioonn pprroocceedduurree MMaaxxiimmuumm
mmaarrkkss
AA..11 SSiinnggllee WWoorrkkoorrddeerr ooff PPiippeelliinnee lleennggtthh eeqquuaall ttoo 22..55 KKmm
oorr mmoorree iinn ssiinnggllee ssttrreettcchh aanndd ssiizzee mmoorree tthhaann 1100 iinncchh oorr
mmoorree ooff 660000## ccllaassss ooff hhiigghh pprreessssuurree HHyyddrrooccaarrbboonn CCSS
PPiippeelliinneess wwiitthh aatt lleeaasstt oonnee ddiissppaattcchh// rreecceeiipptt ssttaattiioonn iinn
aannyy ooff tthhee pprreecceeddiinngg 0055 yyeeaarrss ffrroomm tthhee bbiidd dduuee ddaattee..
FFuullll 2200 mmaarrkkss iiff ssiinnggllee WWOO
ooff PP//LL,,
LLeennggtthh:: ggrreeaatteerr tthhaann 22..55 kkmm
DDiiaa:: ggrreeaatteerr tthhaann 1100 iinncchh
CCllaassss:: 660000 ##
2200
AA..22 [[ii]] OOtthheerr tthhaann tthhee aabboovvee ssuubbmmiitttteedd wwoorrkkoorrddeerr ttoo mmeeeett
ccrriitteerriiaa uunnddeerr AA..11,, aannyy ootthheerr
SSiinnggllee WWoorrkkoorrddeerr hhaavviinngg ppiippeelliinnee ssiinnggllee lleennggtthh ooff 5500
kkmm oorr mmoorree aanndd ddiiaa ggrreeaatteerr tthhaann 1100 iinncchh ooff 660000## ccllaassss
hhiigghh pprreessssuurree hhyyddrrooccaarrbboonn CCSS ppiippeelliinneess..
1155 ppooiinnttss ffoorr eeaacchh WWOO..
LLeennggtthh :: 5500 kkmm oorr mmoorree
DDiiaa:: ggrreeaatteerr tthhaann 1100 iinncchh
CCllaassss:: 660000##
PPeerriioodd:: DDuurriinngg llaasstt ffiivvee
yyeeaarrss rreecckkoonneedd ffoorrmm tthhee
bbiidd dduuee ddaattee
3300
““AANNDD ““ // ““OORR””
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 9 of 154
AA..22 [[iiii]] OOtthheerr tthhaann tthhee wwoorrkkoorrddeerr ssuubbmmiitttteedd ttoo mmeeeett tthhee
ccrriitteerriiaa uunnddeerr AA..11 && AA..22[[ii]],, aannyy ootthheerr
SSiinnggllee IInnddeeppeennddeenntt WWoorrkk OOrrddeerrss ooff ppiippeelliinnee lleennggtthh
lleessss tthhaann 5500 kkmm aanndd ddiiaa ggrreeaatteerr tthhaann 1100 iinncchh hhaavviinngg
mmiinniimmuumm ssiinnggllee ssttrreettcchh ooff 22..55 kkmm ppiippeelliinnee lleennggtthh
aawwaarrddeedd aanndd ccoommpplleetteedd.. HHiigghh PPrreessssuurree hhyyddrrooccaarrbboonn
CCSS ppiippeelliinneess
66 ppooiinnttss ffoorr eeaacchh WWOO..
LLeennggtthh :: mmoorree tthhaann 22..55 kkmm
aanndd lleessss tthhaann 5500 kkmm
DDiiaa:: ggrreeaatteerr tthhaann 1100 iinncchh
CCllaassss:: 660000##
PPeerriioodd:: DDuurriinngg llaasstt ffiivvee
yyeeaarrss rreecckkoonneedd ffoorrmm tthhee
bbiidd dduuee ddaattee..
3300
NNoottee
ffoorr [[AA]]
aa)) BBiiddddeerrss mmeeeettiinngg tthhee mmaaxxiimmuumm mmaarrkkss ooff 3300 uunnddeerr AA..22[[ii]] nneeeedd nnoott rreeqquuiirreedd ttoo ssuubbmmiitt
rreeqquuiissiittee ddooccuummeennttss ttoo ccoommppllyy AA..22[[iiii]]..
bb)) AA ccoommbbiinnaattiioonn ooff bbootthh AA..22[[ii]] aanndd AA..22[[iiii]] iiss aallssoo aacccceeppttaabbllee..
cc)) HHoowweevveerr BBiiddddeerrss mmuusstt cclleeaarrllyy ssuubbmmiitt aa ccoovveerriinngg lleetttteerr ssttaattiinngg tthhee WWoorrkkoorrddeerr ttoo bbee
ccoonnssiiddeerreedd uunnddeerr AA..11 aanndd AA..22..
dd)) IInn nnoo ccaassee aa ssiinnggllee wwoorrkkoorrddeerr ccaannnnoott bbee rree--ssuubbmmiitttteedd // pprroodduucceedd ffoorr ttwwoo ccaatteeggoorriieess.. ii..ee..
ffoorr bbootthh AA..11 aanndd AA..22..
[[BB]] KKEEYY PPEERRSSOONNNNEELL DDAATTAA
SSll..
NNoo..
BBiiddddeerr EEvvaalluuaattiioonn PPaarraammeetteerr MMiinniimmuumm
SSccoorree
rreeqquuiirreedd
MMaaxxiimmuumm
SSccoorree
aassssiiggnneedd
BB.. KKeeyy ppeerrssoonnnneell ddaattaa
KKeeyy ppeerrssoonnnneell oonn ppeerrmmaanneenntt rroollee ooff tthhee ccoommppaannyy wwiitthh
mmiinniimmuumm eexxppeerriieennccee && eedduuccaattiioonnaall qquuaalliiffiiccaattiioonnss rreeqquuiirreedd
aass ppeerr bbiidd ddooccuummeenntt.. DDeettaaiillss bbeellooww::
3322 4400
BB..11 aa)) PPrroojjeecctt MMaannaaggeerr,, EEnnggiinneeeerriinngg MMaannaaggeerr,, CCoonnssttrruuccttiioonn
MMaannaaggeerr
MMaaxxiimmuumm 1100 ppooiinnttss wwiillll bbee aallllootttteedd ffoorr eeaacchh ssaaiidd aabboovvee
kkeeyy ppeerrssoonnnneell aass ppeerr mmeetthhooddoollooggyy mmeennttiioonneedd bbeellooww::
-- 88 ppooiinnttss,, iiff tthhee eexxppeerriieennccee && qquuaalliiffiiccaattiioonn iiss aass ppeerr tthhee
rreeqquuiirreemmeenntt ooff tthhee bbiidd ddooccuummeenntt..
-- 1100 ppooiinnttss,, iiff tthhee eexxppeerriieennccee iiss mmoorree tthhaann 55 yyeeaarrss oorr mmoorree,,
tthhaann tthhee mmiinniimmuumm mmaannddaattoorryy eexxppeerriieennccee rreeqquuiirreedd aass
ppeerr bbiidd rreeqquuiirreemmeenntt
2244 3300
BB..22 bb)) CCoonnttrraaccttss //PPllaannnniinngg MMaannaaggeerr aanndd IInnssppeeccttiioonn MMaannaaggeerr..
MMaaxxiimmuumm 55 ppooiinnttss wwiillll bbee aallllootttteedd ffoorr eeaacchh ooff tthhee aabboovvee
ttwwoo kkeeyy ppeerrssoonnnneell aass ppeerr mmeetthhooddoollooggyy mmeennttiioonneedd bbeellooww::
-- 44 ppooiinnttss,, iiff tthhee eexxppeerriieennccee && qquuaalliiffiiccaattiioonn iiss aass ppeerr tthhee
rreeqquuiirreemmeenntt ooff tthhee bbiidd ddooccuummeenntt..
-- 55 ppooiinnttss,, iiff tthhee eexxppeerriieennccee iiss mmoorree tthhaann 55 yyeeaarrss oorr mmoorree,,
tthhaann tthhee mmiinniimmuumm mmaannddaattoorryy eexxppeerriieennccee rreeqquuiirreedd aass
ppeerr bbiidd rreeqquuiirreemmeenntt
88 1100
[[CC]] KKNNOOWWLLEEDDGGEE BBAASSEE OOFF PPMMCC SSll..
NNoo..
BBiiddddeerr EEvvaalluuaattiioonn PPaarraammeetteerr MMiinniimmuumm
SSccoorree
rreeqquuiirreedd
MMaaxxiimmuumm
SSccoorree
aassssiiggnneedd
CC.. KKnnoowwlleeddggee bbaassee ooff tthhee PPMMCC oorrggaanniizzaattiioonn
TToottaall ssttrreennggtthh ooff BBiiddddeerrss oorrggaanniizzaattiioonn iinn tteerrmmss ooff
tteecchhnniiccaallllyy qquuaalliiffiieedd ppeerrssoonnnneell oonn tthhee ppeerrmmaanneenntt rroollee ooff
66 1100
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 10 of 154
tthhee ccoommppaannyy.. DDeettaaiillss bbeellooww::
CC..11 EEnnggiinneeeerriinngg DDeepptttt..
AAppaarrtt ffrroomm tthhee mmaannppoowweerr ddeettaaiillss pprroodduucceedd uunnddeerr CCllaauussee
[[BB]] ::
MMaaxxiimmuumm 55 ppooiinnttss wwiillll bbee aallllootttteedd aass ppeerr mmeetthhooddoollooggyy
mmeennttiioonneedd bbeellooww::
�� MMiinniimmuumm 55 ppeerrssoonnss ooff DDiipplloommaa // DDeeggrreeee
qquuaalliiffiiccaattiioonn -- 33 ppooiinnttss
�� MMoorree tthhaann 55 ppeerrssoonnss ooff DDiipplloommaa // DDeeggrreeee
qquuaalliiffiiccaattiioonn -- 55 ppooiinnttss
33 55
CC..22 CCoonnssttrruuccttiioonn SSuuppeerrvviissiioonn
AAppaarrtt ffrroomm tthhee mmaannppoowweerr ddeettaaiillss pprroodduucceedd uunnddeerr CCllaauussee
[[BB]] ::
MMaaxxiimmuumm 55 ppooiinnttss wwiillll bbee aallllootttteedd aass ppeerr mmeetthhooddoollooggyy
mmeennttiioonneedd bbeellooww::
�� MMiinniimmuumm 55 ppeerrssoonnss ooff DDiipplloommaa // DDeeggrreeee
qquuaalliiffiiccaattiioonn -- 33 ppooiinnttss
�� MMoorree tthhaann 55 ppeerrssoonnss ooff DDiipplloommaa // DDeeggrreeee
qquuaalliiffiiccaattiioonn -- 55 ppooiinnttss
33 55
TToottaall 110000
OOvveerraallll MMiinniimmuumm ssccoorree rreeqquuiirreedd ffoorr tteecchhnniiccaall qquuaalliiffiiccaattiioonn 7755
�� KKeeyy ppeerrssoonnnneell sshhoouulldd bbee rreegguullaarr eemmppllooyyeeee ooff tthhee ccoonnssuullttaanntt oonn tthheeiirr ppaayyrroollll oorr ffuullll
ttiimmee eemmppllooyyeeee..
�� TThhee ccuurrrriiccuulluumm vviittaaee ooff tthhee ccoonncceerrnneedd ppeerrssoonnnneell mmuusstt bbee ssuubbmmiitttteedd ffoorr CCllaauussee [[BB]]::
KKeeyy PPeerrssoonnnneell aanndd ccllaauussee [[CC]]:: KKnnoowwlleeddggee bbaassee ooff PPMMCC.. TThhee bbiioo--ddaattaa sshhoouulldd bbee
ccoommpplleettee hhaavviinngg aaccccuurraattee ddaattaa aanndd ssiiggnneedd bbyy aann aauutthhoorriizzeedd ooffffiicciiaall ooff tthhee ccoonnssuullttiinngg
ffiirrmm aanndd tthhee iinnddiivviidduuaall pprrooppoosseedd..
�� TThhee ccuurrrriiccuulluumm vviittaaee mmuusstt cclleeaarrllyy ssppeecciiffyy tthhee mmaannppoowweerr ddeettaaiillss,, pphhoottooggrraapphhss,,
eexxppeerriieennccee,, eettcc.. AAllll ddooccuummeennttss mmuusstt bbee aatttteesstteedd bbyy GGaazzeetttteedd ooffffiicceerr oorr nnoottaarryy ppuubblliicc..
�� BBiiddss ffrroomm aallll bbiiddddeerrss sshhaallll bbee eevvaalluuaatteedd aanndd ppooiinnttss sshhaallll bbee aallllooccaatteedd bbaasseedd oonn tthhee
ddooccuummeennttss ssuubbmmiitttteedd bbyy tthhee bbiiddddeerrss..
�� IInnddiivviidduuaall ppooiinnttss aawwaarrddeedd aafftteerr eevvaalluuaattiioonn ooff eeaacchh ccrriitteerriiaa sshhaallll bbee aaddddeedd uupp ffoorr
oobbttaaiinniinngg tthhee ttoottaall ssccoorree// mmaarrkk ooff eeaacchh bbiiddddeerr..
TTeecchhnnoo--CCoommmmeerrcciiaall aacccceeppttaannaaccee::
11.. MMiinniimmuumm ssccoorree uunnddeerr eeaacchh ccaatteeggoorryy mmuusstt bbee ssaattiissffiieedd ffoorr tteecchhnniiccaall
qquuaalliiffiiccaattiioonn.. BBiiddddeerrss ffaaiilliinngg ttoo ssccoorree ““mmiinniimmuumm qquuaalliiffyyiinngg mmaarrkkss”” uunnddeerr
eeaacchh ccaatteeggoorryy aass ddeettaaiilleedd bbeellooww sshhaallll bbee ““rreejjeecctteedd””
[[AA]] CCoonnssuullttaanntt’’ss SSppeecciiffiicc EExxppeerriieennccee aanndd JJoobb VVoolluummee 3300 mmaarrkkss
[[BB]] KKeeyy PPeerrssoonnnneell DDaattaa 3322 mmaarrkkss
[[CC]] KKnnoowwlleeddggee BBaassee ooff PPMMCC 66 mmaarrkkss
22.. TThhee oovveerraallll ccuummuullaattiivvee mmiinniimmuumm qquuaalliiffyyiinngg mmaarrkk ffoorr aallll tthhrreeee [[AA]] ,,[[BB]] && [[CC]]
CCrriitteerriiaa ffoorr tthhee bbiiddddeerrss aass ppeerr aabboovvee eevvaalluuaattiioonn mmeetthhooddoollooggyy iiss 7755%%.. BBiiddddeerrss
ffaaiilliinngg ttoo ssccoorree oovveerraallll 7755 %% ccuummuullaattiivvee sshhaallll bbee rreejjeecctteedd..
�� PPrriiccee BBiiddss ooff TTeecchhnnoo--ccoommmmeerrcciiaallllyy aacccceepptteedd bbiiddss oonnllyy sshhaallll bbee ooppeenneedd..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 11 of 154
�� AAfftteerr ooppeenniinngg ooff ffiinnaanncciiaall pprrooppoossaallss ((ii..ee.. PPrriiccee bbiiddss)) ooff aallll qquuaalliiffiieedd bbiiddddeerrss,, tthhee iinntteerr--
ssee rraannkkiinngg ooff bbiiddddeerrss sshhaallll bbee eessttaabblliisshheedd bbaasseedd oonn tthhee pprriicceess qquuootteedd && tteennddeerr
ssttiippuullaattiioonnss aanndd tthhee LL--11 bbiiddddeerr ooffffeerriinngg lloowweesstt pprriiccee sshhaallll tthheenn bbee sseelleecctteedd// aawwaarrddeedd
tthhee jjoobb..
CCOONNSSUULLTTAANNTT’’SS MMAANNPPOOWWEERR RREEQQUUIIRREEMMEENNTT TTOO MMEEEETT BBEECC
SSSSSSSSllllllll........ TTTTTTTTyyyyyyyyppppppppeeeeeeee QQQQQQQQuuuuuuuuaaaaaaaallllllll iiiiiiiiffffffffiiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn &&&&&&&& kkkkkkkknnnnnnnnoooooooowwwwwwwwlllllllleeeeeeeeddddddddggggggggeeeeeeee EEEEEEEExxxxxxxxppppppppeeeeeeeerrrrrrrriiiiiiiieeeeeeeennnnnnnncccccccceeeeeeee
[[11]] PPPPPPPPrrrrrrrroooooooojjjjjjjjeeeeeeeecccccccctttttttt
MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeerrrrrrrr DDeeggrreeee iinn EEnnggiinneeeerriinngg iinn
aannyy DDiisscciipplliinnee
OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1122 yyeeaarrss eexxppeerriieennccee iinn
eexxeeccuuttiinngg pprroojjeeccttss iinn HHyyddrrooccaarrbboonn IInndduussttrryy
MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1122 yyeeaarrss
eexxppeerriieennccee,, aatt lleeaasstt 66 yyeeaarrss'' eexxppeerriieennccee mmuusstt bbee iinn
eexxeeccuuttiioonn ooff hhyyddrrooccaarrbboonn ppiippeelliinnee pprroojjeeccttss..
[[22]] EEEEEEEEnnnnnnnnggggggggiiiiiiiinnnnnnnneeeeeeeeeeeeeeeerrrrrrrriiiiiiiinnnnnnnngggggggg
MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeerrrrrrrr DDeeggrreeee // DDiipplloommaa iinn aannyy
ddiisscciipplliinnee ooff EEnnggiinneeeerriinngg..
OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1122 yyeeaarrss eexxppeerriieennccee iinn
eexxeeccuuttiinngg pprroojjeeccttss iinn HHyyddrrooccaarrbboonn IInndduussttrryy
MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1122 yyeeaarrss
eexxppeerriieennccee,, aatt lleeaasstt 66 yyeeaarrss'' eexxppeerriieennccee mmuusstt bbee iinn
ddeessiiggnn && eennggiinneeeerriinngg ooff HHyyddrrooccaarrbboonn ppiippeelliinnee
pprroojjeeccttss..
[[33]] CCCCCCCCoooooooonnnnnnnnssssssssttttttttrrrrrrrruuuuuuuuccccccccttttttttiiiiiiiioooooooonnnnnnnn
MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeerrrrrrrr DDeeggrreeee iinn EEnnggiinneeeerriinngg iinn
aannyy DDiisscciipplliinnee // DDiipplloommaa iinn
PPrroojjeecctt MMaannaaggeemmeenntt
OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1122 yyeeaarrss eexxppeerriieennccee iinn
eexxeeccuuttiinngg pprroojjeeccttss iinn HHyyddrrooccaarrbboonn IInndduussttrryy
MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1122 yyeeaarrss
eexxppeerriieennccee,, aatt lleeaasstt 66 yyeeaarrss'' eexxppeerriieennccee mmuusstt bbee iinn
ccoonnssttrruuccttiioonn ooff hhyyddrrooccaarrbboonn ppiippeelliinnee pprroojjeeccttss..
[[44]] CCCCCCCCoooooooonnnnnnnnttttttttrrrrrrrraaaaaaaaccccccccttttttttssssssss
MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeerrrrrrrr DDeeggrreeee // DDiipplloommaa // MMBBAA iinn
CCoonnttrraaccttss MMaannaaggeemmeenntt //
DDeeggrreeee iinn EEnnggiinneeeerriinngg aannyy
ddiisscciipplliinnee
OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1100 yyeeaarrss eexxppeerriieennccee iinn
eexxeeccuuttiinngg pprroojjeeccttss iinn HHyyddrrooccaarrbboonn IInndduussttrryy..
MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1100 yyeeaarrss
eexxppeerriieennccee,, aatt lleeaasstt 55 yyeeaarrss'' eexxppeerriieennccee mmuusstt bbee iinn
iinn eexxeeccuuttiioonn ooff hhyyddrrooccaarrbboonn ppiippeelliinnee pprroojjeeccttss..
[[55]] PPPPPPPPllllllllaaaaaaaannnnnnnnnnnnnnnniiiiiiiinnnnnnnngggggggg
MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeerrrrrrrr DDeeggrreeee // DDiipplloommaa iinn
EEnnggiinneeeerriinngg // PPrroojjeecctt
MMaannaaggeemmeenntt..
OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 88 yyeeaarrss eexxppeerriieennccee iinn
eexxeeccuuttiinngg pprroojjeeccttss iinn HHyyddrrooccaarrbboonn IInndduussttrryy..
MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 88 yyeeaarrss
eexxppeerriieennccee,, aatt lleeaasstt 44 yyeeaarrss'' eexxppeerriieennccee mmuusstt bbee iinn
eexxeeccuuttiioonn ooff hhyyddrrooccaarrbboonn ggaass ppiippeelliinnee pprroojjeeccttss..
[[66]] IIIIIIIInnnnnnnnssssssssppppppppeeeeeeeeccccccccttttttttiiiiiiiioooooooonnnnnnnn
MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeerrrrrrrr DDeeggrreeee // DDiipplloommaa iinn
EEnnggiinneeeerriinngg iinn aannyy
DDiisscciipplliinnee aalloonngg wwiitthh AANNSSTT //
IINNSSTT LLeevveell IIII // IIIIII
cceerrttiiffiiccaattiioonn..
OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1100 yyeeaarrss eexxppeerriieennccee iinn
eexxeeccuuttiioonn ooff pprroojjeeccttss // iinnssppeeccttiioonn iinn HHyyddrrooccaarrbboonn
IInndduussttrryy..
MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1100 yyeeaarrss
eexxppeerriieennccee,, aatt lleeaasstt 55 yyeeaarrss'' eexxppeerriieennccee mmuusstt bbee iinn
iinnssppeeccttiioonn wwoorrkkss rreellaatteedd ttoo ppiippeelliinnee mmaatteerriiaallss //
ppiippeelliinnee ccoonnssttrruuccttiioonn..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 12 of 154
DOCUMENTATION
3.1 Bidder shall furnish necessary documentary evidences i.e. attested copy of ISO Certificate, copy of work orders, copy of completion certificates, and other necessary documents to ascertain the stipulated qualification criteria. In the absence of such requisite documents, GAIL reserves the right to reject the bid without making any reference to the bidder.
4.0 CONTRACT PERIOD:
Contractual scheduled time for the PMC contract shall be 08 months from the date of FOI which is inclusive of 2 months for Project close out period. The PMC would prepare detail schedule in consultation with GAIL at the beginning / during kick-off. All efforts should be made to meet all the intermediate schedule and milestones. PMC is required to plan and put manpower and resources accordingly. PMC is required to work simultaneously in various packages and works and make all out efforts to complete the project on or before scheduled date. HHoowweevveerr,, aass ppeerr
eexxttaanntt pprraaccttiicceess tthhee pprroojjeecctt sshhaallll bbee mmoonniittoorreedd ww..rr..tt iinntteerrnnaall sscchheedduullee aass wweellll tthhee
sscchheedduulleedd ddeeaaddlliinnee..
5.0 GENERAL:
5.1 Bid document is non-transferable. 5.2 GAIL will not be responsible for cost incurred in preparation and delivery of bids. 5.3 Purchase preference to Central Public Sector Undertakings as admissible under the
prevailing Government of India policy shall be applicable. 5.4 This is a ZERO Deviation Bidding Document. Bidder is to ensure compliance of all
provisions of the Bidding Document and submit their bid accordingly. Bids with any deviation to the bid conditions shall be liable for rejection.
5.5 The Complete Bid document is also available on web sites of GAIL (India) Limited
(http://www.gailtenders.in). Further, the bidder has to meet the BEC criteria as specified in the bid document.
5.6 GAIL reserves the right to reject any or all the bids received at its discretion without
assigning any reason whatsoever. 5.7 This Invitation for Bids (IFB) is an integral and inseparable part of the enclosed Bid
Document. * Please specify Bid Document No. GAIL/RJY/C&P/SR20036987/RAO in all future correspondence.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 13 of 154
THIS IS NOT AN ORDER Yours faithfully, For GAIL (India) Limited T N M RAO Manager (C&P) GAIL (India) Limited RAJAHMUNDRY E-mail: tnmrao@gail.co.in
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 14 of 154
GAIL (India) Limited (A Govt. of India Undertaking)
NOTICE INVITING TENDER
(DOMESTIC COMPETITIVE BIDDING)
GAIL (India) Limited invites bids from eligible bidders for Hiring of Project Management Consultancy (PMC) services as detailed below Sl. No.
Tender No. IFB and Bid Document available on website from
Date of Pre Bid Meeting Last date & time for submission of Bid
1 GAIL/RJY/C&P/SR20036987/RAO
09.03.2012 20.03.2012 at 1100 Hours (IST) at GAIL, Rajahmundry
10.04.2012 at 1400 Hours (IST)
For further details, please visit our Tender website (http://www.gailtenders.in). For any queries, bidders may contact Manager (C&P), GAIL (India) Limited, A V A Road Rajkahmundry-533103, Phone : 0883-2400720/21/22 Extn 380/382; e-mail: tnmrao@gail.co.in
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 15 of 154
CUT-OUT SLIP
(OUTER ENVELOPE)
DO NOT OPEN-THIS IS A QUOTATION NAME OF WORK : HIRIRNG OF PMC SERVICES FOR
DESIGN & CONSTRUCTION OF KESANAPALLI (W) TO PONNAMANDA PIPELINE
TENDER DOCUMENT NO.: GAIL/RJY/C&P/SR20036987/RAO DUE DATE & TIME : 10.04.2012 UPTO 1400 HRS. FROM TO Name : Manager (C&P), Address: GAIL (India) Limited AVA Road Rajahmundry-533 103 Andhra Pradesh (To be pasted on the outer envelope containing “Priced”, “Un-priced” bids AND “Bid security”)
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 16 of 154
CUT-OUT SLIP
PART-A (UNPRICED BID)
DO NOT OPEN-THIS IS A QUOTATION NAME OF WORK : HIRIRNG OF PMC SERVICES FOR DESIGN &
CONSTRUCTION OF KESANAPALLI (W) TO PONNAMANDA PIPELINE
TENDER DOCUMENT NO.: GAIL/RJY/C&P/SR20036987/RAO DUE DATE & TIME : 10.04.2012 UPTO 1400 HRS.. FROM TO Name: Manager (C&P), Address: GAIL (India) Limited AVA Road, Rajahmundry-533 103 Andhra Pradesh
(To be pasted on the envelope containing “Un-priced” bids)
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 17 of 154
CUT-OUT SLIP
PART- B (PRICED BID)
DO NOT OPEN-THIS IS A QUOTATION NAME OF WORK: HIRIRNG OF PMC SERVICES FOR DESIGN &
CONSTRUCTION OF KESANAPALLI (W) TO PONNAMANDA PIPELINE
TENDER DOCUMENT NO.: GAIL/RJY/C&P/SR20036987/RAO DUE DATE & TIME : 10.04.2012 UPTO 1400 HRS. FROM TO Name : Manager (C&P), Address: GAIL (India) Limited AVA Road, Rajahmundry-533 103
(To be pasted on the envelope containing “Priced Bid”)
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 18 of 154
SECTION II
INSTRUCTIONS TO BIDDERS (ITB)
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 19 of 154
SECTION II: INSTRUCTION TO BIDDERS
INDEX ARTICLE TITLE
A General 1. Scope of Bid 2. Eligible Bidders 3. One Bid per Bidder 4. Deleted 5. Cost of Bidding 6. Site visit
B Bidding Document 7. Contents of Bidding Document 8. Clarification on Bid Document 9. Amendment of Bid Document
C Preparation of Bid 10. Language of Bid 11. Documents comprising the Bid 12. Bid prices 13. Bid currency 14. Period of validity of Bid 15. Bid Security 16. Pre Bid Meeting 17. Format and signing of Bid 18. Zero Deviation 19. E-Payments 20. Agent /Consultant/ Representative/Retainer/ Associate
D Submission of Bid 21. Sealing and marking of Bids 22. Deadline for submission of Bid 23. Late Bid 24. Modification and withdrawal of Bids
E Bid Opening and Evaluation 25. Bid Opening 26. Process to be confidential 27. Contacting the Owner 28. Examination of Bids and determination of responsiveness 29. Correction of errors 30. Priced Bid Opening 31. Conversion to single currency 32. Evaluation and comparison of Bids 33. Purchase Preference
F Award of Contract 34. Award of work 35. Owner’s right to accept any Bid and to reject any Bid 36. Notification of Award 37. Signing of Agreement 38. Contract Performance Bank Guarantee 39. Corruption and fraudulent practice
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 20 of 154
A: GENERAL
1.0 SCOPE OF BID:
1.1 The Employer / Purchaser / Owner / GAIL as defined in the General Conditions of Contract, hereinafter “the Employer / Purchaser / Owner / GAIL” wishes to receive bids as described in the Bidding Documents.
1.2 SCOPE OF WORK: The scope of work shall be as defined in the bidding document.
1.3 The successful bidder will be expected to complete the Scope of work within the
period stated in Bid Document.
1.4 Throughout this bidding documents, the term “bid” and “tender” and their derivatives (“bidder/tenderer”, “Bid/tendered/tender”, “bidding/tendering”, etc.) are synonymous, and day means calendar day. Singular also means plural.
2.0 ELIGIBLE BIDDERS:
2.1 Documents establishing Bidder’s Qualification:
2.1.1 Bidder shall, as part of their bid, submit a written power of attorney authorizing the signatory of the bid to commit the bidder.
2.1.2 Pursuant to Bid Evaluation criteria specified in Invitation for Bids (IFB) the bidder shall furnish all necessary supporting documentary evidence to establish the bidder’s claim of meeting the BEC.
2.1.3 The bidder shall furnish, as part of his bid, documents establishing the bidder’s eligibility to bid and his qualifications to perform the contract if his bid is accepted.
2.1.4 The documentary evidence of the bidder’s qualifications to perform the contract if his bid is accepted, shall establish to the OWNER’S satisfaction that, the bidder has the financial, technical and productions capacity necessary to perform the contract.
2.2 The invitation of bid is open to any bidder.
2.3 A bidder shall not be affiliated with a firm or entity: (i) that has provided consulting services related to the work to the OWNER
during the preparatory stages of the works or of the project of which the works form a part, or
(j) that has been hired by the Owner as engineer/consultant for the contract.
2.4 The bidder shall not be under a declaration of ineligibility by OWNER for corrupt or fraudulent practices as defined in Instruction to Bidders clause no 39.0.
2.5 The bidder is not put on holiday by GAIL or any of its PMC’s (EIL, MECON, Wood Group, Tractebel or Hydrocarbon Project Engineers Limited) or blacklisted by any Government Department / Public Sector on the due date of submission of bid. If the
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 21 of 154
documents were issued inadvertently / downloaded from website, offers submitted by such bidders shall not be considered for opening / evaluation / award.
2.6 While evaluating the bids, pursuant to Bid Evaluation Criteria (BEC) as specified in the Invitation for Bids (IFB), bidder’s past performance shall also be assessed for ascertaining the responsiveness of the bid. In such a case, the decision of the Owner shall be final and binding on the bidder.
2.7 Job executed by a bidder for its own plant / projects cannot be considered as experience for the purpose of meeting requirement of BEC of the tender. However, jobs executed for subsidiary / fellow subsidiary / holding company will be considered as experience for the purpose of meeting BEC, subject to submission of tax paid invoices(s) duly certified by Statutory Auditor of the bidder towards payments of statutory tax in support of the job executed for subsidiary / fellow subsidiary / holding company. Such bidders to submit these documents in addition to the documents specified in the bidding documents to meet Bid Evaluation Criteria.
3.0 ONE BID PER BIDDER
3.1 A Bidder shall submit only one bid in the same bidding process. A Bidder who submits or participates in more than one bid will cause all the proposals in which the bidder has participated to be disqualified.
3.2 Alternative bids are not acceptable.
3.3 BIDS FROM CONSORTIUM: Not acceptable
4.0 COST OF BIDDING 4.1 The bidder shall bear all costs associated with the preparation and submission of the
bid, and OWNER, will in no case be responsible or liable for this cost, regardless of the conduct or outcome of the bidding process.
5.0 SITE VISIT: 5.1 The bidder is advised to visit and examine the Site of Works and its surroundings and
obtain for itself on its own responsibility all information that may be necessary for preparing the bid. The costs of visiting the Site shall be at the bidder’s own expense.
5.2 The bidder and any of its personnel or agents will be granted permission by the Owner to enter upon its premises and lands for the purpose of such visit, but only upon the express condition that the bidder, its personnel, and agents will release and indemnify the Owner and its personnel and agents from and against all liability in respect thereof, and will be responsible for death or personal injury, loss of or damage to property, and any other loss, damage, costs, and expenses incurred as a result of the inspection.
B: BIDDING DOCUMENT
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 22 of 154
6.0 CONTENT OF BIDDING DOCUMENT 6.1 The complete Bid Documents are hosted on GAIL’s website
http://www.gailtenders.in and should be read in conjunction with any addenda / amendments issued / hosted in accordance with Clause No. 8 of ITB.
Volume I of I : Techno- Commercial
Section-I : Invitation for bid (IFB) Section-II : Instruction to Bidders (ITB) Section-III : General Conditions of Contract (GCC) Section-IV : Forms & Formats Section-V : Part-A Scope of consultancy Services
Part-B Payment terms and other important conditions Section-VI : Price Schedules Section-VII : Attachments
Attachment –I : Proforma for Contract Agreement Attachment –II: Performance Evaluation Attachment –III: Agreed terms and conditions Attachment –IV: Integrity Pact
6.2 The bidder is expected to examine IFB, bidding guidelines on GAIL’s website, all
sections of the Bid Document containing instructions, forms / formats, terms, specifications, drawings, etc., enclosed in the bidding document. The complete Bid Document together with all its attachment thereto, shall be considered to be read, understood and accepted by the bidder. Failure to furnish all information required by the Bidding Document or submission of a bid not substantially responsive to the Bidding Document in every respect will be at bidder’s risk and may result in the rejection of the bid.
7.0 CLARIFICATION ON BID DOCUMENT
7.1 A prospective bidder requiring any information or clarification of the Bidding Documents may notify the Employer in writing by e-mail / fax / post at Employer’s mailing address indicated in the Bid Document. All questions / queries should be referred to Employer at least 02 (two) days before scheduled date of pre-bid meeting. The Employer will respond in writing to any request for information / clarification of the bidding documents, which it receives at least 02 (two) days before the pre-bid meeting date. Written copies of Employer’s response (including an explanation of the query but without identifying the source of the query) will be hosted on the websites; http://www.gailtenders.in, before the bid due date and shall be integral part of the Bidding Documents.
8.0 AMENDMENT OF BID DOCUMENT
8.1 At any time prior to the deadline for submission of bids, the Employer may, for any
reason, whether on its own requirement or in response to a clarification requested by prospective bidders, modify the Bidding Documents by issuing addendum / corrigendum.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 23 of 154
8.1 Any addendum / corrigendum / clarifications / replies to queries thus issued shall be part of the Bidding Documents. The addendum / corrigendum / clarifications / replies to queries will be hosted on the GAIL websites http://www.gailtenders.in. Any addendum / corrigendum / clarifications to bid documents shall be available on GAIL websites before bid due date as and when issued and shall form integral part of Bid Document. Bidders have to take into consideration all the addendum(s) / corrigendum (s) / clarifications issued / replies to queries web hosted, before submitting the bid.
8.2 The Employer may, at its discretion, extend the date of submission of bids in order to allow the bidders a reasonable time to submit their most competitive bid taking into account all the amendments issued.
C: PREPARATION OF BID 9.0 LANGUAGE OF BID
9.1 The Bid prepared by the bidder, all correspondence documents relating to the bid
exchanged by the bidder with the Owner shall be in English Language alone provided that any printed literature furnished by the bidder may be written in another language so long as accompanied by an English translation, in which case, for the purpose of interpretation of the bid, the English translation shall govern.
9.2 In the event of submission of any document/ certificate by the Bidder in a language other than English, the English translation of the same duly authenticated by Chamber of Commerce of Bidder’s country shall be submitted by the Bidder. Metric measurement system shall be applied.
10.0 DOCUMENTS COMPRISING THE BID
10.1 The bid prepared by the bidder shall comprise the following:
10.1.1 Envelope - I: Super-scribing Techno-Commercial Un-priced Bid (Part-I)
10.1.1.1 Part-I : Techno-commercial / Un-priced Bid shall contain the following documents all pages of which are digitally signed by the authorised person and to be uploaded in collaboration folder and shall contain the following:
(a) Covering letter. (b) Bidder’s General Details/information as per format F-1. (c) Power of Attorney in favour of person (s) signing the bid that such person (s)
is/are authorised to sign the bid on behalf of the bidder and any consequence resulting due to such signing shall be binding on the bidder.
(d) A Bid Form as per format F-2. (e) Copies of documents as required in F-3. (f) Copy of Price Schedule/ Schedule of Rates (i.e. with prices blanked out)
mentioning “Quoted / Not Quoted.” (g) Document establishing the eligibility and conformity to the Bid Documents of
all Goods and services, which the bidder proposes to supply under the award. (h) Letter of authority in favour of any one of bidder’s executive having authority
to attend the Pre Bid Meeting, un-priced and price bid opening on specified dates and venue as per format F-4
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 24 of 154
(i) Confirmation of no deviation as per Format F-5. (j) Certificate as per Format F-6 for confirming the Government of India is not
party of Agreement. (k) Specific Experience, annual turnover and other details as called for in
qualifying requirements. Copy of work order and completion certificates should be enclosed with the F-7
(l) Current commitments strictly as per Format F-8 (m) Any other information/ details required as per Bidding Documents including
amendment if any. (n) Check list duly filled in as per Format F-10. (o) A confirmation from the Bidder that the bidder and/or its subcontractor have
not been put on Holiday by GAIL or black listed by any government department/ public sector.
(p) Details of Indian Agent applicable for foreign bidder. (q) Undertaking that the contents of the bidding document have not been altered
or modified in case bidder has downloaded the Bid Document from GAIL website.
10.1.2 Envelope - II: Price Bid – Not to be Opened with Techno-Commercial Un-priced Bid
(Part-II)
10.1.3 Part – II: Price Bid
10.1.3.1 Part – II shall contain original Price Schedule / Schedule of Rates (SOR) duly filled in, digitally signed and stamped on each page. In case of any correction, the bidders shall put his signature and his stamp.
10.1.3.2 Bidder shall download the Price Schedule / Schedule of Rates (SOR) which is uploaded on website as an excel attachment. Bidder shall submit Price Schedule / Schedule of Rates (SOR) duly filled in and signed strictly as per format without altering the content of it. The duly filled Price Schedule / Schedule of Rates (SOR) shall be uploaded by bidder on web site as per tendering procedure.
10.1.4 Envelope – III; Power of Attorney: Part-IV in physical form with the scanned copy of
same uploaded in e-bid. 10.1.4.1 Part-III shall contain one original and one copy of Power of Attorney in non-
judicial stamp paper in a separate sealed envelope.
10.1.5 Envelope – IV; Integrity Pact: Part-V in physical form. 10.1.5.1 Part-IV shall contain one original and one copy of Integrity Pact in a separate
sealed envelope.
10.1.6 Envelope – V; Consortium Agreement in case of Consortium bid in physical form with the scanned copy of same uploaded in e-bid.
10.1.6.1 Part-V shall contain one original and one copy of Consortium Agreement in a
separate sealed envelope.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 25 of 154
10.1.7 Documents to be submitted against Bid Evaluation Criteria (BEC): As per Invitation
for Bids.
11.0 BID PRICES
11.1 The bidder shall e-quote Bid Prices on the appropriate format for “Price Schedule” enclosed as part of Bid Document.
11.2 Prices shall be quoted, in the prescribed Price Schedule by the bidder separately for
each item of scope and in strict compliance to the format of the Price Schedule. 11.3 Prices quoted should be inclusive of fees towards complete scope of work, all taxes,
duties, levies, license fees, service tax and also payment towards third party charges towards surveys etc. However, applicable rate of statutory taxes & duties must be indicated separately.
11.4 Inspection/Certification of all work/services at all stages shall be done by GAIL
wherever GAIL so desires or by any third agency for which no extra charges shall be payable to the Bidder since all personal and incidental expenses of GAIL’s Inspectors shall be borne by GAIL.
11.5 Conditional discount, if offered, shall not be considered for evaluation. Bidders separation of the price components as aforesaid will be solely for the purpose of facilitating the comparison of bids by GAIL and will not in any way limit GAIL’s right to contract on any of the price basis/terms offered basis.
11.6 The cost of any other item / services, which are considered necessary for completion
of the job, is deemed to have been included in the lump-sum prices.
11.7 Prices quoted by the bidder shall be firm and fixed during the bidder’s performance of the contract. A bid submitted with an adjustable price quotation will be treated as non- responsive and rejected.
11.8 Statutory variation in service tax, if any, within the contractual completion period shall be borne by GAIL. No variation in taxes, duties or levies other than service tax shall be payable.
11.9 Prices shall be written both in words and figures. In the event of difference, the price in words shall be valid and binding.
11.10 Bidder shall be solely responsible for ascertaining all types of taxes and duties
applicable for providing the services as mentioned in the scope of work. GAIL shall deduct Indian income tax applicable from the payments due to the bidder under the contract. In case of foreign bidder, withholding tax at applicable rate shall be deducted for which Tax Deduction Certificate shall be issued by GAIL.
11.11 Quoted prices shall also be inclusive of all costs towards carrying out any surveys, travel to India, site visits by its personnel, stay in India, boarding, lodging, incidental expenses etc. required for Scope of Work.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 26 of 154
12.0 BID CURRENCY:
12.1 Indian bidders may submit bid in Indian Rupees Only. 13.0 PERIOD OF VALIDITY OF BID
13.1 The bid shall remain valid for acceptance for four (4) months from the bid due date.
Owner shall reject a bid valid for a shorter period being non-responsive. The Bidder shall not be entitled during the said period of 4 months, to revoke or cancel its Bid or to vary the Bid given or any term thereof.
13.2 In exceptional circumstances, prior to expiry of the original bid validity period, the Owner may request that the bidder extend the period of validity for a specified additional period. The requests and the responses thereto shall be made in writing (by fax/post/e-mail). A bidder agreeing to the request will not be required or permitted to modify his bid.
14.0 BID SECURITY: NOT APPLICABLE
15.0 PRE-BID MEETING
15.1 The bidder (s) or his authorized representative, to whom the bid document has been issued or who have downloaded the bid document from website are invited to attend the pre-bid meeting which will take place at GAIL (India) Ltd., GAIL Bhavan, A V A Road, Rajahmundry. Bidder shall carry Authority letter as per Format F-4 while attending above meeting.
15.2 The purpose of meeting will be to clarify issues and to answer queries on any matter that may be raised at that stage.
15.3 The bidder is requested, as far as possible, to submit any queries by courier or by fax to reach Owner’s office not later than two days before the meeting. All communication must be addressed to GAIL (India) Limited, GAIL Bhavan A V A Road, Rajahmundry. It may not be practicable at the meeting to answer queries received late, but queries and responses/clarifications will be transmitted in accordance with the following sub-clause.
15.4 The text of the queries raised and the responses given, together with any responses prepared after the meeting will be transmitted without delay (without identifying the sources of the questions) to all the purchasers of the bidding documents .Any modifications of the bidding documents listed in clause 7 of Instruction to Bidders that may become necessary as a result of the pre-bid meeting shall be made by the Owner exclusively through the issue of an addendum pursuant to clause 9 of Instruction To Bidders and not through the minutes of the pre-bid meeting
15.5 Non- attendance of the pre-bid meeting will not be a cause for disqualification of the bidder.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 27 of 154
16.0 FORMAT AND SIGNING OF BID 16.1 The-bid shall be signed by the person or persons duly authorised to sign on behalf of
the bidder. The name and position held by each person signing must be stated below the signature. All pages of the bid except any catalogues / literatures shall be signed and sealed by the person or persons signing the bid.
16.2 The bid shall contain no alterations, omissions or additions, unless such corrections are initialed by the person or persons signing the bid.
17.0 ZERO DEVIATION:
17.1 Bidder to note that this is a ZERO Deviation Bidding Document. Owner will appreciate submission of offer based on the terms and conditions in the enclosed General Conditions of Contract, Instruction to Bidders, Scope of Work, and Technical Specification etc. to avoid wastage of time and money in seeking clarifications on technical / commercial aspect of the offer. Bidder’s Bid shall be considered non-responsive and liable for rejection, if deviations are taken to the under mentioned provisions of Bid Documents by the Bidder:-
� Firm Price � Scope of Work � Specifications � Price Schedule / Schedule of Rates � Completion Period for total scope of work � Force Majeure. � Payment terms & conditions. � Contract Performance Bank Guarantee (CPBG). � Price Reduction Schedule (PRS) for delay in completion. � Liability Clause. � Period of validity of bid. � Arbitration / Resolution of Dispute � Termination of Contract � Applicable Laws � Any other condition specifically stated in the Bid Document elsewhere that
non- compliance of the clause lead to rejection of the Bid. 18.0 E-PAYMENTS
18.1 GAIL (India) Limited has initiated payments to suppliers and Consultants
electronically and to facilitate the payments electronically, the Indian bidder should have an account with HDFC Bank or ICICI Bank or State Bank of India so that the payment through e-banking be made to the bidder, in case work is awarded to him. The bidder should give their account number and other details in any one of the above banks to facilitate payment through E-banking.
19.0 AGENT/CONSULTANT/REPRESENTATIVE/RETAINER/ASSOCIATE
19.1 GAIL would prefer to deal directly with the manufacturers/ principals abroad without
involving any Indian Agent. But in case they decide to have their Agent/
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 28 of 154
Representative/Retainer/Associate in India and pay commission for their services against a particular tender it should be bare minimum and the principal would have to certify that such a commission is commensurate with the services rendered to them by such an Agent/ GAIL/ Representative/ Retainer/ Associate in India. The principal will also have to broadly list out services to be rendered by the Agent/ Representative/ Retainer/ Associate in India.
19.2 In the event bidder is having Agent/ GAIL/ Representative/ Retainer/ Associate/
servicing facilities in India (who is not an employee of the bidder) the bidder should indicate in their offer the name of such an Agent/ GAIL/ Representative /Retainer /Associate, they have for services in India. The bidder must also indicate clearly the commission payable to the Agent/ Representative/ Retainer/Associate in rupees in terms of Agreement (enclosing copy of the same). The bidder, in his bid will indicate the nature and extent of service to be provided by such an Agent/ Representative/ Retainer/Associate on behalf of the bidder and also remuneration therefore provided in the price, as a separate item, quoted by the bidder to GAIL. Such remuneration/commission will be paid by GAIL in non-convertible Indian currency in India. Should it be established at any subsequent point of time that the above statement of the bidder is not correct or that any other amount of remuneration/commission either in India or abroad is being paid to any one (who is not an employee of the bidder), the bidder would be liable to be debarred from participating in the future tenders of GAIL. Failure to give such information will lead to rejection of the offer.
The following particulars will also be furnished by the bidder:
(i) Name, address and precise relationship between the foreign
manufacturer/principal and their Agent/ Representative/Retainer/Associate in India.
(ii) The mutual interest which the manufacturer/principal and the Agent/ GAIL/
Representative/ Retainer/Associate in India have in the business of each other.
(iii)Any payment which the Agent/ GAIL/ Representative/ Retainer/ Associate receives in India or abroad from the manufacturer/principal whether as a commission for the contract or as a general fee. Bidder’s quoted price shall be treated as inclusive of such commission & fee.
(iv) Permanent Income Tax number of Agent/ GAIL/ Representative/ Retainer/
Associate in India. (v) Permanent income tax account number of foreign supplier.
(vi) All services to be rendered by the Agent/ GAIL/ Representative /
Retainer/Associate. Note: Tenders which do not comply with the above stipulations are liable to be ignored.
19.3 Overseas bidder should send e-bids directly. E-Bids sent through Agent/ GAIL
/Representative / Retainer /Associate will not be recognized. Agent/ GAIL/
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 29 of 154
Representative/Retainer/Associate of the overseas manufacturers/suppliers are, however, permitted to download biding documents and attend bid opening provided such as Agent/ GAIL/ Representative/Retainer/Associate has a power of attorney/letter of authority setting out very clearly his role, which will be limited to such areas of activity as downloading of bid documents, attending of bid opening and claiming of payment for their services, provided further that such a power of attorney/letter of authority is submitted to GAIL in advanced for scrutiny and acceptance or otherwise.
D: SUBMISSION OF BID
20.0 SEALING AND MARKING OF BIDS
As mentioned in above Invitation for Bids (IFB). 21.0 DEADLINE FOR SUBMISSION OF BID
The offers of the bidder should reach us within bid due date & time as mentioned above.
22.0 LATE BIDS
22.1 GAIL Shall not accept any late bids received after bid due date & time.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 30 of 154
23.0 MODIFICATION AND WITHDRAWAL OF BIDS
23.1 The bidder may modify, re-submit or withdraw their bid after the bid submission, but, before the bid due date of submission as per provision of tendering system of GAIL.
23.2 No bid shall be modified after the deadline for submission of bid. No bid shall be
allowed to be withdrawn in the interval between the deadline for submission of bids and the expiration of the period of bid validity specified by the bidder on the bid form.
E: BID OPENING AND EVALUATION
24.0 BID OPENING
24.1 Un-Priced Techno – Commercial bid opening:
24.1.1 The Employer will open, in the presence of bidders’ designated representatives, the
Un-priced part of bid at date and time as stipulated in IFB. The bidder’s representatives who are present shall sign bid-opening statement evidencing their attendance.
24.1.2 Bidder’s names, the presence (or absence) and amount of bid security, and any other such details as the Employer may consider appropriate will be announced by the owner.
25.0 PROCESS TO BE CONFIDENTIAL
25.1 Information relating to the examination, clarifications, evaluation and comparison of bids, and recommendations for the award of a Contract shall not be disclosed to bidders or any other person officially concerned with such process. Any effort by a bidder to influence the Owner in any manner in respect of bid evaluation or award will result in the rejection of that bid.
26.0 CONTACTING THE OWNER
26.1 Subject to clause 27, no Bidder shall contact GAIL on any matter relating to its Bid,
from the time of Bid opening to the time the Contract is awarded.
26.2 Any effort by a bidder to influence the Owner in any manner in respect of bid evaluation or bid comparison or award may result in the rejection of the bidder’s bid.
27.0 EXAMINATION OF BIDS AND DETERMINATION OF RESPONSIVE NESS
27.1 Owner will examine the bids to determine whether they are complete, whether any computational errors have been made, whether the documents have been properly signed and whether the bids are generally in order.
27.2 Once quoted, bidder shall not make any subsequent price changes, whether resulting
or arising out of any technical/commercial clarifications sought regarding the bid within the scope of work, even if any deviation or exclusion may be specifically
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 31 of 154
stated in the bid. Such price change shall render the bid liable for rejection. All responses to request for clarifications shall be in writing.
27.3 Unsolicited clarification to the Bid and/or change in price during its validity period
would render the Bid liable for outright rejection. 27.4 TECHNO-COMMERCIAL EVALUATION OF BIDS 27.4.1 Bids will be evaluated in accordance with the Bid Evaluation Criteria given in the Bid
Document. The price bid of only those bidders, who meet the Evaluation criteria and Techno-commercial requirement and are found to be responsive shall be opened. Conditional bids shall be liable for rejection.
27.4.2 Bids will be evaluated as received and no query will be asked from the bidders. To assist in the examination, evaluation and comparison of bids if it becomes absolutely necessary, Owner may, at its discretion, ask the bidder for a clarification of its bid. The request for such clarification and the response shall be in writing and no change in the price or substance of bids shall be sought, offered or permitted.
27.4.3 Prior to the evaluation and comparison of bids pursuant to Article-32, Owner will determine the substantial responsiveness of each bid to the bidding documents. For purpose of this Article a substantially responsive bid is one which conforms to all the terms and conditions of the bidding document without material deviations or reservations. Owner’s determination of a bid’s responsiveness is to be based on the contents of the bid itself without recourse to the extrinsic evidence.
27.4.4 A bid determined as substantially non-responsive will be rejected by Owner and may not subsequently be allowed by the Owner to be made responsive by the bidder by correction of the non-conformity.
27.4.5 Bids not confirming to technical specification/requirements (refer Scope of Services) as mentioned in the Bid document will be rejected.
27.4.6 Conditional bids will be liable for rejection. 28.0 CORRECTION OF ERRORS
28.1 Bids will be checked by the Owner for any arithmetic errors. Errors will be corrected
by the Owner as follows in the following sequential order: (a) Where there is a discrepancy between the amounts in words and in figures, the
amount in words will govern; and (b) Where there is a discrepancy between the unit rate and the total resulting from
multiplying the unit rate by the quantity, the unit rate as quoted will prevail and total price will be corrected.
(c) If there is a discrepancy between the total amount and the sum of total prices,
the sum of total prices shall prevail and the total bid amount will be corrected.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 32 of 154
28.2 The amount stated in the bid will be adjusted by the Owner in accordance with the above procedure for the correction of errors and, with the concurrence of the bidder, shall be considered as binding upon the bidder. If the bidder does not accept the corrected amount of bid, its bid will be rejected.
29.0 PRICE BID OPENING
29.1 The Owner shall inform the time, date and venue for price bid opening to all such
bidders who qualify pursuant to techno-commercial bid evaluation. Bidders may be required to attend price bid opening at a short notice of 24 hours. Bidder shall carry authority letter as per Format F-4 while attending opening.
29.2 The Owner will open price bids of all Techno-Commercially acceptable notified to attend price bid opening in presence of authorized bidders’ representatives. The bidder’s representatives who are present shall sign bid-opening register evidencing their attendance.
29.3 The bidder’s name, prices, and such other details as the Owner, at its discretion, may consider appropriate will be announced and recorded at the time of bid opening.
30.0 CONVERSION TO SINGLE CURRENCY
30.1 To facilitate evaluation and comparison, the Owner will covert all bid prices expressed in the amounts in various currencies in which the bid price is payable to single currency and that will be Indian Rupees only at the Bill selling exchange rate published by the State Bank of India on one day prior to the price bid opening date.
31.0 EVALUATION AND COMPARISON OF BIDS As mentioned in BEC.
32.0 PURCHASE PREFREENCE
32.1 Purchase Preference to Central Government Public Sector Undertakings shall be
allowed as per government guidelines in vogue.
F: AWARD OF CONTRACT
33.0 AWARD OF WORK
33.1 The Owner will award the contract to the successful bidder (s) whose bid has been determined to be substantially responsive and/or have been determined as a lowest on least cost to Owner and is determined to be qualified to satisfactorily perform the Contract.
34.0 OWNER’S RIGHT TO ACCEPT ANY BID AND TO REJECT ANY B ID
34.1 The Owner reserves the right to accept or reject any bid, and to annul the bidding process and reject all bids at any time prior to award of the contract without thereby incurring any liability to the affected bidder or bidders or any obligations to inform the affected bidder or bidders of the ground for Owner’s action.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 33 of 154
35.0 NOTIFICATION OF AWARD
35.1 Prior to the expiration of period of bid validity GAIL will notify the successful bidder
in writing by fax/e-mail to be confirmed in writing, that his bid has been accepted. The notification of award / Fax of Intent will constitute the formation of the Contract.
35.2 The Contract period shall commence from the date of notification of award / Fax of Acceptance (FOA).
35.3 The notification of award will constitute the formation of a Contract, until the Contract has been effected pursuant to signing of contract as per Clause 36 of Instruction To Bidders.
36.0 SIGNING OF AGREEMENT
36.1 After the successful bidder has been notified for acceptance of his bid, the bidder is required to execute the Contract Agreement within 15 days of receipt of Fax of Intent in the form provided in the Bidding Documents. The Contract Agreement is to be executed on the non-judicial paper of Andhra Pradesh of appropriate value (the cost of stamp paper shall be borne by the Bidder).
36.2 In the event of failure on the part of the successful bidder to sign the AGREEMENT within the above-stipulated period, the acceptance of the tender shall be considered as cancelled.
37.0 CONTRACT PERFORMANCE BANK GUARANTEE NOT APPLICABLE
38.0 CORRUPT AND FRAUDULENT PRACTICES
38.1 The Owner requires that Bidders/Consultant observe the highest standard of ethics during the execution of Contract. In pursuance of this policy, the Owner defines, for the purposes of this provision, the terms set forth below as follows:
i) “Corrupt Practice” means the offering, giving, receiving, or soliciting of
anything of value to influence the action of public official in contract execution; and
ii) “Fraudulent Practice” means a misrepresentation of facts in order to influence
the execution of a Contract to the detriment of the Owner, and includes collusive practise among bidders (prior to or after bid submission) designed to establish bid prices at artificial non-competitive levels and to deprive the Owner of the benefits of free and open competition;
38.2 The Owner will reject a proposal for award if it determines that the bidder
recommended for award has engaged corrupt or fraudulent practices in competing for the Contract in question:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 34 of 154
38.3 The Owner will declare a firm ineligible for a period pursuant to GCC.
38.4 The bidder(s) are required to execute the “Integrity Pact” attached in the bid document as Attachment IV. In case a bidder does not sign the Integrity Pact, his bid shall be liable for rejection.
38.5 a) Bidder is required to furnish the complete and correct information/ documents required for evaluation of their bids. If the information/ documents forming basis of evaluation is found to be false/ forged, the same shall be considered adequate ground for rejection of the bids and forfeiture of Earnest Money Deposit.
b) In case, the information/ document furnished by the vendor/ contractor
forming basis of evaluation of his bid is found to be false / forged after the award of the contract, GAIL shall have full right to terminate the contract and get the remaining job executed at the risk & cost of such vendor/ contractor without any prejudice to other rights available to GAIL under the contract such as forfeiture of CPBG / Security Deposit, withholding of payment etc.
c) In case, this issue of submission of false documents comes to the notice after
execution of work, GAIL shall have full right to forfeit any amount due to the vendor/ contractor along with forfeiture of CPBG/ Security Deposit furnished by the vendor/ contractor.
d) Further, such bidder/ vendor / contractor shall be put on Blacklist/ Holiday list
of GAIL debarring them from future business with GAIL.
39.0 WAIVER OR TRANSFER OF THE AGREEMENT
39.1 The successful bidder shall not waive the Agreement or transfer it to third parties, whether in part or in whole, nor waive any interest that is included in the Agreement without the prior written permission of the Owner.
40.0 ORDER OF PRECEDENCE
40.1 The Articles contained in this Section shall supplement to the Scope of Work and terms & conditions of contract, General Conditions of Contract. Where any portion of Scope of Works and terms & conditions of contract and General Conditions of Contract is repugnant or at variance with any provisions of Instructions to Bidders. Instructions to Bidders shall be deemed to over-ride the provision(s) of scope of work and terms & conditions of contract, and General Conditions of Contract only to the extent that such repugnancies of variations in Instructions to Bidders are not possible of being reconciled with the provisions of scope of work and terms & conditions of contract, General Conditions of Contract.
41.0 DISPUTE RESOLUTION Clause no. 3.9 GCC for Procurement of Goods has been modified to the extent that the following provision “Dispute Resolution Clause” shall be part of said clause:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 35 of 154
41.1 GAIL (India) limited has framed the Conciliation Rules 2010 in conformity with supplementary to Part –III of the Indian Arbitration and Conciliation Act 1996 for speedier cost effective and amicable settlement of dispute through conciliation. A copy of the said rules made available on GAIL’s website www.gailonline.com for reference. Unless otherwise specified, the matter where decision of the Engineer-in-Charges is deemed to be final and binding as provided in the agreement and the issues/ disputes which cannot be mutually resolved with a reasonable time, all disputes shall be settled in accordance with the Conciliation Rules 2010.
41.2 Any dispute(s)/ difference(s)/issue(s) of any kind whatsoever between/ amongst the Parties arising under/ out of/ in connection with this agreement shall be settled in accordance with the aforesaid rules.
41.3 In case of any dispute(s)/ difference(s)/issue(s), as mentioned above, a Party shall notify the other party (ies) in writing about such a dispute(s)/ difference(s)/issue(s) between/ amongst the Parties and that such a Party wishes to refer the dispute(s)/ difference(s)/issue(s) to Conciliation. Such Invitation for Conciliation shall contain sufficient information as to the dispute(s)/ difference(s)/issue(s) to enable the other Party (ies) to be fully informed as to the nature of the dispute(s)/ difference(s)/issue(s), the amount of monetary claim, if any, and apparent cause(s) of action.
41.4 Conciliation proceedings commence when the other Party(ies) accept(s) the invitation to conciliate and confirmed in writing. If the other Party(ies) reject(s) the invitation, there will be no conciliation proceedings.
41.5 If the Party initiating conciliation does not receive a reply within thirty days from the date on which he/she sends the invitation, or within such other period of time as specified in the invitation, he/she may elect to treat this as a rejection of the invitation to conciliate. If he/ she so elects, he/she shall inform to other Party(ies) accordingly.
41.6 Where Invitation for Conciliation has been furnished, the Parties shall attempt to settle such dispute(s) amicably under Part-III of the Indian arbitration and Conciliation Act, 1996 and GAIL (India) Limited Conciliation Rules, 2010. It would be only after exhausting the option of Conciliation as an Alternate Dispute Resolution Mechanism that the Parties hereto shall go for Arbitration as per the provisions of arbitration clause. For the purpose of this Article, the option of ‘Conciliation’ shall be deemed to have been exhausted, even in case of rejection of ‘Conciliation’ by any of the Parties.
41.7 The cost of Conciliation proceeding including but not limited to fees for Conciliator(s), Airfare, Local Transport, Accommodation, cost towards conference facility etc. shall be borne by the Parties equally.
41.8 The Parties shall freeze claims (s) of interest, if any, and shall not claim the same during pendency of Conciliation proceedings. The Settlement Agreement, as and when reached/ agreed upon, shall be signed between the Parties and Conciliation proceeding shall stand terminated on the date of the Settlement Agreement.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 36 of 154
42.0 UNSOLICITED POST TENDER MODIFICATIONS
42.1 Bidders are advised to quote as per terms and conditions of the Bidding Document and not to stipulate deviations/exceptions. Once quoted, the bidder shall not make any subsequent price changes, whether resulting or arising out of any technical / commercial clarifications and details sought on any deviations, exceptions or stipulations mentioned in the bid unless any amendment to Bidding Document is issued by Owner. Similarly, no revision in quoted price shall be allowed should the deviations stipulated by him are not accepted by GAIL and are required to be withdrawn by him in favour of stipulation of the Bidding Document. Any unsolicited proposed price change is likely to render the bid liable for rejection.
43.0 CENVAT / VAT CREDIT
43.1 Bidders shall provide required documents for availing Cenvat / VAT Credit applicable on Excise duty, CST/VAT/ LST and Service Tax as per prevailing rules.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 37 of 154
SECTION III
GENERAL CONDITIONS OF CONTRACT
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 38 of 154
SECTION-III:
GENERAL CONDITIONS OF CONTRACT ARTICLE 3.1: DEFINITIONS AND INTERPRETATIONS In this Document, as hereunder defined, the following terms and expressions shall have the meaning hereby assigned to them except where the context otherwise requires: AGREEMENT means the agreement concluded on non-judicial stamp paper between GAIL and Consultant for Services as per this Bid document. GAIL/OWNER shall mean GAIL (India) Limited GAIL'S REPRESENTATIVE means the person appointed or authorized from time to time by GAIL for execution of the contract. CONSULTANT'S REPRESENTATIVE means the person appointed from time to time by CONSULTANT for execution of the Contract. ENGINEER-IN-CHARGE/EXECUTIVE-IN-CHARGE shall mean the person designated from time to time by the GAIL and shall include those who are expressly authorized by him to act for and on his behalf for operation of this CONTRACT. SIGN OFF means a recorded statement for completion of a milestone/major activity by Consultant as envisaged in this document and accepted by GAIL. CONTRACT shall mean Letter of Acceptance and all attached exhibits and document referred to therein and all terms and conditions thereof together with any subsequent modifications thereto. SERVICES mean the duties to be performed and the services to be rendered by Consultant according to the terms and conditions of the Contract. HEADINGS the headings appearing herein are for convenience only and shall not be taken in consideration in the interpretation or construction of the Contract. SINGULAR AND PLURAL WORDS importing the singular only also include the plural and vice-versa where the context requires. ARTICLE 3.2: PERFORMANCE OF DUTIES AND SERVICES BY CONSULTNT 3.2.1 Consultant shall perform its Services in full accordance with the terms and conditions
of the Contract and any applicable local laws and regulations and shall exercise all reasonable professional skill, care and diligence in the discharge of said Project work.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 39 of 154
Consultant shall in all professional matters act as a faithful advisor to GAIL, and will provide all the expert commercial/technical advice and skills which are normally required for the class of Services for which it is engaged.
Consultant, its staff, employees shall carry out all its responsibilities in accordance with the best professional standards.
Consultant shall prepare and submit documents /reports etc. in due time and in accordance with the Tender Conditions.
3.2.2 Consultant will maintain for the performance of the Contract, personnel as determined
to be responsible for carrying out this job and such persons shall not be replaced or substituted without written approval of GAIL.
ARTICLE 3.3: GAIL'S REPRESENTATIVE 3.3.1 GAIL shall nominate its Representative(s) who shall be entitled to act on behalf of
GAIL with respect to any decision it is empowered to make. The bill / invoice of Consultant will be certified for payment by such representatives.
ARTICLE 3.4: CONSULTANT’S REPRESENTATIVE 3.4.1 Consultant shall nominate a qualified and experienced person as its Representative
who will be the contact person between GAIL and Consultant for the performance of the Contract. This nomination shall be done within ten (10) days after the coming into force of the Contract. Consultant shall notify GAIL in writing prior to the appointment of a new representative. Consultant's Representative may be replaced only with GAIL's consent after getting approved his CV’s from GAIL.
GAIL shall be at liberty to object to any nomination and to require Consultant to remove Consultant's representative for good causes. Consultant shall replace immediately such person by competent substitute at no extra cost to GAIL.
3.4.2 Consultant’s Representative shall be entitled to act on behalf of Consultant with
respect to any decisions to be made under the Contract. ARTICLE 3.5: PAYMENT TERMS 3.5.1 GAIL shall pay for the services rendered as per stipulation in the tender through E-
Banking only (through ICICI Bank, HDFC Bank or State Bank of India). All Bank charges of consultant’s Bankers shall be to the consultant’s account.
3.5.2 Consultant will invoice GAIL according to the terms and conditions provided in the
tender. 3.5.3 Payment terms shall be as per clause No. 07 of Special Condition of Contract. 3.5.4 In case of disputes concerning invoice(s), GAIL shall return said invoice(s) to
Consultant within fifteen (15) days from its/their receipt specifying in writing the reasons for its / their rejection.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 40 of 154
� GAIL shall pay the undisputed amount of the invoice(s) according to Article -
3.5.3 hereof. � The disputed amount, if any, shall be paid after mutual settlement between
GAIL and Consultant. � Total or partial rejection of the invoice(s) shall not release Consultant from
any of its obligations under the Contract. ARTICLE 3.6: PERFORMANCE GUARANTEE 3.6.1 Consultant shall submit to GAIL an unconditional, irrevocable and on first demand
guarantee from any Indian scheduled bank or a branch of an International bank situated in India and registered with Reserve Bank of India as scheduled foreign bank. However, other than the Nationalized Indian Banks, the banks whose BGs are furnished, must be commercial banks having net worth in excess of Rs. 100 Crores and a declaration to this effect should be made by such commercial bank either in the bank guarantee itself or separately on a letter head.
The value of Contract Performance Guarantee shall be 5% of contract value for the due performance of the Contract. The Contract Performance Guarantee shall be valid as per Special Conditions of Contract. The format of performance guarantee is annexed hereto. All expenses incurred in obtaining of such guarantee shall be borne by Consultant.
3.6.2 In case of extension of completion period, Consultant shall be required to extend the performance guarantee for an appropriate period of time as per contractual requirements.
ARTICLE 3.7: CONFIDENTIALITY 3.7.1 Consultant/GAIL shall treat all matters in connection with the Contract as strictly
confidential and undertakes not to disclose, in any way, information, documents, technical data, experience and know-how given to him by GAIL/Consultant without the prior written consent of the latter.
3.7.2 Consultant further undertakes to limit the access to confidential information to those
of its employees, Implementation Partners who reasonably require the same for the proper performance of the Contract provided however that Consultant shall ensure that each of them has been informed of the confidential nature of the confidentiality and non-disclosure provided for hereof.
ARTICLE 3.8: TAXES AND DUTIES 3.8.1 Consultant shall pay any and all taxes including service tax, duties, levies etc. which
are payable in relation to the performance of the Contract. The quoted price shall be inclusive of all such taxes and duties.
3.8.2 Statutory variation in taxes (CST, LST, WCT, withholding tax, service tax etc.) and
duties, if any, within the contractual completion period shall be borne by GAIL. No variation in taxes duties or levies other than statutory taxes & duties shall be payable.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 41 of 154
3.8.3 Consultant will not claim from GAIL any taxes paid by him. 3.8.4 GAIL shall deduct Income tax at source at applicable rates. ARTICLE 3.9: RESOLUTION OF DISPUTES / ARBITRATION 3.9.1 GAIL and Consultant shall make every effort to resolve amicably by direct informal
negotiations any disagreement or dispute arising between them under or in connection with the Contract.
3.9.2 All disputes, controversies, or claims between the parties (except in matters where the
decision of the Executive/Engineer-in-Charge is deemed to be final and binding) which cannot be mutually resolved within a reasonable time shall be referred to Arbitration by sole arbitrator.
GAIL shall suggest a panel of three independent and distinguished persons to the
other party (Consultant) to select any one among them to act as the sole Arbitrator. In the event of failure of the other party to select the Sole Arbitrator within 30 days
from the receipt of the communication suggesting the panel of arbitrators, the right of selection of sole Arbitrator by the other party shall stand forfeited and GAIL shall have discretion to proceed with the appointment of the sole Arbitrator. The decision of the GAIL on the appointment of Sole Arbitrator shall be final and binding on the parties.
The award of the Sole Arbitrator shall be final and binding on the parties and unless
directed/awarded otherwise by the Sole Arbitrator, the cost of arbitration proceedings shall be shared equally by the PARTIES. The arbitration proceeding shall be in English language and the venue shall be at New Delhi, India.
Subject to the above, the provisions of (Indian) Arbitration & Conciliation Act, 1996
and the rules framed there-under shall be applicable. All matters relating to this contract are subject to the exclusive jurisdiction of the Courts situated in the State of Delhi (India).
3.9.3 Consultant may please note that the Arbitration & Conciliation Act 1996 was enacted
by the Indian Parliament and is based on United Nations Commission on International Trade Law (UNCITRAL model law), which were prepared after extensive consultation with Arbitral Institutions and centers of International Commercial Arbitration. The United Nations General Assembly vide resolution 31/98 adopted the UNCITRAL Arbitration rules on 15 December 1976.
ARTICLE 3.10: LEGAL CONSTRUCTION 3.10.1 Subject to the provisions of this Article, the Contract shall be, in all respects,
constructed and operated as an Indian Contract and in accordance with Indian Laws as in force for the time being and is subject to and referred to the Court of Law situated at New Delhi.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 42 of 154
ARTICLE 3.11: SUSPENSION OF THE PREFORMANCE OF DUTIES AND SERVICES
3.11.1 GAIL may suspend in whole or in part – the performance of services of Consultants
any time upon giving not less than fifteen (15) days notice.
3.11.2 Upon notice of suspension, Consultant shall suspend immediately the services and reduce expenditure to a minimum to be agreed upon by both the parties.
3.11.3 Upon suspension of the performance of services, Consultant shall be entitled to reimbursement of the costs which shall have been actually incurred prior to the date of such suspension. However, the total reimbursement shall be restricted to contract price.
3.11.4 By fifteen days prior notice, GAIL may request Consultant to resume the performance of the services, without any additional cost to GAIL.
3.11.5 In case of suspension of work by consultant on GAIL’s request for more than 10 days, demobilization and remobilization charges will be paid to consultant as per Schedule of Rates.
3.11.6 If the suspension of the duties and services exceeds six months, either party shall be entitled to terminate contract according to Article 3.16 hereunder.
ARTICLE 3.12: PRICE REDUCTION SCHEDULE (PRS) 3.12.1 In case Consultant fails to complete the services within stipulated period then unless
such failure is due to force majeure as defined in Article 3.19 hereinafter or due to GAIL’s default, there will be a reduction in contract price @ 1/2% for each week of delay or part thereof subject to maximum of 5 % of contract price.
3.12.2 GAIL may without prejudice to any methods of recovery, deduct the amount of such
PRS from any money due or which may at any time become due to Consultant from its obligations and liabilities under the contract or by recovery against the Performance Bank Guarantee. Both Consultant and GAIL agree that the above percentage of price reduction are genuine pre-estimates of the loss/damage which GAIL would have suffered on account of delay/ breach on the part of Consultant and the said amount will be payable on demand without there being any proof of the actual loss/or damage caused by such breach/delay. A decision of GAIL in the matter of applicability of price reduction shall be final and binding.
ARTICLE 3.13: ASSIGNMENT 3.13.1 Consultant shall not have the right to assign or transfer the benefit and obligations of
the contract or any part thereof to the third party without the prior express approval in writing of GAIL which it shall do at its discretion. However, in event of that all legal/contractual obligations shall be binding on Consultant only.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 43 of 154
ARTICLE 3.14: INDUSTRIAL AND INTELLECTUAL PROPERTY 3.14.1 In order to perform the services, Consultant must obtain at its sole account, the
necessary assignments, permits and authorizations from the titleholder of the corresponding patents, models, trademarks, names or other protected rights and shall keep GAIL harmless and indemnify GAIL from and against claims, proceedings, damages, costs and expenses (including but not limited to legal costs) for and/or on account of infringements of said patents, models, trademarks names or other protected rights.
3.14.2 All documents, report, information, data etc. collected and prepared by Consultant in
connection with the scope of work submitted to GAIL will be property of GAIL. 3.14.3 Consultant shall not be entitled either directly or indirectly to make use of the
documents, reports given by GAIL for carrying out of any services with any third parties.
3.14.4 Consultant shall not without the prior written consent of GAIL be entitled to publish
studies or descriptive article with or without illustrations or data in respect of or in connection with the performance of services.
ARTICLE 3.15: LIABILITIES 3.15.1 Without prejudice to any express provision in the contract, Consultant shall be solely
responsible for any delay, lack of performance, breach of agreement and/or any default under this contract.
3.15.2 Consultant shall remain liable for any damages due to its gross negligence within the
next 12 months after the issuance of the provisional acceptance certificate of the contract.
3.15.3 The amount of liability will be limited to 10% of the contract value. ARTICLE 3.16: TERMINATION OF CONTRACT 3.16.1 Termination for Default
GAIL reserves its right to terminate / short close the contract, without prejudice to any other remedy for breach of CONTRACT, by giving one month notice if Consultant fails to perform any obligation(s) under the CONTRACT and if Consultant, does not cure his failure within a period of 30 days (or such longer period as GAIL may authorise in writing) after receipt of the default notice from GAIL.
3.16.2 Termination for Insolvency GAIL may at any time terminate the CONTRACT by giving written notice without
compensation to Consultant, if Consultant becomes bankrupt or otherwise insolvent, provided that such termination will not prejudice or affect any right of action or remedy which has accrued or will accrue thereafter to GAIL.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 44 of 154
3.16.3 Termination for convenience
GAIL may by written notice sent to consultant, terminate the contract, in whole or part, at any time for its convenience. However, the payment shall be released to the extent to which performance of work executed as determined by GAIL till the date upon which such termination becomes effective.
3.16.4 Summary of Termination of Contract Due To Submission of False Documents:
Bidders are required to furnish the complete and correct information/documents
required for evaluation of their bids. If the information/documents forming basis
of evaluation is found to be false/ forged, the same shall be considered adequate
ground for rejection of the Bids and forfeiture of Earnest Money Deposit.
In case, the information/document furnished by the contractor forming basis of
evaluation of his bid is found to be false/forged after the award of the contract,
GAIL shall have full right to terminate the contract and get the remaining job
executed at the risk & cost of such contractor without any prejudice to other
rights available to GAIL under the contract such as forfeiture of Security Deposit,
withholding of payments etc.
In case the issue of submission of false document comes to the notice after
execution of the work, GAIL shall have full right to forfeit any amount due to the
contractor along with forfeiture of Security Deposit furnished by the contractor.
Further, such contractor/bidder shall be blacklisted for future business with GAIL
(India) Limited.
ARTICLE 3.17: MODIFICATION Any modification of or addition to the contract shall not be binding unless made in
writing and agreed by both the parties. ARTICLE 3.18: CONTRACT/AGREEMENT The notification of award along with agreement on non judicial stamp paper of
appropriate value of as per proforma within 10 days from the date of receipt of FOA, the cost of stamp paper is to be borne by Consultant, and its enclosures shall constitute the contract between the parties and supersedes all other prior agreements, arrangements and communications, whether oral or written, between the parties relating to the subject matter hereof.
ARTICLE 3.19: FORCE MAJEURE
Shall mean and be limited to the following:
a) War/hostilities b) Riot or Civil commotion c) Earthquake, flood, tempest, lightening or other natural physical disaster. d) Restrictions imposed by the Government or other statutory bodies which
prevents or delays the execution of the Contract by Consultant.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 45 of 154
CONSULTANT shall advise GAIL by a registered letter duly certified by the local Chamber of Commerce or statutory authorities, the beginning and end of the above causes of delay within seven (7) days of the occurrence and cessation of such Force Majeure Conditions. In the event of delay lasting over one month, if arising out of causes of Force Majeure, GAIL reserves the right to cancel the Contract and the provisions governing termination stated under Article 3.16 shall apply.
For delays arising out of Force Majeure, Consultant shall not claim extension in completion date for a period exceeding the period of delay attributable to the causes of Force Majeure and neither GAIL nor Consultant shall be liable to pay extra costs provided it is mutually established that Force Majeure Conditions did actually exist.
Consultant shall categorically specify the extent of Force Majeure Conditions prevalent in their works at the time of submitting their bid and whether the same have been taken into consideration or not in their quotations. In the event of any force majeure cause, Consultant or the GAIL shall not be liable for delays in performing their obligations under this order and the completion dates will be extended to Consultant without being subject to price reduction for delayed completion, as stated elsewhere.
ARTICLE – 3.20: RECTIFICATION PERIOD
All services shall be rendered strictly in accordance with the terms and conditions stated in the Contract.
No deviation from such conditions shall be made without GAIL’S agreement in writing which must be obtained before any work against the order is commenced. All services rendered by Consultant pursuant to the Contract (irrespective of whether engineering, design data or other information has been furnished, reviewed or approved by GAIL) are guaranteed to be of the best quality of their respective kinds.
Consultant shall rectify at his own cost any mistake in assumption of any data in the study or use of wrong data or faulty study observed within twelve months of the acceptance of his report and will submit the rectified report incorporating the changes wherever applicable within 30 days of observance of mistake.
ARTICLE – 3.21: SUB CONTRACT
Any sub contract to be made by the CONSULTANT relating to the services shall be made only to such extent and with such duly qualified specialists and entities as shall be approved in writing in advance by GAIL. Upon the request of GAIL, the consultant shall submit for GAIL’s prior approval, the terms of reference or any amendment thereof for such sub contractor’s SERVICES. Notwithstanding such approval, the consultant shall remain fully responsible for the performance of services under the CONTRACT.
ARTICLE – 3.22: NOTICES 3.22.1 Any notice given by one party to the other pursuant to the CONTRACT shall be sent
in writing or by telegram or fax, telex/cable confirmed in writing.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 46 of 154
3.22.2 A notice shall be effective when delivered or on the notice’s effective date, whichever
is later. ARTICLE – 3.23: ACQUISITION OF DATA
If required, CONSULTANT shall be responsible for carrying out any surveys and acquisition of all data from necessary sources. GAIL, if requested in writing by CONSULTANT, may assist the consultant in the said acquisition by way of issue of recommendatory letters only. All requisite clearances, co-ordination, fees, charges, etc. and compliance to the local laws required for completion of the job shall be the responsibility of the CONSULTANT.
ARTICLE -3.24: ABNORMALLY HIGH RATED ITEMS (AHR ITEMS):
"In items rate contract where the quoted rates for the items exceed 50% of the GAIL's estimated rates, such items will be considered as Abnormally
High Rates Items (AHR) and payment of AHR items beyond the SOR stipulated quantities shall be made at the least of the following rates:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 47 of 154
SECTION-IV
FORMS AND FORMATS
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 48 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
Format F-1 BIDDER’S GENERAL INFORMATION
To GAIL (India) Limited GAIL Bhavan, A V A ROAD Rajahmundry-533103 A.P., India 1-1 Bidder Name:
1-2 Number of Years in Operation
1-3 Address of Registered Office
___________________________________________ City: ______________________________________ District: ____________________________________ State: ______________________________________ PIN/ZIP :___________________________________
1-4 Operation Address (if different from above)
___________________________________________ City: ______________________________________ District: ____________________________________ State: ______________________________________ PIN/ZIP :___________________________________
1-5 Telephone Number ____________________________________________ (Country Code) (Area Code) (Telephone Number)
1-6 E-mail address
1-7 Fax Number ____________________________________________ (Country Code) (Area Code) (Telephone Number)
1-8 Website
1-9 ISO Certification, if any {If yes, please furnish details}
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 49 of 154
1-10 Bid Currency
1-11 Banker’s Name
1-12 Branch
1-13 Branch Code
1-14 Bank Account Number
1-15 Service Tax Registration No. (for Indian Bidder)
1-16 PAN No. (for Indian Bidder)
1-17 PAN No. in India (for Foreign Bidder)
Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 50 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
Format F-2 BID FORM
To Dear Sir, After examining/reviewing the Bidding Documents for Project Management Consultancy services for ……………………………………………….. including technical specifications, drawings, General and Special Conditions of Contract and schedule of rates, etc. the receipt of which is hereby duly acknowledged, we, the undersigned, are pleased to offer to execute the whole of the Job for all specified items as per Schedule of Rates in conformity with, the said Bid Documents, including Addenda Nos. ____________. We undertake, if our bid is accepted, to complete entire work as specified in the Bid Document within the completion schedule specified therein. We confirm that this bid is valid for a period of three (3) months from the date of opening of Techno-Commercial Bid, and it shall remain binding upon us and may be accepted by any time before the expiration of that period. If our bid is accepted, we will provide the performance guarantee equal to 5% (Five per cent) of the Contract Price, for the due performance with in fifteen days of such award. Until a final Contract is prepared and executed, the bid together with your written acceptance thereof in your notification of award shall constitute a binding Contract between us. We understand that Bid Document is not exhaustive and any action and activity not mentioned in Bid Documents but may be inferred to be included to meet the intend of the Bid Documents shall be deemed to be mentioned in Bid Documents unless otherwise specifically excluded and we confirm to perform for fulfilment of Agreement and completeness of the Work in all respects within the time frame and agreed price. We understand that you are not bound to accept the lowest priced or any bid that you may receive. Dated this Day of 200_
Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 51 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
Format F-3
LIST OF ENCLOSURES Dear Sir,
We are enclosing the following documents as part of the bid:
1. Power of Attorney of the signatory to the Bidding Document.
2. Document showing annual turnover for the last three years such as annual reports, profit and loss account, net worth etc. along with information as sought in enclosed formats F-3A and F-3B.
3. Organisation chart of the bidder and the structure assigned for execution of the work under this bid with details of Bidder’s infrastructure in India as well as internationally and local support offices.
4. Methodology of execution of work
5. Copy of Bidding Documents along with addendum/corrigendum no….. duly signed and sealed on each page, in token of confirmation that Bid Documents are considered in full while preparing the bid and in case of award, work will be executed in accordance with the provisions detailed in Bid Documents.
6. Bidder declaration that they are not under any liquidation, court receivership or similar proceedings.
7. Disclaimer: Format F-11 duly filled in.
8. Attachment III: Agreed Terms & Conditions duly filled in.
Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 52 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
Format F-3A
Annual Turnover
NOT APPLICABLE
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 53 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
Format F-3B
FINANCIAL SITUATION
NOT APPLICABLE
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 54 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
Format F-4 LETTER OF AUTHORITY
PROFORMA FOR LETTER OF AUTHORITY FOR ATTENDING AND SUBSEQUENT NEGOTIATIONS/CONFERENCES
No. Date:
Dear Sir,
We _____________________________________ hereby authorize following representative(s) to attend Pre Bid Meeting / un-priced bid opening / Price bid opening and for any other correspondence and communication against above Bidding Document:
1) Name & Designation _______________________ Signature _________________
2) Name & Designation _______________________ Signature _________________
We confirm that we shall be bound by all commitments made by aforementioned authorised representatives.
Yours faithfully, Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:
Note: This letter of authority should be on the letterhead of the bidder and should be signed by a person competent and having the power of attorney to bind the bidder.
Not more than two persons are permitted to attend techno –commercial un-priced and
price bid opening.
Bidder’s authorized executive is required to carry a copy of this authority letter while attending the Pre Bid Meeting, Un-priced bid opening and price bid opening and submit the same to GAIL.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 55 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
Format F-5 NO DEVIATION CONFIRMATION
Dear Sir, We understand that any deviation/exception in any form may result in rejection of bid. We, therefore, certify that we have not taken any exceptions/deviations anywhere in the bid and we agree that if any deviation/exception is mentioned or noticed, our bid may be rejected. Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 56 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
Format F-6 CERTIFICATE
Dear Sir,
If we become a successful bidder and pursuant to the provisions of the Bidding Documents award is given to us for the following certificate shall be automatically enforceable:
“We agree and acknowledge that the Employer is entering into the Agreement solely on its own behalf and not on behalf of any other person or entity. In particular, it is expressly understood and agreed that the Government of India is not a party to the Agreement and has no liabilities, obligations or rights there under. It is expressly understood and agreed that the Employer is authorised to enter into Agreement, solely on its own behalf under the applicable laws of India. We expressly agree, acknowledge and understand that the Employer is not an agent, representative or delegate of the Government of India. It is further understood and agreed that the Government of India is not and shall not be liable for any acts, omissions, commissions, breaches or other wrongs arising out of the Agreement. Accordingly, we hereby expressly waive, release and forego any and all actions or claims, including cross claims, VIP claims or counter claims against the Government of India arising out of the Agreement and covenants not to sue to Government of India as to any manner, claim, cause of action or things whatsoever arising of or under the Agreement.” Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 57 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
Format F-7 DETAILS OF SIMILAR WORK DONE AS PER BID EVALUATION CRITERIA /
SCOPE OF WORK Sr.
No.
Description of the work
Location of the work
Full Postal Address
and phone nos. of
Client & Name of
Officer-in-Charge
Value of Contract
Date of Commence-
ment of Work
Scheduled Completion
Time (Months)
Date of Actual
Completion
Reasons for delay in project
completion, if any
Note: Copies of Letter of awards and completion certificate for the above works to be
enclosed.
The Work completed earlier than the period indicated in Bid Evaluation Criteria / Scope of Work need not be indicated here. The list of work, not of similar nature need not be indicated here. Failing to comply aforementioned instructions may lead to rejection of bid.
Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 58 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
Format F-8
PRESENT COMMITMENTS OF THE BIDDER
Sr. No.
Full Postal Address and phone nos. of Client & Name of Officer-in-Charge
Description of the Work
Date of Commencement
of Work
Scheduled Comp. Period
Total Contractual
Value
%Age Comp. as on Date
Expected Date of
Completion
Remarks
NOT APPLICABLE
Note: This list must be a full list of all type of works in hand. Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 59 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
Format F-9
PROFORMA OF BANK GUARANTEE FOR CONTRACT PERFORMANCE GUARANTEE
PERFORMANCE SECURITY (CONTRACT PERFORMANCE BANK GUA RANTEE) – UNCONDITIONAL
(TO BE STAMPED IN ACCORDANCE WITH STAMP ACT)
REF.
Bank Guarantee No.: Date:
To GAIL ( India) Limited ________________________ ________________________ ________________________ Dear Sirs, In consideration of the GAIL ( India) Limited, New Delhi (India) (herein referred to as the OWNER which expression shall unless repugnant to the context or meaning thereof include successors, administrators and assigns) having awarded to M/s_______________ having principal office at _______________________________________(hereinafter referred to as the “CONSULTANT” which expression shall unless repugnant to the context or meaning thereof include their respective successors, administrators, executors and assigns) the work of ------------------------by issue of OWNER Order No. _______________dated ___________and the same having been accepted by the Consultant resulting into CONTRACT for --------------------------- as per above referred Order having a total value of _______________________for the work of --------------------------and the CONSULTANT having agreed to provide a Contract Performance and warranty guarantee for faithful performance of the aforementioned Contract to Owner. We (bank) _________________________________having Head Office at (hereinafter referred to as the Bank, which expressly shall, unless repugnant to the context or meaning thereof include successors, administrators, executors and assigns) do hereby guarantee to undertake to pay the OWNER on demand any and all moneys payable by the Consultant to the extent of 5%(Five percent) of the Contract Prices as aforesaid at any time up to __________________________________ without a reference to the CONSULTANT. Any such demand made by OWNER on bank shall be inclusive and binding not withstanding any difference between OWNER and CONSULTANT discharges this guarantee. OWNER and CONSULTANT or any dispute pending before any Court, Tribunals, arbitrators or any other Authority. The bank undertakes not to revoke this guarantee during its currency without previous consent of OWNER and further agrees that the guarantee herein contained shall continue to be enforceable till the OWNER discharges this guarantee. OWNER shall have the fullest liberty without affecting in any way the liability of the BANK under this guarantee from time
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 60 of 154
to time to extend the time for performance by CONSULTANT of the afore mentioned CONTRACT, OWNER shall have the fullest liberty, without affecting this guarantee, to postpone from time to time the exercise of any power vested in them or of any right which they might have against CONSULTANT, and to exercise the same at any time in any manner, and either to enforce to forebear to enforce any covenants contained or implied, in the aforementioned CONTRACT between OWNER and CONSULTANT or any other course of or remedy or security available to OWNER. The BANK shall not be released of its obligations under these presents by any exercise by OWNER of its liability with reference to the matters aforesaid or any of them or by reason or any other acts of omission or commission on the part of OWNER or any other indulgence shown by OWNER or by any other matter or thing whatsoever which under law would, but for this provision, have the effect or relieving the BANK. The BANK also agrees that OWNER at its option shall be entitled to enforced this Guarantee against the Bank as a Principal debtor, in the first instance without proceeding against CONSULTANT and notwithstanding any security or other guarantee that OWNER may have in relation to the CONSULTANT’S liabilities. Notwithstanding anything contained herein above our liability under this Guarantees restricted to AND it shall remain in force upto and including ________and shall be extended from time to time for such period as may be desired by the CONSULTANT on whose behalf this Guarantee has been given. Therefore, we hereby affirm that we are guarantors and responsible to you on behalf of the Consultant up to a total amount of (amount of guarantees in words and figures) and we undertake to pay you, upon your first written demand declaring the Consultant to be in default under the contract and without caveat or argument, any sum or sums within the limits of (amount of guarantee) as aforesaid, without your needing to prove or show grounds or reasons for your demand or the sum specified therein. This guarantee is valid until the ________day of _______200 We have power to issue this guarantee in your favour under memorandum and Article of Association and the undersigned has full powers to do so under the Power of Attorney/Resolution of the Board of Directors dated ________ accorded to him by the bank. Dated The ___________day of _____________200 WITNESS: (SIGNATURE) (SIGNATURE)
BANK RUBBER STAMP (NAME) (NAME) (OFFICIAL SEAL) Designation with bank stamp
Plus Attorney as per Power Of Attorney/Resolution Board of Directors Date:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 61 of 154
INSTRUCTIONS FOR FURNISHING CONTRACT PERFORMANCE BA NK
GUARANTEE
1. The Bank Guarantee by successful bidder(s) will be given on non-judicial stamp paper as per stamp duty applicable. The non-judicial stamp paper should be in name of the issuing bank. In case of foreign bank, the said bank guarantee to be issued by its correspondent bank in India on requisite non-judicial stamp paper and place of bid to be considered as Delhi.
2. The bank guarantee by bidders will be given from bank as specified in ITB.
3. A letter from the issuing bank of the requisite Bank Guarantee confirming that said bank guarantee and all future communication relating to the Bank Guarantee shall be forwarded to Owner.
4. If a bank guarantee is issued by a commercial bank, then a letter to Owner confirming its net worth is more than Rs. 1,000,000,000/- (Rupees one hundred crore) or U S $ 22 million in foreign currency along with a documentary evidence.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 62 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
F-12
CHECKLIST Bidders are requested to duly fill in the following checklist. This checklist gives only certain important items to facilitate the bidder to make sure that the necessary data / information as called for in the Bid Document has been submitted by them along with their offer. This, however, does not relieve the bidder of his responsibilities to make sure that his offer is otherwise complete in all respects. Please ensure compliance and tick (√) against following points:
Sl. Particulars Status
1. Offer complete in all respects with pages in sequential order, original Bid Document including drawings, addendum (if any)
2.
Confirm that the following details have been submitted in the Un-priced part:
a) Cover Letter, Letter of Submission
b) Power of Attorney in the name of person(s) signing the bid
c) Bidder's declaration that they are not under any liquidation, court receivership or similar proceedings.
d)
Confirmation that bidder and/or its sub-contractor have not been put on 'holiday' by GAIL or 'blacklisted' by any Government Department / Public Sector Enterprise.
f) Agreed Terms & Conditions (as per Attachment-III) submitted duly filled in each copy of the Un-priced Bid.
3. Confirm that all forms are enclosed with the bid duly signed / digital signed by authorized person(s)
4. Confirm that the Price Bid (in requisite formats strictly complying with the requirements) has been duly filled in for each item & signed
5. Confirm that proper page nos. have been given in a sequential way in all the documents submitted along with your offer with Index.
6. Confirm that any correction in the Un-priced part has been initialled and stamped by an authorized person.
7. Confirm that any correction in the Priced part has been signed in full and stamped by the authorized person.
8. Confirmation that no deviations are taken against commercial and technical specifications of the Bid Document.
10. Confirm that copies of documents establishing the bidder's eligibility are enclosed.
11. Details of local support office in India, infrastructure in India as well as International level.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 63 of 154
Sl. Particulars Status
12. Bio-Data of Key personnel viz. Project Manager, Engineering Manager, Construction Manager, Planning Manager, Inspection Manager, Contracts Manager, as per format enclosed.
(Signature of authorized signatory)
Name: ________________________
Date: Designation: Place: Seal:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 64 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
Format F-11 DISCLAIMER
Bidders should ensure that bidding document is complete in all respects. In the event that the bidding document or any part thereof is mutilated or missing, the bidder shall notify GAIL immediately at the following address: GAIL (India) Limited GAIL BHAWAN A V A ROAD RAJAHMUNDRY-533103 A.P., INDIA Attn.: Mr. T N M RAO E-mail: tnmrao@gail.co.in Ph: +0883-2400720/21/222 Extn: 382
In the event such written notice is not received at the aforementioned office within seven (7) days from the date of issue of the bidding document to the bidder, the bidding documents received by the bidder shall be deemed to be complete in all respects. No extension of time shall be granted under any circumstances to any bidder for submission of its bid on the grounds that the bidder did not obtain a complete set of the bidding document. GAIL makes no representation or warranty, express or implied, as to the accuracy, correctness and completeness of the information contained in the bidding documents.
Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 65 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
F-12 A DECLARATION
We confirm that we are not under any liquidation, court receivership or similar proceedings. We also confirm that we have not been banned or delisted by any Government or Quasi Government agencies of PSU. Further, we confirm that we have not been put on Holiday list of GAIL or any of its PMC (i.e. M/s EIL, MECON, Tracabel & HRC Projects, Wood Group Kenny). We confirm that contents of Bid Document have not been altered or modified. Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 66 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
F-13
CERTIFICATE FOR NON-INVOLVEMENT OF AGENT To, GAIL (India) Limited GAIL Bhavan, A V A ROAD Rajahmundry-533103 A.P., India Dear Sir, This is to certify that we have not engaged involve any Agent / Consultant / Retainer / Associate who is not an employee of _____________________ (name of your company) for payment of any remuneration thereof in India or abroad. Therefore, no Agent's / Representative's / Consultant's commission is payable in India or abroad against this Contract.
(Signature of authorized signatory)
Name: ________________________
Date: Designation: ___________________
Place: Seal: Note:
(1) This Certificate should be issued on the Letterhead of the Bidder. (2) This Certificate is to be issued only if there is no Agent / Consultant / Retainer / Associate is
involved.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 67 of 154
Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO
F-10
PROFORMA FOR DETAILS OF INDIAN AGENT
To, GAIL (India) Limited GAIL Bhavan, A V A ROAD Rajahmundry-533103 A.P., India Dear Sir, Following are the details of Indian Agent / Consultant / Representative:
Sl. Description Bidder’s Response
1. Name & address of Agent / Consultant / Representative in India
2. The precise relationship between the bidder and their Agent / Consultant / Representative in India
3. The mutual interest which the bidder and Agent / Consultant / Representative in India have in the Business of each other.
4.
Any payment which the Agent / Consultant / Representative in India or abroad receives from the bidder whether as a commission for the Contract or as a general retainer fee.
5. Permanent Income Tax Account number of Agent / Consultant / Representative in India.
6. Permanent Income Tax account of bidder in his country and also in India, if applicable.
7. All services to be rendered by the Agent / Consultant / Representative
8. Bidder to confirm copy of Agreement with their Indian Agent is enclosed in Un-priced bid.
Note: Aforementioned information need to be supported with necessary documents.
(Signature of authorized signatory) Name: ________________________
Date: Designation: Place: Seal:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 68 of 154
SECTION – V
PART-A SCOPE OF WORK
PART-B
SPECIAL CONDITION OF CONTRACT
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 69 of 154
PART-A
SCOPE OF WORK
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 70 of 154
GAIL (India) Limited (A Government of India Undertaking)
A Navratna Company
GAIL Bhavan
AVA Road
Rajahmundry
TENDER NO.: GAIL/RJY/C&P/SR20036987/RAO
BIDDING DOCUMENT FOR
HIRING OF PROJECT MANAGEMENT
CONSULTANCY (PMC) SERVICES FOR DESIGN &
CONSTRUCTION OF KESANAPALLI(WEST) TO
PONNAMANDA P/L
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 72 of 154
SSCCOOPPEE OOFF WWOORRKK
OOFF
PPRROOJJEECCTT MMAANNAAGGEEMMEENNTT CCOONNSSUULLTTAANNCCYY ((PPMMCC)) SSEERRVVIICCEESS
FFOORR
KKEESSAANNAAPPAALLLLII((WW)) TTOO PPOONNNNAAMMAANNDDAA PPIIPPEELLIINNEE PPRROOJJEECCTT
11.. IINNTTRROODDUUCCTTIIOONN
11..11 GGAAIILL ((IInnddiiaa)) LLiimmiitteedd iiss ooppeerraattiinngg PPiippeelliinnee NNeettwwoorrkkss iinn KKrriisshhnnaa GGooddaavvaarrii
((KKGG)) BBaassiinn iinn SSttaattee ooff AAnnddhhrraa PPrraaddeesshh,,IInnddiiaa.. GGaass iiss bbeeiinngg iinnjjeecctteedd ffrroomm
vvaarriioouuss ssoouurrcceess ooff OONNGGCC // CCaaiirrnn // RReelliiaannccee KKGG DD66 aanndd bbeeiinngg ttrraannssppoorrtteedd ttoo
vvaarriioouuss ccuussttoommeerrss ooff KKGG bbaassiinn..
22.. BBRRIIEEFF SSCCOOPPEE OOFF WWOORRKK
22..11 TThhee bbrriieeff ddeessccrriippttiioonn ooff tthhee pprroojjeecctt iiss aass uunnddeerr::
GGAAIILL ((IInnddiiaa)) LLiimmiitteedd iinntteennddss ttoo iimmpplleemmeenntt 1100"" xx 44..55 kkmmss.. ((aapppprrooxx..))
KKeessaannaappaallllii((WW)) ttoo PPoonnnnaammaannddaa PPiippeelliinnee aalloonnggwwiitthh tteerrmmiinnaall uupp--ggrraaddaattiioonn aatt
KKeessaannaappaallllii((WW)) aanndd PPoonnnnaammaannddaa tteerrmmiinnaallss ffoorr ttrraannssppoorrttiinngg NNaattuurraall GGaass ttoo
GGAAIILL--TTaattiippaakkaa aanndd ffuurrtthheerr ttoo ootthheerr ccuussttoommeerrss aalloonngg ppiippeelliinnee rroouuttee iinn KKGG
BBaassiinn rreeggiioonn..
22..22 TThhee bbrriieeff ssccooppee ooff sseerrvviicceess iiss aass ppeerr sseeppaarraattee sseeccttiioonn oonn tthhee ““SSccooppee ooff WWoorrkk””
ooff tthhiiss BBiidd DDooccuummeenntt,, bbuutt nnoott lliimmiitteedd ttoo tthhee ffoolllloowwiinngg::
TThhee PPrroojjeecctt MMaannaaggeemmeenntt CCoonnssuullttaanntt ((PPMMCC)) iiss bbeeiinngg aappppooiinntteedd ffoorr eexxeeccuuttiinngg
tthhee pprroojjeecctt rriigghhtt ffrroomm DDeessiiggnn ttoo CCoommmmiissssiioonniinngg && pprroojjeecctt cclloosseeoouutt oonn ttoottaall
aanndd ssiinnggllee ppooiinntt rreessppoonnssiibbiilliittyy bbaassiiss.. TThhiiss sseeccttiioonn iiss ttoo bbee rreeaadd iinn ccoonnjjuunnccttiioonn
wwiitthh ""SSccooppee ooff wwoorrkk””.. TThhee PPMMCC PPrroojjeecctt MMaannaaggeerr wwiillll bbee tthhee ""EEnnggiinneeeerr--iinn--
CChhaarrggee"" ffoorr tthhee ssaaiidd PPrroojjeecctt.. TThhee ssccooppee ooff wwoorrkk ooff tthhee PPMMCC iiss bbrrooaaddllyy ddeeffiinneedd
uunnddeerr tthhee ffoolllloowwiinngg hheeaaddss bbuutt nnoott lliimmiitteedd ttoo::
[[aa]] BBaassiicc EEnnggiinneeeerriinngg && HHyyddrraauulliicc SSTTUUDDYY..
[[bb]] DDeessiiggnn && DDeettaaiilleedd EEnnggiinneeeerriinngg..
[[cc]] CCaarrrryyoouutt aallll nneecceessssaarryy ccaallccuullaattiioonnss aanndd ccoonndduucctt aallll aapppprroopprriiaattee
ddeessiiggnn pprroocceedduurree aanndd aannaallyyssiiss,, aass rreeqquuiirreedd,, ttoo ooppttiimmiizzee tthhee ssiizziinngg
aanndd sseelleeccttiioonn ooff tthhee eeqquuiippmmeenntt aanndd ssppeecciiffiiccaattiioonn ooff mmaatteerriiaallss..
[[dd]] PPrreeppaarree oovveerraallll ddeessiiggnn bbaassiiss..
[[ee]] PPrreeppaarraattiioonn ooff MMaatteerriiaall TTaakkee--ooffffss ((MMTTOO)),, MMaatteerriiaall RReeqquuiissiittiioonn
((MMRR))..
[[ff]] PPrreeppaarraattiioonn ooff iitteemm--wwiissee ccoosstt eessttiimmaattee ffoorr eeaacchh MMaatteerriiaall RReeqquuiissiittiioonn
aanndd TTeennddeerr..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 73 of 154
[[gg]] PPrreeppaarraattiioonn ooff ddrraawwiinnggss,, MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPrroojjeecctt
DDooccuummeenntt IInnddeexx..
[[hh]] PPllaannnniinngg && SScchheedduulliinngg..
[[ii]] IIddeennttiiffyy aallll tthhee iinntteerrffaaccee ppooiinnttss // bbaatttteerryy lliimmiittss aanndd iinnccoorrppoorraattee
tthheemm oonn rreelleevvaanntt ddrraawwiinnggss aanndd ddooccuummeennttss..
[[jj]] RReevviieeww aanndd aapppprroovvaall ooff ddeessiiggnn // ddrraawwiinnggss // ddooccuummeennttss ssuubbmmiitttteedd
bbyy vveennddoorrss // ccoonnttrraaccttoorrss // ssuupppplliieerrss..
[[kk]] TThhee ccoonnssuullttaanntt sshhaallll pprroovviiddee aallll tteecchhnniiccaall ddooccuummeennttss ffoorr lliiaassiioonniinngg
aassssiissttaannccee wwiitthh ssttaattuuttoorryy aauutthhoorriittiieess lliikkee RR&&BB,, SSPPCCBB ((SSttaattee
PPoolllluuttiioonn CCoonnttrrooll BBooaarrdd)),, FFoorreesstt aauutthhoorriittiieess,,iirrrriiggaattiioonn,, CCCCOOEE ((CChhiieeff
CCoonnttrroolllleerr ooff EExxpplloossiivveess)) ffoorr oobbttaaiinniinngg vvaarriioouuss ssttaattuuttoorryy
ppeerrmmiissssiioonnss..
[[ll]] PPrreeppaarraattiioonn ooff TTeennddeerr DDooccuummeennttss,, iinnvviittee bbiiddss,, eevvaalluuaattiioonn ooff uunn--
pprriicceedd aanndd pprriiccee bbiiddss,, rreeccoommmmeennddaattiioonn ffoorr aawwaarrdd ooff jjoobb aass ppeerr
GGAAIILL''ss CC&&PP PPrroocceedduurree,, aassssiissttaannccee dduurriinngg nneeggoottiiaattiioonnss iiff ssiittuuaattiioonn
aarriisseess.. PPrreeppaarraattiioonn ooff LLeetttteerrss ooff IInntteenntt,, WWoorrkk OOrrddeerrss // PPuurrcchhaassee
OOrrddeerrss,, CCoonnttrraacctt DDooccuummeennttss // AAggrreeeemmeennttss,, PPuurrcchhaassee RReeqquuiissiittiioonnss
((PPRR''ss))..
[[mm]] TTeennddeerriinngg && OOrrddeerriinngg,, iinncclluuddiinngg PPuurrcchhaassee ooff aallll eeqquuiippmmeennttss aanndd
mmaatteerriiaallss,, CCuussttoommss CClleeaarraannccee aanndd TTrraannssppoorrttaattiioonn ooff mmaatteerriiaallss //
eeqquuiippmmeennttss ttoo ssiittee,, eettcc..
[[nn]] IInnssppeeccttiioonn // EExxppeeddiittiinngg ooff eeqquuiippmmeennttss // mmaatteerriiaallss bbeeiinngg
mmaannuuffaaccttuurreedd bbyy vveennddoorrss iinncclluuddiinngg ccoonnttrraaccttoorr--ssuupppplliieedd iitteemmss..
[[oo]] MMaannaaggeemmeenntt ooff CCoonnssttrruuccttiioonn SSttoorreess aanndd SSttoorreess AAccccoouunnttiinngg..
[[pp]] CCoonnssttrruuccttiioonn MMaannaaggeemmeenntt && SSuuppeerrvviissiioonn
[[qq]] QQuuaalliittyy AAssssuurraannccee aanndd QQuuaalliittyy CCoonnttrrooll..
[[rr]] PPrroojjeecctt CCoommmmiissssiioonniinngg..
[[ss]] RReevviieeww aanndd aapppprroovvaall ooff ''AAss--BBuuiilltt DDooccuummeennttss // DDrraawwiinnggss''..
[[tt]] PPrroojjeecctt CCoosstt CCoonnttrrooll,, MMaannaaggeemmeenntt && MMoonniittoorriinngg..
[[uu]] CCoonnssttrruuccttiioonn ssuuppeerrvviissiioonn iinncclluuddiinngg cceerrttiiffiiccaattiioonn ooff ccoonnttrraaccttoorr’’ss
bbiillllss..
[[vv]] RRiisskk MMaannaaggeemmeenntt ooff tthhee PPrroojjeecctt aalloonngg wwiitthh ddeettaaiilleedd RRiisskk AAnnaallyyssiiss..
TThhee RRiisskk MMaannaaggeemmeenntt PPllaann ((RRMMPP)) && DDiissaasstteerr MMaannaaggeemmeenntt PPllaann
((DDMMPP)) aarree aallssoo ttoo bbee pprreeppaarreedd bbyy tthhee CCoonnssuullttaanntt..
[[ww]] HHeeaalltthh && SSaaffeettyy MMaannaaggeemmeenntt..
[[xx]] PPrroojjeecctt CClloosseeoouutt..
33.. SSCCOOPPEE OOFF CCUURRRREENNTT PPRROOJJEECCTT
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 74 of 154
SSccooppee uunnddeerr tthhee ccuurrrreenntt pprroojjeecctt iiss aass ffoolllloowwss::
LLaayyiinngg ooff 1100"" ddiiaammeetteerr,, aapppprrooxx.. 44..66 kkmmss.. PPiippeelliinnee ffrroomm KKeessaannaappaallllii((WWeesstt)) ttoo
PPoonnnnaammaannddaa ((iinn tthhee ssaammee RRooUU ppaarraalllleell ttoo eexxiissttiinngg 1122”” ddiiaa ppiippeelliinnee 55 mmttrrss..
aappaarrtt)) aalloonnggwwiitthh hhooookk--uupp wwiitthh ccrreeaattiioonn ooff nneeww tteerrmmiinnaall ffaacciilliittiieess aatt
KKeessaannaappaallllii((WW)) aanndd uuppggrraaddaattiioonn ooff eexxiissttiinngg PPoonnnnaammaannddaa aanndd hhooookk--uupp wwiitthh
eexxiissttiinngg ssttaattiioonn ppiippiinngg nneettwwoorrkk aatt PPoonnnnaammaannddaa.. SScchheemmaattiicc iinnddiiccaattiinngg eexxiissttiinngg
ppiippeelliinnee ffaacciilliittiieess && pprrooppoosseedd nneeww ffaacciilliittiieess ffoorr ssuuppppllyyiinngg NNaattuurraall GGaass iiss aass
uunnddeerr::
44.. SSAALLIIEENNTT DDEETTAAIILLSS::
44..11 PPiippeelliinneess::
[[ii]] LLaayyiinngg aanndd iinnssttaallllaattiioonn ooff 1100"" xx 44..55 kkmmss.. ppiippeelliinnee aanndd aassssoocciiaatteedd
ffaacciilliittiieess..
[[iiii]] TThhee ssccrraappeerr LLaauunncchheerr,, RReecceeiivveerr aanndd aassssoocciiaatteedd ffaacciilliittiieess wwoouulldd bbee
pprroovviiddeedd aatt ssuuiittaabbllee ddiissttaanncceess ttoo ffaacciilliittaattee aallll kkiinnddss ooff PPiiggggiinngg
iinncclluuddiinngg iinntteelllliiggeenntt ppiiggggiinngg..
[[iiiiii]] TThhee ppiippeelliinnee wwiillll bbee pprrootteecctteedd bbyy 33--LLaayyeerr PPEE eexxtteerrnnaall ccooaattiinngg,,
iinntteerrnnaall eeppooxxyy ccooaattiinngg aanndd iimmpprreesssseedd ccuurrrreenntt ccaatthhooddiicc pprrootteeccttiioonn
ssyysstteemm
[[iivv]] TThhee sseeccttiioonnaalliizziinngg vvaallvveess wwoouulldd bbee pprroovviiddeedd iinn aaccccoorrddaannccee wwiitthh tthhee
rreeqquuiirreemmeennttss ooff tthhee ccooddee iinn oorrddeerr ttoo iissoollaattee vvaarriioouuss sseeccttiioonnss ooff tthhee
ppiippeelliinnee.. TThheessee vvaallvveess wwiillll bbee ffuullll bboorree bbaallll vvaallvveess wwiitthh rreemmoottee
aaccttuuaatteedd aanndd mmaannuuffaaccttuurreedd iinn aaccccoorrddaannccee wwiitthh AAPPII--66DD oorr ootthheerr
eeqquuiivvaalleenntt ccooddee..
[[vv]] TThhee iinnssuullaattiinngg jjooiinnttss wwoouulldd bbee pprroovviiddeedd aatt ttrraannssiittiioonn ppooiinntt ooff aabboovvee
ggrroouunndd aanndd uunnddeerrggrroouunndd ppoorrttiioonn ooff tthhee ppiippeelliinnee ffoorr eelleeccttrriiccaall
iissoollaattiioonn..
[[vvii]] AAllll ppiippeelliinneess aanndd aassssoocciiaatteedd ssyysstteemmss wwoouulldd bbee ddeessiiggnneedd,, ccoonnssttrruucctteedd
aanndd tteesstteedd aass ppeerr llaatteesstt eeddiittiioonn ooff AASSMMEE BB3311..88 aanndd ootthheerr rreelleevvaanntt
aapppplliiccaabbllee ccooddeess..
44..22 DDiissppaattcchh TTeerrmmiinnaall::
TThhee DDiissppaattcchh TTeerrmmiinnaall wwiillll bbee llooccaatteedd aatt KKeessaannaappaallllii((WW)).. FFoolllloowwiinngg sshhaallll bbee
bbrrooaaddllyy pprroovviiddeedd::
((ii)) PPiigg llaauunncchhiinngg aarrrraannggeemmeenntt..
((iiii)) FFiilltteerriinngg aanndd PPrreessssuurree rreedduuccttiioonn,, iiff rreeqquuiirreedd..
((iiiiii)) MMeetteerriinngg ffaacciilliittiieess,, iiff rreeqquuiirreedd..
((iivv)) TTeerrmmiinnaall wwoorrkkss –– bboouunnddaarryy wwaallll,, ccoonnttrrooll bbuuiillddiinngg ((ppoottaa ccaabbiinn // cciivviill
ssttrruuccttuurree)),, sseeccuurriittyy bbooootthh,, ppaavveemmeenntt,, aapppprrooaacchh rrooaaddss eettcc..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 75 of 154
((vv)) AAllll vvaallvveess aass rreeqquuiirreedd ffoorr tthhee tteerrmmiinnaallss..
44..33 RReecceeiipptt tteerrmmiinnaall::
GGaass RReecceeiipptt TTeerrmmiinnaall wwiillll bbee aatt GGAAIILL--PPoonnnnaammaannddaa tteerrmmiinnaall.. FFoolllloowwiinngg sshhaallll
bbee bbrrooaaddllyy pprroovviiddeedd::
((ii)) PPiigg rreecceeiivviinngg aarrrraannggeemmeenntt..
((iiii)) FFiilltteerriinngg aanndd PPrreessssuurree rreedduuccttiioonn,, iiff rreeqquuiirreedd..
((iiiiii)) TTaapp--ooffff ffoorr NNeeaarrbbyy CCoonnssuummeerrss
((iivv)) MMeetteerriinngg ffaacciilliittiieess,, iiff rreeqquuiirreedd..
((vv)) TTeerrmmiinnaall wwoorrkkss –– bboouunnddaarryy wwaallll,, ppaavveemmeenntt,, aapppprrooaacchh rrooaaddss eettcc..
((vvii)) AAllll vvaallvveess aass rreeqquuiirreedd ffoorr tthhee tteerrmmiinnaallss..
44..44 TTeelleeccoommmmuunniiccaattiioonn && SSCCAADDAA::
OOppttiiccaall FFiibbeerr CCaabbllee bbaasseedd tteelleeccoommmmuunniiccaattiioonn ssyysstteemm sshhaallll bbee llaaiidd aalloonngg tthhee
pprrooppoosseedd ppiippeelliinnee rroouuttee.. TThhee nneeww ssyysstteemm sshhaallll bbee ddeessiiggnneedd ssuuiittaabbllyy aass ppeerr
llaatteesstt tteecchhnnoollooggiieess iinn tteelleeccoomm // SSCCAADDAA ssyysstteemm..
44..55 AAddvvaanncceedd AAccttiioonnss TTaakkeenn bbyy GGAAIILL::
((ii)) TThhee ppiippeess aarree aallrreeaaddyy wwiitthh GGAAIILL aanndd iitt hhaass bbeeeenn ddeecciiddeedd ffoorr 1100iinncchh ddiiaa
ppiippeelliinnee.. TThhee ppiippeess aarree aatt GGAAIILL--VViizzaagg.. PPMMCC sshhaallll ttaakkee rreessppoonnssiibbiilliittyy ooff
ttrraannssppoorrttiinngg ttoo ssiittee aanndd tthheeiirr rreeccoonncciilliiaattiioonn..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 76 of 154
CCOONNSSUULLTTAANNTT’’SS SSCCOOPPEE OOFF WWOORRKK
55.. EENNGGIINNEEEERRIINNGG::
55..11 PPrroocceessss DDeessiiggnn::
TThhiiss wwiillll ccoommpprriissee ooff bbuutt nnoott lliimmiitteedd ttoo tthhee ffoolllloowwiinngg aanndd ddeelliivveerreedd ttoo GGAAIILL
bbootthh iinn hhaarrdd aanndd ssoofftt ffoorrmmss::
[[ii]] PPrroocceessss DDeessiiggnn BBaassiiss iinncclluuddiinngg PPrroocceessss DDeessccrriippttiioonn,, OOppeerraattiioonn &&
CCoonnttrrooll PPhhiilloossoopphhyy
[[iiii]] EEqquuiippmmeenntt PPrroocceessss DDaattaasshheeeettss
[[iiiiii]] EEqquuiippmmeenntt LLiisstt
[[iivv]] PPrroocceessss FFllooww DDiiaaggrraammss
[[vv]] PPiippiinngg aanndd IInnssttrruummeennttaattiioonn DDiiaaggrraammss ((PP&&IIDD’’ss)),, HHAAZZOOPP SSttuuddyy
[[vvii]] IInnssttrruummeenntt LLiisstt aanndd DDaattaasshheeeettss
[[vviiii]] UUttiilliittiieess rreeqquuiirreemmeenntt aanndd tthheeiirr ssppeecciiffiiccaattiioonnss
[[vviiiiii]] PPiippiinngg MMaatteerriiaall SSppeecciiffiiccaattiioonnss
[[iixx]] LLiinnee SScchheedduullee
[[xx]] PPrroocceessss DDeessccrriippttiioonn
[[xxii]] OOppeerraattiioonn aanndd CCoonnttrrooll PPhhiilloossoopphhyy
55..22 PPiippeelliinnee // PPiippiinngg ((SSppeecciiffiiccaattiioonnss ffoorr aallll PPiippeelliinnee LLaayyiinngg // CCiivviill // MMeecchhaanniiccaall
aanndd RReellaatteedd WWoorrkkss))::
[[ii]] PPrreeppaarraattiioonn ooff DDeessiiggnn bbaassiiss..
[[iiii]] CCoommpplleettiioonn ooff AAlliiggnnmmeenntt SShheeeettss aanndd ootthheerr CCoonnssttrruuccttiioonn DDrraawwiinnggss
iinncclluuddiinngg tthhoossee ffoorr CCrroossssiinnggss aalloonngg tthhee PPiippeelliinnee rroouuttee..
[[iiiiii]] VVeerriiffyy//IInnssppeecctt SSppeecciiffiiccaattiioonnss ffoorr LLiinnee PPiippeess,, LLiinnee MMaatteerriiaallss aanndd
TTeerrmmiinnaall MMaatteerriiaallss..
[[iivv]] PPrreeppaarree TTeennddeerr SSppeecciiffiiccaattiioonnss ffoorr LLiinnee PPiippee TTrraannssppoorrttaattiioonn,, llaayyiinngg
aanndd ccoonnssttrruuccttiioonn,, tteerrmmiinnaallss,, HHDDDD CCrroossssiinnggss eettcc..
[[vv]] PPrreeppaarree EEqquuiippmmeenntt LLaayyoouuttss..
[[vvii]] PPrreeppaarree GGeenneerraall AArrrraannggeemmeenntt DDrraawwiinnggss..
[[vviiii]] SSeeiissmmiicc AAnnaallyyssiiss..
[[vviiiiii]] PPeerrffoorrmm PPiippeelliinnee SSttrreessss AAnnaallyyssiiss ttoo ddeetteerrmmiinnee tthhee ssyysstteemm fflleexxiibbiilliittyy..
[[iixx]] CCaarrrryy oouutt PPiippiinngg SSttrreessss aanndd FFlleexxiibbiilliittyy AAnnaallyyssiiss ffoorr tthhee SSttaattiioonn PPiippiinngg..
[[xx]] PPrreeppaarree MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPuurrcchhaassee RReeqquuiissiittiioonnss.. SSttaattiioonn
ppiippiinngg mmaatteerriiaallss –– vvaallvveess,, llaauunncchheerrss//rreecceeiivveerrss,, eettcc..
[[xxii]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 77 of 154
[[xx]] RReevviieeww VVeennddoorrss'' // CCoonnttrraaccttoorrss'' DDooccuummeennttss..
[[xxii]] PPrreeppaarree aallll tthhee PPiippeelliinnee // PPiippiinngg DDrraawwiinnggss rreeqquuiirreedd ffoorr CCoonnssttrruuccttiioonn..
[[xxiiii]] RReevviieeww ooff ssuurrvveeyy ccaarrrriieedd oouutt bbyy TThhiirrdd ppaarrttyy aaggeennccyy..
55..33 EElleeccttrriiccaall::
[[ii]] PPrreeppaarree DDeessiiggnn BBaassiiss
[[iiii]] PPrreeppaarree EElleeccttrriiccaall LLooaadd DDeettaaiillss ffoorr DDiissppaattcchh // RReecceeiivviinngg TTeerrmmiinnaallss //
hhiigghh mmaasstt lliigghhttiinngg aatt KKSSPP((WW)) aanndd PPoonnnnmmaannddaa
[[iiiiii]] CCaarrrryy oouutt CCoommppaarraattiivvee SSttuuddyy ffoorr vvaarriioouuss ttyyppeess ooff PPoowweerr SSoouurrcceess aatt
SSVV // CCPP SSttaattiioonnss..
[[iivv]] RReevviieeww SSooiill RReessiissttiivviittyy RReeppoorrttss pprreeppaarreedd bbyy tthhee CCoonnttrraaccttoorrss..
[[vv]] PPrreeppaarree SSppeecciiffiiccaattiioonnss ffoorr CCaatthhooddiicc PPrrootteeccttiioonn ssyysstteemm,, bbootthh TTCCPP((iiff
rreeqquuiirreedd)) && PPCCPP..
[[vvii]] PPrreeppaarree DDaattaasshheeeettss aanndd MMaatteerriiaall TTaakkee--OOffff..
[[vviiii]] PPrreeppaarree MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPuurrcchhaassee RReeqquuiissiittiioonnss..
[[vviiiiii]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..
[[iixx]] PPrreeppaarree TTeennddeerr SSppeecciiffiiccaattiioonnss ffoorr EElleeccttrriiccaall aanndd CCPP wwoorrkkss..
[[xx]] RReevviieeww VVeennddoorrss'' // CCoonnttrraaccttoorrss'' DDooccuummeennttss..
[[xxii]] PPrreeppaarree tthhee EElleeccttrriiccaall DDrraawwiinnggss ffoorr ccoonnssttrruuccttiioonn..
[[xx]] PPrreeppaarree AArreeaa CCllaassssiiffiiccaattiioonn DDrraawwiinngg..
55..44 MMeecchhnniiccaall::
[[ii]] PPrreeppaarree MMeecchhaanniiccaall DDeessiiggnn BBaassiiss –– tteerrmmiinnaall,, llaauunncchheerrss// rreecceeiivveerrss,,
bbaallll vvaallvveess eettcc..
[[iiii]] PPrreeppaarree EEqquuiippmmeenntt DDaattaasshheeeettss aanndd MMaatteerriiaall TTaakkee--OOffff..
[[iiiiii]] PPrreeppaarree MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPuurrcchhaassee RReeqquuiissiittiioonnss..
[[iivv]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..
[[vv]] PPrreeppaarree TTeennddeerr SSppeecciiffiiccaattiioonnss ffoorr MMeecchhaanniiccaall WWoorrkkss..
[[vvii]] RReevviieeww VVeennddoorrss'' // CCoonnttrraaccttoorrss'' DDooccuummeennttss..
[[vviiii]] LLaayyoouutt,, GGeenneerraall AArrrraannggeemmeenntt DDrraawwiinnggss aanndd DDeessiiggnn ooff vvaarriioouuss
PPiippiinngg vvaarriioouuss SSttaattiioonnss lliikkee IIPP // SSVV //DDeessppaattcchh // RReecceeiipptt SSttaattiioonnss
[[vviiiiii]] DDaattaasshheeeettss ffoorr aallll AAcccceessssoorriieess // SSppaarreess rreellaatteedd ttoo IItteemmss // WWoorrkkss
ddeettaaiilleedd iinn tthhee TTeennddeerr DDooccuummeennttss..
[[iixx]] DDeettaaiilleedd TTeecchhnniiccaall SSppeecciiffiiccaattiioonnss ffoorr aallll MMeecchhaanniiccaall rreellaatteedd iitteemmss..
55..55 TTeelleeccoomm::
[[ii]] PPrreeppaarree DDeessiiggnn BBaassiiss iinncclluuddiinngg rreeqquuiirreemmeenntt ooff eexxiissttiinngg aanndd
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 78 of 154
pprrooppoosseedd TTeelleeccoomm SSyysstteemm bbaasseedd oonn ssiittee vviissiitt iiff rreeqquuiirreedd..
[[iiii]] PPrreeppaarree MMRR''ss // TTeecchhnniiccaall SSppeecciiffiiccaattiioonnss,, eettcc..
[[iiiiii]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..
[[iivv]] RReevviieeww VVeennddoorrss'' // CCoonnttrraaccttoorrss'' DDooccuummeenntt
[[vv]] PPrreeppaarree TTeelleeccoomm // SSCCAADDAA IInntteerrffaaccee DDrraawwiinnggss // DDooccuummeennttss..
[[vvii]] RReevviieeww aanndd AApppprroovvee aallll EEnnggiinneeeerriinngg aanndd FFAATT DDooccuummeennttss..
[[vviiii]] PPrreeppaarree FFAATT // SSAATT PPrroocceedduurree..
[[vviiiiii]] CCaarrrryy oouutt FFaaccttoorryy AAcccceeppttaannccee TTeessttiinngg..
[[iixx]] TTrraaiill RRuunn ooff tthhee SSyysstteemm..
[[xx]] PPrreeppaarree DDrraawwiinngg RReeqquuiirreemmeenntt ffoorr CCoonnssttrruuccttiioonn..
[[xxii]] OOvveerraallll PPaacckkaaggee SSuuppeerrvviissiioonn aanndd CCoommmmiissssiioonniinngg ooff TTeelleeccoomm SSyysstteemm
aanndd IInntteeggrraattiioonn..
[[xxiiii]] CCaarrrryy oouutt SSiittee AAcccceeppttaannccee TTeessttiinngg..
[[xxiiiiii]] CCoooorrddiinnaattiioonn aanndd SSuuppeerrvviissiioonn dduurriinngg IInnssttaallllaattiioonn aanndd
CCoommmmiissssiioonniinngg..
55..66 IInnssttrruummeennttaattiioonn::
[[ii]] RReevviieeww PP&&IIDD''ss aanndd CCoonnttrrooll PPhhiilloossoopphhyy ffoorr SSCCAADDAA ccoommppaattiibbiilliittyy
aanndd AAPPPPSS rreeqquuiirreemmeenntt
[[iiii]] RReevviieeww IInnssttrruummeennttaattiioonn,, CCiivviill WWoorrkkss,, CCoommppoossiittee TTeennddeerrss,, EElleeccttrriiccaall,,
CCPP aanndd TTeelleeccoomm SSyysstteemmss ttoo eennssuurree tthhaatt SSCCAADDAA && AAPPPPSS
rreeqquuiirreemmeennttss aarree mmeett..
[[iiiiii]] PPrreeppaarree DDeessiiggnn BBaassiiss..
[[iivv]] FFiinnaalliizzee IInnssttrruummeenntt DDaattaasshheeeettss aanndd pprreeppaarree MMaatteerriiaall TTaakkee--ooffff..
[[vv]] PPrreeppaarree mmaattcchhiinngg IInnssttrruummeennttaattiioonn aanndd SSCCAADDAA PPhhiilloossoopphhyy..
[[vvii]] PPrreeppaarree SSyysstteemm SSppeecciiffiiccaattiioonnss,, MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPuurrcchhaassee
RReeqquuiissiittiioonnss..
[[vviiii]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..
[[vviiiiii]] PPrreeppaarree FFAATT aanndd SSAATT TTeesstt PPllaannss aanndd PPrroocceedduurree DDooccuummeennttss..
[[iixx]] PPrreeppaarree DDrraawwiinnggss rreeqquuiirreedd ffoorr CCoonnssttrruuccttiioonn..
[[xx]] PPrroovviiddee aassssiissttaannccee dduurriinngg IInntteeggrraattiioonn aanndd CCoommmmiissssiioonniinngg ooff
SSCCAADDAA // AAPPPPSS SSyysstteemm..
[[xxii]] PPrreeppaarree IInnssttrruummeennttaattiioonn && SSCCAADDAA IInntteerrffaaccee DDrraawwiinnggss //
DDooccuummeennttss..
55..77 GGeenneerraall CCiivviill::
[[ii]] PPrreeppaarree tthhee DDeessiiggnn BBaassiiss iinncclluuddiinngg rreeqquuiirreemmeennttss ffoorr FFiirree FFiigghhttiinngg
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 79 of 154
aanndd SSaaffeettyy aassppeeccttss..
[[iiii]] PPrreeppaarree PPlloott PPllaannss ffoorr DDiissppaattcchh // RReecceeiivviinngg TTeerrmmiinnaallss,, SSVV''ss // IIPP''ss //
CCPP SSttaattiioonnss..
[[iiiiii]] PPrreeppaarree AArreeaa DDrraawwiinnggss..
[[iivv]] PPrreeppaarree MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPuurrcchhaassee RReeqquuiissiittiioonnss..
[[vv]] PPrreeppaarree MMaatteerriiaall TTaakkee--OOffff..
[[vvii]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..
[[vviiii]] PPrreeppaarree TTeennddeerr SSppeecciiffiiccaattiioonnss ffoorr TTooppooggrraapphhiiccaall SSuurrvveeyyss aanndd
ggeenneerraall CCiivviill WWoorrkkss..
[[vviiiiii]] RReevviieeww VVeennddoorrss'' // CCoonnttrraaccttoorrss'' DDooccuummeennttss..
[[iixx]] PPrreeppaarree && iissssuuee DDrraawwiinnggss rreeqquuiirreedd ffoorr CCoonnssttrruuccttiioonn iinncclluuddiinngg
FFoouunnddaattiioonn DDrraawwiinnggss..
[[xx]] AAllll CCiivviill wwoorrkkss rreellaatteedd wwiitthh IInntteerrmmeeddiiaattee PPiiggggiinngg SSttaattiioonnss ((IIPP)) //
CCaatthhooddiicc PPrrootteeccttiioonn SSttaattiioonnss ((CCPP)),, DDiissppaattcchh // RReecceeiivviinngg SSttaattiioonnss aanndd
SSeeccttiioonnaalliizziinngg VVaallvvee SSttaattiioonnss ((SSVV)).. AAllll CCiivviill ccoonnssttrruuccttiioonn wwoorrkkss
rreellaatteedd ttoo IIPP // CCPP //SSVV // DDiissppaattcchh // RReecceeiipptt SSttaattiioonnss aarree ttoo bbee iinncclluuddeedd
bbyy tthhee PPMMCC iinn tthhee wwoorrkk ppaacckkaaggee ooff ccoommppoossiittee PPiippeelliinnee LLaayyiinngg
CCoonnttrraacctt..
55..88 AArrcchhiitteeccttuurree::
[[ii]] PPrreeppaarree AArrcchhiitteeccttuurraall DDrraawwiinnggss ffoorr SSuubb--ssttaattiioonn,, CCoonnttrrooll RRoooomm,,
AAddmmiinniissttrraattiivvee BBuuiillddiinngg,, eettcc..
[[iiii]] PPrreeppaarree MMaatteerriiaall TTaakkee--OOffff..
[[iiiiii]] PPrreeppaarree TTeennddeerr SSppeecciiffiiccaattiioonnss..
[[iivv]] OOvveerraallll PPlloott PPllaann ooff tthhee SSVV // IIPP // CCPP // DDeessppaattcchh // RReecceeiipptt SSttaattiioonnss..
[[vv]] AArrcchhiitteeccttuurraall DDrraawwiinnggss ffoorr vvaarriioouuss BBuuiillddiinnggss aatt CCPP // IIPP // SSVV //
DDeessppaattcchh // RReecceeiipptt SSttaattiioonnss..
[[vvii]] SSiittee GGrraaddiinngg PPllaann aanndd llaayyoouutt ooff rrooaaddss // ssttoorrmm--wwaatteerr ddiissppoossaall //
sseewwaaggee ddiissppoossaall aatt aabboovvee llooccaattiioonnss..
[[vviiii]] FFiirree--ffiigghhttiinngg ffaacciilliittiieess aatt DDiissppaattcchh // RReecceeiipptt SSttaattiioonnss aanndd ootthheerr
llooccaattiioonnss..
[[vviiiiii]] DDeettaaiilleedd TTeecchhnniiccaall SSppeecciiffiiccaattiioonnss ffoorr EEqquuiippmmeenntt ffoouunnddaattiioonnss,, rrooaaddss,,
ddrraaiinnss,, ccoommppoouunnddss wwaallll,, eettcc..
[[iixx]] MMTTOO aanndd MMRR ffoorr aallll iitteemmss..
55..99 SSttrruuccttuurraall::
[[ii]] PPrreeppaarree DDeessiiggnn BBaassiiss..
[[iiii]] PPrreeppaarree LLaayyoouutt DDrraawwiinnggss ffoorr BBuuiillddiinnggss..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 80 of 154
[[iiiiii]] PPrreeppaarree MMaatteerriiaall TTaakkee--OOffff..
[[iivv]] PPrreeppaarree SSppeecciiffiiccaattiioonnss ffoorr SSttrruuccttuurraall WWoorrkkss..
[[vv]] PPrreeppaarree DDrraawwiinnggss rreeqquuiirreedd ffoorr CCoonnssttrruuccttiioonn..
55..1100 SSCCAADDAA // AAPPPPSS::
[[ii]] PPrreeppaarree DDeessiiggnn BBaassiiss..
[[iiii]] PPrreeppaarree MMRR''ss // TTeecchhnniiccaall SSppeecciiffiiccaattiioonnss,, DDrraawwiinnggss,, IInnssttrruummeennttaattiioonn
AAddeeqquuaaccyy RReeppoorrtt ffoorr AAPPPPSS..
[[iiiiii]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..
[[iivv]] RReevviieeww aanndd AApppprroovvee ooff aallll EEnnggiinneeeerriinngg // FFAATT DDooccuummeennttss..
[[vv]] CCaarrrryy oouutt SSCCAADDAA // AAPPPPSS PPrroojjeecctt MMaannaaggeemmeenntt aaccttiivviittiieess..
[[vvii]] CCaarrrryy oouutt FFaaccttoorryy AAcccceeppttaannccee TTeessttiinngg
[[vviiii]] PPrreeppaarree CCaabbllee SScchheedduullee aanndd TTeerrmmiinnaattiioonn DDrraawwiinngg ffoorr SSCCAADDAA..
[[vviiiiii]] CCaarrrryy oouutt SSiittee AAcccceeppttaannccee TTeessttiinngg..
[[iixx]] CCaarrrryy oouutt ssiittee // CCoonnssttrruuccttiioonn SSuuppeerrvviissiioonn..
[[xx]] CCoommmmiissssiioonniinngg..
[[xxii]] CCoo--oorrddiinnaattee wwiitthh IInnssttrruummeennttaattiioonn,, CCiivviill,, CCoommppoossiittee WWoorrkk,, EElleeccttrriiccaall,,
CCPP && TTeelleeccoomm SSyysstteemm VVeennddoorrss ffoorr oovveerraallll SSCCAADDAA // AAPPPPSS
rreeqquuiirreemmeenntt aanndd CCoommmmiissssiioonniinngg..
55..1111 SSaaffeettyy::
[[ii]] PPMMCC wwiillll bbee rreessppoonnssiibbllee ffoorr ccaarrrryyiinngg oouutt tthhee HHAAZZOOPP ssttuuddyy dduurriinngg
ddeettaaiill eennggiinneeeerriinngg,, ccoonnssttrruuccttiioonn && ccoommmmiissssiioonniinngg aanndd eennssuurree tthhaatt aallll
ddeessiiggnn cchhaannggeess rreeqquuiirreedd ttoo bbee iinnccoorrppoorraatteedd dduurriinngg ccoonnssttrruuccttiioonn
hhaavvee bbeeeenn ttaakkeenn ccaarree..
[[iiii]] PPMMCC wwiillll bbee rreessppoonnssiibbllee ffoorr pprreeppaarriinngg tthhee DDiissaasstteerr MMaannaaggeemmeenntt
PPllaann,, OOnnssiittee aanndd OOffffssiittee EEmmeerrggeennccyy AAccttiioonn PPllaann,, SSaaffeettyy MMaannuuaall,, aanndd
ssuubbmmiitt tthhee ssaammee ttoo GGAAIILL bbeeffoorree tthhee ccoommmmeenncceemmeenntt ooff
ccoommmmiissssiioonniinngg tthhee ppiippeelliinnee ssyysstteemm.. TThhee PPMMCC iiss aallssoo rreeqquuiirreedd ttoo
pprreeppaarree SSaaffeettyy PPaammpphhlleettss,, DDoo''ss && DDoonn''ttss,, eettcc.. rreeqquuiirreedd ttoo bbee
ddiissttrriibbuutteedd ttoo ssttaattuuttoorryy aauutthhoorriittiieess,, vviillllaaggeerrss dduurriinngg ccoonnssttrruuccttiioonn..
[[iiiiii]] PPMMCC ttoo ccaarrrryy oouutt EEnnvviirroonnmmeenntt IImmppaacctt AAsssseessssmmeenntt ((EEIIAA)) aanndd
pprreeppaarree EEnnvviirroonnmmeenntt MMaannaaggeemmeenntt PPllaann ((EEMMPP)) aass ppeerr pprreevvaaiilliinngg
eennvviirroonnmmeenntt pprrootteeccttiioonn aacctt ffoorr oobbttaaiinniinngg ssttaattuuaarryy cclleeaarraanncceess..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 81 of 154
66.. PPRROOCCUURREEMMEENNTT SSEERRVVIICCEESS
66..11 PPuurrcchhaassee::
TThhee PPMMCC wwiillll bbee rreessppoonnssiibbllee ffoorr pprreeppaarriinngg aallll tthhee TTeennddeerr DDooccuummeennttss ffoorr aallll
tthhee PPuurrcchhaassee aanndd WWoorrkk OOrrddeerrss.. TThhee TTeennddeerr DDooccuummeennttss wwiillll iinnccoorrppoorraattee tthhee
GGAAIILL''ss ssttaannddaarrddiizzeedd ""GGeenneerraall CCoonnddiittiioonnss ooff CCoonnttrraacctt [[GGCCCC –– GGooooddss //GGCCCC ––
WWoorrkkss ((aass aapppplliiccaabbllee))]]"" aanndd ""IInnssttrruuccttiioonnss ttoo BBiiddddeerrss"" wwhhiicchh wwiillll bbee pprroovviiddeedd
bbyy GGAAIILL ttoo PPMMCC.. TThhee tteennddeerriinngg wwiillll bbee ddoonnee ssttrriiccttllyy aass ppeerr GGAAIILL’’ss ""CCoonnttrraaccttss
aanndd PPrrooccuurreemmeenntt PPrroocceedduurree"" aanndd nnoottiiffiiccaattiioonnss // gguuiiddeelliinneess bbeeiinngg iissssuueedd bbyy
MMiinniissttrryy,, GGoovveerrnnmmeenntt ooff IInnddiiaa,, CCeennttrraall VViiggiillaannccee CCoommmmiissssiioonn,, eettcc.. ffrroomm ttiimmee
ttoo ttiimmee.. TThhee eennvviissaaggeedd aaccttiivviittiieess iinncclluuddee::
[[11]] PPrreeppaarriinngg aanndd ffllooaattiinngg ooff TTeennddeerr IInnqquuiirriieess ((iinn nneewwssppaappeerrss,, GGAAIILL''ss
wweebbssiittee,, PPMMCC''ss wweebbssiittee,, eettcc..)) iinncclluuddiinngg ffoorrmmuullaattiioonn ooff BBiidd
EEvvaalluuaattiioonn CCrriitteerriiaa ((BBEECC)).. AAllll tteennddeerrss aarree rreeqquuiirreedd ttoo bbee ppuubblliisshheedd
oonn GGAAIILL''ss // PPMMCC''ss wweebbssiittee.. AAllll rreeqquuiissiittee hheellpp ffrroomm GGAAIILL--
RRaajjaahhmmuunnddrryy CC&&PP sshhaallll bbee pprroovviiddeedd..
[[22]] IIssssuuee IICCBB // ddoommeessttiicc eennqquuiirriieess ttoo tthhee bbiiddddeerrss..
[[33]] CCaarrrryy oouutt tteecchhnnoo--ccoommmmeerrcciiaall eevvaalluuaattiioonn ooff bbiiddss aanndd pprreeppaarree tthhee
ppuurrcchhaassee rreeccoommmmeennddaattiioonn iinnlliinnee wwiitthh GGAAIILL''ss pprroocceedduurreess..
[[44]] CCoonnssuullttaanntt sshhaallll mmaakkee eeffffoorrttss ffoorr ggeettttiinngg mmaaxxiimmuumm nnuummbbeerr ooff
tteecchhnnoo--ccoommmmeerrcciiaallllyy vvaalliidd ooffffeerrss ((aatt lleeaasstt 33)) ffoorr aallll mmaatteerriiaall
rreeqquuiissiittiioonnss // tteennddeerrss ttoo eennssuurree pprrooppeerr ccoommppeettiittiioonn.. HHoowweevveerr,, ffoorr
eexxcceeppttiioonnaall ccaasseess wwhheerree tthhiiss iiss nnoott ppoossssiibbllee ccoonnssuullttaanntt wwiillll pprroovviiddee
aapppprroopprriiaattee rreeaassoonniinngg // jjuussttiiffiiccaattiioonn ffoorr nnoott eennssuurriinngg tthhee ssaammee..
[[55]] PPrreeppaarree ddrraafftt PPuurrcchhaassee OOrrddeerr // WWoorrkk OOrrddeerr ffoorr iissssuuaannccee bbyy GGAAIILL..
[[66]] PPrreeppaarree ppuurrcchhaassee ssttaattuuss rreeppoorrttss aanndd mmoonniittoorr pprrooccuurreemmeenntt pprrooggrreessss..
[[77]] AApppprroovvaall ooff ssuupppplliieerr ddrraawwiinnggss // ddeessiiggnnss iinn ttiimmee..
[[88]] EEnnssuurriinngg pprrooppeerr ttrraannssppoorrttaattiioonn,, llooggiissttiiccss aanndd mmaatteerriiaall mmaannaaggeemmeenntt..
[[99]] MMaasstteerr VVeennddoorr LLiisstt:: AA mmaasstteerr vveennddoorr lliisstt iiss ttoo bbee pprreeppaarreedd ffoorr
ssuuppppllyy ooff aallll mmaatteerriiaallss aanndd eeqquuiippmmeennttss,, ccoonnttrraaccttss.. TThhiiss lliisstt wwiillll bbee
bbaasseedd oonn ccoonnssuullttaanntt''ss eexxppeerriieennccee wwiitthh IInnddiiaann aanndd wwoorrllddwwiiddee
vveennddoorrss.. EEffffoorrttss wwiillll bbee mmaaddee ttoo iinncclluuddee aass mmaannyy IInnddiiaann vveennddoorrss aass
ppoossssiibbllee.. VVeennddoorrss oonn hhoolliiddaayy lliisstt ooff GGAAIILL // CCoonnssuullttaanntt dduurriinngg
tteennddeerriinngg wwiillll nnoott bbee ccoonnssiiddeerreedd..
[[1100]] WWaarrrraannttiieess aanndd GGuuaarraanntteeeess:: PPMMCC sshhaallll oobbttaaiinn ffrroomm tthhee vveennddoorrss //
ssuupppplliieerrss,, tthhee bbeesstt ppoossssiibbllee wwaarrrraannttiieess aanndd gguuaarraanntteeeess ccoovveerriinngg
wwoorrkkmmaannsshhiipp aanndd mmaatteerriiaallss ffoorr tthhee bbeenneeffiitt ooff tthhee oowwnneerr aanndd wwiillll
ttaakkee aallll sstteeppss ttoo eennssuurree tthhaatt ssuucchh wwaarrrraannttiieess aanndd gguuaarraanntteeeess aarree
eennffoorrcceedd ((ssaammee sshhaallll bbee wwiitthhiinn tthhee ffrraammeewwoorrkk ooff GGAAIILL''ss CC&&PP
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 82 of 154
PPrroocceedduurree)).. TThhee PPMMCC sshhaallll bbee ccoommpplleetteellyy rreessppoonnssiibbllee ffoorr aallll
wwaarrrraannttiieess // gguuaarraanntteeeess rreellaatteedd ttoo tthhee ddeessiiggnn && eennggiinneeeerriinngg bbeeiinngg
ddoonnee bbyy tthheemm..
[[1111]] EEnnqquuiirriieess:: TThhee PPMMCC sshhaallll aassssiiggnn aa cceennttrraall pprrooccuurreemmeenntt tteeaamm ttoo
mmaannaaggee aanndd ccoonndduucctt tthhee ppuurrcchhaassee ooff aallll eeqquuiippmmeennttss aanndd mmaatteerriiaallss..
EEnnqquuiirryy aaccttiivviittiieess sshhaallll bbee ccoonnttrroolllleedd bbyy tthhee ccoonnssuullttaanntt.. CCoonnssuullttaanntt
sshhaallll bbee rreessppoonnssiibbllee ffoorr iissssuuiinngg eennqquuiirriieess ttoo tthhoossee vveennddoorrss oonn
aapppprroovveedd vveennddoorr lliissttss,, eexxppeeddiittiinngg rreecceeiipptt ooff qquuoottaattiioonnss,, eevvaalluuaattiinngg
tthhee bbiiddss aanndd ssuubbmmiittttiinngg rreeccoommmmeennddaattiioonnss ttoo OOwwnneerr ffoorr aapppprroovvaall..
WWhhiillee tthhee eennqquuiirriieess aarree ffllooaatteedd bbyy PPMMCC,, iitt wwiillll bbee tthhee rreessppoonnssiibbiilliittyy
ooff tthhee PPMMCC ttoo iinnccoorrppoorraattee GGAAIILL''ss MMaatteerriiaall CCooddee aaggaaiinnsstt eeaacchh iitteemm..
FFoorr iinnccoorrppoorraattiinngg tthhee MMaatteerriiaall CCooddee tthhee PPMMCC wwiillll bbee ggiivveenn tthhee
GGAAIILL''ss MMaatteerriiaall CCooddee ddaattaabbaassee..
[[1122]] PPrreessss AAddvveerrttiisseemmeenntt ffeeee wwoouulldd bbee rreeiimmbbuurrsseedd ttoo tthhee PPMMCC iinncclluuddiinngg
sseerrvviiccee ttaaxx aass aapppplliiccaabbllee,, aanndd pprroocceeeeddss ooff tteennddeerr ffeeeess sshhaallll bbee
ffoorrwwaarrddeedd ttoo tthhee OOwwnneerr bbyy tthhee PPMMCC..
[[1133]] RReeaassoonnss ffoorr ccoosstt vvaarriiaattiioonn bbeettwweeeenn eessttiimmaatteedd ccoosstt ssuubbmmiitttteedd wwiitthh
rreeccoommmmeennddaattiioonn ffoorr pprriiccee bbiidd ooppeenniinngg aanndd oorrddeerr vvaalluuee..
[[1144]] TThhee ccyyccllee ttiimmee ffoorr ccoommpplleettiioonn ooff eeaacchh iinntteerrmmiitttteenntt aaccttiivviittyy ffoorr pprree--
oorrddeerriinngg // ppoosstt--oorrddeerriinngg wwiillll bbee mmaaiinnttaaiinneedd ssoo aass ttoo aacchhiieevvee ttiimmeellyy
ccoommpplleettiioonn ooff tthhee pprroojjeecctt aass ppeerr ttaarrggeetteedd ccoommpplleettiioonn sscchheedduullee..
[[1155]] HHoowweevveerr,, ttiimmeelliinneess ssppeecciiffiieedd aatt ffuuttuurree sseeccttiioonnss wwiillll bbee ffoolllloowweedd bbyy
tthhee PPMMCC.. TThhee ssaammee wwiillll bbee hhiigghhlliigghhtteedd iinn tthhee EExxeeccuuttiioonn PPllaann ttoo bbee
ssuubbmmiitttteedd bbyy PPMMCC..
[[1166]] CCuussttoomm cclleeaarraannccee aanndd ttrraannssppoorrttaattiioonn ooff mmaatteerriiaallss // eeqquuiippmmeennttss iiss
iinncclluuddeedd iinn ssccooppee ooff tthhee PPMMCC.. GGAAIILL sshhaallll ppaayy tthhee ccuussttoommss dduuttyy..
HHoowweevveerr tthhee cclleeaarriinngg,, ffoorrwwaarrddiinngg && ttrraannssppoorrttaattiioonn ooff tthhee mmaatteerriiaallss
// eeqquuiippmmeennttss sshhaallll bbee ccaarrrriieedd oouutt tthhrroouugghh GGAAIILL aapppprroovveedd // eennggaaggeedd
aaggeennccyy aanndd ccoossttss ooff ssaammee sshhaallll bbee rreeiimmbbuurrsseedd bbyy GGAAIILL aass ppeerr aaccttuuaall..
[[1177]] MMaatteerriiaall // PPuurrcchhaassee RReeqquuiissiittiioonnss ((MMRR // PPRR)) aarree ttoo bbee pprroocceesssseedd
tthhrroouugghh EERRPP ((SSAAPP)).. NNeecceessssaarryy hheellpp wwoouulldd bbee pprroovviiddeedd ttoo tthhee PPMMCC
ppeerrssoonnnneell..
[[1188]] CCoonnssuullttaanntt wwiillll pprreeppaarree MMRR iinn ssuucchh wwaayy tthhaatt ssuurrpplluuss ggeenneerraattiioonn iiss
mmiinniimmuumm.. MMiilleessttoonnee ffoorr tthhiiss wwiillll bbeeccoommee ppaayyaabbllee iiff tthhee ssuurrpplluuss
ggeenneerraattiioonn,, aass ppaarrtt ooff tthhee ttoottaall pprrooccuurreemmeenntt iiss 33%% oorr lleessss..
[[1199]] TThhee ccoonnssuullttaanntt sshhaallll ffoorrwwaarrdd tthhee bbiillllss ttoo GGAAIILL,, aafftteerr eenntteerriinngg iinn
GGAAIILL’’ss BBiillll WWaattcchh SSyysstteemm ((BBWWSS)),, dduullyy cceerrttiiffiieedd ffoorr ppaayymmeenntt,, wwiitthhiinn
tthhee ssttiippuullaatteedd ttiimmee ooff rreecceeiipptt.. AAssssiissttaannccee ooff GGAAIILL sshhaallll bbee pprroovviiddeedd..
66..22 MMaannuuffaaccttuurriinngg,, IInnssppeeccttiioonn && EExxppeeddiittiinngg::
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 83 of 154
[[11]] GGrraannttiinngg aapppprroovvaall ttoo aallll ddrraawwiinnggss // ddooccuummeennttss ssuubbmmiitttteedd bbyy
vveennddoorr ffoorr ssttaarrtt && dduurriinngg mmaannuuffaaccttuurriinngg wwiitthhiinn ttwwoo ((0022)) wweeeekkss ooff
tthhee ssuubbmmiissssiioonn ooff ddooccuummeenntt bbyy vveennddoorr // ccoonnttrraaccttoorr.. TThhee PPMMCC
sshhoouulldd eexxppeeddiittee ssuubbmmiissssiioonn ooff rreeqquuiirreedd ddrraawwiinnggss,, QQAAPP,, pprroocceedduurree,,
eettcc.. bbyy vveennddoorrss iinn oorrddeerr ttoo eexxppeeddiittee tthhee pprrooccuurreemmeenntt ooff mmaatteerriiaallss..
[[22]] PPrreeppaarree iinnssppeeccttiioonn aanndd eexxppeeddiittiinngg pprroocceedduurree..
[[33]] EEssttaabblliisshh vveennddoorrss mmaannuuffaaccttuurriinngg aanndd ddeelliivveerryy sscchheedduulleess..
[[44]] EExxppeeddiittee vveennddoorrss ffoorr ttiimmeellyy aaccttiioonn oonn ssuubb--ccoonnttrraacctteedd iitteemmss..
[[55]] QQuuaalliiffyy aanndd aapppprroovvee vveennddoorr''ss pprroocceedduurreess iinn ttiimmee ffoorr
mmaannuuffaaccttuurriinngg..
[[66]] CCaarrrryy oouutt MMaatteerriiaall iiddeennttiiffiiccaattiioonn aanndd mmaarrkkiinngg..
[[77]] CCaarrrryy oouutt iinnssppeeccttiioonn ooff aallll iitteemmss ddiirreeccttllyy ppuurrcchhaasseedd bbyy GGAAIILL // PPMMCC..
CCaarrrryy oouutt iinnssppeeccttiioonn ooff bboouugghhtt--oouutt iitteemmss ooff ccoonnttrraaccttoorrss'' ssuuppppllyy,, aass
ssppeecciiffiieedd eellsseewwhheerree iinn tthhee tteennddeerr..
[[88]] AAllll cchhaarrggeess ffoorr iinnssppeeccttiioonn // eexxppeeddiittiinngg iiss iinn tthhee ssccooppee ooff tthhee PPMMCC..
[[99]] CCaarrrryy oouutt IInnssppeeccttiioonn ooff iitteemmss pprrooppoosseedd ttoo bbee uusseedd ffrroomm GGAAIILL
ssuurrpplluuss ssttoorreess..
[[1100]] EEnnssuurree tthhaatt iitteemmss pprrooccuurreedd bbyy ccoonnttrraaccttoorrss aarree aacccceeppttaabbllee aass ppeerr PPOO
ssppeecciiffiiccaattiioonnss aanndd ssttaannddaarrddss..
[[1111]] CCaarrrryy oouutt iinnssppeeccttiioonn ooff tthhee iitteemmss pprrooccuurreedd tthhrroouugghh tthhee ccoonnttrraaccttoorrss
bbyy pprrooffeessssiioonnaallss ooff ccoonncceerrnneedd ddiisscciipplliinnee // ssyysstteemm..
[[1122]] CCaarrrryy oouutt iinnssppeeccttiioonn ooff tthhee iitteemmss pprrooccuurreedd tthhrroouugghh tthhee ccoonnttrraaccttoorrss
bbyy pprrooffeessssiioonnaallss ooff ccoonncceerrnneedd ddiisscciipplliinnee // ssyysstteemm..
[[1133]] WWiittnneessss ppeerrffoorrmmaannccee // aacccceeppttaannccee tteessttss aass aapppplliiccaabbllee..
[[1144]] PPMMCC sshhoouulldd eennssuurree tthhee ccoommpplliiaannccee ooff tthhee rreeqquuiirreemmeennttss ooff 33..22
cceerrttiiffiiccaattiioonn..
[[1155]] CCaarrrryy oouutt eexxppeeddiittiinngg tthhee ddeelliivveerriieess ooff mmaatteerriiaallss // eeqquuiippmmeennttss..
[[1166]] PPrreeppaarree ppeerriiooddiicc iinnssppeeccttiioonn aanndd eexxppeeddiittiinngg rreeppoorrttss..
[[1177]] TThhee ffoolllloowwiinngg sshhaallll bbee aapppplliiccaabbllee ffoorr IInnssppeeccttiioonn // ttoouurr oouuttssiiddee IInnddiiaa::
((aa)) SSttaaggee iinnssppeeccttiioonn wwiillll bbee ccaarrrriieedd oouutt sseelleeccttiivveellyy bbaasseedd oonn PPuurrcchhaassee
RReeqquuiissiittiioonn..
((bb)) FFoorr ccrriittiiccaall // mmaajjoorr iitteemmss ffiinnaall tteesstt iinncclluuddiinngg hhyyddrroo--tteessttss,, FFAATT,,
eettcc.. sshhaallll bbee wwiittnneesssseedd aanndd cceerrttiiffiieedd.. HHoowweevveerr,, ffoorr ccoommppoonneennttss,, nnoonn--
ccrriittiiccaall // mmiinnoorr eeqquuiippmmeennttss aanndd bbuullkk mmaatteerriiaallss aacccceeppttaannccee wwiillll bbee oonn
tthhee bbaassiiss ooff rreevviieeww ooff rreelleevvaanntt tteesstt cceerrttiiffiiccaatteess // aaccttuuaall iinnssppeeccttiioonn aass
ddeecciiddeedd bbyy tthhee iinnssppeeccttoorr iinn ccoonnssuullttaattiioonn wwiitthh GGAAIILL((CCrriittiiccaall // mmaajjoorr
iitteemmss mmaayy iinncclluuddee LLiinnee PPiippeess,, SSeeccttiioonnaalliizziinngg VVaallvveess,, UUllttrraassoonniicc
FFllooww MMeetteerrss,, MMeetteerriinngg SSkkiiddss,, eettcc..))..
((cc)) AAllll eexxppeennddiittuurreess sshhaallll bbee bboorrnnee bbyy tthhee ccoonnssuullttaanntt wwiitthhiinn tthhee
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 84 of 154
qquuootteedd pprriiccee..
((dd)) FFoorr GGAAIILL,, tthhee CCoonnssuullttaanntt iiss wwhhoollllyy aanndd ffuullllyy rreessppoonnssiibbllee ffoorr aallll
iinnssppeeccttiioonn dduurriinngg mmaannuuffaaccttuurriinngg aanndd ccoonnssttrruuccttiioonn ffoorr wwhhiicchh tthhee
ccoonnssuullttaanntt mmaayy iissssuuee nneecceessssaarryy cceerrttiiffiiccaatteess aass ddeeeemmeedd ffiitt.. AAllll ccoossttss ooff
tthhee iinnssppeeccttiioonn ooff ggooooddss bbeeffoorree ddeelliivveerryy ffrroomm tthhee vveennddoorr wwoorrkkss wwiillll
bbee bboorrnnee bbyy tthhee ccoonnssuullttaanntt aanndd iinncclluuddeedd iinn tthhee PPMMCC--ffeeee aass iinnddiiccaatteedd
aatt SSll..--((cc)) aabboovvee..
PPMMCC sshhaallll cceerrttiiffyy FFAATT aanndd SSAATT ooff vvaarriioouuss pprrooccuurreemmeenntt iitteemmss
bbeessiiddeess wwiittnneessssiinngg tthhee ssaammee..
AAllll aaccttiivviittiieess ppeerrttaaiinniinngg ttoo IInnssppeeccttiioonn aatt vveennddoorrss && ccoonnttrraaccttoorrss
wwoorrkkss ssiitteess sshhaallll bbee tthhee ccoommpplleettee rreessppoonnssiibbiilliittyy ooff tthhee PPMMCC.. PPMMCC iiss
rreeqquuiirreedd ttoo iissssuuee ffiinnaall ""IInnssppeeccttiioonn RReelleeaassee NNoottee"" aafftteerr iinnssppeeccttiioonn..
TThhee IInnssppeeccttiioonn aanndd tteesstt ppllaannss ffoorr mmaatteerriiaall aanndd ccoonnssttrruuccttiioonn ssiittee
aaccttiivviittiieess sshhaallll bbee ddeevveellooppeedd bbyy tthhee PPMMCC aanndd ggoott aapppprroovveedd ffrroomm tthhee
OOwwnneerr..
66..33 CCuussttoommss cclleeaarraannccee aanndd ttrraannssppoorrttaattiioonn::
CCuussttoommss cclleeaarraannccee aanndd ttrraannssppoorrttaattiioonn ooff mmaatteerriiaallss // eeqquuiippmmeennttss iiss iinncclluuddeedd iinn
ssccooppee ooff tthhee PPMMCC.. GGAAIILL sshhaallll ppaayy tthhee CCuussttoommss DDuuttyy.. HHoowweevveerr tthhee cclleeaarriinngg,,
ffoorrwwaarrddiinngg && ttrraannssppoorrttaattiioonn ooff tthhee mmaatteerriiaallss // eeqquuiippmmeennttss sshhaallll bbee ccaarrrriieedd oouutt
tthhrroouugghh GGAAIILL aapppprroovveedd // eennggaaggeedd aaggeennccyy aanndd ccoossttss ooff ssaammee sshhaallll bbee
rreeiimmbbuurrsseedd bbyy GGAAIILL aass ppeerr aaccttuuaall aanndd sseerrvviiccee ttaaxx aass aapppplliiccaabbllee..
66..44 CCoonnttrraaccttiinngg::
[[11]] PPrreeppaarree BBiidd EEvvaalluuaattiioonn CCrriitteerriiaa ((BBEECC)) && lliisstt ooff ccoonnttrraaccttoorrss ffoorr
vvaarriioouuss wwoorrkkss..
[[22]] PPrreeppaarree TTeennddeerr DDooccuummeennttss ffoorr aallll wwoorrkkss..
[[33]] RReelleeaassee ooff NNIITT ffoorr ppuubblliiccaattiioonn // iissssuuee EEnnqquuiirriieess ttoo ccoonnttrraaccttoorrss.. AAllll
EEnnqquuiirriieess aarree ttoo bbee ppuubblliisshheedd iinn tthhee wweebbssiitteess ooff GGAAIILL // PPMMCC..
[[44]] CCaarrrryy oouutt TTeecchhnniiccaall aanndd CCoommmmeerrcciiaall EEvvaalluuaattiioonn ooff BBiiddss aanndd
PPrreeppaarree RReeccoommmmeennddaattiioonnss..
[[55]] PPrreeppaarree FFOOAA // WWoorrkk OOrrddeerr..
[[66]] PPrreeppaarree CCoonnttrraacctt DDooccuummeennttss..
[[77]] PPrreeppaarree TTeennddeerriinngg SSttaattuuss RReeppoorrtt..
[[88]] TThhee ccoonnssuullttaanntt sshhaallll ffoollllooww GGAAIILL''ss CC&&PP PPrroocceedduurree,, GGCCCC,, IITTBB,, eettcc..
ffoorr aallll CCoonnttrraaccttss ((CCoonnssuullttaanntt bbeeffoorree ssuubbmmiittttiinngg tthhee bbiidd,, iiff ddeessiirreess ttoo
ssttuuddyy tthhee GGAAIILL''ss CC&&PP PPrroocceedduurree,, GGeenneerraall CCoonnddiittiioonnss ooff CCoonnttrraacctt &&
IInnssttrruuccttiioonnss ttoo BBiiddddeerrss ccaann rreeffeerr tthhee ccooppyy ooff ssaammee aatt GGAAIILL’’ss ooffffiiccee))..
66..55 CCoosstt EEnnggiinneeeerriinngg::
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 85 of 154
[[11]] PPrreeppaarree PPeerriiooddiicc CCoosstt SSttaattuuss RReeppoorrttss ((MMoonntthhllyy))..
[[22]] PPrreeppaarree MMRR aanndd ddeettaaiilleedd ccoosstt eessttiimmaatteess ffoorr bbiidd ccoommppaarriissoonn
ppuurrppoosseess..
[[33]] PPrreeppaarraattiioonn ooff aaccccuurraattee eessttiimmaatteess iinn ttiimmee ((bbaasseedd oonn ppaasstt ddaattaa //
CCPPWWDD bbaassiiss // MMaarrkkeett rraattee AAnnaallyyssiiss)) ffoorr pprrooccuurreemmeenntt iitteemmss aanndd
wwoorrkkss iiss aann iimmppoorrttaanntt aaccttiivviittyy iinn CCoosstt EEnnggiinneeeerriinngg.. OOwwnneerr llaayyss
ssttrroonngg eemmpphhaassiiss oonn aaccccuurraaccyy ooff ccoosstt eessttiimmaatteess aanndd pprriiccee ddiiffffeerreennccee
bbeeyyoonndd ((±±)) 1100%% sshhaallll ccaallll ffoorr aannaallyyssiiss.. IInn ccaassee ooff ddeevviiaattiioonn bbeettwweeeenn
ccoosstt eessttiimmaatteess && LL--11 pprriiccee bbiidd bbeeiinngg mmoorree tthhaann ((±±)) 1100%% nnoott bbaacckkeedd
bbyy jjuussttiiffiiaabbllee rreeaassoonnss aanndd nnoott bbeeyyoonndd tthhee ccoonnttrrooll ooff PPMMCC sshhaallll bbee
ttrreeaatteedd aass ddeeffiicciieennccyy ooff sseerrvviicceess bbyy PPMMCC..
[[44]] IInn ccaassee ooff tthhee ddeevviiaattiioonn bbeettwweeeenn ccoosstt eessttiimmaattee pprroovviiddeedd bbyy tthhee PPMMCC
aatt tthhee ttiimmee ooff bbiidd ssuubbmmiissssiioonn aanndd tthhee aaccttuuaall LL11--pprriiccee bbeeiinngg mmoorree
tthhaann ((±±)) 2200%%,, tthheenn rreeccoovveerryy sshhaallll bbee eeffffeecctteedd ffrroomm tthhee PPMMCC’’ss
ppaayymmeenntt aass bbeellooww::
LLeett tthhee aaccttuuaall aawwaarrddeedd ccoosstt ooff aa ppaarrttiiccuullaarr ppaacckkaaggee == YY
LLeett tthhee ttoottaall aawwaarrddeedd ccoosstt ooff aallll tthhee ppaacckkaaggeess iinn tthhee pprroojjeecctt == XX
TThheerreeffoorree rreeccoovveerryy ffoorr aa ppaacckkaaggee,, wwhheerree tthhee ccoosstt eessttiimmaattee ddeevviiaattiioonn
iiss mmoorree tthhaann ((±±)) 2200%% ddeevviiaattiioonn iiss ggiivveenn bbyy::
((YY // XX)) ** ((22%% ooff aawwaarrddeedd PPMMCC ccoosstt))
TThhuuss tthhee ppaayymmeenntt aaggaaiinnsstt tthhee mmiilleessttoonnee ffoorr ""AAccccuurraattee CCoosstt
EEssttiimmaattee"" mmeennttiioonneedd iinn ""PPaayymmeenntt TTeerrmmss"" ooff BBiidd DDooccuummeenntt sshhaallll bbee
mmaaddee oonnllyy aafftteerr oorrddeerr ppllaacceemmeenntt ooff aallll tthhee ppuurrcchhaassee // wwoorrkk
ppaacckkaaggeess,, aass tthhee vvaalluuee ooff XX ccaann bbee ddeetteerrmmiinneedd oonnllyy tthheenn..
[[55]] PPrroovviiddee aassssiissttaannccee iinn sseettttlliinngg aallll ccoommmmeerrcciiaall iissssuueess wwiitthh aallll tthhee
vveennddoorrss // ccoonnttrraaccttoorrss ttiillll tthhee ffiinnaall cclloosseeoouutt..
[[66]] FFoorrmmaatt ffoorr rreeppoorrttiinngg ccoosstt eessttiimmaatteess sshhaallll bbee ggiivveenn llaatteerr bbyy GGAAIILL..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 86 of 154
77.. CCOONNSSTTRRUUCCTTIIOONN::
77..11 CCoonnssttrruuccttiioonn MMaannaaggeemmeenntt::
[[11]] OOnnllyy oonnee sspprreeaadd.. TThhee pprroojjeecctt iiss vveerryy ccrriittiiccaall aanndd aallll eeffffoorrttss sshhaallll bbee
mmaaddee bbyy PPMMCC ttoo eennssuurree ppaarraalllleell jjoobbss aanndd ffaasstteerr ccoommpplleettiioonn ooff tthhee
wwoorrkk..
[[22]] PPrroovviiddiinngg ssppeecciiaalliizzeedd gguuiiddaannccee aanndd aassssiissttaannccee ffoorr ddeevveellooppmmeenntt ooff
ccoonnssttrruuccttiioonn mmeetthhooddoollooggyy ffoorr aallll ccoonnssttrruuccttiioonn aaccttiivviittiieess iinncclluuddiinngg
rreevviieeww aanndd aapppprroovvaall ooff ccoonnssttrruuccttiioonn pprroocceedduurreess aanndd mmeetthhooddoollooggyy..
[[33]] RReevviieeww ccoonnttrraaccttoorr''ss rreessoouurrcceess aanndd sscchheedduulleess..
[[44]] MMoobbiilliizzee aaddeeqquuaattee mmaannppoowweerr ttoo ccaarrrryy oouutt tthhee ccoonnssttrruuccttiioonn
ssuuppeerrvviissiioonn aaccttiivviittiieess..
[[55]] SSuuppeerrvviissiioonn dduurriinngg tthhee ssuurrvveeyyss aanndd ssooiill iinnvveessttiiggaattiioonnss wwhheenn ccaarrrriieedd
oouutt bbyy tthhee ccoonnttrraaccttoorrss.. CCaarrrryy oouutt ccoonnssttrruuccttiioonn ssuuppeerrvviissiioonn aaccttiivviittiieess
bbaasseedd oonn tthhee aapppprroovveedd ccoonnssttrruuccttiioonn ddrraawwiinnggss..
[[66]] CCaarrrryy oouutt pprrooggrreessss mmeeaassuurreemmeenntt,, ssccrruuttiinnyy,, wwoorrkkss cceerrttiiffiiccaattiioonn ooff
ccoonnttrraaccttoorr''ss bbiillllss ffoorr ppaayymmeennttss ((iinncclluuddiinngg ffiinnaall bbiillllss))..
[[77]] DDeevviiaattiioonnss,, eexxttrraa iitteemmss,, AAHHRR iitteemmss,, ttiimmee eexxtteennssiioonn,, eettcc.. ooff tthhee
ccoonnttrraaccttoorrss aarree ttoo bbee aannaallyyzzeedd aanndd ffoorrwwaarrdd tthhee rreeccoommmmeennddaattiioonnss
wwiitthhiinn 1155 ddaayyss ooff ooccccuurrrreennccee ffoorr aapppprroovvaall ooff GGAAIILL..
[[88]] CCoooorrddiinnaattee wwiitthh ccoonnttrraaccttoorrss // GGAAIILL..
[[99]] CCaarrrryy oouutt ssttoorreess mmaannaaggeemmeenntt iinncclluuddiinngg hhaannddiinngg oovveerr ttoo GGAAIILL tthhee
lleeffttoovveerr ccoonnssttrruuccttiioonn ssuurrpplluuss mmaatteerriiaallss aalloonngg wwiitthh tthheeiirr IInnssppeeccttiioonn
CCeerrttiiffiiccaatteess aanndd ffiinnaall ddrraawwiinnggss aanndd ddooccuummeennttss.. CCoonnssuullttaanntt sshhaallll bbee
rreessppoonnssiibbllee ffoorr pprrooppeerr mmaaiinntteennaannccee aanndd uuppkkeeeepp ooff tthhee mmaatteerriiaallss..
RReeccoovveerryy sshhaallll bbee lleevviieedd ffoorr lloossss oorr sshhoorrttaaggee ooff mmaatteerriiaallss..
[[1100]] CCaarrrryy oouutt ccoonnttrraacctt mmaannaaggeemmeenntt
[[1111]] PPrreeppaarree mmoonntthhllyy // wweeeekkllyy pprrooggrreessss ssttaattuuss rreeppoorrttss..
[[1122]] CCaarrrryy oouutt QQAA // QQCC dduurriinngg ccoonnssttrruuccttiioonn.. CCoonnssuullttaanntt sshhaallll uussee iittss
CCoonnssttrruuccttiioonn MMaannaaggeemmeenntt PPrroocceedduurree ((CCMMPP)) aanndd rreevviieeww aallll tthhee QQAA
// QQCC ffoorrmmaattss ssuubbmmiitttteedd bbyy tthhee eexxeeccuuttiioonn ccoonnttrraaccttoorrss iinn oorrddeerr ttoo
mmaaiinnttaaiinn rreeqquuiirreedd qquuaalliittyy dduurriinngg ccoonnssttrruuccttiioonn ppeerriioodd..
[[1133]] NNeecceessssaarryy tteecchhnniiccaall aassssiissttaannccee ffoorr sseettttlleemmeenntt ooff eexxttrraa ccllaaiimmss rraaiisseedd
bbyy tthhee ccoonnttrraaccttoorrss // vveennddoorrss aanndd aarrbbiittrraattiioonn ccaasseess sshhaallll bbee pprroovviiddeedd
bbyy tthhee ccoonnssuullttaanntt ttiillll aa ppeerriioodd ooff ttwweennttyy--ffoouurr ((2244)) mmoonntthhss aafftteerr tthhee
ccoommpplleettiioonn ooff tthhee pprroojjeecctt aatt nnoo eexxttrraa ccoosstt ttoo GGAAIILL.. CCoonnssuullttaanntt sshhaallll
ggiivvee rreeccoommmmeennddaattiioonnss oonn eexxttrraa ccllaaiimmss rraaiisseedd bbyy tthhee ccoonnttrraaccttoorrss //
vveennddoorrss.. FFiinnaall aacccceeppttaannccee // sseettttlleemmeenntt wwiillll bbee ttaakkeenn ccaarree ooff bbyy GGAAIILL..
[[1144]] TThhee ccoonnssuullttaanntt sshhaallll ffoorrwwaarrdd bbiillllss,, aafftteerr eenntteerriinngg iinn GGAAIILL''ss BBiillll
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 87 of 154
WWaattcchh SSyysstteemm ((BBWWSS)),, dduullyy cceerrttiiffiieedd ffoorr ppaayymmeenntt ttoo GGAAIILL wwiitthhiinn
sseevveenn ((0077)) wwoorrkkiinngg ddaayyss ffrroomm tthhee ddaattee ooff rreecceeiipptt..
[[1155]] IInn aaddddiittiioonn ttoo aabboovvee,, PPMMCC sshhaallll ddoo aallll aaccttiivviittiieess ttoo ddoo CCoonnssttrruuccttiioonn
MMaannaaggeemmeenntt eeffffiicciieennttllyy..
[[1166]] AAss rreeggaarrdd ddeeppllooyymmeenntt ooff CCoonnssttrruuccttiioonn MMaannppoowweerr bbyy PPMMCC iiss
ccoonncceerrnneedd,, tthhee mmiinniimmuumm nnuummbbeerr ooff mmaannppoowweerr ttoo bbee ddeeppllooyyeedd iiss aass
ppeerr rreessppeeccttiivvee ccllaauussee ooff tthhiiss tteennddeerr..
[[1177]] PPMMCC hhaass ttoo aarrrraannggee iittss oowwnn ccaammpp ffaacciilliittiieess aatt ccoonnssttrruuccttiioonn ssiitteess wwiitthh
rreeaassoonnaabbllee BBooaarrddiinngg aanndd llooddggiinngg,, ttrraannssppoorrttaattiioonn,, mmoobbiillee eexxppeennsseess,,
ccaammpp--ooffffiiccee ffaacciilliittiieess,, eettcc.. IInn oorrddeerr ttoo hhaavvee cclloossee ccoooorrddiinnaattiioonn aammoonngg
GGAAIILL aanndd PPMMCC ppeerrssoonnnneell,, tthhee ccaammpp--ooffffiiccee sshhaallll bbee llooccaatteedd aatt
RRaajjaahhmmuunnddrryy vveerryy cclloossee ttoo GGAAIILL OOffffiiccee,, AAVVAA RRooaadd,, RRaajjaahhmmuunnddrryy,,
EEGG ddiisstttt.. PPMMCC mmuusstt hhaavvee iittss oowwnn ssiittee ooffffiiccee aatt KKSSPP((WW)) oorr
PPoonnnnaammaannddaa..
TThhee PPMMCC sshhaallll qquuoottee aallll cchhaarrggeess iinncclluussiivvee..
NNoo sseeppaarraattee ppaayymmeenntt // rree--iimmbbuurrsseemmeenntt sshhaallll bbee mmaaddee bbyy GGAAIILL..
77..22 SSttoorreess aanndd MMaatteerriiaall mmaannaaggeemmeenntt::
PPMMCC sshhaallll bbee ffuullllyy rreessppoonnssiibbllee ffoorr mmaatteerriiaallss mmaannaaggeemmeenntt ffoorr ggooooddss // mmaatteerriiaall
ppuurrcchhaasseedd ffrroomm vvaarriioouuss ssuupppplliieerrss.. CC&&PP SSttoorreess aatt GGAAIILL--RRaajjaahhmmuunnddrryy sshhaallll bbee
ssttoocckk ssiittee.. PPMMCC iiss rreessppoonnssiibbllee ffoorr iinnssppeeccttiioonn aanndd mmaatteerriiaall cclleeaarraannccee ffoorr
ppaayymmeenntt.. TThhee ssccooppee ooff mmaatteerriiaall
mmaannaaggeemmeenntt sseerrvviicceess ttoo bbee pprroovviiddeedd bbyy tthhee CCoonnssuullttaanntt sshhaallll iinncclluuddee,, bbuutt nnoott
lliimmiitteedd ttoo::
[[11]] RReecceeiivvee eeqquuiippmmeennttss // mmaatteerriiaallss ffrroomm ssuupppplliieerrss aanndd iinnssppeecctt aanndd
cceerrttiiffyy tthheeiirr iinnvvooiicceess ffoorr ppaayymmeenntt..
[[22]] IInnssppeecctt tthhee ccoonnddiittiioonn ooff ggooooddss rreecceeiivveedd aanndd aassssiisstt GGAAIILL iiss pprreeppaarriinngg
GGooooddss RReecceeiipptt VVoouucchheerr..
[[33]] IInnssppeecctt aanndd cceerrttiiffyy uunnuusseedd mmaatteerriiaall rreettuurrnneedd bbyy tthhee ccoonnttrraaccttoorrss..
PPrreeppaarree rreeccoonncciilliiaattiioonn ssttaatteemmeennttss ttoo eennaabbllee OOwwnneerr ttoo cchheecckk aanndd ttaakkee
oovveerr bbaallaannccee ssttoorreess,, aalloonngg wwiitthh rreeqquuiissiittee iinnssppeeccttiioonn cceerrttiiffiiccaatteess,,
ddooccuummeennttss,, eettcc.. aanndd cceerrttiiffyy mmaatteerriiaall rree--ccoonncciilliiaattiioonn aass ppeerr tteennddeerr
ccoonnddiittiioonnss..
[[44]] RReessppoonnssiibbiilliittyy ooff hhaannddoovveerr ooff pprroojjeecctt ssuurrpplluuss mmaatteerriiaallss ttoo GGAAIILL..
[[55]] AAllll eeffffoorrttss sshhaallll bbee mmaaddee bbyy PPMMCC ttoo uuttiilliizzee GGAAIILL mmaatteerriiaallss –– ffoorr
ootthheerr pprroojjeecctt ssuurrpplluuss..
77..33 AAss--bbuuiilltt ddrraawwiinnggss::
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 88 of 154
[[11]] FFoollllooww uupp wwiitthh vveennddoorrss aanndd ccoonnttrraaccttoorrss ffoorr aass--bbuuiilltt ddrraawwiinnggss //
ddooccuummeennttss iinn rreeqquuiirreedd ssooffttwwaarree aanndd hhaarrddccooppyy ffoorrmmaatt,, rreevviieeww //
aapppprroovvee tthhee ssaammee aanndd ffoorrwwaarrdd ttoo GGAAIILL..
[[22]] AAllll pprroojjeecctt rreellaatteedd ddooccuummeennttss ffoorr ffuuttuurree rreeffeerreennccee aanndd rreeccoorrddss wwiillll
bbee hhaannddeedd oovveerr ttoo GGAAIILL aass ppeerr ssttaannddaarrdd iinntteerrnnaattiioonnaall pprraaccttiiccee..
SSuubbmmiissssiioonn ooff ffiinnaall ddooccuummeennttss sshhaallll bbee uunnddeerr tthhee ffoolllloowwiinngg hheeaaddss::
((aa)) AAss--bbuuiilltt DDrraawwiinnggss..
((bb)) DDeettaaiilleedd OOppeerraattiinngg MMaannuuaall..
((cc)) SSeeppaarraatteellyy hhiigghhlliigghhttiinngg rreeccoommmmeennddaattiioonnss ooff tthhee EEIIAA ((iiff
aapppplliiccaabbllee)),, HHAAZZOOPP SSttuuddyy && RRiisskk AAnnaallyyssiiss ccoovveerriinngg QQuuaalliittaattiivvee //
QQuuaannttiittaattiivvee rriisskkss aanndd RRiisskk MMaannaaggeemmeenntt PPllaann ((RRMMPP)) && DDiissaasstteerr
MMaannaaggeemmeenntt PPllaann ((DDMMPP)),, eettcc..
((dd)) PPrroobblleemmss ffaacceedd dduurriinngg tthhee pprroojjeecctt eexxeeccuuttiioonn aanndd mmiittiiggaattiioonn
mmeeaassuurreess ttaakkeenn aanndd rreeaassoonnss ffoorr ffuuttuurree..
88.. PPRROOJJEECCTT MMAANNAAGGEEMMEENNTT AANNDD CCOONNTTRROOLL
88..11 PPllaannnniinngg aanndd SScchheedduulliinngg::
TThhee PPMMCC wwiillll bbee ccoommpplleetteellyy rreessppoonnssiibbllee ffoorr pprreeppaarriinngg pprroojjeecctt ppllaannss aanndd
sscchheedduullee iinnlliinnee wwiitthh tthhee OOvveerraallll PPrroojjeecctt SScchheedduullee pprroovviiddeedd bbyy tthhee cclliieenntt.. TThhiiss
wwiillll iinncclluuddee tthhee pprreeppaarraattiioonn aanndd ssuubbmmiissssiioonn ooff::
[[AA]] WWOORRKK BBRREEAAKKDDOOWWNN SSTTRRUUCCTTUURREE IINNCCOORRPPOORRAATTIINNGG
[[ii]] AAssssiisstt GGAAIILL iinn ddooccuummeennttaattiioonn rreeqquuiirreedd ffoorr SSttaattuuttoorryy
PPeerrmmiissssiioonnss // NNOOCC''ss ffrroomm vvaarriioouuss aauutthhoorriittiieess ffoorr CCrroossssiinngg
PPeerrmmiissssiioonnss,, NNOOCC ffrroomm SSttaattee PPoolllluuttiioonn CCoonnttrrooll BBooaarrddss,, CCCCOOEE
CClleeaarraannccee,, MMOOEE&&FF CClleeaarraannccee,, aannyy ootthheerr ppeerrmmiissssiioonn rreeqquuiirreedd
ffoorr pprroojjeecctt eexxeeccuuttiioonn..
[[iiii]] EEnnggiinneeeerriinngg ((DDeettaaiill EEnnggiinneeeerriinngg && PPrroocceessss DDeessiiggnn BBaassiiss))
[[iiiiii]] TTeennddeerriinngg
[[iivv]] OOrrddeerriinngg
[[vv]] MMaannuuffaaccttuurriinngg
[[vvii]] IInnssppeeccttiioonn && EExxppeeddiittiinngg
[[vviiii]] DDeelliivveerryy
[[vviiiiii]] CCoonnssttrruuccttiioonn
[[iixx]] CCoommmmiissssiioonniinngg
[[BB]] PPrroojjeecctt NNeettwwoorrkk DDiiaaggrraammss,, PPEERRTT // GGNNAATT CChhaarrtt // II--JJ lliisstt
[[CC]] PPrroojjeecctt AAccttiivviittyy LLiisstt,, MMiilleessttoonneess iinnccoorrppoorraattiinngg tthhee EEaarrllyy SSttaarrtt,, EEaarrllyy
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 89 of 154
FFiinniisshh,, LLaattee SSttaarrtt && LLaattee FFiinniisshh DDaatteess,, TToottaall FFllooaatt,, FFrreeee FFllooaatt aaggaaiinnsstt
eeaacchh AAccttiivviittyy
[[DD]] PPrroojjeecctt OOvveerraallll PPeerrcceennttaaggee SScchheedduullee:: MMoonntthhllyy BBrreeaakkuuppss,, aanndd
CCuummuullaattiivvee BBrreeaakkuuppss
[[EE]] PPeerrcceennttaaggee SScchheedduullee MMoonntthhllyy BBrreeaakkuuppss ffoorr eeaacchh eelleemmeenntt // ddiisscciipplliinnee
ooff WWBBSS
[[FF]] PPrroojjeecctt CCoosstt EEssttiimmaattee ffoorr eeaacchh PPuurrcchhaassee aanndd WWoorrkk OOrrddeerr
[[GG]] PPrroojjeecctt FFiinnaanncciiaall CCoommmmiittmmeenntt SScchheedduullee iinn aaccccoorrddaannccee wwiitthh tthhee
eennvviissaaggeedd // aaccttuuaall ddaatteess ffoorr oorrddeerr ppllaacceemmeenntt
[[HH]] PPrroojjeecctt PPllaannnneedd CCaasshh OOuuttffllooww iinn aaccccoorrddaannccee ttoo tthhee eennvviissaaggeedd // aaccttuuaall
ddaatteess ooff ddeelliivveerryy // ccoonnssttrruuccttiioonn
[[II]] PPMMCC OOrrggaannooggrraamm ffoorr PPrroojjeecctt OOffffiiccee && CCoonnssttrruuccttiioonn SSiittee OOffffiiccee
[[JJ]] PPMMCC MMaannppoowweerr DDeeppllooyymmeenntt SScchheedduullee ((MMoonntthh--wwiissee))
[[KK]] PPrroojjeecctt CCoommmmuunniiccaattiioonn // CCoooorrddiinnaattiioonn PPllaann ((CClliieenntt && PPMMCC
IInntteerraaccttiioonn MMooddeell))
[[LL]] IInnssppeeccttiioonn SScchheedduullee aanndd PPllaann
[[MM]] SSuubbmmiissssiioonn ooff MMoonntthhllyy RReeppoorrttss aass ppeerr tthhee rreeqquuiirreemmeenntt ooff MMiinniissttrryy
MMoonniittoorriinngg CCeellll ((MMMMCC)) iinnccoorrppoorraattiinngg tthhee aabboovvee ddeettaaiillss ((AA.. ttoo HH..))
TThhee vvaarriioouuss eelleemmeennttss wweeiigghhttaaggeess ttoo bbee ffoolllloowweedd ffoorr oovveerraallll PPrroojjeecctt sscchheedduulliinngg
aanndd pphhyyssiiccaall pprrooggrreessss mmoonniittoorriinngg iiss aass uunnddeerr::
SSll.. EElleemmeennttss WWeeiigghhttaaggee
[[ii]] AAssssiissttaannccee ffoorr SSttaattuuttoorryy PPeerrmmiissssiioonnss // NNOOCC''ss 22
[[iiii]] EEnnggiinneeeerriinngg ((DDeettaaiill EEnnggiinneeeerriinngg && PPrroocceessss DDeessiiggnn
BBaassiiss))
44
[[iiiiii]] TTeennddeerriinngg 1122
[[iivv]] OOrrddeerriinngg 1155
[[vv]] MMaannuuffaaccttuurriinngg 2255
[[vvii]] DDeelliivveerryy 1100
[[vviiii]] CCoonnssttrruuccttiioonn 2288
[[vviiiiii]] CCoommmmiissssiioonniinngg 22
[[iixx]] PPrroojjeecctt CClloossee--oouutt 22
FFoolllloowwiinngg aarree ttoo bbee ssttrriiccttllyy nnootteedd::
PPrreeppaarree mmoonntthhllyy pprrooggrreessss rreeppoorrttss ffoorr tthhee PPrroojjeecctt aanndd pprroovviiddee aallll aassssiissttaannccee ttoo
GGAAIILL ffoorr pprreeppaarriinngg rreeppoorrttss rreeqquuiirreedd bbyy ttoopp ccoorrppoorraattee mmaannaaggeemmeenntt.. SSttrriicctt
aaddhheerreennccee ttoo ssuubbmmiissssiioonn ooff aallll ddooccuummeennttss,, rreeppoorrttss,, pprreesseennttaattiioonnss,, qquueerriieess ffrroomm
vvaarriioouuss aaggeenncciieess nneeeeddss ttoo bbee pprreeppaarreedd aanndd ssuubbmmiitttteedd oonn ttiimmee.. FFoorr ssuucccceessssffuull
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 90 of 154
aanndd ttiimmeellyy iimmpplleemmeennttaattiioonn,, tthhee ccoonnssuullttaanntt sshhaallll aaddhheerree ttoo,, bbuutt nnoott lliimmiitteedd ttoo,,
tthhee ffoolllloowwiinngg::
[[11]] TThhee ccoonnssuullttaanntt sshhaallll pprreeppaarree tthhee OOvveerraallll PPrroojjeecctt SScchheedduullee aass ppeerr tthhee
GGAAIILL''ss aapppprroovvaall aanndd aallssoo aass ppeerr tthhee iinntteerrnnaall sscchheedduullee wwhhiicchh wwiillll bbee
ddeecciiddeedd dduurriinngg tthhee PPrroojjeecctt kkiicckk--ooffff mmeeeettiinngg..
[[22]] TThhee PPrroojjeecctt SScchheedduullee ((NNeettwwoorrkk DDiiaaggrraamm && IIJJ LLiisstt)) wwiillll bbee pprreeppaarreedd
ffoorr iitteemmss lliisstteedd aass ((AA)) aabboovvee aanndd ssuubbmmiitt ttoo GGAAIILL wwiitthhiinn oonnee ((0011))
wweeeekk ooff kkiicckk--ooffff mmeeeettiinngg.. TThhiiss sshhaallll aallssoo iinncclluuddee tthhee AAccttiivviittyy lliisstt,, lliisstt
ooff MMiilleessttoonneess,, WWoorrkk--BBrreeaakkddoowwnn SSttrruuccttuurree ((WWBBSS)),, eettcc.. PPrreeppaarraattiioonn ooff
aallll tthheessee ddooccuummeennttss iinn PPrriimmaavveerraa // SSAAPP--PPSS mmoodduullee iiss rreeqquuiirreedd.. TThhee
ccoonnssuullttaanntt sshhaallll aallssoo pprreeppaarree tthhee ffiinnaanncciiaall mmoonntthh--wwiissee ccaasshh ffllooww
ddiiaaggrraamm,, aappaarrtt ffrroomm tthhee mmoonntthhllyy aappaarrtt ffrroomm tthhee mmoonntthhllyy pphhyyssiiccaall
pprrooggrreessss sscchheedduullee aass ppeerr iinntteerrnnaall aanndd bbooaarrdd aapppprroovveedd sscchheedduullee..
[[33]] PPrreeppaarree vvaarriioouuss SSttaattuuss RReeppoorrttss,, ee..gg.. PPrree--OOrrddeerr,, PPoosstt--OOrrddeerr,, MMaatteerriiaall
EExxppeeddiittiinngg,, CCoonnssttrruuccttiioonn,, eettcc..
[[44]] PPrreeppaarree PPrroojjeecctt CClloosseeoouutt RReeppoorrtt,, iinncclluuddiinngg ppeerrffoorrmmaannccee rreeppoorrtt ooff
vveennddoorrss // ccoonnttrraaccttoorrss..
[[55]] AAppaarrtt ffrroomm tthhee aabboovvee ddeelliivveerraabblleess ooff tthhee ccoonnssuullttaanntt,, tthhee ccoonnssuullttaanntt
wwiillll bbee rreeqquuiirreedd ttoo ssuubbmmiitt ootthheerr ddooccuummeennttss iinn tthhee ffoorrmm ooff rreeppoorrttss,, aass
ddeeeemmeedd nneecceessssaarryy ffoorr ssuucccceessssffuull aanndd ttiimmeellyy PPrroojjeecctt iimmpplleemmeennttaattiioonn..
88..22 PPrroojjeecctt MMaannaaggeemmeenntt::
TThhee PPMMCC wwiillll bbee ccoommpplleetteellyy rreessppoonnssiibbllee ffoorr tthhee eennttiirree PPrroojjeecctt MMaannaaggeemmeenntt
wwhheerreeiinn tthheeyy wwiillll bbee rreeqquuiirreedd ttoo wwoorrkk iinn cclloossee ccoooorrddiinnaattiioonn wwiitthh GGAAIILL tteeaamm..
FFoorr eeffffiicciieenntt aanndd ttiimmeellyy ccoommpplleettiioonn ooff tthhee pprroojjeecctt tthhee PPMMCC wwiillll bbee rreeqquuiirreedd ttoo::
[[11]] EEssttaabblliisshh CCoommmmuunniiccaattiioonn PPrroocceedduurreess iinn ccoonnccuurrrreennccee wwiitthh GGAAIILL..
[[22]] EEssttaabblliisshh PPrroocceedduurreess ffoorr vvaarriioouuss aaccttiivviittiieess ttoo bbee ppeerrffoorrmmeedd ffoorr
vvaarriioouuss WWBBSS eelleemmeennttss vviizz.. TTeennddeerriinngg,, OOrrddeerriinngg,, MMaannuuffaaccttuurriinngg,,
IInnssppeeccttiioonn,, DDeelliivveerryy,, eettcc..
[[33]] DDeeffiinnee SSccooppee ooff WWoorrkk ffoorr vvaarriioouuss ggrroouuppss..
[[44]] AAtttteenndd MMoonntthhllyy PPrroojjeecctt RReevviieeww MMeeeettiinnggss wwiitthh GGAAIILL MMaannaaggeemmeenntt..
[[55]] AAtttteenndd wweeeekkllyy PPrroojjeecctt MMeeeettiinngg wwiitthh PPrroojjeecctt MMaannaaggeerr..
[[66]] SSuurrvveeiillllaannccee oonn tthhee eennttiirree PPrroojjeecctt--rreellaatteedd aaccttiivviittiieess..
[[77]] MMoonniittoorr pprrooggrreessss ooff tthhee PPrroojjeecctt aanndd ssuubbmmiitt ppeerriiooddiicc ssttaattuuss rreeppoorrttss ttoo
GGAAIILL..
[[88]] CCoooorrddiinnaattiioonn wwiitthh vveennddoorrss // ccoonnttrraaccttoorrss rreellaattiinngg ttoo tthhee pprrooccuurreemmeenntt
ooff iitteemmss aanndd eexxeeccuuttiioonn ooff tthhee wwoorrkk..
[[99]] PPrroovviiddee ttiimmeellyy iinnppuuttss iinn tteerrmmss ooff mmaatteerriiaallss && ddrraawwiinnggss ttoo
ccoonnttrraaccttoorrss ffoorr ccaarrrryyiinngg oouutt ccoonnssttrruuccttiioonn aaccttiivviittiieess..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 91 of 154
[[1100]] PPrreeppaarree vvaarriioouuss rreeppoorrttss // ddrraafftt rreeppllyy lleetttteerrss aass rreeqquuiirreedd ffrroomm ttiimmee ttoo
ttiimmee ffoorr GGAAIILL''ss mmaannaaggeemmeenntt aanndd ffoorr oonnwwaarrdd ssuubbmmiissssiioonn ttoo
GGoovveerrnnmmeenntt && ssttaattuuttoorryy aauutthhoorriittiieess.. NNoorrmmaall ttiimmee sshhaallll bbee 33
wwoorrkkiinngg ddaayyss aatt mmaaxx..
[[1111]] PPrroovviiddee iinnffoorrmmaattiioonn oonn bbeesstt iinntteerrnnaattiioonnaall pprraaccttiicceess bbeeiinngg ffoolllloowweedd
aaccrroossss tthhee gglloobbee ffoorr ggaass ppiippeelliinnee pprroojjeeccttss aass aanndd wwhheenn tthhee
iinnffoorrmmaattiioonn iiss ddeessiirreedd bbyy GGAAIILL ffoorr eeffffeeccttiivvee aanndd ttiimmeellyy PPrroojjeecctt
ccoommpplleettiioonn..
[[1122]] BBaasseedd oonn rreeqquuiirreemmeenntt tthhee PPMMCC sshhaallll ccoommee ffoorr mmeeeettiinnggss wwiitthh GGAAIILL
wwiitthhiinn tthhee sshhoorrtteesstt ppoossssiibbllee ttiimmee wwhheerreeiinn aapppprroopprriiaattee lleevveell ooff
ppeerrssoonn sshhaallll bbee ddeeppllooyyeedd..
88..33 PPrroojjeecctt MMoonniittoorriinngg aanndd ccoonnttrrooll::
TThhee PPMMCC sshhaallll aallssoo pprroovviiddee tthhee PPrroojjeecctt MMoonniittoorriinngg SSeerrvviicceess iinncclluuddiinngg tthhee
ffoolllloowwiinngg SSccooppee ooff WWoorrkk::
[[11]] PPrreeppaarraattiioonn ooff ddeettaaiilleedd PPrroojjeecctt SScchheedduullee..
[[22]] IIddeennttiiffiiccaattiioonn ooff aallll aaccttiivviittiieess ffaalllliinngg oonn tthhee ccrriittiiccaall ppaatthh ooff tthhee
PPrroojjeecctt..
[[33]] IIddeennttiiffiiccaattiioonn ooff aallll aaccttiivviittiieess rreeqquuiirriinngg cclloossee ccoo--oorrddiinnaattiioonn //
ssyynncchhrroonniizzaattiioonn..
[[44]] PPrreeppaarraattiioonn ooff aa llooookk--aahheeaadd mmooddeell // ccaattcchh--uupp ppllaann ffoorr tthhee PPrroojjeecctt
ffrroomm ttiimmee ttoo ttiimmee..
[[55]] GGeenneerraattiioonn ooff aallll pprroojjeecctt mmoonniittoorriinngg rreeppoorrttss ffoorr tthhee PPrroojjeecctt ddrraawwiinngg
aatttteennttiioonn ttoowwaarrddss ccrriittiiccaall jjoobbss,, aaccttiivviittiieess aanndd ffuunnccttiioonnss..
[[66]] IIddeennttiiffiiccaattiioonn ooff aallll aaccttiivviittiieess // sstteeppss rreeqquuiirreedd ffoorr eexxeeccuuttiioonn ooff tthhee
PPrroojjeecctt wwiitthhiinn aapppprroovveedd ccoosstt..
[[77]] IIddeennttiiffiiccaattiioonn ooff aallll aaccttiivviittiieess // sstteeppss rreeqquuiirreedd ffoorr eexxeeccuuttiioonn ooff tthhee
PPrroojjeecctt wwiitthhiinn ssttiippuullaatteedd ttiimmee..
[[88]] HHiigghhlliigghhtt ppiittffaallllss,, iiff aannyy,, ccaauusseedd bbyy tthhee PPrroojjeecctt CCoonnssuullttaanntt // aannyy
aaggeennccyy hhiinnddeerriinngg eeffffiicciieenntt eexxeeccuuttiioonn ooff tthhee pprroojjeecctt..
[[99]] MMoonniittoorriinngg ooff ccoonnttrraaccttoorr llooggiissttiiccss ffoorr ccoonnssttrruuccttiioonn..
[[1100]] GGeenneerraattiioonn ooff MMIISS rreeppoorrttss ffoorr tthhee PPrroojjeecctt,, aanndd iiddeennttiiffyy ccrriittiiccaall ppaatthh
oonn ffoorrttnniigghhttllyy bbaassiiss..
[[1111]] PPrroovviiddiinngg aallll iinnppuuttss // ppeerrffoorrmmiinngg aallll PPrroojjeecctt mmoonniittoorriinngg aaccttiivviittiieess aass
ddeessiirreedd bbyy tthhee GGAAIILL MMaannaaggeemmeenntt // PPrroojjeecctt--ggrroouupp ffrroomm ttiimmee ttoo ttiimmee
ffoorr ttiimmeellyy ccoommpplleettiioonn ooff tthhee PPrroojjeecctt..
[[1122]] CCaarrrryyiinngg oouutt qquuaalliittyy aauuddiittss aanndd IIddeennttiiffyyiinngg tthhee rroooott ccaauusseess ooff tthhee
pprroobblleemmss eennccoouunntteerreedd iinn ppiippeelliinnee ccoonnssttrruuccttiioonn aaccttiivviittiieess..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 92 of 154
[[1133]] IInn aaddddiittiioonn ttoo aabboovvee,, PPMMCC sshhaallll ddoo aallll aaccttiivviittiieess ttoo ddoo PPrroojjeecctt
MMoonniittoorriinngg SSeerrvviicceess eeffffiicciieennttllyy..
[[1144]] RRiisskk MMaannaaggeemmeenntt:: TThhee PPMMCC sshhoouulldd iiddeennttiiffyy aanndd eevvaalluuaattee tthhee
eexxeeccuuttiioonn rriisskkss aatt ddiiffffeerreenntt ssttaaggeess,, rreeccoommmmeenndd aanndd iimmpplleemmeenntt
aapppprroopprriiaattee rriisskk mmiittiiggaattiioonn mmeeaassuurreess.. TThheessee aarree ttoo bbee rreefflleecctteedd iinn
mmoonntthhllyy pprrooggrreessss rreeppoorrtt,, rreevviieeww mmeeeettiinnggss aanndd tthhrroouugghh ootthheerr
aapppprroopprriiaattee ccoommmmuunniiccaattiioonnss..
99.. CCOOMMMMIISSSSIIOONNIINNGG,, SSTTAARRTT--UUPP AANNDD PPEERRFFOORRMMAANNCCEE TTEESSTTSS::
99..11 MMeecchhaanniiccaall CCoommpplleettiioonn::
[[11]] AAtt aa ddaattee pprriioorr ttoo mmeecchhaanniiccaall ccoommpplleettiioonn ttoo bbee aaggrreeeedd wwiitthh OOwwnneerr,,
PPMMCC sshhaallll rreeccoommmmeenndd ttoo OOwwnneerr ffoorr aapppprroovvaall ooff tthhee OOppeerraattiinngg
MMaannuuaall pprreeppaarreedd bbyy PPMMCC..
[[22]] PPMMCC sshhaallll rreevviieeww aanndd rreeccoommmmeenndd ffoorr aapppprroovvaall ooff tthhee pprrooggrraamm,, aanndd
ssuuppeerrvviissee tthhee mmeecchhaanniiccaall ccoommpplleettiioonn wwoorrkk ppeerrffoorrmmeedd bbyy
ccoonnttrraaccttoorrss.. UUppoonn ssuucccceessssffuull ccoommpplleettiioonn ooff mmeecchhaanniiccaall ccoommpplleettiioonn
wwoorrkk,, PPMMCC sshhaallll rreevviieeww aanndd rreeccoommmmeenndd aapppprroovvaall ooff CCoonnssttrruuccttiioonn
CCoommpplleettiioonn CCeerrttiiffiiccaattee ddooccuummeennttaattiioonn..
[[33]] PPMMCC sshhaallll aapppprroovvee aass rreeqquuiirreedd aallll pprroocceedduurreess,, ppllaannss,, sscchheedduulleess aanndd
nneecceessssaarryy cceerrttiiffiiccaattiioonn ffoorr ccoonnssttrruuccttiioonn ccoommpplleettiioonn bbyy tthhee ootthheerr
ccoonnttrraaccttoorrss.. TThhee ccoonnssttrruuccttiioonn ccoommpplleettiioonn ooff iinnddiivviidduuaall sseeccttiioonnss ooff
tthhee PPrroojjeecctt sshhaallll bbee pprrooggrraammmmeedd iinn aaccccoorrddaannccee wwiitthh tthhee oovveerraallll
CCoommmmiissssiioonniinngg PPllaann..
[[44]] PPMMCC sshhaallll eennssuurree tthhaatt aallll nneecceessssaarryy ppeerrssoonnnneell ffrroomm eeqquuiippmmeenntt
ssuupppplliieerrss aarree ccaalllleedd ttoo aatttteenndd tthhee pprreeccoommmmiissssiioonniinngg aaccttiivviittiieess aass
pprroovviiddeedd ffoorr iinn tthhee EEqquuiippmmeenntt PPuurrcchhaassee OOrrddeerrss..
[[55]] PPMMCC sshhaallll pprreeppaarree ffoorr aapppprroovvaall bbyy OOwwnneerr aanndd iimmpplleemmeenntt aallll
nneecceessssaarryy pprroocceedduurreess ttoo eennssuurree ssaaffeettyy ooff ppeerrssoonnnneell wwoorrkkiinngg oonn
ccoonnssttrruuccttiioonn aaccttiivviittiieess aatt tthhee ssaammee ttiimmee aass ffiieelldd iinnssppeeccttiioonn,, tteessttiinngg
aanndd ccoommmmiissssiioonniinngg iiss iinn pprrooggrreessss..
[[66]] PPMMCC sshhaallll ssuuppeerrvviissee ccoonnttrraaccttoorrss,, wwoorrkk ssuucchh tthhaatt pphhaassee mmeecchhaanniiccaall
ccoommpplleettiioonn aanndd ccoommmmiissssiioonniinngg ttaakkeess ppllaaccee aass ddeetteerrmmiinneedd bbyy
OOwwnneerr''ss bbuussiinneessss nneeeeddss..
[[77]] IItt sshhaallll bbee oobblliiggaattoorryy oonn tthhee ppaarrtt ooff PPMMCC ttoo iissssuuee tthhee ""MMeecchhaanniiccaall
CCoommpplleettiioonn CCeerrttiiffiiccaattee""..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 93 of 154
99..22 CCoommmmiissssiioonniinngg aanndd SSttaarrtt--uupp::
[[11]] CCoommmmiissssiioonniinngg aanndd ssttaarrtt--uupp iiss ttoo bbee ccaarrrriieedd oouutt wwiitthh aassssiissttaannccee ffrroomm
ootthheerr ccoonnttrraaccttoorrss..
[[22]] UUppoonn OOwwnneerr''ss aapppprroovvaall ooff tthhee mmeecchhaanniiccaall ccoommpplleettiioonn ooff tthhee wwoorrkk,,
aanndd wwhheenn iitt iiss ddeeeemmeedd ssuuiittaabbllee bbyy OOwwnneerr,, tthheeccoommmmiissssiioonniinngg wwoorrkk
mmaayy ccoommmmeennccee aaccccoorrddiinngg ttoo tthhee ppllaannss aanndd sscchheedduulleess pprreeppaarreedd bbyy
PPMMCC..
[[33]] PPMMCC sshhaallll ssuubbmmiitt CCoommmmiissssiioonniinngg PPrroocceedduurree,, oorrggaanniizzee aa ssttaarrtt--uupp
tteeaamm ttoo ssuuppeerrvviissee aanndd mmoonniittoorr tthhee ccoommmmiissssiioonniinngg,, ssttaarrttuupp,,
ppeerrffoorrmmaannccee tteesstt aanndd iinniittiiaall ooppeerraattiioonn ooff tthhee ffaacciilliittiieess ccoonnssiissttiinngg ooff
rreepprreesseennttaattiivvee ooff OOwwnneerr''ss ooppeerraattiinngg ppeerrssoonnnneell,, eeqquuiippmmeenntt ssuupppplliieerrss,,
PPMMCC aanndd ccoonnttrraaccttoorrss aanndd sshhaallll eennssuurree tthhaatt tthhee ccoonnttrraaccttoorrss pprroovviiddee
ssuuffffiicciieenntt nnuummbbeerrss ooff sskkiilllleedd llaabboouurr tthhaatt iiss nneeeeddeedd ttoo ccoommpplleemmeenntt tthhee
OOwwnneerr''ss ssttaarrttuupp ppeerrssoonnnneell aanndd ttoo ppeerrffoorrmm aallll aaccttiivviittiieess wwhhiicchh iinncclluuddee
tthhee rruunnnniinngg oorr ooppeerraattiioonn ooff aallll eeqquuiippmmeennttss..
[[44]] PPMMCC sshhaallll eennssuurree tthhaatt tthhee ccoonnttrraaccttoorr pprroovviiddee ssuuffffiicciieenntt mmaannppoowweerr,,
ssppeecciiaall ttoooollss aanndd ssppaarree ppaarrttss nneecceessssaarryy ffoorr tthhee ccoommmmiissssiioonniinngg
aaccttiivviittiieess wwiillll,, aass aa mmiinniimmuumm iinncclluuddee::
●● OOppeerraattiioonnaall tteessttiinngg..
●● PPrree--ssttaarrttuupp iinnssppeeccttiioonnss..
●● FFiilllliinngg ooff lluubbrriiccaannttss,, wwhheerreevveerr nneecceessssaarryy..
●● EEqquuiippmmeenntt ooppeerraattiioonn ttoo mmaakkee vviibbrraattiioonn aanndd ssaaffeettyy ddeevviiccee
cchheecckkss,, aanndd ootthheerr rreeqquuiirreedd ooppeerraattiinngg tteessttss aanndd aaddjjuussttmmeennttss..
●● FFlluusshhiinngg,, bblloowwiinngg aanndd cchheemmiiccaall cclleeaanniinngg..
●● IInnssttaallllaattiioonn ooff tteemmppoorraarryy ssccrreeeennss,, ssttrraaiinneerrss aanndd bblliinnddss..
●● NNeecceessssaarryy ppuurrggee ooppeerraattiioonnss,, iinncclluuddiinngg iinnssttaallllaattiioonn ooff tteemmppoorraarryy
ppuurrggee ppiippiinngg,, hhoosseess oorr eeqquuiippmmeenntt ccoonnnneeccttiioonnss..
●● CChheecckkiinngg ooff bboorreess ooff oorriiffiiccee ppllaatteess aanndd iinnssttaalllliinngg tthheessee ppllaatteess
aafftteerr fflluusshhiinngg ooppeerraattiioonnss..
●● FFuunnccttiioonnaall cchheecckk oonn aallll iinnssttrruummeennttss aanndd ccoonnttrroolllleerrss,, iinnssttrruummeenntt
ccaalliibbrraattiioonnss wwiitthh ssttaannddaarrdd tteesstt..
●● EEqquuiippmmeenntt aanndd aallll rreeqquuiirreedd aaddjjuussttmmeennttss aanndd ccoonnttrrooll ppooiinntt
sseettttiinnggss..
●● CChheecckk aallll iinnssttrruummeenntt llooooppss ffoorr pprrooppeerr ffuunnccttiioonniinngg..
●● CChheecckkss aallll ppiippee ssuuppppoorrttss,, aanndd gguuiiddeess ffoorr sseettttiinnggss hhoott // ccoolldd aanndd
nneecceessssaarryy aaddjjuussttmmeennttss..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 94 of 154
●● CChheecckkiinngg aanndd rreeccoorrddiinngg ppoossiittiioonnss ooff aallll vvaallvveess..
●● CCoonndduucctt ssiimmuullaattiioonn rruunnss ttoo aallllooww rruunn--iinn ooppeerraattiioonnaall tteessttiinngg ooff
tthhee eeqquuiippmmeenntt..
[[55]] PPMMCC sshhaallll eennssuurree tthhaatt aallll ddeeffeeccttss aanndd ddeeffiicciieenncciieess ffoouunndd dduurriinngg tthhee
ccoouurrssee ooff ccoommmmiissssiioonniinngg sshhaallll bbee rreeccttiiffiieedd bbyy tthhee ccoonnttrraaccttoorrss..
[[66]] PPMMCC sshhaallll ssuuppeerrvviissee aanndd mmoonniittoorr aallll ccoommmmiissssiioonniinngg aanndd ssttaarrtt--uupp
aaccttiivviittiieess aanndd aallll ppeerrffoorrmmaannccee tteesstt--rruunnss wwhhiicchh wwiillll bbee ccaarrrriieedd oouutt bbyy
tthhee ccoonnttrraaccttoorrss.. AAllll ppeerrffoorrmmaannccee tteesstt rreessuullttss sshhaallll bbee rreevviieewweedd aanndd
cceerrttiiffiieedd bbyy PPMMCC..
[[77]] PPMMCC sshhaallll rreeppoorrtt ttoo OOwwnneerr oonn aa wweeeekkllyy bbaassiiss oonn tthhee pprrooggrreessss aanndd
ssttaattuuss ooff ccoommmmiissssiioonniinngg aanndd ssttaarrttuupp wwoorrkk..
[[88]] PPMMCC sshhaallll eennssuurree tthhaatt aallll ccoommmmiissssiioonniinngg rreeccoorrddss aanndd lloogg--sshheeeettss aarree
pprrooppeerrllyy ccoollllaatteedd aanndd ssuubbmmiitttteedd ttoo OOwwnneerr aass ppaarrtt ooff ccoonnttrraaccttoorrss''
MMeecchhaanniiccaall CCoommpplleettiioonn CCeerrttiiffiiccaattee aapppprroovvaall ddooccuummeennttss aanndd
pprroovviissiioonnaall aacccceeppttaannccee ddooccuummeennttss aass rreelleevvaanntt..
[[99]] IItt sshhaallll bbee oobblliiggaattoorryy oonn tthhee ppaarrtt ooff PPMMCC ttoo iissssuuee tthhee ""CCoommmmiissssiioonniinngg
CCeerrttiiffiiccaattee""..
99..33 [[AA]] FFaaccttoorryy AAcccceeppttaannccee TTeessttss::
PPMMCC sshhaallll wwiittnneessss && cceerrttiiffyy tthhee FFaaccttoorryy AAcccceeppttaannccee TTeessttss ((FFAATT)) iinn tthhee
pprreemmiisseess ooff ccoonnttrraaccttoorr ffoorr TTeelleeccoomm,, SSCCAADDAA && AAPPPPSS,, IInnssttrruummeennttaattiioonn ssyysstteemm,,
CCPP ssyysstteemm,, eettcc.. wwhhiicchh wwiillll bbee ccaarrrriieedd oouutt bbyy tthhee rreessppeeccttiivvee ccoonnttrraaccttoorrss..
[[BB]] SSiittee AAcccceeppttaannccee TTeessttss::
RReessppeeccttiivvee ccoonnttrraaccttoorrss sshhaallll ccaarrrryy oouutt tthhee SSiittee AAcccceeppttaannccee TTeessttss ((SSAATT)) ooff
TTeelleeccoomm,, SSCCAADDAA && AAPPPPSS,, IInnssttrruummeennttaattiioonn ssyysstteemm,, CCPP ssyysstteemm,, eettcc.. sshhaallll bbee
wwiittnneesssseedd && cceerrttiiffiieedd bbyy PPMMCC aatt ssiittee..
1100.. PPRROOJJEECCTT DDOOCCUUMMEENNTTSS // CCOOMMPPLLEETTIIOONN // CCLLOOSSEEOOUUTT RREEPPOORRTT::
CCoonnsseeqquueenntt uuppoonn tthhee ssuucccceessssffuull ccoommpplleettiioonn aanndd ccoommmmiissssiioonniinngg ooff tthhee pprroojjeecctt
tthhee PPMMCC sshhaallll bbee rreessppoonnssiibbllee ffoorr tthhee ffoolllloowwiinngg::
((ii)) FFoollllooww uupp wwiitthh vveennddoorrss aanndd ccoonnttrraaccttoorrss ffoorr aass--bbuuiilltt ddrraawwiinnggss //
ddooccuummeennttss iinn rreeqquuiirreedd ssooffttwwaarree aanndd hhaarrddccooppyy ffoorrmmaatt,, rreevviieeww //
aapppprroovvee tthhee ssaammee aanndd ffoorrwwaarrdd GGAAIILL..
((iiii)) SSuubbmmiissssiioonn ooff aallll PPrroojjeecctt--rreellaatteedd ddooccuummeennttss ttoo GGAAIILL ffoorr ffuuttuurree
rreeffeerreennccee aanndd rreeccoorrddss aass ppeerr ssttaannddaarrdd iinntteerrnnaattiioonnaall pprraaccttiiccee..
SSuubbmmiissssiioonn ooff ffiinnaall ddooccuummeennttss sshhaallll bbee uunnddeerr tthhee ffoolllloowwiinngg hheeaaddss::
((aa)) AAss--bbuuiilltt DDrraawwiinnggss..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 95 of 154
((bb)) DDeettaaiilleedd OOppeerraattiinngg MMaannuuaall hhiigghhlliigghhttiinngg rreeccoommmmeennddaattiioonnss ooff
tthhee EEIIAA,, HHAAZZOOPP SSttuuddyy && RRiisskk AAnnaallyyssiiss,, eettcc..
((cc)) PPrroobblleemmss ffaacceedd dduurriinngg tthhee pprroojjeecctt eexxeeccuuttiioonn aanndd mmiittiiggaattiioonn
mmeeaassuurreess ttaakkeenn iinn ffuuttuurree..
((iiiiii)) SSuubbmmiissssiioonn ooff aallll eevvaalluuaattiioonn sshheeeettss ooff ppeerrffoorrmmaannccee ffoorr aallll vveennddoorrss,,
ccoonnttrraaccttss iinn lliinnee wwiitthh eessttaabblliisshheedd pprroocceedduurreess ttoo wwhhoomm oorrddeerrss wweerree
ppllaacceedd..
((iivv)) HHaarrdd && ssoofftt ccooppiieess ooff PPrroojjeecctt CClloosseeoouutt RReeppoorrtt iinnccoorrppoorraattiinngg tthhee
ffoolllloowwiinngg::
((aa)) PPrroojjeecctt BBrriieeff
((bb)) PPiippeelliinnee LLiinnee DDiiaaggrraamm
((cc)) CChhrroonnoollooggyy ooff AApppprroovvaallss
((dd)) PPMMCC HHeeaadd OOffffiiccee && SSiittee OOffffiiccee OOrrggaannooggrraamm
((ee)) NNaammeess ooff PPMMCC PPeerrssoonnnneell wwoorrkkiinngg ffoorr tthhee pprroojjeecctt aalloonngg wwiitthh aallll
ccoonnttaacctt ddeettaaiillss..
((ff)) PPiippeelliinnee CCoonnffiigguurraattiioonn aanndd SSpprreeaadd DDeettaaiillss..
((gg)) DDeettaaiillss ooff vvaarriioouuss TTyyppeess ooff CCrroossssiinnggss..
((hh)) NNaammeess ooff SSttaannddaarrddss rreeffeerrrreedd aanndd uusseedd iinn DDeessiiggnn && EEnnggiinneeeerriinngg
ffoorr vvaarriioouuss IItteemmss,, CCoonnssttrruuccttiioonn,, IInnssppeeccttiioonn..
((ii)) WWBBSS--eelleemmeenntt wwiissee ""SS"" CCuurrvvee aanndd OOvveerraallll PPhhyyssiiccaall PPrrooggrreessss
CCuurrvvee
((jj)) LLiisstt ooff KKeeyy MMiilleessttoonneess aanndd ddaattee ooff aaccttuuaall aacchhiieevveemmeenntt..
((kk)) LLiisstt ooff PPOO''ss // WWOO''ss,, iinncclluuddiinngg VVeennddoorr''ss nnaammee aanndd ccoonnttaacctt
ddeettaaiillss..
((ll)) EExxppeerriieennccee ggaaiinneedd dduurriinngg PPrroojjeecctt EExxeeccuuttiioonn aanndd iimmpprroovveemmeennttss
ffoorr ffuuttuurree pprroojjeeccttss..
((mm)) CCoonnssttrruuccttiioonn PPhhoottooggrraapphhss..
1111.. CCOONNSSUULLTTAANNTT’’SS MMAANNPPOOWWEERR
1111..11 TThhee CCoonnssuullttaanntt sshhaallll ddeeppllooyy rreeqquuiirreedd nnuummbbeerr ooff mmaannppoowweerr,, qquuaalliiffiieedd aanndd
eexxppeerriieenncceedd ppeerrssoonnnneell ee..gg.. pprrooffeessssiioonnaall eennggiinneeeerrss,, ssuubboorrddiinnaattee eennggiinneeeerriinngg
ppeerrssoonnnneell,, ccoonnssttrruuccttiioonn ssuuppeerrvviissoorrss,, iinnssppeeccttoorrss aanndd ootthheerr ssppeecciiaalliissttss ooff
aapppprroopprriiaattee lleevveellss ttoo eennssuurree::
•• QQuuaalliittyy iinn aallll ssttaaggeess aanndd aassppeeccttss aass ppeerr rreeqquuiirreemmeenntt ooff ccooddeess,,
ssttaannddaarrddss,, ssppeecciiffiiccaattiioonnss aanndd bbeesstt iinntteerrnnaattiioonnaall pprraaccttiicceess..
•• TTiimmeellyy && eexxppeeddiittiioouuss ccoommpplleettiioonn ooff tthhee pprroojjeecctt..
•• EEccoonnoommiizzee pprroojjeecctt eexxppeennsseess..
1111..22 QQuuaalliiffiiccaattiioonn aanndd eexxppeerriieennccee rreeqquuiirreemmeenntt ooff tthhee ccoonnssuullttaanntt ppeerrssoonnnneell aarree
ggiivveenn hheerreeuunnddeerr aatt CCllaauussee 1111..44..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 96 of 154
1111..33 TThhee ccoonnssuullttaanntt sshhaallll ssuubbmmiitt tthhee ffoolllloowwiinngg ffoorr aapppprroovvaall ooff tthhee oowwnneerr aafftteerr
aawwaarrdd ooff aaggrreeeemmeenntt
__ OOrrggaannooggrraamm aatt PPrroojjeecctt –– HHOO && SSiittee
__ MMaannnniinngg SScchheedduullee
1111..44 TThhee PPMMCC wwiillll bbee rreeqquuiirreedd ttoo ddeeppuuttee qquuaalliiffiieedd,, eexxppeerriieenncceedd mmaannppoowweerr ffoorr tthhee
eexxeeccuuttiioonn ooff tthhee PPrroojjeecctt.. TThhee ccoonnssuullttaanntt wwiillll eennssuurree tthhaatt tthhee ccoommpplleettee
mmaannppoowweerr wwhhoossee nnaammeess hhaavvee bbeeeenn pprrooppoosseedd ttoo bbee ddeeppllooyyeedd ffoorr tthhee PPrroojjeecctt
eexxeeccuuttiioonn aatt tthhee ttiimmee ooff ssuubbmmiissssiioonn ooff tthhee bbiiddss aarree nnoott cchhaannggeedd dduurriinngg PPrroojjeecctt
eexxeeccuuttiioonn.. IInn ccaassee ooff cchhaannggee iinn pprrooppoosseedd ppeerrssoonnnneell,, tthhee PPMMCC wwiillll ssuubbmmiitt bbiioo
ddaattaa ooff tthhee ssuubbssttiittuuttee mmaannppoowweerr pprrooppoosseedd aanndd ttaakkee GGAAIILL''ss aapppprroovvaall.. TThhee
vvaarriioouuss ccaatteeggoorriieess ooff mmaannppoowweerr rreeqquuiirreedd ttoo bbee ddeeppllooyyeedd ffoorr tthhee PPrroojjeecctt aarree
ddeettaaiilleedd uunnddeerr::
SSll.. TTyyppee QQuuaall ii ff iiccaatt iioonn && kknnoowwlleeddggee EExxppeerriieennccee
[[11]] PPrroojjeecctt
MMaannaaggeerr
•• DDeeggrreeee iinn EEnnggiinneeeerriinngg iinn aannyy
DDiisscciipplliinnee
•• KKnnoowwlleeddggee ooff PPrroojjeecctt
MMaannaaggeemmeenntt,, CCoonnttrraaccttss
MMaannaaggeemmeenntt,, CCooddeess aanndd
SSttaannddaarrddss ppeerrttaaiinniinngg ttoo ggaass
ppiippeelliinneess,, IInndduussttrryy aacccceepptteedd
BBeesstt PPrraaccttiicceess iinn eexxeeccuuttiinngg
ppiippeelliinnee pprroojjeeccttss,,
GGoovveerrnnmmeenntt GGuuiiddeelliinneess
OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1122 yyeeaarrss
eexxppeerriieennccee iinn eexxeeccuuttiinngg pprroojjeeccttss iinn
HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee.. HHyyddrrooccaarrbboonn
PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn //
CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall PPllaanntt,,
LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc..
MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1122
yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 66 yyeeaarrss''
eexxppeerriieennccee mmuusstt bbee iinn sseenniioorr ppoossiittiioonn iinn
eexxeeccuuttiioonn ooff hhyyddrrooccaarrbboonn ppiippeelliinnee
pprroojjeeccttss..
[[22]] AAssssiissttaanntt //
DDeeppuuttyy
PPrroojjeecctt
MMaannaaggeerr
•• DDeeggrreeee iinn EEnnggiinneeeerriinngg iinn aannyy
DDiisscciipplliinnee
•• KKnnoowwlleeddggee ooff PPrroojjeecctt
MMaannaaggeemmeenntt,, CCoonnttrraaccttss
MMaannaaggeemmeenntt,, CCooddeess aanndd
SSttaannddaarrddss ppeerrttaaiinniinngg ttoo ggaass
ppiippeelliinneess,, IInndduussttrryy aacccceepptteedd
BBeesstt PPrraaccttiicceess iinn eexxeeccuuttiinngg
ppiippeelliinnee pprroojjeeccttss..
OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1100 yyeeaarrss
eexxppeerriieennccee iinn eexxeeccuuttiinngg pprroojjeeccttss iinn
HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee.. HHyyddrrooccaarrbboonn
PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn //
CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall PPllaanntt,,
LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc..
MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1100
yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 55 yyeeaarrss''
eexxppeerriieennccee mmuusstt bbee iinn eexxeeccuuttiioonn ooff
hhyyddrrooccaarrbboonn ppiippeelliinnee pprroojjeeccttss
[[33]] CCoonnttrraaccttss
MMaannaaggeerr
•• DDeeggrreeee // DDiipplloommaa // MMBBAA iinn
CCoonnttrraaccttss MMaannaaggeemmeenntt //
DDeeggrreeee iinn EEnnggiinneeeerriinngg
KKnnoowwlleeddggee ooff PPrrooccuurreemmeenntt
&& CCoonnttrraaccttss ffoorr ggooooddss
rreellaatteedd ttoo hhyyddrrooccaarrbboonn
iinndduussttrryy,, ppiippeelliinneess
OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1100 yyeeaarrss
eexxppeerriieennccee iinn eexxeeccuuttiinngg pprroojjeeccttss iinn
HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee.. HHyyddrrooccaarrbboonn
PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn
// CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall
PPllaanntt,, LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc..
MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1100
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 97 of 154
•• KKnnoowwlleeddggee ooff rreegguullaattiioonnss,,
nnoottiiffiiccaattiioonnss,, aaccttss ppeerrttaaiinniinngg
ttoo pprrooccuurreemmeenntt ooff ggooooddss,,
wwoorrkkss ccoonnttrraacctt,, llooccaall ttaaxx
ssttrruuccttuurree,, ssttoorreess
mmaannaaggeemmeenntt,, eettcc..
yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 55 yyeeaarrss''
eexxppeerriieennccee mmuusstt bbee iinn sseenniioorr ppoossiittiioonn iinn
eexxeeccuuttiioonn ooff hhyyddrrooccaarrbboonn ppiippeelliinnee
pprroojjeeccttss..
[[44]] PPllaannnniinngg
MMaannaaggeerr
•• DDeeggrreeee // DDiipplloommaa iinn
EEnnggiinneeeerriinngg // PPrroojjeecctt
MMaannaaggeemmeenntt..
•• KKnnoowwlleeddggee ooff PPllaannnniinngg &&
SScchheedduulliinngg ffoorr pprroojjeeccttss
rreellaatteedd ttoo hhyyddrrooccaarrbboonn
iinndduussttrryy,, ppiippeelliinneess..
•• KKnnoowwlleeddggee ooff vvaarriioouuss
aaccttiivviittiieess rreellaatteedd ttoo
eexxeeccuuttiioonn ooff ppiippeelliinnee
pprroojjeeccttss..
OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 88 yyeeaarrss
eexxppeerriieennccee iinn eexxeeccuuttiinngg pprroojjeeccttss iinn
HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee.. HHyyddrrooccaarrbboonn
PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn
// CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall
PPllaanntt,, LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc..
MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 88
yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 44 yyeeaarrss''
eexxppeerriieennccee mmuusstt bbee iinn sseenniioorr ppoossiittiioonn iinn
eexxeeccuuttiioonn ooff hhyyddrrooccaarrbboonn ggaass ppiippeelliinnee
pprroojjeeccttss..
[[55]] EEnnggiinneeeerriinngg
MMaannaaggeerr
•• DDeeggrreeee // DDiipplloommaa iinn aannyy
ddiisscciipplliinnee ooff EEnnggiinneeeerriinngg..
•• KKnnoowwlleeddggee ooff aallll ssttaannddaarrddss,,
ccooddeess rreeqquuiirreedd ffoorr tthhee
ddeessiiggnn aanndd eennggiinneeeerriinngg ooff
ppiippeelliinnee pprroojjeeccttss..
•• KKnnoowwlleeddggee ooff mmaatteerriiaallss aanndd
mmeettaalllluurrggiiccaall pprrooppeerrttiieess ffoorr
mmaatteerriiaallss uusseedd iinn ppiippeelliinnee
pprroojjeeccttss..
•• KKnnoowwlleeddggee ooff IInndduussttrryy
aacccceepptteedd BBeesstt PPrraaccttiicceess iinn
ddeessiiggnniinngg && eennggiinneeeerriinngg
ppiippeelliinnee pprroojjeeccttss..
•• KKnnoowwlleeddggee ooff wwoorrkkiinngg iinn
ssooffttwwaarree ttoooollss rreellaatteedd ttoo
ssyysstteemm ssiizziinngg,, ssyysstteemm
ooppttiimmiizzaattiioonn,, ssiimmuullaattiioonn,,
eennggiinneeeerriinngg,, eettcc..
OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1122 yyeeaarrss
eexxppeerriieennccee iinn eexxeeccuuttiinngg pprroojjeeccttss iinn
HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee.. HHyyddrrooccaarrbboonn
PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn
//CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall PPllaanntt,,
LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc..
MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1122
yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 66 yyeeaarrss''
eexxppeerriieennccee mmuusstt bbee iinn sseenniioorr ppoossiittiioonn iinn
ddeessiiggnn && eennggiinneeeerriinngg ooff HHyyddrrooccaarrbboonn
ppiippeelliinnee pprroojjeeccttss..
[[66]] FFiinnaannccee
MMaannaaggeerr
•• GGrraadduuaattee iinn CCoommmmeerrccee //
IICCWWAA // CCAA // MMBBAA iinn
FFiinnaannccee
•• KKnnoowwlleeddggee ooff aacctt // rruulleess //
rreegguullaattiioonnss// nnoottiiffiiccaattiioonnss
ppeerrttaaiinniinngg ttoo FFiinnaanncciiaall
MMaannaaggeemmeenntt ii..ee.. ttaaxxeess &&
OOvveerraallll EExxppeerriieennccee:: 1100 yyeeaarrss ooff rreelleevvaanntt
eexxppeerriieennccee..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 98 of 154
dduuttiieess
•• KKnnoowwlleeddggee ooff ttaaxx // dduuttyy
ssttrruuccttuurree ffoorr iinnddiiggeennoouuss &&
iimmppoorrtteedd pprrooccuurreemmeenntt..
[[77]] CCoonnssttrruuccttiioonn
MMaannaaggeerr
•• DDeeggrreeee iinn EEnnggiinneeeerriinngg iinn
aannyy DDiisscciipplliinnee // DDiipplloommaa iinn
PPrroojjeecctt MMaannaaggeemmeenntt
•• KKnnoowwlleeddggee ooff PPrroojjeecctt
MMaannaaggeemmeenntt,, CCoonnssttrruuccttiioonn
MMaannaaggeemmeenntt,, hhaannddlliinngg ooff
CCoonnttrraaccttss,, CCooddeess aanndd
SSttaannddaarrddss ppeerrttaaiinniinngg ttoo
ccoonnssttrruuccttiioonn ooff ggaass
ppiippeelliinneess,, IInndduussttrryy aacccceepptteedd
BBeesstt PPrraaccttiicceess iinn eexxeeccuuttiinngg
ppiippeelliinnee pprroojjeeccttss..
OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1122 yyeeaarrss
eexxppeerriieennccee iinn eexxeeccuuttiinngg pprroojjeeccttss iinn
HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee.. HHyyddrrooccaarrbboonn
PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn //
CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall PPllaanntt,,
LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc..
MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1122
yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 66 yyeeaarrss''
eexxppeerriieennccee mmuusstt bbee iinn sseenniioorr ppoossiittiioonn iinn
wwoorrkkss rreellaatteedd ttoo ccoonnssttrruuccttiioonn ooff
hhyyddrrooccaarrbboonn ppiippeelliinnee pprroojjeeccttss..
[[88]] IInnssppeeccttiioonn
MMaannaaggeerr
•• DDeeggrreeee // DDiipplloommaa iinn
EEnnggiinneeeerriinngg iinn aannyy
DDiisscciipplliinnee aalloonngg wwiitthh AANNSSTT
// IINNSSTT LLeevveell IIII // IIIIII
cceerrttiiffiiccaattiioonn..
•• KKnnoowwlleeddggee ooff ccooddeess //
ssttaannddaarrddss ffoorr mmaannuuffaaccttuurriinngg
aanndd iinnssppeeccttiioonn ooff lliinnee
mmaatteerriiaallss ffoorr ppiippeelliinnee
pprroojjeeccttss..
OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1100 yyeeaarrss
eexxppeerriieennccee iinn eexxeeccuuttiioonn ooff pprroojjeeccttss //
iinnssppeeccttiioonn iinn HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee..
HHyyddrrooccaarrbboonn PPrroocceessss PPllaannttss,, PPiippeelliinneess
((HHyyddrrooccaarrbboonn // CCrruuddee // OOiill // GGaass)),,
PPeettrroocchheemmiiccaall PPllaanntt,, LLPPGG PPllaanntt,,
RReeffiinneerryy,, eettcc..
MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1100
yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 55 yyeeaarrss''
eexxppeerriieennccee mmuusstt bbee iinn iinnssppeeccttiioonn wwoorrkkss
rreellaatteedd ttoo ppiippeelliinnee mmaatteerriiaallss // ppiippeelliinnee
ccoonnssttrruuccttiioonn..
TThhee ssuuppppoorrttiinngg ssttaaffff // mmaannppoowweerr uunnddeerr eeaacchh ttyyppee mmuusstt hhaavvee tthhee wwoorrkkiinngg
eexxppeerriieennccee ooff aatt lleeaasstt 77 yyeeaarrss iinn HHyyddrrooccaarrbboonn IInndduussttrryy ii..ee.. HHyyddrrooccaarrbboonn
PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn // CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall
PPllaanntt,, LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc.. oouutt ooff wwhhiicchh aatt lleeaasstt 33 yyeeaarrss'' eexxppeerriieennccee mmuusstt
bbee iinn tthhee rreelleevvaanntt wwoorrkkiinngg aarreeaa..
1111..55 FFoorr tthhee ppiippeelliinnee ccoonnssttrruuccttiioonn aaccttiivviittiieess tthhee iinnddiiccaattiivvee ssttrruuccttuurree ooff mmaannppoowweerr
ttoo bbee ddeeppllooyyeedd bbyy tthhee PPMMCC ffoorr ooppttiimmaall wwoorrkk oouuttppuutt iiss aass uunnddeerr::
1111..55..11 PPiippeelliinnee LLaayyiinngg aanndd TTeerrmmiinnaall WWoorrkkss::
PPiippeelliinnee LLaayyiinngg iiss aa SSppeecciiaalliizzeedd JJoobb wwhheerreeiinn lloott ooff rreessoouurrccee
iinncclluuddiinngg mmaannppoowweerr aanndd eeqquuiippmmeenntt hhaass ttoo bbee mmoobbiilliizzeedd bbeeffoorree tthhee
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 99 of 154
aaccttuuaall ffrroonntt eenndd aaccttiivviittiieess ssttaarrttss.. TThhee ffoolllloowwiinngg aaccttiivviittiieess aarree
iinnvvoollvveedd iinn llaayyiinngg wwoorrkkss::
[[11]] RROOUU AAccqquuiissiittiioonn
[[22]] SSttrriinnggiinngg
[[33]] TTrreenncchhiinngg
[[44]] WWeellddiinngg
[[55]] JJooiinntt CCooaattiinngg
[[66]] LLoowweerriinngg && BBaacckkffiilllliinngg
[[77]] TTiiee--IInn
[[88]] HHyyddrroo--tteessttiinngg
[[99]] DDrryyiinngg,, PPiiggggiinngg,, GGaass--IInn
[[1100]] AAtttteennddiinngg aanndd lliiqquuiiddaattiinngg cchheecckk lliisstt ppooiinnttss
1111..55..22 TTeerrmmiinnaall WWoorrkkss::
FFoorr TTeerrmmiinnaall WWoorrkkss ffoolllloowwiinngg aaccttiivviittiieess aarree nnoorrmmaallllyy ccaarrrriieedd oouutt,,
bbuutt nnoott lliimmiitteedd ttoo ffoolllloowwiinngg::
[[11]] SSiittee GGrraaddiinngg..
[[22]] CCiivviill WWoorrkkss aanndd CCoonnssttrruuccttiioonn AAccttiivviittiieess..
[[33]] IInnssttaallllaattiioonn ooff GGaass MMeetteerriinngg SSyysstteemm,, PPCCVV''ss,, SSDDVV''ss,, FFiillttrraattiioonn
SSyysstteemm,, GGaass CChhrroommaattooggrraapphh..
[[44]] WWoorrkkss ppeerrttaaiinniinngg ttoo iinnssttaallllaattiioonn ooff MMeecchhaanniiccaall EEqquuiippmmeennttss //
TTeelleeccoomm // SSCCAADDAA ssyysstteemm..
[[55]] WWoorrkkss ppeerrttaaiinniinngg ttoo EElleeccttrriiccaall aanndd IInnssttrruummeennttaattiioonn..
[[66]] TTeessttiinngg && ccoommmmiissssiioonniinngg..
TThhee PPMMCC hhaass ttoo mmaaiinnttaaiinn mmiinniimmuumm 0022 nnooss.. ooff mmaannppoowweerr aatt ccoonnssttrruuccttiioonn
ssiittee ffoorr bbootthh mmaaiinnlliinnee aanndd ssttaattiioonn wwoorrkkss aatt aallll ttiimmee aatt ssiittee..
IINNDDIICCAATTIIVVEE SSIITTEE OORRGGAANNIIZZAATTIIOONN CCHHAARRTT FFOORR PPMMCC MMAANNPPOOWWEERR
PPrroojjeecctt IInn--CChhaarrggee
RROOUU
SSttrriinnggiinngg
TTrreenncchhiinngg
WWeellddiinngg &&
NNDDTT
JJooiinntt CCooaattiinngg
LLoowweerriinngg
BBaacckkffiilllliinngg
TTiiee--iinn
HHyyddrrootteessttiinngg
DDrryyiinngg--ppiiggggiinngg
GGaass iinn
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 100 of 154
11 nnuummbbeerr ooff
qquuaalliiffiieedd
ccoonnssttrruuccttiioonn
mmaannppoowweerr
22 nnuummbbeerrss ooff
qquuaalliiffiieedd
mmaannppoowweerr ffoorr
ssuuppeerrvviissiioonn
22 nnuummbbeerrss ooff
qquuaalliiffiieedd
ccoonnssttrruuccttiioonn
mmaannppoowweerr
22 nnuummbbeerrss ooff
qquuaalliiffiieedd
ccoonnssttrruuccttiioonn
mmaannppoowweerr
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 101 of 154
PPMMCC MMAANNPPOOWWEERR EESSTTIIMMAATTEESS -- MMaaiinnlliinnee
SSll.. TTyyppee AAccttiivviittyy CCoonnssuullttaanntt
[[11]] FFrroonntt--EEnndd
AAccttiivviittiieess
RROOUU OOppeenniinngg 0011
[[22]] SSttrriinnggiinngg
[[33]] TTrreenncchhiinngg
[[44]] WWeellddiinngg 0022
[[55]] BBaacckk--EEnndd
AAccttiivviittiieess
JJooiinntt CCooaattiinngg 0022
[[66]] LLoowweerriinngg &&
BBaacckkffiilllliinngg
[[77]] TTiiee--IInn 0044**
[[88]] HHyyddrroo--tteessttiinngg
[[99]] DDrryyiinngg,, PPiiggggiinngg,, GGaass
IInn
[[1100]] SSCCAADDAA // TTeelleeccoomm
[[1111]] CCaatthhooddiicc PPrrootteeccttiioonn
[[1122]] SSuubb--ttoottaall 0099
[[1133]] OOppeenniinngg // SSpprreeaadd IInn--cchhaarrggee 0011
[[1144]] TTOOTTAALL 1100
NNoottee:: ** -- FFrroonntt eenndd ppeerrssoonnss mmaayy bbee rreeddeeppllooyyeedd,, iiff aaccttiivviittiieess aarree nnoott ssiimmuullttaanneeoouuss..
PPMMCC MMAANNPPOOWWEERR EESSTTIIMMAATTEESS -- TTeerrmmiinnaall
SSll.. AAccttiivviittyy CCoonnssuullttaanntt
MMaannppoowweerr
[[11]] CCiivviill WWoorrkkss aanndd CCoonnssttrruuccttiioonn
AAccttiivviittiieess
0011
[[22]] TTeerrmmiinnaall wweellddiinngg wwoorrkkss ––
ffaabbrriiccaattiioonn aanndd eerreeccttiioonn
0011
TThhee CCoonnssuullttaanntt sshhaallll ssuubbmmiitt tthhee ffoolllloowwiinngg aalloonngg wwiitthh tthhee BBiidd DDooccuummeenntt::
[[11]] BBiioo--DDaattaa ooff tthhee KKeeyy ppeerrssoonnnneell aanndd tthheeiirr eexxppeerriieennccee vviizz.. PPrroojjeecctt
MMaannaaggeerr,, EEnnggiinneeeerriinngg MMaannaaggeerr,, CCoonnssttrruuccttiioonn MMaannaaggeerr,, PPllaannnniinngg
MMaannaaggeerr,, IInnssppeeccttiioonn MMaannaaggeerr,, CCoonnttrraaccttss MMaannaaggeerr mmuusstt bbee eenncclloosseedd
aalloonngg wwiitthh tthhee bbiidd..
[[22]] SSuubbssttiittuuttiinngg ooff PPMMCC''ss ppeerrssoonnnneell wwiitthh ootthheerr PPMMCC''ss ppeerrssoonnnneell wwiillll bbee
ddoonnee wwiitthh eeiitthheerr ssaammee lleevveell && eexxppeerriieennccee oorr hhiigghheerr lleevveell &&
eexxppeerriieenncceedd ppeerrssoonnnneell..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 102 of 154
[[33]] TThhee PPMMCC hhaass ttoo mmaaiinnttaaiinn mmiinniimmuumm 0022 nnooss.. ooff mmaannppoowweerr aatt
ccoonnssttrruuccttiioonn ssiittee ffoorr bbootthh mmaaiinnlliinnee aanndd ssttaattiioonn wwoorrkkss.. IInn oorrddeerr ttoo
eexxppeeddiittee pprrooggrreessss,, wwiitthhiinn tthhee ssaammee ssccooppee ooff wwoorrkk,, PPMMCC mmaayy bbee
rreeqquuiirreedd ttoo aauuggmmeenntt wwiitthh mmoorree mmaannppoowweerr wwiitthhoouutt aannyy aaddddiittiioonnaall
ffiinnaanncciiaall iimmpplliiccaattiioonnss ttoo GGAAIILL..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 103 of 154
1122.. PPRROOJJEECCTT EEXXEECCUUTTIIOONN MMEETTHHOODDOOLLOOGGYY
1122..11 TThhee PPMMCC wwiillll bbee rreeqquuiirreedd ttoo pprreeppaarree aann EExxeeccuuttiioonn MMeetthhooddoollooggyy ffoorr eexxeeccuuttiinngg
tthhee ppiippeelliinnee PPrroojjeecctt wwiitthh tthhee aaiimm ttoo eexxeeccuuttee tthhee PPrroojjeecctt iinn sscchheedduullee ttiimmee,,
eeccoonnoommiizzee tthhee PPrroojjeecctt ccoosstt aanndd eexxeeccuuttee tthhee PPrroojjeecctt iinn tthhee mmoosstt eeffffeeccttiivvee wwaayy..
TThhee mmeetthhooddoollooggyy wwiillll bbee pprreeppaarreedd wwiitthhiinn tthhee ffrraammeewwoorrkk ooff tthhee GGAAIILL''ss
pprroocceedduurreess iinn vvoogguuee.. TThhee ffoolllloowwiinngg sseeccttiioonnss oouuttlliinnee tthhee aarreeaa wwhhiicchh nneeeeddss ttoo
bbee ccoovveerreedd iinn tthhee EExxeeccuuttiioonn MMeetthhooddoollooggyy..
SS..NN IItteemm DDeessccrriippttiioonn
[[AA]] DDeettaaiill EEnnggiinneeeerriinngg TThhiiss wwiillll ccoovveerr tthhee ddeettaaiillss ffoorr eennggiinneeeerriinngg
ttoo bbee ddoonnee uunnddeerr vvaarriioouuss ddiisscciipplliinneess,,
lliissttiinngg ooff rreeqquuiirreemmeennttss,, pprreeppaarraattiioonn ooff
ssppeecciiffiiccaattiioonnss,, mmaatteerriiaall rreeqquuiissiittiioonnss,,
pprroocceessss ddeessiiggnn bbaassiiss,, ppiippeelliinnee ssiizziinngg,,
rreecceeiipptt // ddiissppaattcchh tteerrmmiinnaallss,, eettcc.. LLiissttiinngg ooff
SSttaannddaarrddss bbaasseedd oonn wwhhiicchh tthhee eennggiinneeeerriinngg
hhaass bbeeeenn ddoonnee iitteemm--wwiissee..
[[BB]] SSeelleeccttiioonn ooff
TTeecchhnnoollooggyy ffoorr vvaarriioouuss
MMaatteerriiaallss // EEqquuiippmmeennttss
TThhiiss wwiillll hhiigghhlliigghhtt tthhee ddeettaaiillss ffoorr tthhee
tteecchhnnoollooggyy ttoo bbee sseelleecctteedd ffoorr hhiigghh vvaalluuee
iitteemmss lliikkee tteerrmmiinnaall ppiippeess,, ppoowweerr ssoouurrccee,,
SSCCAADDAA,, tteelleeccoomm,, mmeetteerriinngg,, eettcc.. TTyyppee ooff
ppiippeess,, ppiippee ggrraaddee,, eettcc..
[[CC]] CCoonnttrraaccttss
MMaannaaggeemmeenntt::
PPrrooccuurreemmeenntt SSttrraatteeggyy
((OOppeenn TTeennddeerrss,,
LLiimmiitteedd TTeennddeerrss,,
MMVVLL)) ffoorr PPrrooccuurreemmeenntt
PPaacckkaaggee,, WWoorrkkss
PPaacckkaaggee
TThhiiss wwiillll hhiigghhlliigghhtt tthhee iiddeennttiiffiiccaattiioonn ooff aallll
mmaatteerriiaallss aanndd wwoorrkkss aanndd tthheeiirr ppaacckkaaggiinngg
ffoorr tteennddeerriinngg aanndd eexxeeccuuttiioonn.. EEssttiimmaattiinngg
tthhee ccoosstt ooff eeaacchh mmaatteerriiaall,, wwoorrkkss ppaacckkaaggee..
MMooddee ooff tteennddeerriinngg iinnlliinnee wwiitthh GGAAIILL
CCoonnttrraaccttss && PPrrooccuurreemmeenntt PPrroocceedduurree.. LLiisstt
ooff vveennddoorrss aass ppeerr tthhee MMaasstteerr VVeennddoorr LLiisstt
ooff PPMMCC ffoorr iitteemmss ttoo bbee pprrooccuurreedd tthhrroouugghh
lliimmiitteedd tteennddeerriinngg..
[[DD]] CCoonnssttrruuccttiioonn
MMaannaaggeemmeenntt
IIddeennttiiffiiccaattiioonn aanndd ffiinnaalliizzaattiioonn ooff nnuummbbeerr ooff
sseeccttiioonnss // sspprreeaadd iinn lliinnee wwiitthh bbeesstt
iinntteerrnnaattiioonnaall pprraaccttiicceess.. IIddeennttiiffiiccaattiioonn aanndd
ffiinnaalliizzaattiioonn ooff llooccaattiioonnss ffoorr ccaammpp ooffffiicceess
aalloonngg ppiippeelliinnee rroouuttee.. IIddeennttiiffiiccaattiioonn aanndd
llooccaattiioonn ooff dduummpp--ssiitteess ffoorr lliinnee ppiippeess..
CCoonnssttrruuccttiioonn ssttrraatteeggyy aanndd sscchheedduullee..
CCeerrttiiffiiccaattiioonn ooff ccoonnttrraaccttoorrss'' bbiillllss..
[[EE]] IInnssppeeccttiioonn PPllaann DDeettaaiilleedd ppllaann && mmeetthhooddoollooggyy ffoorr
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 104 of 154
iinnssppeeccttiioonn ffoorr vvaarriioouuss ccaatteeggoorriieess ooff
mmaatteerriiaallss aanndd ccoonnssttrruuccttiioonn iinncclluuddiinngg::
__ PPiippiinngg MMaatteerriiaallss
__ MMaaiinn LLiinnee VVaallvveess,, TTeerrmmiinnaall VVaallvveess
__ CCoonnssttrruuccttiioonn
__ FFAATT // SSAATT ffoorr SSCCAADDAA,, TTeelleeccoomm aanndd
ootthheerr PPaacckkaaggeess..
MMeetthhooddoollooggyy ffoorr rreelleeaassee ooff mmaatteerriiaallss aafftteerr
iinnssppeeccttiioonn.. DDeeppllooyymmeenntt sscchheedduullee ooff
mmaannppoowweerr ffoorr IInnssppeeccttiioonn..
[[FF]] SSttoorreess && MMaatteerriiaallss
MMaannaaggeemmeenntt
TTeennddeerriinngg aanndd aassssiissttiinngg GGAAIIll CC&&PP ––SSttoorreess
ooff mmaatteerriiaall rreecceeiipptt aanndd iinnssppeeccttiioonn
[[GG]] PPrroojjeecctt CCoommmmiissssiioonniinngg
&& SSttaarrttuupp
MMeetthhooddoollooggyy ffoorr CCoommmmiissssiioonniinngg &&
SSttaarrttuupp.. PPrreeppaarraattiioonn ooff OOppeerraattiioonn aanndd
MMaaiinntteennaannccee MMaannuuaallss,, DDiissaasstteerr
MMaannaaggeemmeenntt PPllaann,, EEmmeerrggeennccyy AAccttiioonn
PPllaann..
[[HH]] HHSSEE PPllaann HHeeaalltthh && SSaaffeettyy gguuiiddeelliinneess rreeqquuiirreedd ttoo bbee
ffoolllloowweedd iinn ccoonnssttrruuccttiioonn,,ccoommmmiissssiioonniinngg &&
ssttaarrttuupp..
[[II]] PPrroojjeecctt PPllaannnniinngg &&
SScchheedduulliinngg
DDeettaaiilleedd ppllaannss aanndd sscchheedduullee ffoorr vvaarriioouuss
eelleemmeennttss ooff WWBBSS.. OOvveerraallll PPrroojjeecctt SScchheedduullee
&& PPllaann.. FFiinnaanncciiaall CCoommmmiittmmeenntt SScchheedduullee &&
aanndd CCaasshh ffllooww PPllaann ffoorr vvaarriioouuss oorrddeerrss..
[[JJ]] PPrroojjeecctt HHaarrdd CCoossttss BBaassiiss ooff ccoosstt eessttiimmaattee aanndd eessttiimmaatteedd ccoosstt
aaggaaiinnsstt vvaarriioouuss pprrooccuurreemmeenntt && wwoorrkkss
ppaacckkaaggee..
[[KK]] RReessoouurrccee RReeqquuiirreemmeenntt SScchheedduullee ffoorr ddeeppllooyymmeenntt ooff mmaannppoowweerr ffoorr
PPrroojjeecctt OOffffiiccee aanndd CCoonnssttrruuccttiioonn SSiittee..
OOrrggaannooggrraamm ffoorr PPrroojjeecctt OOffffiiccee &&
CCoonnssttrruuccttiioonn SSiittee..
[[LL]] PPrroojjeecctt CClloosseeoouutt PPMMCC wwiillll ddeevviissee aanndd ssuuggggeesstt tthhee
mmeetthhooddoollooggyy ffoorr pprroojjeecctt cclloosseeoouutt,,
ddeelliivveerraabblleess rreeqquuiirreedd ttoo bbee ssuubbmmiitttteedd
dduurriinngg cclloosseeoouutt,, sscchheedduullee ffoorr cclloosseeoouutt..
1122..22 PPrrooccuurreemmeenntt // WWoorrkkss PPaacckkaaggeess::
DDeettaaiill EEnnggiinneeeerriinngg iiss ttoo bbee ccaarrrriieedd oouutt bbyy tthhee PPMMCC iinncclluuddiinngg tthhee ssiizziinngg aanndd
eennggiinneeeerriinngg ooff aallll tthhee mmaajjoorr iitteemmss.. IInnssppeeccttiioonn ooff tthhee aallll mmaajjoorr iitteemmss mmeennttiioonneedd
bbeellooww iiss ttoo bbee ccaarrrriieedd oouutt bbyy tthhee PPMMCC.. TThhee lliisstt bbeellooww iiss iinnddiiccaattiivvee.. TThheerree mmaayy
bbee ssoommee iitteemmss wwhhiicchh ccaann bbee ddiirreeccttllyy pprrooccuurreedd tthhrroouugghh tteennddeerriinngg.. TThhee lliisstt wwiillll
bbee ffiinnaalliizzeedd aatt aapppprroopprriiaattee ttiimmee,, pprreeffeerraabbllyy dduurriinngg kkiicckk--ooffff mmeeeettiinngg.. NNoo
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 105 of 154
aaddddiittiioonnaall aammoouunntt iiss ppaayyaabbllee ttoo tthhee PPMMCC ffoorr tteennddeerriinngg ooff mmoorree oorr lleessss nnooss..
ppaacckkaaggeess tthhaann mmeennttiioonneedd bbeellooww::
SS..NN PPaacckkaaggee DDeessccrriippttiioonn
[[11]] TTrraannssppoorrttaattiioonn aanndd ssttoorraaggee ooff LLiinnee PPiippeess
[[22]] SSccrraappppeerrss,, FFllooww TTeeeess,, PPiigg SSiiggnnaalleerrss,, QQOOEECC
[[33]] IInnssuullaattiinngg JJooiinnttss
[[44]] PPiippee LLiinnee BBaallll VVaallvveess
[[55]] OOtthheerr BBaallll VVaallvveess
[[66]] PPrreessssuurree RReedduuccttiioonn aanndd MMeetteerriinngg SSkkiiddss
[[77]] CCoommppoossiittee CCoonnssttrruuccttiioonn PPaacckkaaggee iinncclluuddiinngg ffoolllloowwiinngg PPrrooccuurreemmeennttss
aanndd WWoorrkkss ::
PPrrooccuurreemmeenntt::
ii.. OOFFCC aanndd HHDDPPEE DDuuccttss
iiii.. TTeelleeccoommmmuunniiccaattiioonn SSyysstteemm
iiiiii.. RRTTUU && SSCCAADDAA
iivv.. GGaass DDeetteeccttiioonn SSyysstteemmss
vv.. TTeerrmmiinnaall BBaallll VVaallvveess
vvii.. AAssssoorrtteedd PPiippeess,, FFiittttiinnggss,, FFllaannggeess,, BBoollttss,, NNuuttss,, GGaasskkeettss aanndd aallll
rreellaatteedd hhaarrddwwaarree ((ootthheerr tthhaann pprrooccuurreedd aabboovvee))
vviiii.. GGlloobbee VVaallvveess,, CChheecckk VVaallvveess,, NNRRVV''ss,, PPlluugg VVaallvveess
vviiiiii.. CCaabblleess,, IInnssttrruummeennttss,, UUPPSS,, BBaatttteerriieess
iixx.. PPoowweerr SSoouurrcceess
xx.. AAllll ootthheerr MMaatteerriiaallss nnoott iinncclluuddeedd aabboovvee..
WWoorrkkss::
ii.. LLaayyiinngg ooff PPiippeelliinnee aanndd AAssssoocciiaatteedd FFaacciilliittiieess
iiii.. CCaatthhooddiicc PPrrootteeccttiioonn WWoorrkkss
iiiiii.. CCoonnssttrruuccttiioonn aanndd EErreeccttiioonn ooff TTeerrmmiinnaall FFaacciilliittiieess,, iinncclluuddiinngg
IInnssttaallllaattiioonn ooff aallll EEqquuiippmmeennttss
iivv.. AAllll CCiivviill,, MMeecchhaanniiccaall,, EElleeccttrriiccaall,, IInnssttrruummeennttaattiioonn WWoorrkkss
vv.. CCoommmmiissssiioonniinngg
vvii.. HHyyddrroollooggiiccaall SSuurrvveeyy && GGeeootteecchhnniiccaall SSeerrvviicceess..
1122..33 EExxeeccuuttiioonn PPllaann::
PPrroojjeecctt eexxeeccuuttiioonn mmeetthhooddoollooggyy ttoo ccoommpplleettee tthhee pprroojjeecctt wwiitthhiinn tthhee ggiivveenn
sscchheedduullee sshhaallll bbee ssuubbmmiitttteedd bbyy tthhee PPMMCC iimmmmeeddiiaatteellyy aafftteerr aawwaarrdd ooff tthhee
ccoonnttrraacctt.. SSuucchh eexxeeccuuttiioonn ooff mmeetthhooddoollooggyy wwiillll bbee ddiissccuusssseedd aanndd iinn ccaassee aannyy
aammeennddmmeenntt// mmooddiiffiiccaattiioonnss iinn tthhee mmeetthhooddoollooggyy aarree rreeqquuiirreedd ttoo aacchhiieevvee tthhee
ttaarrggeett ccoommpplleettiioonn ooff PPrroojjeecctt,, tthheenn ssaammee wwiillll bbee rreevviisseedd.. TThhee ddeessccrriippttiioonn sshhaallll
ccoovveerr aallll aassppeeccttss ooff tthhee PPrroojjeecctt ffrroomm aawwaarrdd ooff CCoonnttrraacctt,, tthhrroouugghh aanndd iinncclluuddiinngg
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 106 of 154
aassppeeccttss ooff tthhee bbaassiicc ddeessiiggnn aanndd ddeettaaiilleedd eennggiinneeeerriinngg,, ccoonnssttrruuccttiioonn,,
ccoommpplleettiioonn,, ccoommmmiissssiioonniinngg aanndd hhaannddoovveerr ooff tthhee PPrroojjeecctt..
1122..44 QQuuaalliittyy AAssssuurraannccee::
BBiiddddeerr sshhaallll pprroovviiddee ddeettaaiillss ooff iittss iinntteennddeedd ccoommpplliiaannccee wwiitthh PPrroojjeecctt QQuuaalliittyy
AAssssuurraannccee rreeqquuiirreemmeennttss.. TThhiiss ccoommpplliiaannccee sshhaallll bbee ssuuppppoorrtteedd bbyy qquuaalliittyy
ssttaatteemmeennttss aanndd qquuaalliittyy mmaannuuaallss ooff tthhee bbiiddddeerr aanndd aallll mmaajjoorr ssuubbccoonnttrraaccttoorrss..
1122..55 DDeessiiggnn SSttaannddaarrddss::
TThhee ffoolllloowwiinngg ddeessiiggnn ssttaannddaarrddss sshhaallll bbee uusseedd aass aa mmiinniimmuumm iinn tthhee ssccooppee ooff
wwoorrkk::
((ii)) IInntteerrnnaattiioonnaall SSttaannddaarrddss:: AANNSSII,, AASSMMEE,, AASSTTMM,, AAPPII,, SSAA,, NNAACCEE,, IISSOO,,
DDIINN,, EENN,, eettcc..
((iiii)) IInnddiiaann SSttaannddaarrddss..
((iiiiii)) OOiill IInndduussttrryy SSaaffeettyy DDiirreeccttoorraattee ((OOIISSDD)) SSttaannddaarrddss..
((iivv)) OOtthheerr ppuubblliisshheedd SSttaannddaarrddss // SSttaannddaarrdd PPrraaccttiicceess..
((vv)) PPNNGGRRBB gguuiiddeelliinneess
IInn ccaassee ooff ccoonnfflliicctt aammoonngg IInnddiiaann SSttaannddaarrddss oorr wwiitthh IInntteerrnnaattiioonnaall SSttaannddaarrddss,,
oowwnneerr sshhoouulldd bbee ccoonnssuulltteedd ffoorr ddeevviiaattiioonnss wwhhiicchh iinn CCoonnssuullttaanntt''ss ooppiinniioonn hhaavvee
ccoosstt iimmppaacctt..
1133.. EEXXCCLLUUSSIIOONNSS FFRROOMM CCOONNSSUULLTTAANNTT’’SS SSCCOOPPEE
TThhee ffoolllloowwiinngg aarree ssppeecciiffiiccaallllyy eexxcclluuddeedd ffrroomm tthhee ssccooppee,, hhoowweevveerr,, aallll tteecchhnniiccaall
aassssiissttaannccee wwiillll bbee pprroovviiddeedd bbyy tthhee CCoonnssuullttaanntt::
((ii)) RROOUU ffoorr ppiippeelliinnee llaayyiinngg aanndd llaanndd aaccqquuiissiittiioonn..
((iiii)) IInnssuurraannccee ppoolliicciieess sshhaallll bbee ttaakkeenn eeiitthheerr bbyy GGAAIILL oorr bbyy VVeennddoorr //
CCoonnttrraaccttoorr ((hhoowweevveerr,, llooddggiinngg ooff iinnssuurraannccee ccllaaiimmss aanndd rreeaalliizzaattiioonn ooff tthhee
ssaammee sshhaallll bbee ddoonnee bbyy tthhee CCoonnssuullttaanntt))..
((iiiiii)) IInndduussttrriiaall rreellaattiioonn ffuunnccttiioonnss aanndd iimmpplleemmeennttaattiioonn ooff LLaabboouurr LLaawwss aatt
wwoorrkkssiitteess..
((iivv)) TTeennddeerr // NNIITT aaddvveerrttiisseemmeenntt ffeeeess sshhaallll bbee iinn GGAAIILL''ss ssccooppee aanndd sshhaallll bbee
rreeiimmbbuurrsseedd ttoo tthhee CCoonnssuullttaanntt aatt aaccttuuaall.. TTeennddeerr ffeeeess rreecceeiivveedd aaggaaiinnsstt
ssaallee ooff TTeennddeerr DDooccuummeennttss ffrroomm vvaarriioouuss aaggeenncciieess sshhaallll bbee ffoorrwwaarrddeedd ttoo
GGAAIILL..
((vv)) PPaayymmeenntt ooff CCuussttoommss dduuttyy aammoouunntt aanndd ttrraannssppoorrttaattiioonn cchhaarrggeess ooff
iimmppoorrtteedd mmaatteerriiaallss..
((vvii)) IInn ccaassee ooff rreeiimmbbuurrsseemmeenntt,, aapppplliiccaabbllee sseerrvviiccee ttaaxx wwiillll bbee ppaaiidd oonn
ssuubbmmiissssiioonn ooff CCeennvvaattaabbllee IInnvvooiicceess ooff PPMMCC..
1144.. AADDDDIITTIIOONN,, RREEDDUUCCTTIIOONN IINN SSCCOOPPEE AANNDD RREE--TTEENNDDEERRIINNGG
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 107 of 154
1144..11 AAddddiittiioonn // rreedduuccttiioonn ooff PPMMCC--ffeeeess wwoouulldd bbee ccoonnssiiddeerreedd iinn ccaassee ooff aaddddiittiioonn oorr
ddeelleettiioonn iinn tthhee ssccooppee ooff tthhee PPrroojjeecctt..
1144..22 CChhaannggee iinn ddrraawwiinnggss // ddooccuummeennttss iinn ccaassee ooff ssiittee ddeecciissiioonnss,, llaanndd aavvaaiillaabbiilliittyy,,
eettcc.. iiss ttoo bbee ccaarrrriieedd oouutt bbyy tthhee PPMMCC wwiitthhoouutt aannyy eexxttrraa ccoosstt..
1144..33 RRee--wwoorrkkiinngg // rree--tteennddeerriinngg // rree--ddeessiiggnniinngg,, eettcc..,, iiff aannyy,, sshhaallll bbee ddoonnee wwiitthhoouutt
eexxttrraa ccoosstt ttoo GGAAIILL.. RRee--tteennddeerriinngg ffoorr nnoonn--rreessppoonnssiivveenneessss,, lleessss ccoommppeettiittiioonn
hhiigghheerr pprriiccee,, eettcc..,, tthhee ssaammee iiss ttoo bbee ccaarrrriieedd oouutt bbyy PPMMCC wwiitthhiinn tthhee qquuootteedd ccoosstt..
1144..44 IInn ccaassee CCoonnssuullttaanntt iiss rreeqquuiirreedd ttoo eexxeeccuuttee cceerrttaaiinn eexxttrraa aaccttiivviittiieess nnoott eennvviissaaggeedd
iinn tthhee oorriiggiinnaall ssccooppee ooff wwoorrkk,, tthheenn CCoonnssuullttaanntt sshhaallll ssuubbmmiitt ttoo EEIICC ooff GGAAIILL,,
tthhee ddeettaaiilleedd ssccooppee ooff wwoorrkk aalloonngg wwiitthh eessttiimmaatteedd mmaann--hhoouurrss.. MMaann--hhoouurrss sshhaallll
bbee mmuuttuuaallllyy aaggrreeeedd bbeettwweeeenn GGAAIILL && CCoonnssuullttaanntt bbeeffoorree pprroocceeeeddiinngg ooff tthhee
wwoorrkk aanndd sshhaallll bbee ppaaiidd aatt tthhee rraattee ooff mmaann--hhoouurr // mmaann--ddaayy rraatteess ssppeecciiffiieedd iinn
tthhee SSOORR ffoorr eexxttrraa wwoorrkk
1155.. OOTTHHEERR CCOONNDDIITTIIOONNSS
1155..11 TThhee CCoonnssuullttaanntt sshhaallll ppeerrffoorrmm tthhee wwoorrkk uunnddeerr tthhiiss CCoonnttrraacctt wwiitthh ddiilliiggeennccee
aanndd ccoonnffoorrmmiinngg ttoo tthhee bbeesstt iinntteerrnnaattiioonnaall pprraaccttiicceess aavvaaiillaabbllee iinn tthhiiss aarreeaa..
1155..22 TThhee CCoonnssuullttaanntt sshhaallll ppeerrffoorrmm tthheeiirr oobblliiggaattiioonnss ccoonnffoorrmmiinngg ttoo rruulleess,,
rreegguullaattiioonnss aanndd pprroocceedduurreess pprreessccrriibbeedd bbyy llaaww..
1155..33 TThhee CCoonnssuullttaanntt sshhaallll ttaakkee aapppprroovvaall // ccoonnccuurrrreennccee ffrroomm GGAAIILL oonn mmaajjoorr aanndd
ccrriittiiccaall iissssuueess,, ee..gg.. DDeessiiggnn BBaassiiss,, PP&&IIDD''ss,, eettcc..
1155..44 TThheerree mmaayy bbee mmiinnoorr cchhaannggeess iinn ssccooppeess dduurriinngg tthhee iimmpplleemmeennttaattiioonn ooff tthhee
PPrroojjeecctt.. TThhee CCoonnssuullttaanntt sshhaallll nnoott bbee eennttiittlleedd ffoorr eexxttrraa ppaayymmeenntt ffoorr tthhee ssaammee..
1155..55 TThhee CCoonnssuullttaanntt sshhaallll ssuuggggeesstt mmeeaassuurreess ttoo ccuutt ddoowwnn ccoossttss aanndd ttiimmee oovveerrrruunnss
wwiitthhoouutt ccoommpprroommiissiinngg tthhee qquuaalliittyy ooff wwoorrkk rreeqquuiirreedd iinn iimmpplleemmeennttiinngg tthhee
pprroojjeecctt..
1155..66 TThhee CCoonnssuullttaanntt sshhoouulldd iinnttiimmaattee iinn aaddvvaannccee aannyy cclliieenntt''ss oobblliiggaattiioonnss ffoorr ttiimmeellyy
ccoommpplleettiioonn ooff aaccttiivviittiieess,, ee..gg.. rreeqquuiirreemmeennttss ooff ssttaattuuttoorryy nnoorrmmss,, rreegguullaattoorryy
aauutthhoorriittiieess,, eettcc..
1155..77 TThhee CCoonnssuullttaanntt sshhaallll pprroovviiddee aapppprroovveedd ddrraawwiinnggss,, eettcc.. wweellll iinn ttiimmee ttoo tthhee
ccoonnttrraaccttoorr ffoorr ccoommmmeenncciinngg aanndd pprroocceeeeddiinngg wwiitthh tthhee wwoorrkk aass ppeerr aaggrreeeedd
sscchheedduullee..
1155..88 FFoorreeiiggnn bbiiddddeerr mmuusstt ddeeppllooyy EExxppaattrriiaattee PPrroojjeecctt MMaannaaggeerr..
1155..99 AApppprroovvaallss ffrroomm GGAAIILL:: AApppprroovvaallss wwiillll bbee ggiivveenn bbyy GGAAIILL ffoorr DDeessiiggnn bbaassiiss,,
PP&&IIDD''ss aanndd aallll mmaajjoorr ddooccuummeennttss,, ssttaaggee wwiissee aapppprroovvaallss ffoorr pprrooccuurreemmeenntt,,
iissssuuaannccee ooff PPuurrcchhaassee OOrrddeerrss,, eexxeeccuuttee AAggrreeeemmeenntt wwiitthh vveennddoorrss // ccoonnttrraaccttoorrss,,
RReelleeaassiinngg ooff ppaayymmeennttss aass ppeerr PPOO // WWOO tteerrmmss,, ooppeenniinngg ooff LLeetttteerrss ooff CCrreeddiitt iinn
ffaavvoorr ooff vveennddoorrss,, eettcc.. ffoorr aallll ccaasseess..
1155..1100 AAnnyy aaccttiivviittyy rreeqquuiirreedd ttoo bbee ccaarrrriieedd oouutt ffoorr ccoommpplleettiioonn ooff tthhee PPrroojjeecctt tthhoouugghh
nnoott ssppeecciiffiiccaallllyy mmeennttiioonneedd iinn tthhee TTeennddeerr DDooccuummeenntt sshhaallll bbee ccaarrrriieedd oouutt aatt nnoo
eexxttrraa ccoosstt ttoo GGAAIILL..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 108 of 154
1155..1111 AAllll aassssiissttaannccee rreeqquuiirreedd bbyy GGAAIILL ((vviizz.. bbuutt nnoott lliimmiitteedd ttoo pprreeppaarraattiioonn ooff
ddrraawwiinnggss,, ddooccuummeennttss,, rreeppoorrttss,, eettcc..)) ffoorr OObbttaaiinniinngg ppeerrmmiissssiioonnss aanndd cclleeaarraanncceess
ffrroomm ssttaattuuttoorryy aauutthhoorriittiieess sshhaallll bbee ppeerrffoorrmmeedd bbyy tthhee CCoonnssuullttaanntt aatt nnoo eexxttrraa
ccoosstt ttoo GGAAIILL..
1155..1122 TThhee CCoonnssuullttaanntt sshhaallll bbee rreessppoonnssiibbllee ttoo pprreeppaarree ddaaiillyy,, wweeeekkllyy,, ffoorrttnniigghhttllyy &&
mmoonntthhllyy pprrooggrreessss rreeppoorrttss ooff tthhee pprroojjeecctt iinn aapppprroovveedd ffoorrmmaattss wwiitthhiinn tthhee
qquuootteedd lluummpp--ssuumm pprriiccee oonnllyy..
1155..1133 TThhee CCoonnssuullttaanntt sshhaallll aatttteenndd ((aanndd ccoonnttrriibbuuttee)) ttoo PPrroojjeecctt && CCoonnssttrruuccttiioonn rreevviieeww
mmeeeettiinnggss ttaakkeenn bbyy GGAAIILL mmaannaaggeemmeenntt aatt PPrroojjeecctt // CCoorrppoorraattee // SSiittee ooffffiicceess ooff
GGAAIILL aanndd aallssoo aatt VVeennddoorr''ss // CCoonnttrraaccttoorr''ss ooffffiicceess ffrroomm ttiimmee ttoo ttiimmee ffoorr
eexxppeeddiittiioouuss ccoommpplleettiioonn ooff tthhee PPrroojjeecctt wwiitthhiinn tthhee qquuootteedd lluummpp--ssuumm pprriiccee oonnllyy,,
wwhhiicchh sshhaallll bbee ppaarrttiicciippaatteedd aatt aapppprroopprriiaattee lleevveell bbyy PPMMCC..
1155..1144 TThhee CCoonnssuullttaanntt sshhaallll ppuutt iinn rreeqquuiissiittee eeffffoorrttss ttoo aacchhiieevvee aacccceelleerraatteedd ttiimmee--
sscchheedduulleess ffoorr PPrroojjeecctt ccoommpplleettiioonn,, iiff ssoo rreeqquuiirreedd,, aatt nnoo eexxttrraa ccoosstt ttoo GGAAIILL..
1155..1155 PPMMCC''ss pprriimmaarryy rreessppoonnssiibbiilliittiieess,, hhoowweevveerr nnoott lliimmiitteedd ttoo,, ffoorr aarrbbiittrraattiioonn ccaasseess
ttiillll tthhee ffiinnaall aawwaarrdd ooff aarrbbiittrraattiioonn::
((ii)) EExxaammiinniinngg && pprroovviiddiinngg rreeppllyy ooff ccllaaiimmss,, eettcc..
((iiii)) PPaarrttiicciippaattiioonn iinn aarrbbiittrraattiioonn pprroocceeeeddiinnggss..
1155..1166 OOnnee sseenniioorr--lleevveell PPMMCC ppeerrssoonnnneell sshhoouulldd bbee hheelldd rreessppoonnssiibbllee aatt ffoorr ddaayy--ttoo--ddaayy
ccoooorrddiinnaattiioonn aaccttiivviittiieess bbeettwweeeenn GGAAIILL && PPMMCC..
1155..1177 TTeecchhnniiccaall QQuueerriieess ((TTQQ)) // CCoommmmeerrcciiaall QQuueerriieess ((CCQQ)),, iiff rreeqquuiirreedd iinn tteennddeerriinngg
pprroocceessss,, sshhoouulldd bbee rraaiisseedd wwiitthh tthhee pprriioorr aapppprroovvaall ooff GGAAIILL..
1155..1188 TThhee CCoonnssuullttaanntt wwiillll bbee nnoottiiffiieedd aabboouutt tthheeiirr ppeerrffoorrmmaannccee oonn ppeerriiooddiicc bbaassiiss..
1155..1199 CCaappiittaalliizzaattiioonn ooff tthhee ppiippeelliinnee oorr aa sseeccttiioonn ooff tthhee ppiippeelliinnee::
PPMMCC ttoo ccaarrrryy oouutt aallll tthhee mmaatteerriiaall ttrraannssaaccttiioonnss aanndd kkeeeepp rreeccoorrddss ppeerrttaaiinniinngg ttoo
tthhee mmoovveemmeenntt ooff mmaatteerriiaallss aanndd tthheeiirr ttrraacceeaabbiilliittyy // aaccccoouunnttiinngg aass wweellll aass
pphhyyssiiccaall uussaaggee ww..rr..tt.. tthhee sseeccttiioonn ooff tthhee ppiippeelliinnee.. PPMMCC ttoo bbiiffuurrccaattee tthhee ccoosstt aass
ppeerr GGAAIILL ffoorrmmaattss ffoorr tthhee ppuurrppoossee ooff ccaappiittaalliizzaattiioonn ooff aasssseettss.. AAtt tthhee ttiimmee ooff
ccaappiittaalliizzaattiioonn,, CCoonnssuullttaanntt mmaayy bbee rreeqquuiirreedd ttoo ddeeppuuttee tthheeiirr rreepprreesseennttaattiivveess aatt
GGAAIILL ooffffiiccee..
1166.. KKEEYY RREESSUULLTT AARREEAASS AANNDD RREECCOOVVEERRIIEESS::
IItt iiss tthhee pprriimmee rreessppoonnssiibbiilliittyy ooff tthhee PPMMCC ttoo ccoommpplleettee tthhee pprroojjeecctt iinn sscchheedduullee
ttiimmee.. TThhee ccoonnssuullttaanntt wwoouulldd sscchheedduullee aanndd eexxeeccuuttee pprroojjeecctt aaccttiivviittiieess ssuucchh aass ttoo
ccoommpplleettee tthhee eennttiirree pprroojjeecctt wwiitthhiinn tthhee sscchheedduullee.. RReeccoovveerriieess wwoouulldd bbee eeffffeecctteedd
ffoorr tthhee ddeellaayyss aattttrriibbuuttaabbllee ttoo tthhee PPMMCC.. TThhee PPMMCC sshhaallll bbee ppeerriiooddiiccaallllyy
iinnttiimmaatteedd aabboouutt tthheeiirr ppeerrffoorrmmaannccee..
KKeeyy rreessuulltt aarreeaass ooff tthhee ppeerrffoorrmmaannccee ooff tthhee PPMMCC aalloonngg wwiitthh tthhee iinnddiiccaatteedd
rreeccoovveerriieess aarree mmeennttiioonneedd iinn tthhee ffoolllloowwiinngg ttaabbllee.. TThhiiss iiss iinn aaddddiittiioonn ttoo PPrriiccee
RReedduucciinngg SScchheedduullee aass ppeerr aarrttiiccllee 33..1122 ooff tthhee GGCCCC.. RReeccoovveerriieess uunnddeerr tthhiiss
ccllaauussee aanndd PPRRSS aarree ssuubbjjeecctt ttoo aarrttiiccllee 33..1155 ooff GGCCCC oonn lliimmiittaattiioonn ooff lliiaabbiilliittiieess..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 109 of 154
SS NN.. AAccttiivviittyy TTiimmee lliinnee RReeccoovveerryy
11 FFiinnaalliizzaattiioonn ooff DDeessiiggnn aanndd
ddeettaaiilleedd eennggiinneeeerriinngg 1100 ddaayyss ffrroomm FFOOII
55 %% ooff tthhee rreessppeeccttiivvee
mmiilleessttoonnee aammoouunntt
22 FFiinnaalliizzaattiioonn ooff PP&&IIDDSS 2255 ddaayyss ffrroomm FFOOII 55 %% ooff tthhee rreessppeeccttiivvee
mmiilleessttoonnee aammoouunntt
33
EEvvaalluuaattiioonn ooff bbiiddss && ssuubbmmiissssiioonn
ooff PPBBOO rreeccoommmmeennddaattiioonn
iinncclluuddiinngg TTQQ // CCQQ,, iiff aannyy..
1100 ddaayyss ffrroomm
ooppeenniinngg ooff bbiiddss
55 %% ooff tthhee rreessppeeccttiivvee
mmiilleessttoonnee aammoouunntt
44 SSuubbmmiissssiioonn ooff AAwwaarrdd // OOrrddeerr
ppllaacceemmeenntt rreeccoommmmeennddaattiioonnss..
77 ddaayyss ffrroomm tthhee ddaattee
ooff aapppprroovvaall ooff PPBBOO
bbyy GGAAIILL..
55 %% ooff tthhee rreessppeeccttiivvee
mmiilleessttoonnee aammoouunntt
55
SSuubbmmiissssiioonn ooff ddrraafftt LLOOAA aanndd
aassssiisstt ffoorr eennttrryy ooff PPOO// LLOOAA iinn
SSAAPP
77 ddaayyss ffrroomm tthhee ddaattee
ooff FFaaxx ooff IInntteenntt..
55 %% ooff tthhee rreessppeeccttiivvee
mmiilleessttoonnee aammoouunntt
66
AApppprroovvaall ooff DDrraawwiinnggss//
DDooccuummeennttss ooff VVeennddoorrss ffoorr
mmaannuuffaaccttuurriinngg ooff EEqquuiippmmeenntt//
MMaatteerriiaallss..
WWiitthhiinn 77 ddaayyss ooff
rreecceeiipptt ffrroomm VVeennddoorrss
55 %% ooff tthhee rreessppeeccttiivvee
mmiilleessttoonnee aammoouunntt
77 CCoommmmeenncceemmeenntt ooff iinnssppeeccttiioonn ffoorr
EEqquuiippmmeennttss// MMaatteerriiaallss
WWiitthhiinn 33 ddaayyss ooff
iinnssppeeccttiioonn ccaallll
55 %% ooff tthhee rreessppeeccttiivvee
‘‘DDeelliivveerryy’’ mmiilleessttoonnee
aammoouunntt..
88
NNoonn ddeeppllooyymmeenntt ooff kkeeyy
ppeerrssoonnnneell aass ppeerr ddeeppllooyymmeenntt
rreeqquuiirreemmeenntt ((ffoorr PPrroojjeecctt MMaannaaggeerr
aanndd CCoonnssttrruuccttiioonn MMaannaaggeerr))..
RRss 1100,,000000 ppeerr ddaayy
NNootteess::
((11)) IInn aallll tthhee aabboovvee,, ccaalleennddaarr ddaayyss aarree ttoo bbee ccoonnssiiddeerreedd..
((22)) AAppaarrtt ffrroomm aabboovvee,, ppaayymmeennttss ttoowwaarrddss aaccccuurraattee ccoosstt eessttiimmaattee aanndd nnoonn
ggeenneerraattiioonn ooff ssuurrpplluuss wwoouulldd bbee rreegguullaatteedd aass ppeerr tteerrmmss ooff mmiilleessttoonnee
ppaayymmeenntt aanndd ootthheerr tteennddeerr ccoonnddiittiioonnss..
((33)) IInn ccaassee pprroojjeecctt iiss ccoommpplleetteedd wwiitthhiinn tthhee ccoonnttrraaccttuuaall ccoommpplleettiioonn sscchheedduullee
ii..ee.. 88 mmoonntthhss iinncclluuddiinngg 22 mmoonntthhss ppeerriioodd ffoorr pprroojjeecctt cclloossee oouutt ttiimmee ffrroomm
ddaattee ooff FFOOII,, rreetteennttiioonn // RReeccoovveerriieess mmaaddee aaggaaiinnsstt kkeeyy rreessuulltt aarreeaa iiff aannyy
sshhaallll bbee rreeiimmbbuurrsseedd ttoo tthhee ccoonnssuullttaanntt..
((44)) FFuurrtthheerr,, iinn ccaassee ffiinnaall ttiimmee eexxtteennssiioonn iiss ggrraanntteedd wwiitthhoouutt PPRRSS,, nnoo
rreeccoovveerryy wwiillll bbee mmaaddee..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 110 of 154
HHEEAALLTTHH,, SSAAFFEETTYY && EENNVVIIRROONNMMEENNTTAALL RREEQQUUIIRREEMMEENNTTSS
IItt iiss GGAAIILL''ss oobbjjeeccttiivvee ppoolliiccyy ttoo eennssuurree tthhaatt ppootteennttiiaall hheeaalltthh aanndd ssaaffeettyy ffaaccttoorrss aanndd
eennvviirroonnmmeennttaall eeffffeeccttss aarree aasssseesssseedd ffoorr aallll pprroodduuccttss,, pprroojjeeccttss aanndd aaccttiivviittiieess aanndd
aaccqquuiissiittiioonnss.. FFoorr pprroojjeeccttss,, tthhiiss iiss iimmpplleemmeenntteedd bbyy ssttaaggeedd aauuddiittss ooff hheeaalltthh,, ssaaffeettyy aanndd
eennvviirroonnmmeennttaall aassppeeccttss ffrroomm ccoonncceepptt ssttaaggee ttoo ppoosstt ccoommmmiissssiioonniinngg iinn oorrddeerr ttoo
ddeetteerrmmiinnee aannyy sshhoorrttccoommiinnggss oorr nnoonn ccoommpplliiaannccee..
TThhee ssppeecciiffiicc rreeqquuiirreemmeenntt iinncclluuddeess tthhee ffoolllloowwiinngg::
AA.. PPrroojjeecctt SSaaffeettyy RReevviieeww
AA ffoorrmmaall pprroojjeecctt ssaaffeettyy rreevviieeww iiss ttoo bbee ccaarrrriieedd oouutt bbyy OOwwnneerr aanndd iinntteeggrraatteedd
aaccrroossss tthhee vvaarriioouuss ccoonnttrraaccttss.. TThhee OOwwnneerr''ss rreevviieeww tteeaamm wwiillll rreeqquuiirree ddaattaa,, iinnppuutt
ffrroomm kkeeyy ppeerrssoonnnneell ffrroomm ootthheerr ccoonnttrraaccttoorrss aanndd aacccceessss ttoo aallll llooccaattiioonnss bbeeiinngg
uusseedd bbyy ccoonnttrraaccttoorr,, ssuubb--ccoonnttrraaccttoorrss aanndd ssuupppplliieerrss.. PPMMCC sshhaallll mmaakkee aallll
nneecceessssaarryy aarrrraannggeemmeennttss ffoorr ssuucchh rreevviieewwss aass rreeqquuiirreedd bbyy OOwwnneerr aanndd sshhaallll
eennssuurree tthhaatt ccoonnttrraaccttoorrss mmaakkee aavvaaiillaabbllee ssuucchh ddaattaa,, ppeerrssoonnnneell aanndd llooccaattiioonnss aass
rreeqquuiirreedd.. PPMMCC sshhaallll eennssuurree tthhaatt aallll rreeccoommmmeennddaattiioonnss aanndd ffiinnddiinnggss ffrroomm
ssaaffeettyy rreevviieewwss aarree iimmpplleemmeenntteedd bbyy ccoonnttrraaccttoorrss iinn aa ttiimmeellyy mmaannnneerr..
BB.. EEnnvviirroonnmmeennttaall IImmppaacctt AAsssseessssmmeenntt ((EEIIAA))
PPMMCC sshhaallll eennssuurree tthhaatt aallll rreeccoommmmeennddaattiioonnss rreessuullttiinngg ffrroomm tthhee EEIIAA // RRRRAA
ssttuuddiieess,, oonn aapppprroovvaall bbyy OOwwnneerr,, aarree iinnccoorrppoorraatteedd iinn tthhee TTeennddeerr DDooccuummeennttss ffoorr
iimmpplleemmeennttaattiioonn bbyy ccoonnttrraaccttoorrss..
CC.. HHAAZZOOPP
PPMMCC sshhaallll pprroovviiddee aa tteeaamm,, wwiitthh GGAAIILL''ss aapppprroovvaall,, ffoorr ccaarrrryyiinngg oouutt HHAAZZOOPP
ssttuuddyy dduurriinngg ddeessiiggnn ssttaaggee,, ccoonnssttrruuccttiioonn ssttaaggee,, ccoommmmiissssiioonniinngg ssttaaggee aanndd sshhaallll
eennssuurree tthhaatt aallll rreeccoommmmeennddaattiioonnss aanndd ffiinnddiinnggss aarree iimmpplleemmeenntteedd bbyy
ccoonnttrraaccttoorrss iinn aa ttiimmeellyy mmaannnneerr.. NNoonn--CCoommpplliiaannccee ooff tthhee HHAAZZOOPP
rreeccoommmmeennddaattiioonnss bbyy ccoonnttrraaccttoorr sshhaallll bbee tthhee rreessppoonnssiibbiilliittyy ooff PPMMCC..
DD.. HHeeaalltthh,, SSiittee SSaaffeettyy aanndd SSeeccuurriittyy
PPMMCC sshhaallll bbee rreessppoonnssiibbllee,, oonn bbeehhaallff ooff OOwwnneerr ffoorr eennssuurriinngg aa hhiigghh ssttaannddaarrdd ooff
ooccccuuppaattiioonnaall hheeaalltthh aanndd ssiittee ssaaffeettyy mmaannaaggeemmeenntt aanndd ffoorr eennssuurriinngg tthhee
rreeqquuiirreemmeennttss ffoorr hheeaalltthh,, ssaaffeettyy aanndd sseeccuurriittyy ttoo bbee mmaaiinnttaaiinneedd bbyy ccoonnttrraaccttoorrss,,
ssuubb--ccoonnttrraaccttoorrss aanndd ootthheerr ppeerrssoonnnneell wwoorrkkiinngg aatt ssiittee.. PPMMCC sshhaallll ccoommppiillee tthhee
ssaaffeettyy rreeqquuiirreemmeenntt oonn ccoonnttrraaccttoorrss..
TThhee ppuurrppoossee ooff tthheessee ssaaffeettyy rreeqquuiirreemmeennttss sshhaallll bbee ttoo pprreevveenntt aannyy aacccciiddeennttss,,
iinncciiddeennttss oorr eevveennttss tthhaatt ccoouulldd rreessuulltt iinn iinnjjuurryy oorr ffaattaalliittyy ttoo ppeerrssoonnnneell ffrroomm
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 111 of 154
ccoonnttrraaccttoorrss,, ssuubb--ccoonnttrraaccttoorrss oorr PPMMCC,, OOwwnneerr oorr tthhiirrdd ppaarrttiieess aanndd//oorr ddaammaaggee
oorr ddeessttrruuccttiioonn ttoo ccoonnttrraaccttoorr''ss oorr OOwwnneerr''ss pprrooppeerrttyy,, eeqquuiippmmeenntt aanndd mmaatteerriiaallss..
TThhee rreeqquuiirreemmeennttss sshhaallll bbee iinntteennddeedd ttoo ssuupppplleemmeenntt aannyy GGoovveerrnniinngg AAuutthhoorriittyy
ooff IInnddiiaa,, ssttaattee,, mmuunniicciippaall,, llooccaall oorr ootthheerr rreegguullaattiioonnss aapppplliiccaabbllee aatt tthhee ssiittee
wwhhiicchh PPMMCC sshhaallll bbee oobblliiggeedd ttoo eennffoorrccee oonn bbeehhaallff ooff OOwwnneerr.. PPMMCC sshhaallll aaggrreeee
wwiitthh OOwwnneerr''ss rreepprreesseennttaattiivvee aatt ssiittee aannyy vvaarriiaattiioonnss bbeettwweeeenn tthheessee
rreeqquuiirreemmeennttss.. PPMMCC sshhaallll mmoonniittoorr rreeppoorrtt aanndd eennssuurree tthhaatt tthhee aabboovvee
rreeqquuiirreemmeennttss aarree ffuullllyy aaddhheerreedd ttoo..
EE.. SSiittee SSaaffeettyy OOrrggaanniizzaattiioonn
PPMMCC iiss ttoo aappppooiinntt ssaaffeettyy ooffffiicceerrss wwiitthh aapppprroopprriiaattee ssttaaffff ssuuppppoorrtt wwhhoossee
rreessppoonnssiibbiilliittyy iiss ttoo mmoonniittoorr aallll ssaaffeettyy aaccttiivviittiieess oonn tthhee jjoobb aanndd rreeppoorrtt hhiiss
ffiinnddiinnggss ttoo PPMMCC.. TThhee ssaaffeettyy ooffffiicceerr sshhaallll mmaakkee ppeerriiooddiicc ssaaffeettyy iinnssppeeccttiioonnss ooff
tthhee jjoobb--ssiittee oonn aa sscchheedduullee tthhaatt wwiillll pprroovviiddee oonnggooiinngg ccoovveerraaggee.. TThhee iinnssppeeccttiioonnss
sshhoouulldd bbee mmaaddee jjooiinnttllyy wwiitthh tthhee ssuuppeerriinntteennddeennttss ooff tthhee ccoonnttrraaccttoorrss
rreessppoonnssiibbllee ffoorr oonnggooiinngg wwoorrkk iinn tthhee aarreeaass ttoo bbee iinnssppeecctteedd.. AAnnyy iinnffrraaccttiioonnss oorr
ppoooorr ssaaffeettyy pprraaccttiicceess uunnccoovveerreedd bbyy tthheessee iinnssppeeccttiioonnss sshhaallll bbee pprroommppttllyy
ccoorrrreecctteedd.. SSaaffeettyy rreeqquuiirreemmeennttss sshhaallll bbee eennffoorrcceedd oonn tthhee eennttiirree ssuuppeerrvviissoorryy
oorrggaanniizzaattiioonn ooff tthhee ccoonnttrraaccttoorr aanndd ssuubb--ccoonnttrraaccttoorrss.. EEaacchh llooccaattiioonn sshhaallll rreeqquuiirree
eennffoorrcceemmeenntt ooff aapppprroovveedd ssaaffeettyy rruulleess aanndd pprroocceedduurreess bbyy ccoonnttrraaccttoorrss aanndd ssuubb--
ccoonnttrraaccttoorrss..
FF.. SSiittee SSaaffeettyy PPllaannnniinngg
PPrriioorr ttoo aawwaarrdd ooff ccoonnssttrruuccttiioonn ccoonnttrraaccttss oorr ssttaarrtt ooff ssiittee wwoorrkk,, PPMMCC sshhaallll ppllaann
jjoobb ssaaffeettyy rreeqquuiirreemmeenntt iinn ccoonnjjuunnccttiioonn wwiitthh ccoonnttrraaccttoorrss ggiivviinngg dduuee
ccoonnssiiddeerraattiioonn ttoo::
((ii)) GGAAIILL''ss // PPMMCC''ss SSaaffeettyy rreeqquuiirreemmeennttss;;
((iiii)) LLooccaattiioonn ooff jjoobb--ssiittee((ss));;
((iiiiii)) TTyyppee,, bbaacckkggrroouunndd aanndd qquuaalliittyy ooff llaabboorr rreessoouurrcceess aanndd aannttiicciippaatteedd
ttrraaiinniinngg pprrooggrraammmmee;;
((iivv)) NNaattuurree ooff ccoonnssttrruuccttiioonn wwoorrkk,, ttyyppeess ooff hhaazzaarrddss aannttiicciippaatteedd aanndd hhaazzaarrdd
pprreevveennttiioonn mmeetthhooddss;;
((vv)) IInnssppeeccttiioonn,, tteessttiinngg aanndd ccoommmmiissssiioonniinngg aaccttiivviittiieess oovveerrllaappppiinngg wwiitthh
ccoonnssttrruuccttiioonn iinncclluuddiinngg ttrraaiinniinngg aanndd iimmpplleemmeennttaattiioonn ooff ppeerrmmiitt ttoo wwoorrkk
ssyysstteemm
((vvii)) CCoonnssttrruuccttiioonn eeqquuiippmmeennttss aanndd mmaatteerriiaallss ttoo bbee uusseedd;;
((vviiii)) MMiinniimmiizziinngg tthhee nnuummbbeerr ooff ccoonnttrraaccttoorrss // ssuubb--ccoonnttrraaccttoorrss wwoorrkkiinngg iinn aannyy
aarreeaa aatt tthhee ssaammee ttiimmee
((vviiiiii)) PPeerrssoonnaall pprrootteeccttiivvee ccllootthhiinngg aanndd eeqquuiippmmeenntt rreeqquuiirreemmeennttss mmuusstt bbee
eessttaabblliisshheedd,, aanndd oorrddeerrss ppllaacceedd ffoorr ttiimmeellyy ddeelliivveerryy ttoo jjoobb ssiittee ooff ssuucchh
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 112 of 154
eeqquuiippmmeenntt.. PPMMCC wwiillll eennssuurree tthhaatt ccoonnttrraaccttoorrss eexxeeccuuttee oobblliiggaattiioonnss iinn
tthhiiss aarreeaa..
GG.. SSiittee SSaaffeettyy MMaannuuaall
PPrriioorr ttoo ssttaarrtt ooff wwoorrkk aatt eeaacchh jjoobb--ssiittee,, PPMMCC sshhaallll ppuubblliisshh aanndd ddiissttrriibbuuttee aa
SSaaffeettyy MMaannuuaall,, SSaaffeettyy BBuulllleettiinn,, DDoo''ss && DDoonn''ttss aabboouutt ssaaffeettyy aapppprroovveedd bbyy
OOwwnneerr ttoo ccoovveerr ssaaffeettyy aaccttiivviittiieess.. TThhee MMaannuuaall sshhaallll bbee ppuubblliisshheedd bbootthh iinn
EEnngglliisshh aanndd HHiinnddii aanndd iinn aannyy ootthheerr llaanngguuaaggee ssuuiittiinngg wwoorrkkeerrss'' lliinngguuiissttiicc
rreeqquuiirreemmeennttss..
TThhee ddeessiiggnn ooff tthhee MMaannuuaall sshhaallll ppeerrmmiitt eeaassyy ccoommmmuunniiccaattiioonn ooff iittss ccoonntteennttss ttoo
aallll ppeerrssoonnnneell,, rreeccooggnniizziinngg llaanngguuaaggeess aanndd lliitteerraaccyy ccoonnddiittiioonnss aatt tthhee jjoobb ssiittee..
AAllll GGAAIILL''ss,, PPMMCC''ss aanndd ccoonnttrraaccttoorrss'' ssuuppeerrvviissoorryy ppeerrssoonnnneell wwiillll bbee iissssuueedd aa
ccooppyy ooff tthhee MMaannuuaall.. FFuurrtthheerr ddiissttrriibbuuttiioonn ooff tthhee MMaannuuaall,, oorr ssppeecciiffiicc sseeccttiioonnss,,
sshhaallll bbee ddeetteerrmmiinneedd ddeeppeennddeenntt uuppoonn tthhee nneeeeddss ooff tthhee aaddoopptteedd ccoonnssttrruuccttiioonn
ssttrraatteeggyy aanndd oorrggaanniizzaattiioonn.. CCooppyy ooff tthhee MMaannuuaall wwiillll bbee ssttrriiccttllyy ddiissttrriibbuutteedd ttoo
aallll ssttaattuuttoorryy aauutthhoorriittiieess..
TThhee ccoonntteennttss ooff tthhee MMaannuuaall sshhaallll iinncclluuddee,, aass aa mmiinniimmuumm,, tthhee ffoolllloowwiinngg::
((ii)) OOwwnneerr''ss && PPMMCC''ss ssaaffeettyy oorrggaanniizzaattiioonn,, pphhiilloossoopphhyy aanndd rreessppoonnssiibbiilliittiieess..
((iiii)) OOwwnneerr''ss && PPMMCC''ss ssaaffeettyy rreeqquuiirreemmeennttss..
((iiiiii)) TThhee ggeenneerraall ssaaffeettyy rruulleess aapppplliiccaabbllee ttoo tthhee jjoobb--ssiittee..
((iivv)) NNeeaarr--mmiissss AAcccciiddeenntt RReeppoorrtt..
((vv)) MMoonntthhllyy ssaaffeettyy aauuddiitt rreeppoorrtt iinnlliinnee wwiitthh OOIISSDD gguuiiddeelliinneess // cchheecckklliisstt..
((vvii)) TThhee rreeqquuiirreemmeennttss,, aavvaaiillaabbiilliittyy aanndd pprroovviissiioonn ooff ppeerrssoonnaall pprrootteeccttiivvee
ccllootthhiinngg && eeqquuiippmmeennttss ffoorr ssppeecciiffiicc aaccttiivviittiieess tthhaatt wwiillll ooccccuurr aatt jjoobb ssiittee..
((vviiii)) TTrraaffffiicc rreegguullaattiioonnss aatt tthhee wwoorrkk--ssiitteess..
((vviiiiii)) RReeqquuiirreemmeennttss aanndd ssttaannddaarrddss ffoorr uussee ooff ssccaaffffoollddiinngg // llaaddddeerrss..
((iixx)) RReeqquuiirreemmeennttss ffoorr ggrroouunnddiinngg eelleeccttrriiccaall ccoonnssttrruuccttiioonn eeqquuiippmmeennttss aanndd
ttoooollss..
((xx)) TTyyppee,, aavvaaiillaabbiilliittyy aanndd rreessppoonnssiibbiilliittyy ffoorr uussee ooff ffiirree--ffiigghhttiinngg
eeqquuiippmmeennttss..
((xxii)) WWoorrkk ppeerrmmiitt pprroocceedduurreess..
((xxiiii)) PPrroocceedduurreess ttoo bbee ffoolllloowweedd wwhheenn aann aacccciiddeenntt,, iinnjjuurryy oorr ffiirree ooccccuurrss..
((xxiiiiii)) SSiimmppllee pprroocceedduurreess ttoo bbee ffoolllloowweedd bbyy eennttiirree ccoonnttrraaccttoorr''ss oorrggaanniizzaattiioonn
sshhoouulldd mmaajjoorr aacccciiddeenntt ooccccuurr..
((xxiivv)) CCoonnttrrooll oorr aacccceessss ttoo ssiittee..
PPMMCC wwiillll iissssuuee uuppddaattee aanndd rreevviissee bbooookklleettss pprriioorr ttoo ccoommmmeenncciinngg
ccoommmmiissssiioonniinngg aaccttiivviittiieess aass nneeww hhaazzaarrddss aarriissee aanndd nneeww wwoorrkkiinngg pprroocceedduurreess
aarree rreeqquuiirreedd..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 113 of 154
HH.. PPrreeppaarraattiioonn ooff EEmmeerrggeennccyy AAccttiioonn PPllaann
PPMMCC sshhaallll pprreeppaarree tthhee oonnssiittee && ooffffssiittee EEmmeerrggeennccyy AAccttiioonn PPllaann ffoorr ssiittee aappaarrtt
ffrroomm pprreeppaarriinngg DDiissaasstteerr MMaannaaggeemmeenntt PPllaann iinnlliinnee wwiitthh tthhee rreeqquuiirreemmeennttss ooff
GGAAIILL''ss IISSOO pprroocceedduurreess aanndd OOIISSDD nnoorrmmss.. TThhee ssaammee wwiillll bbee hhaannddeedd oovveerr ttoo
GGAAIILL ffoorr aapppprroovvaall aanndd ssuubbsseeqquueenntt cciirrccuullaattiioonn..
II.. SSaaffeettyy AAccttiivviittiieess
PPMMCC sshhaallll eennssuurree tthhaatt ccoonnttrraaccttoorrss // ssuubb--ccoonnttrraaccttoorrss ccaarrrryy oouutt tthheeiirr aaccttiivviittiieess iinn
aaccccoorrddaannccee wwiitthh tthhee ssaaffeettyy ppllaann tthhrroouugghhoouutt tthhee ccoouurrssee ooff tthhee ccoonnssttrruuccttiioonn ooff
tthhee pprroojjeecctt ttoo iinnccuullccaattee aanndd mmaaiinnttaaiinn ssaaffeettyy aawwaarreenneessss aammoonngg tthheeiirr
eemmppllooyyeeeess..
EEaacchh eemmppllooyyeeee,, pprriioorr ttoo bbeeggiinnnniinngg wwoorrkk,, sshhaallll bbee ggiivveenn aa ssaaffeettyy oorriieennttaattiioonn
ccoouurrssee.. PPMMCC sshhaallll bbee rreessppoonnssiibbllee ffoorr aarrrraannggiinngg tthhee pprroovviiddiinngg ssuucchh aanndd
eennssuurriinngg ccoonnssiisstteennccyy ooff kknnoowwlleeddggee aanndd uunnddeerrssttaannddiinngg aaccrroossss aallll aanndd wwoorrkk
ggrroouuppss.. AAllll ppeerrssoonnnneell mmuusstt bbee ffuullllyy kknnoowwlleeddggeeaabbllee ooff tthhee ppootteennttiiaall hhaazzaarrddss
iinnvvoollvveedd iinn tthhee wwoorrkk tthheeyy ssuuppeerrvviissee aanndd tthhee ssaaffee pprraaccttiicceess ttoo bbee ffoolllloowweedd iinn
tthheeiirr wwoorrkk..
JJ.. AAcccciiddeenntt IInnvveessttiiggaattiioonn aanndd RReeppoorrttiinngg
AAnnyy aacccciiddeenntt oorr iinncciiddeenntt rreessuullttiinngg iinn aa lloosstt ttiimmee iinnjjuurryy,, ddeeaatthh,, oorr ddaammaaggee ttoo
pprrooppeerrttyy oorr eeqquuiippmmeenntt iiss ttoo bbee iinnvveessttiiggaatteedd bbyy PPMMCC.. EEvveerryy iinncciiddeenntt sshhaallll bbee
ddooccuummeenntteedd pprroommppttllyy aafftteerr tthhee iinncciiddeenntt iinncclluuddiinngg tthhee rreessuullttss ooff iinnvveessttiiggaattiioonn
aanndd rreeccoommmmeennddaattiioonnss ffoorr pprreevveennttiivvee aaccttiioonn.. PPMMCC sshhaallll aallssoo eennssuurree tthhaatt aallll
nneecceessssaarryy ppuubblliicciittyy iiss ggiivveenn,, wwiitthhiinn tthhee ssiittee,, ttoo eennssuurree ffuurrtthheerr iinncciiddeennttss ddoo nnoott
ooccccuurr.. TThhiiss iinnvveessttiiggaattiioonn aanndd rreeppoorrtt sshhaallll nnoott pprreecclluuddee aannyy ssiimmiillaarr
iinnvveessttiiggaattiioonnss aanndd rreeppoorrttss rreeqquuiirreedd bbyy ggoovveerrnnmmeennttaall rreegguullaattiioonn,, bbuutt mmaayy bbee
hhaannddlleedd ccoonnccuurrrreennttllyy wwiitthh tthheemm..
PPMMCC sshhaallll mmaaiinnttaaiinn ssaaffeettyy ppeerrffoorrmmaannccee aanndd aacccciiddeenntt ssttaattiissttiiccss rreeccoorrddss ffoorr tthhee
wwhhoollee ssiittee iinn ccoonnffoorrmmaannccee ttoo aann aaggrreeeedd iinntteerrnnaattiioonnaall ssttaannddaarrdd oorr ssyysstteemm ttoo bbee
aapppprroovveedd bbyy OOwwnneerr.. UUppddaatteedd ssaaffeettyy ppeerrffoorrmmaannccee aanndd aacccciiddeenntt ssttaattiissttiiccss sshhaallll
bbee iinncclluuddeedd iinn PPMMCC''ss eevveerryy mmoonntthhllyy rreeppoorrtt..
KK.. HHeeaalltthh PPrrooggrraamm
TThhee PPMMCC iiss ttoo aappppooiinntt aann OOccccuuppaattiioonnaall HHeeaalltthh MMaannaaggeerr wwiitthh aapppprroopprriiaattee
ssttaaffff wwhhoossee rreessppoonnssiibbiilliittyy wwiillll bbee ttoo mmoonniittoorr aallll ooccccuuppaattiioonnaall hheeaalltthh aaccttiivviittiieess
oonn tthhee wwoorrkk ssiittee aanndd hhiiss ffiinnddiinnggss ttoo tthhee PPMMCC.. TThhiiss rroollee ccoouulldd bbee ccoouupplleedd wwiitthh
tthhaatt ooff tthhee SSaaffeettyy MMaannaaggeerr.. TThhee OOccccuuppaattiioonnaall HHeeaalltthh MMaannaaggeerr wwiillll bbee
rreessppoonnssiibbllee ffoorr::
•• FFoorrmmaattiioonn ooff hheeaalltthh oorrggaanniizzaattiioonn;;
•• PPrreeppaarraattiioonn aanndd ssuubbmmiissssiioonn ttoo OOwwnneerr ooff aa hheeaalltthh pprrooggrraamm;;
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 114 of 154
•• PPrroommoottiioonn ooff hheeaalltthh eedduuccaattiioonn aatt tthhee wwoorrkk ssiittee aanndd aannaallyyssiiss;;
•• IInnvveessttiiggaattiioonn aanndd rreeppoorrttiinngg ooff hhaazzaarrddss aanndd iinncciiddeennttss oonn tthhee ssiittee..
AAddddiittiioonnaallllyy,, tthhee ooccccuuppaattiioonnaall hheeaalltthh mmaannaaggeerr sshhaallll mmaakkee ppeerriiooddiicc
iinnssppeeccttiioonnss ooff tthhee ssiittee,, wwiitthh ssppeecciiffiicc rreeffeerreennccee ttoo::
•• SSaanniittaattiioonn;;
•• LLaayyoouutt ooff tteemmppoorraarryy aanndd ppeerrmmaanneenntt iinnssttaallllaattiioonnss;;
•• PPrroovviissiioonn ooff aaddeeqquuaattee mmeeddiiccaall ppeerrssoonnnneell,, ffaacciilliittiieess,, eeqquuiippmmeenntt aanndd
ssuupppplliieess;;
•• IImmpplleemmeennttaattiioonn ooff mmeeaassuurreess ffoorr ddeeaalliinngg wwiitthh iinnjjuurriieess // iillllnneessss..
BBiiddddeerr sshhaallll pprroovviiddee ddeettaaiillss ooff iittss ccoommpplliiaannccee wwiitthh tthhee PPrroojjeecctt hheeaalltthh,, ssaaffeettyy
aanndd eennvviirroonnmmeennttaall rreeqquuiirreemmeennttss iinncclluuddeedd wwiitthh tthhiiss TTeennddeerr DDooccuummeennttss.. TThhiiss
ccoommmmiittmmeenntt sshhaallll bbee ssuuppppoorrtteedd bbyy HHSSEE ssttaatteemmeennttss aanndd mmaannuuaallss // pprroocceedduurreess
ffoorr bbiiddddeerr aanndd aallll mmaajjoorr ssuubb--ccoonnttrraaccttoorrss..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 115 of 154
PPMMCC DDEELLIIVVEERRAABBLLEESS
TThhee PPrroojjeecctt MMaannaaggeemmeenntt CCoonnssuullttaanntt ((PPMMCC)) iiss rreeqquuiirreedd ttoo ssuubbmmiitt aallll
ddeelliivveerraabblleess wwiitthhiinn tthhee sscchheedduullee iinnlliinnee wwiitthh tthhee rreeqquuiirreemmeennttss mmeennttiioonneedd iinn
vvaarriioouuss sseeccttiioonnss ooff tthhiiss BBiidd DDooccuummeenntt.. TThhee ddeelliivveerraabblleess iinncclluuddee aallll
ddooccuummeennttss,, ddrraawwiinnggss,, ppllaann,, bbeesstt pprraaccttiicceess,, rreepplliieess,, eettcc.. mmeennttiioonneedd uunnddeerr
vvaarriioouuss ddiisscciipplliinneess ooff tthhee WWBBSS eelleemmeennttss.. TThhee ddeelliivveerraabblleess aarree ssuummmmaarriizzeedd aass
uunnddeerr,, bbuutt nnoott lliimmiitteedd ttoo::
[[11]] AAllll PPeerriiooddiicc RReeppoorrttss,, DDaaiillyy PPrrooggrreessss RReeppoorrttss dduurriinngg CCoonnssttrruuccttiioonn,,
CCuussttoommiizzeedd RReeppoorrttss,, PPrreesseennttaattiioonnss,, BBeesstt PPrraaccttiicceess// IInntteerrnnaattiioonnaall
PPrraaccttiicceess rreeqquuiirreedd ffoorr ssuubbmmiissssiioonn ttoo MMaannaaggeemmeenntt // EExxtteerrnnaall
AAggeenncciieess..
[[22]] AAllll DDooccuummeennttss rreellaatteedd ttoo EEnnggiinneeeerriinngg,, TTeennddeerriinngg,, OOrrddeerriinngg,,
MMaannuuffaaccttuurriinngg,, DDeelliivveerryy,, CCoonnssttrruuccttiioonn,, CCoommmmiissssiioonniinngg..
[[33]] SSttaaggee--wwiissee RReeccoommmmeennddaattiioonnss..
[[44]] DDeessiiggnn bbaassiiss,, DDaattaasshheeeettss,, PP&&IIDD’’ss,, EEnnggiinneeeerriinngg DDrraawwiinnggss..
[[55]] PPrroojjeecctt CCoosstt RReeppoorrttss..
[[66]] VVaarriioouuss ttyyppeess ooff PPllaannss,, MMaannuuaallss,, iinncclluuddiinngg DDiissaasstteerr MMaannaaggeemmeenntt
PPllaann..
[[77]] DDooccuummeennttaattiioonn ffoorr CCCCOOEE,, NNaaggppuurr ccoommpplliiaannccee..
[[88]] PPeerrffoorrmmaannccee EEvvaalluuaattiioonn RReeppoorrttss ooff VVeennddoorrss // CCoonnttrraaccttoorrss
[[99]] PPrroojjeecctt CClloosseeoouutt RReeppoorrttss..
[[1100]] SSttaattuuttoorryy DDooccuummeennttss..
[[1111]] AAnnyy ootthheerr DDeelliivveerraabbllee nnoott mmeennttiioonneedd hheerreeiinn bbuutt rreeqquuiirreedd eellsseewwhheerree
iinn TTeennddeerr..
[[1122]] BBootthh hhaarrdd aanndd eeddiittaabbllee ssoofftt ccooppiieess aarree ttoo bbee pprroovviiddeedd..
TTIIMMEELLYY CCOOMMPPLLEETTIIOONN IISS TTHHEE EESSSSEENNCCEE OOFF TTHHEE
PPRROOJJEECCTT
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 116 of 154
SECTION V
PART-B
SPECIAL CONDITION OF CONTRACT
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 117 of 154
GGAAIILL ((IInnddiiaa)) LLiimmiitteedd ((AA GGoovveerrnnmmeenntt ooff IInnddiiaa UUnnddeerrttaakkiinngg))
AA NNaavvrraattnnaa CCoommppaannyy
GGAAIILL BBhhaavvaann
AAVVAA RRooaadd
RRaajjaahhmmuunnddrryy
TTEENNDDEERR NNOO..:: GAIL/RJY/C&P/SR20036987/RAO
BBIIDDDDIINNGG DDOOCCUUMMEENNTT FFOORR
HHIIRRIINNGG OOFF PPRROOJJEECCTT MMAANNAAGGEEMMEENNTT
CCOONNSSUULLTTAANNCCYY ((PPMMCC)) SSEERRVVIICCEESS FFOORR DDEESSIIGGNN &&
CCOONNSSTTRRUUCCTTIIOONN OOFF KKEESSAANNAAPPAALLLLII((WWEESSTT)) TTOO
PPOONNNNAAMMAANNDDAA PP//LL
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 118 of 154
SSPPEECCIIAALL CCOONNDDIITTIIOONNSS
OOFF TTHHEE
CCOONNTTRRAACCTT
[[SSCCCC]]
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 119 of 154
SSPPEECCIIAALL CCOONNDDIITTIIOONNSS OOFF CCOONNTTRRAACCTT
OOFF
PPRROOJJEECCTT MMAANNAAGGEEMMEENNTT CCOONNSSUULLTTAANNCCYY ((PPMMCC)) SSEERRVVIICCEESS FFOORR
KKEESSAANNAAPPAALLLLII((WW)) TTOO PPOONNNNAAMMAANNDDAA PPIIPPEELLIINNEE PPRROOJJEECCTT
11.. IINNTTRROODDUUCCTTIIOONN
11..11 GGAAIILL ((IInnddiiaa)) LLiimmiitteedd iiss ooppeerraattiinngg PPiippeelliinnee NNeettwwoorrkkss iinn KKrriisshhnnaa GGooddaavvaarrii ((KKGG))
BBaassiinn iinn SSttaattee ooff AAnnddhhrraa PPrraaddeesshh,,IInnddiiaa.. GGaass iiss bbeeiinngg iinnjjeecctteedd ffrroomm vvaarriioouuss ssoouurrcceess ooff
OONNGGCC // CCaaiirrnn // RReelliiaannccee KKGG DD66 aanndd bbeeiinngg ttrraannssppoorrtteedd ttoo vvaarriioouuss ccuussttoommeerrss ooff KKGG
bbaassiinn..
22.. BBRRIIEEFF SSCCOOPPEE OOFF WWOORRKK
22..11 TThhee bbrriieeff ddeessccrriippttiioonn ooff tthhee pprroojjeecctt iiss aass uunnddeerr::
GGAAIILL ((IInnddiiaa)) LLiimmiitteedd iinntteennddss ttoo iimmpplleemmeenntt 1100"" xx 44..55 kkmmss.. ((aapppprrooxx..)) KKeessaannaappaallllii((WW))
ttoo PPoonnnnaammaannddaa PPiippeelliinnee aalloonnggwwiitthh tteerrmmiinnaall uupp--ggrraaddaattiioonn aatt KKeessaannaappaallllii((WW)) aanndd
PPoonnnnaammaannddaa tteerrmmiinnaallss ffoorr ttrraannssppoorrttiinngg NNaattuurraall GGaass ttoo GGAAIILL--TTaattiippaakkaa aanndd ffuurrtthheerr
ttoo ootthheerr ccuussttoommeerrss aalloonngg ppiippeelliinnee rroouuttee iinn KKGG BBaassiinn rreeggiioonn..
22..22 TThhee bbrriieeff ssccooppee ooff sseerrvviicceess iiss aass ppeerr sseeppaarraattee sseeccttiioonn oonn tthhee ““SSccooppee ooff WWoorrkk”” ooff tthhiiss
BBiidd DDooccuummeenntt,, bbuutt nnoott lliimmiitteedd ttoo tthhee ffoolllloowwiinngg::
TThhee PPrroojjeecctt MMaannaaggeemmeenntt CCoonnssuullttaanntt ((PPMMCC)) iiss bbeeiinngg aappppooiinntteedd ffoorr eexxeeccuuttiinngg tthhee
pprroojjeecctt rriigghhtt ffrroomm DDeessiiggnn ttoo CCoommmmiissssiioonniinngg && pprroojjeecctt cclloosseeoouutt oonn ttoottaall aanndd ssiinnggllee
ppooiinntt rreessppoonnssiibbiilliittyy bbaassiiss.. TThhiiss sseeccttiioonn iiss ttoo bbee rreeaadd iinn ccoonnjjuunnccttiioonn wwiitthh ""SSccooppee ooff
wwoorrkk””.. TThhee PPMMCC PPrroojjeecctt MMaannaaggeerr wwiillll bbee tthhee ""EEnnggiinneeeerr--iinn--CChhaarrggee"" ffoorr tthhee ssaaiidd
PPrroojjeecctt.. TThhee ssccooppee ooff wwoorrkk ooff tthhee PPMMCC iiss bbrrooaaddllyy ddeeffiinneedd uunnddeerr tthhee ffoolllloowwiinngg hheeaaddss
bbuutt nnoott lliimmiitteedd ttoo::
[[aa]] BBaassiicc EEnnggiinneeeerriinngg && HHyyddrraauulliicc SSTTUUDDYY..
[[bb]] DDeessiiggnn && DDeettaaiilleedd EEnnggiinneeeerriinngg..
[[cc]] CCaarrrryyoouutt aallll nneecceessssaarryy ccaallccuullaattiioonnss aanndd ccoonndduucctt aallll aapppprroopprriiaattee ddeessiiggnn
pprroocceedduurree aanndd aannaallyyssiiss,, aass rreeqquuiirreedd,, ttoo ooppttiimmiizzee tthhee ssiizziinngg aanndd sseelleeccttiioonn
ooff tthhee eeqquuiippmmeenntt aanndd ssppeecciiffiiccaattiioonn ooff mmaatteerriiaallss..
[[dd]] PPrreeppaarree oovveerraallll ddeessiiggnn bbaassiiss..
[[ee]] PPrreeppaarraattiioonn ooff MMaatteerriiaall TTaakkee--ooffffss ((MMTTOO)),, MMaatteerriiaall RReeqquuiissiittiioonn ((MMRR))..
[[ff]] PPrreeppaarraattiioonn ooff iitteemm--wwiissee ccoosstt eessttiimmaattee ffoorr eeaacchh MMaatteerriiaall RReeqquuiissiittiioonn aanndd
TTeennddeerr..
[[gg]] PPrreeppaarraattiioonn ooff ddrraawwiinnggss,, MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPrroojjeecctt DDooccuummeenntt
IInnddeexx..
[[hh]] PPllaannnniinngg && SScchheedduulliinngg..
[[ii]] IIddeennttiiffyy aallll tthhee iinntteerrffaaccee ppooiinnttss // bbaatttteerryy lliimmiittss aanndd iinnccoorrppoorraattee tthheemm oonn
rreelleevvaanntt ddrraawwiinnggss aanndd ddooccuummeennttss..
[[jj]] RReevviieeww aanndd aapppprroovvaall ooff ddeessiiggnn // ddrraawwiinnggss // ddooccuummeennttss ssuubbmmiitttteedd bbyy
vveennddoorrss // ccoonnttrraaccttoorrss // ssuupppplliieerrss..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 120 of 154
[[kk]] TThhee ccoonnssuullttaanntt sshhaallll pprroovviiddee aallll tteecchhnniiccaall ddooccuummeennttss ffoorr lliiaassiioonniinngg
aassssiissttaannccee wwiitthh ssttaattuuttoorryy aauutthhoorriittiieess lliikkee RR&&BB,, SSPPCCBB ((SSttaattee PPoolllluuttiioonn
CCoonnttrrooll BBooaarrdd)),, FFoorreesstt aauutthhoorriittiieess,,iirrrriiggaattiioonn,, CCCCOOEE ((CChhiieeff CCoonnttrroolllleerr ooff
EExxpplloossiivveess)) ffoorr oobbttaaiinniinngg vvaarriioouuss ssttaattuuttoorryy ppeerrmmiissssiioonnss..
[[ll]] PPrreeppaarraattiioonn ooff TTeennddeerr DDooccuummeennttss,, iinnvviittee bbiiddss,, eevvaalluuaattiioonn ooff uunn--pprriicceedd
aanndd pprriiccee bbiiddss,, rreeccoommmmeennddaattiioonn ffoorr aawwaarrdd ooff jjoobb aass ppeerr GGAAIILL''ss CC&&PP
PPrroocceedduurree,, aassssiissttaannccee dduurriinngg nneeggoottiiaattiioonnss iiff ssiittuuaattiioonn aarriisseess.. PPrreeppaarraattiioonn
ooff LLeetttteerrss ooff IInntteenntt,, WWoorrkk OOrrddeerrss // PPuurrcchhaassee OOrrddeerrss,, CCoonnttrraacctt DDooccuummeennttss
// AAggrreeeemmeennttss,, PPuurrcchhaassee RReeqquuiissiittiioonnss ((PPRR''ss))..
[[mm]] TTeennddeerriinngg && OOrrddeerriinngg,, iinncclluuddiinngg PPuurrcchhaassee ooff aallll eeqquuiippmmeennttss aanndd
mmaatteerriiaallss,, CCuussttoommss CClleeaarraannccee aanndd TTrraannssppoorrttaattiioonn ooff mmaatteerriiaallss //
eeqquuiippmmeennttss ttoo ssiittee,, eettcc..
[[nn]] IInnssppeeccttiioonn // EExxppeeddiittiinngg ooff eeqquuiippmmeennttss // mmaatteerriiaallss bbeeiinngg mmaannuuffaaccttuurreedd bbyy
vveennddoorrss iinncclluuddiinngg ccoonnttrraaccttoorr--ssuupppplliieedd iitteemmss..
[[oo]] MMaannaaggeemmeenntt ooff CCoonnssttrruuccttiioonn SSttoorreess aanndd SSttoorreess AAccccoouunnttiinngg..
[[pp]] CCoonnssttrruuccttiioonn MMaannaaggeemmeenntt && SSuuppeerrvviissiioonn
[[qq]] QQuuaalliittyy AAssssuurraannccee aanndd QQuuaalliittyy CCoonnttrrooll..
[[rr]] PPrroojjeecctt CCoommmmiissssiioonniinngg..
[[ss]] RReevviieeww aanndd aapppprroovvaall ooff ''AAss--BBuuiilltt DDooccuummeennttss // DDrraawwiinnggss''..
[[tt]] PPrroojjeecctt CCoosstt CCoonnttrrooll,, MMaannaaggeemmeenntt && MMoonniittoorriinngg..
[[uu]] CCoonnssttrruuccttiioonn ssuuppeerrvviissiioonn iinncclluuddiinngg cceerrttiiffiiccaattiioonn ooff ccoonnttrraaccttoorr’’ss bbiillllss..
[[vv]] RRiisskk MMaannaaggeemmeenntt ooff tthhee PPrroojjeecctt aalloonngg wwiitthh ddeettaaiilleedd RRiisskk AAnnaallyyssiiss.. TThhee
RRiisskk MMaannaaggeemmeenntt PPllaann ((RRMMPP)) && DDiissaasstteerr MMaannaaggeemmeenntt PPllaann ((DDMMPP)) aarree
aallssoo ttoo bbee pprreeppaarreedd bbyy tthhee CCoonnssuullttaanntt..
[[ww]] HHeeaalltthh && SSaaffeettyy MMaannaaggeemmeenntt..
[[xx]] PPrroojjeecctt CClloosseeoouutt..
33.. SSCCOOPPEE OOFF CCUURRRREENNTT PPRROOJJEECCTT
SSccooppee uunnddeerr tthhee ccuurrrreenntt pprroojjeecctt iiss aass ffoolllloowwss::
LLaayyiinngg ooff 1100"" ddiiaammeetteerr,, aapppprrooxx.. 44..66 kkmmss.. PPiippeelliinnee ffrroomm KKeessaannaappaallllii((WWeesstt)) ttoo
PPoonnnnaammaannddaa ((iinn tthhee ssaammee RRooUU ppaarraalllleell ttoo eexxiissttiinngg 1122”” ddiiaa ppiippeelliinnee 55 mmttrrss.. aappaarrtt))
aalloonnggwwiitthh hhooookk--uupp wwiitthh ccrreeaattiioonn ooff nneeww tteerrmmiinnaall ffaacciilliittiieess aatt KKeessaannaappaallllii((WW)) aanndd
uuppggrraaddaattiioonn ooff eexxiissttiinngg PPoonnnnaammaannddaa aanndd hhooookk--uupp wwiitthh eexxiissttiinngg ssttaattiioonn ppiippiinngg
nneettwwoorrkk aatt PPoonnnnaammaannddaa.. SScchheemmaattiicc iinnddiiccaattiinngg eexxiissttiinngg ppiippeelliinnee ffaacciilliittiieess && pprrooppoosseedd
nneeww ffaacciilliittiieess ffoorr ssuuppppllyyiinngg NNaattuurraall GGaass iiss aass uunnddeerr::
44.. CCOONNTTRRAACCTT PPEERRIIOODD
TThhee ccoonnttrraaccttuuaall sscchheedduulleedd ttiimmee ffoorr tthhee PPMMCC CCoonnttrraacctt sshhaallll bbee EEIIGGHHTT ((0088)) mmoonntthhss
ffrroomm tthhee ddaattee ooff ""FFaaxx ooff AAcccceeppttaannccee ((FFOOAA))"",, wwhhiicchh iiss iinncclluussiivvee ooff TTWWOO ((0022))
mmoonntthhss ffoorr PPrroojjeecctt cclloosseeoouutt..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 121 of 154
TThhee PPMMCC wwoouulldd pprreeppaarree ddeettaaiill sscchheedduullee iinn ccoonnssuullttaattiioonn wwiitthh GGAAIILL aatt tthhee bbeeggiinnnniinngg
// dduurriinngg kkiicckk--ooffff.. AAllll eeffffoorrttss sshhoouulldd bbee mmaaddee ttoo mmeeeett aallll tthhee iinntteerrmmeeddiiaattee sscchheedduullee
aanndd mmiilleessttoonneess.. PPMMCC iiss rreeqquuiirreedd ttoo ppllaann aanndd ppuutt mmaannppoowweerr aanndd rreessoouurrcceess
aaccccoorrddiinnggllyy.. PPMMCC iiss rreeqquuiirreedd ttoo wwoorrkk ssiimmuullttaanneeoouussllyy iinn vvaarriioouuss ppaacckkaaggeess aanndd wwoorrkkss
aanndd mmaakkee aallll--oouutt eeffffoorrttss ttoo ccoommpplleettee tthhee PPrroojjeecctt oonn oorr bbeeffoorree tthhee sscchheedduulleedd ddaattee..
HHoowweevveerr,, aass ppeerr eexxttaanntt pprraaccttiicceess tthhee pprroojjeecctt sshhaallll bbee mmoonniittoorreedd ww..rr..tt iinntteerrnnaall
sscchheedduullee aass wweellll tthhee sscchheedduulleedd ddeeaaddlliinnee..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 122 of 154
SSPPEECCIIAALLCCOONNDDIITTIIOONNSS OOFF TTHHEE CCOONNTTRRAACCTT
55.. GGEENNEERRAALL::
55..11 IInn aaddddiittiioonn ttoo mmeeaanniinngg aassccrriibbeedd ttoo cceerrttaaiinn ccaappiittaalliizzeedd tteerrmmss iinn ""GGeenneerraall CCoonnddiittiioonnss
ooff CCoonnttrraacctt ((GGCCCC))"",, ffoolllloowwiinngg iinniittiiaall ccaappiittaalliizzeedd tteerrmmss sshhaallll hhaavvee tthhee mmeeaanniinngg aass
aassccrriibbeedd ttoo ssuucchh tteerrmm hheerreeuunnddeerr.. IInn ccaassee aannyy tteerrmm ddeeffiinneedd hheerreeuunnddeerr iiss aallssoo ddeeffiinneedd
iinn GGCCCC,, tthhee mmeeaanniinngg aassccrriibbeedd ttoo ssuucchh tteerrmm hheerreeuunnddeerr sshhaallll pprreevvaaiill::
•• ""BBiidd // TTeennddeerr DDooccuummeennttss"" sshhaallll mmeeaann ddooccuummeennttss iissssuueedd ttoo tthhee bbiiddddeerr
ppuurrssuuaanntt ttoo IIFFBB aanndd lliisstteedd iinn IITTBB..
•• ""EEffffeeccttiivvee DDaattee"" sshhaallll mmeeaann tthhee ddaattee oonn wwhhiicchh CCoonnssuullttaanntt''ss oobblliiggaattiioonnss wwiillll
ccoommmmeennccee aanndd tthhaatt wwiillll bbee ddaattee ooff ""FFaaxx ooff IInntteenntt ((FFOOII))"" // ""FFaaxx ooff AAcccceeppttaannccee
((FFOOAA))""..
55..22 TThhee ""SSppeecciiaall CCoonnddiittiioonnss ooff CCoonnttrraacctt ((SSCCCC))"" sshhaallll bbee rreeaadd iinn ccoonnjjuunnccttiioonn wwiitthh tthhee
""GGeenneerraall CCoonnddiittiioonnss ooff CCoonnttrraacctt ((GGCCCC))"",, ""SSccooppee ooff CCoonnssuullttaannccyy SSeerrvviicceess"",, ""PPrriiccee
SScchheedduullee // SScchheedduullee ooff RRaatteess ((SSOORR))"",, ddrraawwiinnggss,, eettcc.. aanndd aannyy ootthheerr ddooccuummeenntt ffoorrmmiinngg
ppaarrtt ooff tthhiiss CCoonnttrraacctt wwhheerreevveerr tthhee ccoonntteexxtt ssoo rreeqquuiirreess..
55..33 WWhheerreevveerr aannyy ppoorrttiioonn ooff tthhee GGCCCC iiss rreeppuuggnnaanntt ttoo oorr aatt vvaarriiaannccee wwiitthh aannyy pprroovviissiioonnss
ooff tthhee SSCCCC,, tthheenn,, uunnlleessss aa ddiiffffeerreenntt iinntteennttiioonn aappppeeaarrss,, tthhee pprroovviissiioonnss ooff tthhee SSCCCC sshhaallll
bbee ddeeeemmeedd ttoo ggoovveerrnn tthhee pprroovviissiioonnss ooff tthhee GGCCCC,, aanndd SSCCCC sshhaallll pprreevvaaiill ttoo tthhee eexxtteenntt
ooff ssuucchh rreeppuuggnnaannccyy,, oorr vvaarriiaattiioonnss eexxiisstt..
55..44 IInn tthhee CCoonnttrraacctt ddooccuummeennttss,, uunnlleessss ootthheerrwwiissee ssttaatteedd ssppeecciiffiiccaallllyy,, tthhee ssiinngguullaarr sshhaallll
iinncclluuddee tthhee pplluurraall aanndd vviiccee vveerrssaa wwhheerreevveerr tthhee ccoonntteexxtt ssoo rreeqquuiirreess..
55..55 NNoottwwiitthhssttaannddiinngg tthhee ssuubb--ddiivviissiioonnss ooff tthhee CCoonnttrraacctt ddooccuummeennttss iinnttoo sseeppaarraattee sseeccttiioonnss
aanndd vvoolluummeess,, eevveerryy ppaarrtt ooff eeaacchh sshhaallll bbee ddeeeemmeedd ttoo bbee ssuupppplleemmeennttaarryy ttoo aanndd
ccoommpplleemmeennttaarryy ooff eevveerryy ootthheerr ppaarrtt aanndd sshhaallll bbee rreeaadd wwiitthh aanndd iinnttoo tthhee AAggrreeeemmeenntt ssoo
ffaarr aass iitt mmaayy bbee pprraaccttiiccaabbllee ttoo ddoo ssoo..
55..66 AAllll hheeaaddiinnggss,, ssuubbttiittlleess aanndd mmaarrggiinnaall nnootteess ttoo tthhee ccllaauusseess ooff tthhee GGCCCC,, SSCCCC oorr ttoo tthhee
ssppeecciiffiiccaattiioonnss oorr ttoo aannyy ootthheerr ppaarrtt ooff BBiidd DDooccuummeenntt aarree ssoolleellyy ffoorr tthhee ppuurrppoossee ooff
ggiivviinngg aa ccoonncciissee iinnddiiccaattiioonn aanndd nnoott aa ssuummmmaarryy ooff tthhee ccoonntteennttss tthheerreeooff,, aanndd tthheeyy sshhaallll
nneevveerr bbee ddeeeemmeedd ttoo bbee ppaarrtt tthheerreeooff oorr bbee uusseedd iinn iinntteerrpprreettaattiioonn tthheerreeooff..
55..77 ''CCoommpplleettiioonn CCeerrttiiffiiccaattee'' wwiillll bbee iissssuueedd bbyy tthhee EEnnggiinneeeerr--iinn--CChhaarrggee ((EEIICC)) ooff OOwwnneerr oonn
aacccceeppttaannccee ooff ''CClloosseeoouutt RReeppoorrtt'' ssuubbmmiitttteedd bbyy CCoonnssuullttaanntt..
55..88 TThhee qquuootteedd rraatteess sshhaallll bbee ddeeeemmeedd ttoo bbee iinncclluussiivvee ooff aallll aapppplliiccaabbllee ttaaxxeess,, dduuttiieess,, ooccttrrooii,,
lleevviieess,, wwoorrkk ccoonnttrraacctt ttaaxx iiff aannyy.. SSeerrvviiccee ttaaxx aass ppeerr sseerrvviiccee ttaaxx aacctt,, sshhaallll bbee qquuootteedd
sseeppaarraatteellyy iinn tthhee lliinnee iitteemm pprroovviiddeedd.. BBiiddddeerr sshhaallll nnoott bbee eelliiggiibbllee ffoorr aannyy ootthheerr
rreevviissiioonn iinn rraatteess ttiillll tthhee ccoommpplleettiioonn ooff tthhee ccoonnttrraacctt aanndd ccoonnttrraaccttoorr sshhaallll nnoott bbee eelliiggiibbllee
ffoorr aannyy ccoommppeennssaattiioonn oonn tthhiiss aaccccoouunntt dduurriinngg eennttiirree ccoonnttrraacctt ppeerriioodd.. TThhee ccoonnttrraaccttoorr
hhaass ttoo rraaiissee CCeennvvaattaabbllee iinnvvooiiccee sshhoowwiinngg cclleeaarrllyy tthhee sseerrvviiccee ttaaxx aalloonngg wwiitthh cceessss
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 123 of 154
ccoommppoonneenntt sseeppaarraatteellyy iinn tthhee iinnvvooiiccee.. FFuurrtthheerr tthhee bbiiddddeerr aatt tthhee ttiimmee ooff bbiiddddiinngg mmuusstt
iinnddiiccaattee tthhee sseerrvviiccee ttaaxx ccoommppoonneenntt ii..ee.. %% sseerrvviiccee ttaaxx aapppplliiccaabbllee..
55..99 WWhheerreevveerr iitt iiss mmeennttiioonneedd iinn tthhee ssccooppee ooff wwoorrkk // ssppeecciiffiiccaattiioonnss tthhaatt tthhee CCoonnssuullttaanntt
sshhaallll ppeerrffoorrmm cceerrttaaiinn wwoorrkk oorr pprroovviiddee cceerrttaaiinn ffaacciilliittiieess,, iitt iiss uunnddeerrssttoooodd tthhaatt tthhee
CCoonnssuullttaanntt sshhaallll ddoo ssoo aatt hhiiss ccoosstt aanndd tthhee vvaalluuee ooff CCoonnttrraacctt sshhaallll bbee ddeeeemmeedd ttoo hhaavvee
iinncclluuddeedd ccoosstt ooff ssuucchh ppeerrffoorrmmaannccee aanndd pprroovviissiioonnss ssoo mmeennttiioonneedd..
55..1100 IInn ccaassee ooff aann iirrrreeccoonncciillaabbllee ccoonnfflliicctt aammoonnggsstt ""GGeenneerraall CCoonnddiittiioonnss ooff CCoonnttrraacctt"",,
""SSppeecciiaall CCoonnddiittiioonnss ooff CCoonnttrraacctt"",, ""SSccooppee ooff CCoonnssuullttaannccyy SSeerrvviicceess"",, ""PPrriiccee SScchheedduullee //
SScchheedduullee ooff RRaatteess ((SSOORR))"",, eettcc..,, tthhee ffoolllloowwiinngg sshhaallll pprreevvaaiill ttoo tthhee eexxtteenntt ooff ssuucchh
iirrrreeccoonncciillaabbllee ccoonnfflliicctt iinn oorrddeerr ooff pprreecceeddeennccee::
((ii)) LLeetttteerr ooff AAcccceeppttaannccee ((aalloonnggwwiitthh PPrriiccee SScchheedduullee // SSOORR)) // CCoonnttrraacctt AAggrreeeemmeenntt..
((iiii)) FFaaxx ooff IInntteenntt // LLeetttteerr ooff IInntteenntt // FFaaxx ooff AAcccceeppttaannccee..
((iiiiii)) SSccooppee ooff CCoonnssuullttaannccyy SSeerrvviicceess..
((iivv)) IInnssttrruuccttiioonnss ttoo BBiiddddeerrss..
((vv)) SSppeecciiaall CCoonnddiittiioonnss ooff CCoonnttrraacctt..
((vvii)) GGeenneerraall CCoonnddiittiioonnss ooff CCoonnttrraacctt..
((vviiii)) IInnddiiaann SSttaannddaarrddss..
((vviiiiii)) OOtthheerr AApppplliiccaabbllee SSttaannddaarrddss..
55..1111 IItt wwiillll bbee CCoonnssuullttaanntt''ss rreessppoonnssiibbiilliittyy ttoo bbrriinngg ttoo tthhee nnoottiiccee ooff EEIICC aannyy iirrrreeccoonncciillaabbllee
ccoonnfflliicctt iinn tthhee CCoonnttrraacctt DDooccuummeennttss bbeeffoorree ssttaarrttiinngg tthhee wwoorrkk((ss)) oorr mmaakkiinngg tthhee ssuuppppllyy
wwiitthh rreeffeerreennccee ttoo wwhhiicchh tthhee ccoonnfflliicctt eexxiissttss..
66.. PPEERRFFOORRMMAANNCCEE EEVVAALLUUAATTIIOONN::
66..11 TThhee ppeerrffoorrmmaannccee ooff CCoonnssuullttaanntt ttoo wwhhoomm tthhee aawwaarrdd iiss ppllaacceedd sshhaallll bbee eevvaalluuaatteedd rriigghhtt
ffrroomm ssuubbmmiissssiioonn ooff bbiidd ttiillll tthhee ffiinnaall ccoommpplleettiioonn..
77.. PPAAYYMMEENNTT TTEERRMMSS AANNDD MMOODDEE OOFF PPAAYYMMEENNTT::
77..11 TTeerrmmss ooff PPaayymmeenntt::
((ii)) AAllll tthhee rreelleevvaanntt ccllaauusseess ooff ""GGeenneerraall CCoonnddiittiioonnss ooff CCoonnttrraacctt"",, ""IInnssttrruuccttiioonnss ttoo
BBiiddddeerrss"" aanndd ""SSppeecciiaall CCoonnddiittiioonnss ooff CCoonnttrraacctt"" sshhaallll bbee aapppplliiccaabbllee..
((iiii)) PPaayymmeenntt sshhaallll ssttaarrtt oonnllyy aafftteerr ssiiggnniinngg ooff CCoonnttaacctt AAggrreeeemmeenntt aass ppeerr BBiidd
DDooccuummeenntt..
((iiiiii)) PPaayymmeennttss wwiillll bbee bbaasseedd oonn ssuucccceessssffuull ccoommpplleettiioonn ooff mmiilleessttoonnee aaccttiivviittiieess,, aass
ppeerr tthhee %% aammoouunntt ooff lluummppssuumm vvaalluuee qquuootteedd bbyy tthhee PPMMCC.. PPaayymmeenntt sshhaallll bbee
mmaaddee tthhrroouugghh ee--bbaannkkiinngg.. TThhee ccoonnssuullttaanntt sshhaallll rraaiissee mmoonntthhllyy iinnvvooiicceess ffoorr tthhee
mmiilleessttoonneess aattttaaiinneedd dduurriinngg tthhee bbiilllliinngg ppeerriioodd wwiitthh rreeqquuiirreedd ddooccuummeennttaattiioonn..
TThhee ccoonnssuullttaanntt sshhaallll ssuubbmmiitt cceennvvaattaabbllee iinnvvooiiccee ttoo eennaabbllee GGAAIILL ttoo aavvaaiill
CCeennvvaatt CCrreeddiitt.. TThhee ddeettaaiillss ooff tthhee mmiilleessttoonneess aarree aass eenncclloosseedd aatt nneexxtt
ffoorrtthhccoommiinngg ppaaggeess..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 124 of 154
((iivv)) IInn ccaassee aannyy mmiilleessttoonnee iiss nnoott aapppplliiccaabbllee,, oorr nnoott eexxeeccuuttaabbllee,, oorr mmiilleessttoonneess aarree
cclluubbbbeedd,, ppaayymmeenntt wwoouulldd bbee rreelleeaasseedd wwiitthh ssuuiittaabbllee cclluubbbbiinngg // ssuubbssttiittuuttiioonn
wwiitthh tthhee aapppprroovvaall ooff GGAAIILL''ss EEIICC..
((vv)) IInn ccaassee aannyy mmiilleessttoonnee iiss nnoott aacchhiieevveedd,, ppaayymmeenntt ffoorr tthhee ssaammee sshhaallll nnoott bbee
mmaaddee.. HHoowweevveerr,, oonn ccoommpplleettiioonn ooff PPrroojjeecctt,, aallll tthhee mmiilleessttoonneess wwiillll bbee ddeeeemmeedd
ccoommpplleetteedd aanndd ppaayymmeennttss aaggaaiinnsstt tthhee mmiilleessttoonneess wwiillll bbee rreelleeaasseedd..
((vvii)) TThhee PPMMCC sshhaallll bbee rreessppoonnssiibbllee ttoo ssuubbmmiitt tthhee iinnvvooiicceess tthhrroouugghh GGAAIILL''ss BBiillll
WWaattcchh SSyysstteemm ((BBWWSS)) aanndd rreettaaiinn aann eelleeccttrroonniicc rreecceeiipptt oonn ssuubbmmiissssiioonn.. GGAAIILL
wwiillll nnoott eenntteerrttaaiinn aannyy bbiillll nnoott ssuubbmmiitttteedd tthhrroouugghh BBWWSS.. OOwwnneerr sshhaallll eennddeeaavvoorr
ttoo rreelleeaassee ppaayymmeennttss wwiitthhiinn ffiifftteeeenn ((1155)) ddaayyss,, ffoorr tthhee bbiillllss rraaiisseedd bbyy tthhee PPMMCC,,
tthhrroouugghh ee--bbaannkkiinngg..
((vviiii)) PPaayymmeenntt sshhaallll bbee mmaaddee ttoo tthhee bbaannkk aaccccoouunntt bbeeaarriinngg tthhee nnaammee ooff PPMMCC ttoo
wwhhoomm WWoorrkk OOrrddeerr hhaass bbeeeenn rreelleeaasseedd bbyy GGAAIILL.. TThhee PPMMCC sshhoouulldd ooppeenn aa bbaannkk
aaccccoouunntt iinn IInnddiiaa..
((vviiiiii)) ""CClloosseeoouutt ooff PPrroojjeecctt"" iinn MMiilleessttoonnee aabboovvee rreeffeerrss ttoo:: MMeecchhaanniiccaall ccoommpplleettiioonn ooff
tthhee PPrroojjeecctt,, ssuubbsseeqquueenntt ccoommmmiissssiioonniinngg ooff aallll ffaacciilliittiieess iinnssttaalllleedd,, cclloossuurree ooff aallll
ppuurrcchhaassee oorrddeerrss,, wwoorrkk oorrddeerrss,, ccoonnttrraaccttss,, ssuubbmmiissssiioonn ooff aallll aass--bbuuiilltt ddrraawwiinnggss,,
ooppeerraattiinngg mmaannuuaallss,, ddooccuummeennttss,, eettcc.. ffrroomm vveennddoorrss // ccoonnttrraaccttoorrss ttoo OOwwnneerr aanndd
rreecceeiipptt ooff aallll uunnuusseedd mmaatteerriiaall ffrroomm ccoonnttrraaccttoorrss aanndd rreettuurrnn ttoo OOwwnneerr aafftteerr dduuee
mmaatteerriiaall rreeccoonncciilliiaattiioonn,, rreeccoommmmeennddiinngg ppeennaallttiieess,, rreeccoovveerriieess ((iiff aannyy)) ffoorr
sshhoorrttaaggee,, ddaammaaggeess iinn ggooooddss,, ssuubbmmiissssiioonn ooff vveennddoorr((ss))'' // ccoonnttrraaccttoorr((ss))''
ppeerrffoorrmmaannccee eevvaalluuaattiioonn aanndd ssuubbmmiissssiioonn ooff PPrroojjeecctt CClloosseeoouutt RReeppoorrtt,, eettcc..
((iixx)) VVEERRYY IIMMPPOORRTTAANNTT::
EEaacchh mmiilleessttoonnee ppaayymmeenntt sshhaallll bbee aass ppeerr bbeellooww ccrriitteerriiaa::
--
OOnn ccoommpplleettiioonn ooff MMiilleessttoonneess aaggaaiinnsstt eeaacchh aaccttiivviittyy ooff PPrroojjeecctt aass
iiddeennttiiffiieedd iinn tthhee ssccooppee ooff wwoorrkk pprrooggrreessssiivveellyy bbaasseedd oonn
FFoorrttnniigghhttllyy iinnvvooiicceess
9955%%
-- AAfftteerr cclloossee oouutt ooff PPrroojjeecctt oonn ccoommpplleettiioonn ooff jjoobb iinn aallll rreessppeeccttss 55%%
DDeedduuccttiioonn aatt SSoouurrccee::
•• OOwwnneerr wwiillll rreelleeaassee tthhee ppaayymmeenntt ttoo tthhee CCoonnssuullttaanntt aafftteerr eeffffeeccttiinngg ddeedduuccttiioonnss aass ppeerr
aapppplliiccaabbllee llaaww iinn ffoorrccee..
•• OOwwnneerr wwiillll rreelleeaassee ppaayymmeennttss ttoo tthhee CCoonnssuullttaanntt aafftteerr ooffffsseettttiinngg aallll dduueess ttoo tthhee
OOwwnneerr ppaayyaabbllee bbyy tthhee CCoonnssuullttaanntt uunnddeerr tthhee CCoonnttrraacctt..
•• SSeerrvviiccee ttaaxx wwoouulldd bbee ppaaiidd eexxttrraa aatt aaccttuuaallss oonn rreecceeiipptt ooff cceennvvaattaabbllee iinnvvooiiccee..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 125 of 154
77..22 LLiisstt ooff MMiilleessttoonneess ffoorr rreelleeaassee ooff PPaayymmeenntt::
ss..nn DDeessccrriippttiioonn %%
ppaayymmeenntt
%% ccuummuullaattiivvee
ppaayymmeenntt
[[AA]] EEnnggiinneeeerriinngg 1100..0000
11.. CCeerrttiiffiiccaattiioonn aanndd iinnssppeeccttiioonn ooff DDeessiiggnn BBaassiiss
DDooccuummeenntt aanndd RReevviieeww
11..5500 11..5500
22.. FFiinnaalliizzaattiioonn ooff PPrroocceessss PP&&IIDD''ss aalloonngg wwiitthh SSuubbmmiissssiioonn
ooff FFiinnaall DDooccuummeenntt
22..0000 33..5500
33.. CCoommpplleettiioonn ooff HHAAZZOOPP SSttuuddyy aalloonngg wwiitthh SSuubbmmiissssiioonn
ooff FFiinnaall PP&&IIDD''ss aanndd HHAAZZOOPP CClloossuurree RReeppoorrtt,, EEIIAA,,
EEMMPP
00..5500 44..0000
44.. FFiinnaalliizzaattiioonn ooff TTeennddeerr DDooccuummeenntt ffoorr MMaaiinnlliinnee VVaallvveess 00..5500 44..5500
55.. FFiinnaalliizzaattiioonn ooff TTeennddeerr DDooccuummeenntt ffoorr SSccrraappppeerr TTrraappss,,
FFllooww TTeeeess && IInnssuullaattiinnggJJooiinnttss
00..5500 55..0000
66.. FFiinnaalliizzaattiioonn ooff TTeennddeerr DDooccuummeenntt ffoorr PPiippee LLaayyiinngg &&
CCoommppoossiittee WWoorrkkss
33..5500 88..5500
77.. FFiinnaalliizzaattiioonn ooff TTeennddeerr DDooccuummeenntt ffoorr PPoowweerr SSoouurrccee,,
SSCCAADDAA SSyysstteemm aanndd tteelleeccoomm ssyysstteemm
11..0000 99..5500
88.. FFiinnaalliizzaattiioonn ooff MMaatteerriiaall TTaakkee--ooffff ((MMTTOO)) ffoorr AAssssoorrtteedd
PPiippeess ,, FFiittttiinnggss,, FFllaannggeess,, VVaallvveess
00..5500 1100..0000
ss..nn DDeessccrriippttiioonn %%
ppaayymmeenntt
%% ccuummuullaattiivvee
ppaayymmeenntt
[[BB]] PPllaannnniinngg aanndd SScchheedduulliinngg 11..0000
11.. FFiinnaalliizzaattiioonn ooff LLeevveell --33 IInntteerrnnaall SScchheedduullee 00..1155 1100..1155
22.. FFiinnaalliizzaattiioonn aanndd SSuubbmmiissssiioonn ooff LLiisstt ooff MMiilleessttoonneess ffoorr
IInntteerrnnaall MMoonniittoorriinngg
00..1155 1100..3300
33.. FFiinnaalliizzaattiioonn ooff PPrroojjeecctt EExxeeccuuttiioonn PPllaann // MMeetthhooddoollooggyy 00..2200 1100..5500
44.. SSuubbmmiissssiioonn ooff OOrrggaannooggrraamm ffoorr PPrroojjeecctt OOffffiiccee &&
ccoonnssttrruuccttiioonn SSiittee aalloonngg wwiitthh DDeeppllooyymmeenntt ooff
MMaannppoowweerr
00..5500 1111..0000
ss..nn DDeessccrriippttiioonn %%
ppaayymmeenntt
%% ccuummuullaattiivvee
ppaayymmeenntt
[[CC]] TTeennddeerriinngg 77..0000
11.. IIssssuuee && PPuubblliiccaattiioonn ooff NNIITT ffoorr PPiippee LLaayyiinngg &&
CCoommppoossiittee WWoorrkkss
11..5500 1122..5500
22.. IIssssuuee && PPuubblliiccaattiioonn ooff NNIITT ffoorr PPrrooccuurreemmeenntt ooff
MMaaiinnlliinnee VVaallvveess
00..5500 1133..0000
33.. IIssssuuee && PPuubblliiccaattiioonn ooff NNIITT ffoorr PPrrooccuurreemmeenntt ooff
SSccrraappppeerr TTrraappss,, FFllooww TTeeeess && IInnssuullaattiinngg JJooiinnttss
00..5500 1133..5500
44.. IIssssuuee && PPuubblliiccaattiioonn ooff NNIITT ffoorr PPrrooccuurreemmeenntt ooff PPoowweerr
SSoouurrccee,, SSCCAADDAA aanndd tteelleeccoomm ssyysstteemmss
00..5500 1144..0000
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 126 of 154
55.. IIssssuuee && PPuubblliiccaattiioonn ooff NNIITT ffoorr PPrrooccuurreemmeenntt ooff
AAssssoorrtteedd PPiippeess,, FFiittttiinnggss,, FFllaannggeess,, VVaallvveess
00..5500 1144..5500
66.. SSuubbmmiissssiioonn ooff PPBBOO RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall
ffoorr PPiippee LLaayyiinngg && CCoommppoossiittee WWoorrkkss
11..5500 1166..0000
77.. SSuubbmmiissssiioonn ooff PPBBOO RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall
ffoorr PPrrooccuurreemmeenntt ooff MMaaiinnlliinnee VVaallvveess
00..5500 1166..5500
88.. SSuubbmmiissssiioonn ooff PPBBOO RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall
ffoorr SSccrraappppeerr TTrraappss,, FFllooww TTeeeess && IInnssuullaattiinngg JJooiinnttss
00..5500 1177..0000
99.. SSuubbmmiissssiioonn ooff PPBBOO RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall
ffoorr PPrrooccuurreemmeenntt ooff PPoowweerr SSoouurrccee,, SSCCAADDAA aanndd
tteelleeccoomm ssyysstteemmss
00..5500 1177..5500
1100.. SSuubbmmiissssiioonn ooff PPBBOO RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall
ffoorr AAssssoorrtteedd PPiippeess,, FFiittttiinnggss,, FFllaannggeess,, VVaallvveess eettcc
00..5500 1188..0000
ss..nn DDeessccrriippttiioonn %%
ppaayymmeenntt
%% ccuummuullaattiivvee
ppaayymmeenntt
[[DD]] OOrrddeerriinngg 1100..0000
11.. SSuubbmmiissssiioonn ooff AAwwaarrdd // OOrrddeerr PPllaacceemmeenntt
rreeccoommmmeennddaattiioonnss aanndd AApppprroovvaall ffoorr PPiippee LLaayyiinngg &&
CCoommppoossiittee WWoorrkkss
22..0000 2200..0000
22.. SSuubbmmiissssiioonn ooff AAwwaarrdd // OOrrddeerr PPllaacceemmeenntt
rreeccoommmmeennddaattiioonnss aanndd AApppprroovvaall ffoorr PPrrooccuurreemmeenntt ooff
MMaaiinnlliinnee VVaallvveess
00..7755 2200..7755
33.. SSuubbmmiissssiioonn ooff AAwwaarrdd // OOrrddeerr PPllaacceemmeenntt
RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall ffoorr PPrrooccuurreemmeenntt ooff
SSccrraappppeerr TTrraappss,, FFllooww TTeeeess aanndd IInnssuullaattiinngg JJooiinnttss
00..7755 2211..5500
44.. SSuubbmmiissssiioonn ooff AAwwaarrdd // OOrrddeerr PPllaacceemmeenntt
RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall ffoorr PPoowweerr ssoouurrccee,,
SSCCAADDAA aanndd tteelleeccoomm ssyysstteemmss
00..7755 2222..2255
55.. SSuubbmmiissssiioonn ooff AAwwaarrdd // OOrrddeerr PPllaacceemmeenntt
RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall ffoorr AAssssoorrtteedd PPiippeess,,
FFiittttiinnggss,, FFllaannggeess,, VVaallvveess
00..7755 2233..0000
66.. AAssssiissttiinngg GGAAIILL bbyy ssuubbmmiittttiinngg ddrraafftt LLOOAA ffoorr PPiippee
LLaayyiinngg && CCoommppoossiittee WWoorrkkss
22..0000 2255..0000
77.. AAssssiissttiinngg GGAAIILL bbyy ssuubbmmiittttiinngg ddrraafftt LLOOAA ffoorr
PPrrooccuurreemmeenntt ooff MMaaiinnlliinnee VVaallvveess
00..7755 2255..7755
88.. AAssssiissttiinngg GGAAIILL bbyy ssuubbmmiittttiinngg ddrraafftt LLOOAA ffoorr
PPrrooccuurreemmeenntt ooff SSccrraappppeerr TTrraappss,, FFllooww TTeeeess aanndd
IInnssuullaattiinngg JJooiinnttss
00..7755 2266..5500
99.. AAssssiissttiinngg GGAAIILL bbyy ssuubbmmiittttiinngg ddrraafftt LLOOAA ffoorr PPoowweerr
ssoouurrccee,, SSCCAADDAA aanndd tteelleeccoomm ssyysstteemmss
00..7755 2277..2255
1100.. AAssssiissttiinngg GGAAIILL bbyy ssuubbmmiittttiinngg ddrraafftt LLOOAA ffoorr AAssssoorrtteedd
PPiippeess,, FFiittttiinnggss,, FFllaannggeess,, VVaallvveess
00..7755 2288..0000
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 127 of 154
ss..nn DDeessccrriippttiioonn %%
ppaayymmeenntt
%% ccuummuullaattiivvee
ppaayymmeenntt
[[EE]] IInnssppeeccttiioonn,, EExxppeeddiittiinngg,, MMaannuuffaaccttuurriinngg &&
ddeelliivveerryy
1177..0000
11.. AApppprroovvaall ooff DDrraawwiinnggss // DDooccuummeennttss ffoorr PPiippee LLaayyiinngg
&& CCoommppoossiittee WWoorrkkss
22..0000 3300..0000
22.. AApppprroovvaall ooff DDrraawwiinnggss // DDooccuummeennttss ffoorr
ccoommmmeenncceemmeenntt ooff MMaannuuffaaccttuurriinngg ffoorr MMaaiinnlliinnee
VVaallvveess
11..0000 3311..0000
33.. AApppprroovvaall ooff DDrraawwiinnggss // DDooccuummeennttss ffoorr
ccoommmmeenncceemmeenntt ooff MMaannuuffaaccttuurriinngg ffoorr SSccrraappppeerr TTrraappss,,
FFllooww TTeeeess && IInnssuullaattiinngg JJooiinnttss
22..0000 3333..0000
44.. AApppprroovvaall ooff DDrraawwiinnggss // DDooccuummeennttss ffoorr
ccoommmmeenncceemmeenntt ooff MMaannuuffaaccttuurriinngg ffoorr PPoowweerr ssoouurrccee,,
SSCCAADDAA aanndd tteelleeccoomm ssyysstteemmss
22..0000 3355..0000
55.. AApppprroovvaall ooff DDrraawwiinnggss // DDooccuummeennttss ffoorr
ccoommmmeenncceemmeenntt ooff MMaannuuffaaccttuurriinngg ffoorr AAssssoorrtteedd PPiippeess,,
FFiittttiinnggss,, FFllaannggeess,, VVaallvveess
22..0000 3377..0000
66.. DDeelliivveerryy ccoommpplleettee aatt ddeessiiggnnaatteedd DDuummppssiittee // SSttoorree ffoorr
MMaaiinnlliinnee VVaallvveess
22..0000 3399..0000
77.. DDeelliivveerryy ccoommpplleettee aatt ddeessiiggnnaatteedd DDuummppssiittee //
CCoonnssttrruuccttiioonn SSiittee SSttoorree SSccrraappppeerr TTrraappss,, FFllooww TTeeeess &&
IInnssuullaattiinngg JJooiinnttss
22..0000 4411..0000
88.. DDeelliivveerryy,, IInnssttaallllaattiioonn && CCoommmmiissssiioonniinngg ccoommpplleettee ffoorr
PPoowweerr SSoouurrccee,, SSCCAADDAA aanndd TTeelleeccoomm ssyysstteemm
22..0000 4433..0000
99.. DDeelliivveerryy ccoommpplleettee aatt DDeessiiggnnaatteedd CCoonnssttrruuccttiioonn SSiittee ffoorr
AAssssoorrtteedd PPiippeess,, FFiittttiinnggss,, FFllaannggeess,, VVaallvveess
22..0000 4455..0000
ss..nn DDeessccrriippttiioonn %%
ppaayymmeenntt
%% ccuummuullaattiivvee
ppaayymmeenntt
[[FF]] CCoonnssttrruuccttiioonn && CCoommmmiissssiioonniinngg 5500..0000
11.. CCoommpplleettee MMoobbiilliizzaattiioonn ooff CCoonnssuullttaanntt MMaannppoowweerr aatt
SSiittee aass ppeerr rreeqquuiirreemmeenntt aanndd SSuubbmmiissssiioonn ooff
OOrrggaannooggrraamm
22..5500 4477..5500
22.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 1100%% 22..5500 5500..0000
33.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 2255%% 22..5500 5522..5500
44.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 4400%% 22..5500 5555..0000
55.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 5500%% 22..5500 5577..5500
66.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 7755%% 22..5500 6600..0000
77.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 8855%% 33..0000 6633..0000
88.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 110000%% 44..0000 6677..0000
99.. SSuubbmmiissssiioonn ooff MMeecchhaanniiccaall CCoommpplleettiioonn CCeerrttiiffiiccaattee 44..0000 7711..0000
1100.. CCoommmmiissssiioonniinngg && GGaass--IInn ffoorr PPiippeelliinnee SSyysstteemm aanndd 44..0000 7755..0000
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 128 of 154
SSuubbmmiissssiioonn ooff CCoommmmiissssiioonniinngg CCeerrttiiffiiccaattee
1111.. CCoommmmiissssiioonniinngg && GGaass--IInn ffoorr aallll SSttaattiioonnss && TTeerrmmiinnaallss 44..0000 7799..0000
1122.. AAccccuurraattee CCoosstt EEssttiimmaattee ffoorr aallll PPuurrcchhaassee OOrrddeerrss aanndd
WWoorrkk OOrrddeerrss
22..0000 8811..0000
1133.. SSuubbmmiissssiioonn ooff aallll PPOO CClloossuurree SSttaatteemmeennttss 22..0000 8833..0000
1144.. SSuubbmmiissssiioonn ooff aallll WWOO CClloossuurree SSttaatteemmeennttss 22..0000 8855..0000
1155.. AAcccceeppttaannccee ooff aallll PPOO CClloossuurree SSttaatteemmeennttss pprreeppaarreedd bbyy
CCoonnssuullttaanntt
22..0000 8877..0000
1166.. AAcccceeppttaannccee ooff aallll WWOO CClloossuurree SSttaatteemmeennttss pprreeppaarreedd
bbyy CCoonnssuullttaanntt
22..0000 8899..0000
1177.. SSuubbmmiissssiioonn ooff PPeerrffoorrmmaannccee CCaarrddss ooff aallll VVeennddoorrss 11..0000 9900..0000
1188.. SSuubbmmiissssiioonn ooff PPeerrffoorrmmaannccee CCaarrddss ooff aallll CCoonnttrraaccttoorrss 11..0000 9911..0000
1199.. HHaannddoovveerr ooff LLiisstt ooff SSuurrpplluuss aanndd NNoonn--ggeenneerraattiioonn ooff
SSuurrpplluuss MMaatteerriiaall bbeeyyoonndd
22..0000 9933..0000
2200.. HHaannddoovveerr ooff ccoommpplleettee MMaatteerriiaall RReeccoonncciilliiaattiioonn 22..0000 9955..0000
ss..nn DDeessccrriippttiioonn %%
ppaayymmeenntt
%% ccuummuullaattiivvee
ppaayymmeenntt
[[GG]] PPrroojjeecctt CClloosseeoouutt 55..0000
11.. PPrroojjeecctt CClloosseeoouutt aanndd SSuubbmmiissssiioonn ooff PPrroojjeecctt CClloossuurree
RReeppoorrtt
55..0000 110000..0000
TTOOTTAALL 110000..0000
NNoottee::
((ii)) IInn ccaassee aannyy ppaacckkaaggee iiss iinncclluuddeedd iinn tthhee ccoommppoossiittee ccoonnssttrruuccttiioonn tteennddeerr,, tthheenn
mmiilleessttoonnee ((uuppttoo ssuuppppllyy ooff mmaatteerriiaall)) ffoorr tthhaatt ppaacckkaaggee sshhaallll bbee rreelleeaasseedd oonnllyy
aafftteerr rreecceeiipptt ooff mmaatteerriiaall aatt ssiittee..
((iiii)) AAss ""PPrroojjeecctt CClloosseeoouutt"" hhaass bbeeeenn mmaaddee sseeppaarraattee mmiilleessttoonnee,, AArrttiiccllee--33..55..33..33 ooff
GGCCCC iiss mmooddiiffiieedd aass bbeellooww:: OOnn ccoommpplleettiioonn ooff mmiilleessttoonneess lliisstteedd aabboovvee :: 110000%%
ooff ppaayymmeenntt dduuee aaggaaiinnsstt tthhee mmiilleessttoonnee
VVEERRYY IIMMPPOORRTTAANNTT::
EEaacchh mmiilleessttoonnee ppaayymmeenntt sshhaallll bbee aass ppeerr bbeellooww ccrriitteerriiaa::
-- OOnn ccoommpplleettiioonn ooff MMiilleessttoonneess aaggaaiinnsstt eeaacchh aaccttiivviittyy ooff PPrroojjeecctt aass iiddeennttiiffiieedd iinn tthhee
ssccooppee ooff wwoorrkk pprrooggrreessssiivveellyy bbaasseedd oonn FFoorrttnniigghhttllyy iinnvvooiicceess 9955%%
-- AAfftteerr cclloossee oouutt ooff PPrroojjeecctt oonn ccoommpplleettiioonn ooff jjoobb iinn aallll rreessppeeccttss 55%%
88.. PPRRIICCEE RREEDDUUCCTTIIOONN SSCCHHEEDDUULLEE [[PPRRSS]]:: aass ppeerr GGCCCC..
99.. TTAAXXEESS AANNDD DDUUTTIIEESS CCLLAAUUSSEE:: aass ppeerr GGCCCC..
1100.. TTEERRMMIINNAATTIIOONN CCLLAASSUUEE:: aass ppeerr GGCCCC..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 129 of 154
1111.. CCOOMMPPEENNSSAATTIIOONN OONN SSUUSSPPEENNSSIIOONN OOFF TTHHEE PPEERRFFOORRMMAANNCCEE OOFF
DDUUTTIIEESS && SSEERRVVIICCEESS::
1111..11 IInn ccaassee GGAAIILL ssuussppeennddss tthhee wwoorrkk iinn tteerrmmss ooff aarrttiiccllee NNoo.. 33..1111 ooff GGCCCC,, tthhee ccoonnssuullttaanntt
sshhaallll bbee ccoommppeennssaatteedd iinn oorrddeerr ttoo mmaaiinnttaaiinn tthhee mmiinniimmuumm eexxppeennddiittuurree oonn wweeeekkllyy
bbaassiiss.. SSuucchh ccoommppeennssaattiioonn sshhaallll nnoott bbee ppaayyaabbllee ffoorr ffiirrsstt 33 mmoonntthhss.. IIff ssuussppeennssiioonn
ccoonnttiinnuueess bbeeyyoonndd tthhrreeee mmoonntthhss,, tthhee ccoommppeennssaattiioonn sshhaallll bbee ppaaiidd bbaasseedd oonn tthhee qquuootteedd
ppeerr wweeeekk ((ccoommpplleetteedd)) rraattee.. TThhee ccoonnssuullttaanntt sshhaallll mmeennttiioonn tthhee rraattee ffoorr ssuucchh
ccoommppeennssaattiioonn ppeerr ccoommpplleetteedd wweeeekk iinn tthhee ““PPrriicceedd PPaarrtt”” wwhhiicchh wwiillll bbee ccoonnssiiddeerreedd ffoorr
eevvaalluuaattiioonn.. TThhee ppeerriioodd ccoonnssiiddeerreedd ffoorr tthhee ppuurrppoossee ooff eevvaalluuaattiioonn sshhaallll bbee 1122
ccoommpplleetteedd wweeeekkss..
1111..22 IInn ccaassee ooff ssuussppeennssiioonn bbeeyyoonndd ssiixx mmoonntthhss,, eeiitthheerr ppaarrttyy hhaass tthhee ooppttiioonn ttoo ttaakkee aaccttiioonn aass
ppeerr AArrttiiccllee NNoo.. 33..1111..66 ooff GGCCCC..
1111..33 IInn ccaassee tthhee bbiiddddeerr ddooeess nnoott iinnddiiccaattee tthhee rraattee ffoorr ccoommppeennssaattiioonn aass ppeerr tthhee pprrooffoorrmmaa iinn
tthhee PPrriicceedd PPaarrtt,, iitt wwiillll bbee ccoonnssiiddeerreedd tthhaatt nnoo ccoommppeennssaattiioonn iiss rreeqquuiirreedd ttoo bbee ppaaiidd ttoo
tthhee ccoonnssuullttaanntt aanndd pprroovviissiioonnss ooff CCllaauussee NNoo....55..00 wwiillll nnoott bbee aapppplliiccaabbllee ffoorr tthheemm..
12.0 FORMAT OF BIO DATA
Bio-Data of the Key personnel viz: Project Manager, Engineering Manager,
Construction Manager, Planning Manager, Inspection Manager, Contracts
Manager as per format enclosed in next page
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 130 of 154
FORMAT FOR BIO DATA
Paste
Photograph
Here
1. Name
2. DOB
3. Place of Birth
4. Nationality
5. Contact Details, Phone No.,
6. Languages Know (Read, Write,
Speak)
7. Educational Qualifications
8. Professional Qualifications
9. Affiliations to Professional
Bodies
10.
Professional Experience
Organization From To Years Position Responsibilities
11.
Computer & Software’s
Proficiency
12.
Contact details
Tel No.
Mobile No.
Email.
12.
Any Other Information:
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 131 of 154
SECTION – VI
PRICE SCHEDULE
SCHEDULE OF RATE (SOR)
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 132 of 154
SSCCHHEEDDUULLEE OOFF RRAATTEESS [[SSOORR]] HHIIRRIINNGG OOFF PPMMCC FFOORR KKSSPP((WWeesstt)) ttoo PPOONNNNAAMMAANNDDAA
11..00 PPRREEAAMMBBLLEE TTOO PPRRIICCEE SSCCHHEEDDUULLEE
11..11 PPrriiccee SScchheedduullee sshhaallll bbee rreeaadd iinn ccoonnjjuunnccttiioonn wwiitthh GGCCCC,, SSCCCC,, IITTBB aanndd SSccooppee ooff wwoorrkk ooff
tthhiiss tteennddeerr ddooccuummeenntt..
11..22 TThhee qquuootteedd pprriiccee ooff tthhee bbiiddddeerr sshhaallll iinncclluuddee,, bbuutt nnoott lliimmiitteedd ttoo tthhee ffoolllloowwiinngg::
►► OOffffiiccee iinnffrraassttrruuccttuurree,, ccoommppuutteerr ffaacciilliittiieess,, aallll pprriinnttiinngg,, rreepprroodduuccttiioonn,,
ccoommmmuunniiccaattiioonn aanndd ccoouurriieerr rreeccoorrddss..
►► PPMMCC ooffffiiccee sshhaallll bbee mmaaiinnttaaiinneedd aatt RRaajjaahhmmuunnddrryy,, aatt vveerryy cclloossee pprrooxxiimmiittyy ttoo
GGAAIILL BBhhaavvaann,, AAVVAA RRooaadd,, RRaajjaahhmmuunnddrryy..
►► PPMMCC’’ss ppeerrssoonnnneell iinncciiddeennttaall eexxppeennsseess..
►► FFeeeess ppaaiidd ttoo aannyy ootthheerr aaggeennccyy,, ccoommppaannyy,, oorrggaanniizzaattiioonn aanndd ssppeecciiaalliisstt eettcc..
►► IInnccoommee ttaaxx oorr aannyy ootthheerr aaggeennccyy,, ccoommppaannyy,, oorrggaanniizzaattiioonn aanndd ssppeecciiaalliisstt..
►► IInnssuurraannccee ttaakkeenn bbyy tthhee PPMMCC ffoorr iittss iinnssppeeccttoorrss // ccoo--oorrddiinnaattoorrss ttoo bbee ddeeppuutteedd
ffoorr tthhee jjoobb..
►► AAllll ccoonnvveeyyaannccee // llooccaall ttrraavveell ffrroomm RRaajjaahhmmuunnddrryy ttoo ssiittee ii..ee.. KKeessaannaappaallllii((WW))
aanndd PPoonnnnaammaannddaa.. IItt iiss aapppprrooxx.. 110000 kkmm aawwaayy ffrroomm RRaajjaahhmmuunnddrryy..
22..00 BBAASSIISS OOFF PPRRIICCEESS AANNDD OOTTHHEERR RRAATTEESS
22..11 TThhee mmoonntthhllyy rraattee sshhaallll bbee iinncclluussiivvee ooff
►► aallll ccoosstt,, rriisskk aanndd eexxppeennssee,, oovveerrhheeaadd,, pprrooffiitt aanndd//oorr ffeeee rreellaatteedd ttoo tthhee
ssaattiissffaaccttoorryy ppeerrffoorrmmaannccee aanndd ccoommpplleettiioonn ooff tthhee wwoorrkk wwiitthh rreeggaarrdd ttoo
ccoonnssuullttaattiioonn..
►► AAllll eexxppeennsseess ttoowwaarrddss bbooaarrddiinngg && llooddggiinngg ffoorr iinnssppeeccttoorrss..
►► AAllll eexxppeennsseess ttoowwaarrddss llooccaall ttrraavveell ttoo aanndd ffrroo ffrroomm ssiittee..
►► CCaammpp ooffffiiccee ffaacciilliittiieess..
22..22 EErrrroorrss aanndd OOmmmmiissssiioonnss:: BBiiddddeerrss sshhaallll eennssuurree tthhaatt tthheerree aarree nnoo eerrrroorrss oorr oommiissssiioonnss iinn
tthhee PPrriiccee BBiidd.. AAllll ccoolluummnnss ooff tthhee pprriiccee bbiidd aarree mmaannddaattoorryy ttoo bbee ffiilllleedd--uupp.. IInn ccaassee
tthheerree iiss nnoo aammoouunntt,, ““00”” ((zzeerroo)) nneeeeddss ttoo bbee mmeennttiioonneedd.. IInn ccaassee aannyy oommiissssiioonnss aarree
nnoottiicceedd iinn tthhee PPrriicceedd BBiidd,, tthhee bbiidd iiss lliiaabbllee ttoo bbee rreejjeecctteedd.. PPrriicceess sshhaallll bbee wwrriitttteenn iinn
bbootthh wwoorrddss aanndd ffiigguurreess.. IInn ccaassee ooff aannyy ddiissccrreeppaannccyy bbeettwweeeenn pprriicceess iinn wwoorrddss aanndd
pprriicceess iinn ffiigguurreess,, tthhee pprriicceess iinn wwoorrddss sshhaallll bbee vvaalliidd aanndd bbiinnddiinngg.. IInn ccaassee ooff aannyy eerrrroorr
iinn ttoottaall iinnddiiccaatteedd bbyy tthhee bbiiddddeerr,, tthhee uunniitt pprriiccee aalloonnee sshhaallll bbee ccoonnssiiddeerreedd vvaalliidd aanndd
bbiinnddiinngg oonn tthhee bbiiddddeerr..
33..00 RRAATTEESS FFOORR PPMMCC PPEERRSSOONNNNEELL
33..11 TThhee PPMMCC iiss rreeqquuiirreedd ttoo qquuoottee tthhee mmoonntthhllyy rraattee iinn tthhee ffoorrmmaatt iinnddiiccaatteedd iinn SScchheedduullee ooff
RRaatteess ((SSOORR)) –– mmoonntthhllyy cchhaarrggeess ttoowwaarrddss ccoonnssuullaattaannccyy ++ bbooaarrddiinngg ++ llooddggiinngg ++ llooccaall
ccoonnvveeyyaannccee aallll ccoosstt iinncclluussiivvee..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 133 of 154
33..22 TThhee PPMMCC ooffffiiccee sshhaallll bbee aatt RRaajjaahhmmuunnddrryy..
33..33 GGAAIILL sshhaallll nnoott pprroovviiddee eeiitthheerr llooccaall ttrraavveell aassssiissttaannccee ffrroomm RRaajjaahhmmuunnddrryy ttoo rreessppeeccttiivvee
ssiittee oorr hhootteell aaccccoommmmooddaattiioonn..
44..00 MMOONNTTHHLLYY RRAATTEESS
44..11 MMoonntthhllyy rraattee == oonnee ccaalleennddaarr mmoonntthh
44..22 TThhee mmoonntthhllyy rraattee iiss ccoonnssiiddeerreedd aallll iinncclluussiivvee ii..ee..
PPMMCC CCoonnssuullttaattiioonn cchhaarrggeess ++ bbooaarrddiinngg && llooddggiinngg cchhaarrggeess ++ ccaammpp
ffaacciilliittiieess ++ ooffffiiccee ffaacciilliittiieess ++ ccoommmmuunniiccaattiioonn ffaacciilliittiieess..
44..33 PPMMCC iiss rreeqquuiirreedd ttoo ddeeppllooyy ppeerrssoonnnneell oonn ccoonnttiinnuuoouuss bbaassiiss..
44..44 AAnnyy aaddddiittiioonnaall ccoossttss wwhhaatt--ssoo--eevveerr ttoowwaarrddss bbaacckk--uupp mmaannaaggeemmeenntt,,
pprrooffeessssiioonnaall,, IITT ffaacciilliittiieess,, eelleeccttrroonniicc ggaaddggeettss,, ttrraannssmmiittttaall,, wwaasshhiinngg
aalllloowwaanncceess,, bbooaarrddiinngg eexxttrraass,, ccoonnvveeyyaannccee eettcc.. sshhaallll nnoott bbee ppaayyaabbllee.. TThhee
PPMMCC oorrggaanniizzaattiioonn sshhaallll mmaaiinnttaaiinn aa llooccaall ooffffiiccee aatt RRaajjaahhmmuunnddrryy,, vveerryy
cclloossee ttoo GGAAIILL BBhhaavvaann,, AAVVAA RRooaadd,, RRaajjaahhmmuunnddrryy -- 553333110033
44..55 NNoo eexxttrraa aammoouunntt iiss ppaayyaabbllee ffoorr eexxttrraa wwoorrkkiinngg hhoouurrss.. IItt iiss aallll iinncclluussiivvee iinn
tthhee mmoonntthhllyy rraattee..
55..00 MMOOBBIILLIIZZAATTIIOONN // DDEEMMOOBBIILLIIZZAATTIIOONN // TTRRAAVVEELL CCHHAARRGGEESS::
NNoott--aapppplliiccaabbllee
66..00 PPEERRFFOORRMMAANNCCEE MMOONNIITTOORRIINNGG::
TThhee ppeerrffoorrmmaannccee ooff TTPPIIAA sshhaallll bbee mmoonniittoorreedd aass ppeerr tthhee GGAAIILL’’ss PPeerrffoorrmmaannccee
EEvvaalluuaattiioonn PPrroocceedduurree.. AAss mmaajjoorriittyy ooff tthhee wwoorrkk iiss bbeeiinngg ccoonndduucctteedd aatt tthhee ccoonnssttrruuccttiioonn
ssiittee,, ppeerriiooddiicc ppeerrffoorrmmaannccee eevvaalluuaattiioonn aanndd tthhee ffiinnaall eevvaalluuaattiioonn wwiillll bbee ddoonnee bbyy
rreessppeeccttiivvee GGAAIILL ccoonnssttrruuccttiioonn ssiittee iinncchhaarrggeess..
77..00 EEVVAALLUUAATTIIOONN OOFF TTHHEE BBIIDDSS::
77..11 FFoorr eevvaalluuaattiioonn ooff tthhiiss bbiidd ddooccuummeenntt ffoorr aawwaarrdd ooff wwoorrkk,, oovveerraallll LL--11 wwiillll bbee
ccoonnssiiddeerreedd
77..22 BBiiddddeerr hhaass ttoo qquuoottee tthhee sseerrvviiccee ttaaxx %% aanndd tthhee aammoouunntt aapppplliiccaabbllee..
88..00 SScchheedduullee ooff rraatteess ffoorrmmaatt aattttaacchheedd..
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 134 of 154
SSCCHHEEDDUULLEE OOFF RRAATTEESS
SS..NN JJOOBB DDEESSCCRRIIPPTTIIOONN UUOOMM QQTTYY UUNNIITT RRAATTEE
((iinn RRss..))
AAMMOOUUNNTT
((iinn RRss..))
[[11]] PPRROOJJEECCTT MMAANNAAGGEEMMEENNTT CCOONNSSUULLTTAANNCCYY
[[PPMMCC]] FFOORR KKSSPP((WW)) ttoo PPoonnnnaammaannddaa PP//LL MMoonntthhss 88
[[22]] SSeerrvviiccee ttaaxx @@
____________________ %%
GGRRAANNDD TTOOTTAALL
NNOOTTEE::
► PPMMCC UUNNIITT RRAATTEE FFOORR EEAACCHH MMOONNTTHH SSHHAALLLL BBEE IINNCCLLUUSSIIVVEE OOFF
CCOONNSSUULLTTAANNCCYY ++ BBOOAARRDDIINNGG ++ LLOODDGGIINNGG ++ LLOOCCAALL CCOONNVVEEYYAANNCCEE ++
IINNCCIIDDEENNTTAALL EEXXPPEENNSSEESS ++ CCAAMMPP FFAACCIILLIITTIIEESS ++ CCOO--OORRDDIINNAATTOORR
PPEERRSSOONNNNEELL ++ OOFFFFIICCEE FFAACCIILLIITTIIEESS EETTCC.. GGAAIILL SSHHAALLLL NNOOTT PPRROOVVIIDDEE
AANNYYTTHHIINNGG .. ► UUNNIITT RRAATTEE SSHHOOUULLDD BBEE IINNCCLLUUSSIIVVEE OOFF AALLLL TTAAXXEESS,, DDUUTTIIEESS EETTCC..
((CCSSTT,, LLSSTT,, WWCCTT EETTCC..)) EEXXCCEEPPTT SSEERRVVIICCEE TTAAXX ► BBIIDDDDEERR TTOO QQUUOOTTEE TTHHEE PPEERRCCEENNTTAAGGEE OOFF SSEERRVVIICCEE TTAAXX
AAPPPPLLIICCAABBLLEE AANNDD TTHHEE AAMMOOUUNNTT..
______________________________________________________________
SSIIGGNNAATTUURREE OOFF TTHHEE BBIIDDDDEERR
________________________________________________________________
NNAAMMEE OOFF TTHHEE PPMMCC AAGGEENNCCYY
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 135 of 154
SECTION-VII
ATTACHMENTS
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 136 of 154
ATTACHMENT - I
CONTRACT PROFORMA
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 137 of 154
CONTRACT AGREEMENT FORM AGREEMENT for “_________” (hereinafter called the "Job") made on ______ day of _________, 2009 between M/s _________, hereinafter called the “CONSULTANT” (which term shall unless excluded by or repugnant to the subject or context include its successors and permitted assignees) of the one part and the GAIL (India) Limited hereinafter called “GAIL” (which term shall unless excluded by or repugnant to the subject or context include its successors and assignees) of the other part. WHEREAS GAIL being desirous of having provided for execution of certain work mentioned, enumerated or referred to in the LOA including Completion Schedule of job has called for proposal. A. The CONSULTANT has examined the Job specified in Bid Document of GAIL and has satisfied himself
by careful examination before submitting his proposal as to the nature of the Job and local conditions, the nature and magnitude of the Job, the availability of manpower and materials necessary for the execution of Job and has made local and independent enquiries and obtained complete information as to the matters and thing referred to, or implied in LOA or having any connection therewith and has considered the nature and extent of all probable and possible situations, delays, hindrances or interference’s to or with the execution and completion of the Job to be carried out under the Agreement, and has examined and considered all other matters, conditions and things and probable and possible contingencies, and generally all matters incidental thereto and auxiliary thereof affecting the completion of the Job and which might have included him in making his proposal.
B. The LOA including Completion Schedule of Job and Letter of Acceptance of proposal form part of this Agreement though separately set out herein and are included in the expression Agreement wherever herein used.
AND WHEREAS GAIL accepted the bid of the CONSULTANT for the provision and the execution of the said Job at the values stated in bid and finally approved by GAIL upon the terms and subject to the conditions of Agreement. NOW THIS AGREEMENT WITNESSETH AND IT IS HEREBY AGREED AND DECLARED AS FOLLOWS: 1. In consideration of the payment to be made to the CONSULTANT for the Job to be executed by him
the CONTRACTOR hereby covenants with GAIL that the CONSULTANT shall and will duly provide, execute and complete the said Job and shall do and perform all other acts and things in the Agreement mentioned or described or which are to be implied there from or may be reasonably necessary for the completion of the said Job and at the said times and in the manner and subject to the terms and conditions or stipulations mentioned in the Agreement.
2. In consideration of the due provision execution and completion of the said Job, GAIL does hereby
agree with the Agreement that GAIL will pay to the CONSULTANT the respective amounts for the Job actually done by him and approved by GAIL at the amount specified in this LOA, such payment to be made at such time in such manner as provided for in the Agreement and LOA.
In witness whereof the parties have executed these presents in the day and the year first above written. Signed and Delivered for and on behalf of Signed and Delivered for and on behalf of M/s GAIL (India) Limited M/s _________________ Date: ________________ Date: _________________ Place: ________________ Place: _________________ IN PRESENCE OF TWO WITNESSES 1.__________________________ 1. _____________________ 2.__________________________ 2. _____________________
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 138 of 154
ATTACHMENT II
PERFORMANCE EVALUATION
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 139 of 154
PURPOSE OF ATTACHMENT –II
PERFORMANCE EVALUATION 1.1 GAIL follows a system of Performance Evaluation of vendors and contractors to
monitor and ensure the timely and smooth completion of supplies, execution of contracts, and maintenance of quality standards. The basic objective is to recognize and develop reliable vendors and contractors who consistently meet or exceed expectations and requirements of GAIL with respect to timely receipt of supplies, completion of work and services and the quality specifications, standards. Vendors and contractors whose performance is not found satisfactory will be debarred from future business with GAIL.
1.2 All the suppliers and contractors working with GAIL will be evaluated based on the
parameters defined in the performance Rating Data Sheet as per enclosed Annexure –I of attachment –II.
1.3 The evaluated rating may be falling in any of the following category depending upon
the scoring of points in various parameters. Very good Good Fair Poor 1.4 In case, a vendor/contractor is not able to achieve a minimum scoring of 60% points
in the given parameters individually and collectively for all parameters i.e. with poor rating shall be put on “HOLIDAY” for a period of 1 to 3 years depending upon the nature of failure on their part in performance and such venders and contractors will not be allowed to participate in business with GAIL for the Holiday period.
1.5 The vendors and contractors will be blacklisted for submitting forged documents in
respect of experience, turnover and any other requirements forming the basis for pre qualifying / eligibility criteria irrespective of their rating in the past. Such vendors & Contractors will be debarred from having business with GAIL in future.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 140 of 154
GAIL (India) Limited Annexure - 1
PERFORMANCE RATING DATA SHEET (FOR PROJECTS/CONSULTANCY JOBS)
(i) Project/Work Centre
:
(ii) Order/Contract No. & Date
:
(iii) Brief description of Items Works/Assignment
:
(iv) Order/Contract value (Rs.)
:
(v) Name of Vendor/Contractor/Consultant
:
(vi) Contracted delivery/Completion Schedule
:
(vii) Actual delivery/Completion date
:
Performance Parameter
Delivery/Completion Performance
Quality Performance
Reliability Performance
Total
Maximum Marks 40 40 20 100 Marks Allocated (*)
Remarks (if any) PERFORMANCE RATING (**): Note: (*) Allocation of marks would be as per enclosed instructions (**) performance rating shall be classified as under :
Sl. No. Range (Marks) Rating 1. 60 & below POOR 2. 61-75 FAIR 3. 76-90 GOOD 4. MORE THAN 90 VERY GOOD
Signature of Authorised signatory with name & designation
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 141 of 154
INSTRUCTIONS FOR ALLOCATION OF MARKS
Marks are to be allocated as under: 1.1 DELIVERY/COMPLETION PERFORMANCE : 40 MARKS Delivery Period/completion Schedule Delay in weeks Marks a) Up to 3 months Before CDD 40 Delay upto 4 weeks 35 Delay upto 8 weeks 30 Delay upto 10 weeks 25 Delay upto 12 weeks 20 Delay upto 16 weeks 15 More than 16 weeks 0 b) Above 3 months Before CDD 40 Delay upto 4 weeks 35 Delay upto 8 weeks 30 Delay upto 10 weeks 25 Delay upto 16 weeks 20 Delay upto 20 weeks 15 Delay upto 24 weeks 10 More than 24 weeks 0 1.2 QUALITY PERFORMANCE: 40 MARKS
For Normal Cases: No Defects/No Deviation/No failure: 40 marks i) Rejection/Defects Marks to be allocated on
pro-rata basis for acceptable quantity as compared to total quantity for normal cases
10 Marks
ii) When quality failure endangers the system integration and safety of the system.
Failure of severe nature - Moderate nature - low severe nature
0 marks 5 marks 10-25 marks
iii) Number of deviations 1. No. deviation 2. No. of deviations
<=2 3. No. of deviations
>2
5 Marks 2 marks 0 marks
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 142 of 154
1.3 RELIABILITY PERFORMANCE: 20 MARKS
A. FOR WORKS / CONTRACTS
i) Submission of order acceptance, agreement, PBG, Drawings and other documents within time
4 marks
ii) Mobilization of resources as per Contact and in time 4 marks iii) Liquidation of Check-list points 4 marks iv) Compliance to statutory and HS & E requirements
Or Reliability of Estimates/Design/Drawing etc. in case of Consultancy jobs
4 marks
v) Timely submission of estimates and other documents for Extra, Substituted & AHR items
4 marks
B. FOR SUPPLIES
i) Submission of order acceptance, PBG , Drawing and other documents within time
5 marks
ii) Attending complaints and requests for after Sales service/warranty repairs and/or query/advice (upto the evaluation period)
5 marks
iii) Response to various correspondence and conformance to standards like ISO
5 marks
iv) Submission of all required documents including Test Certificates at the time of supply
5 marks
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 143 of 154
ATTACHMENT III
AGREED TERMS & CONDITIONS
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 144 of 154
ATTACHMENT III BRIEF SUMMARY OF AGREED TERMS AND CONDITIONS
Bidder’s Name M/s............................. Bid Document No. : GAIL/RJY/C&P/SR20036987/RAO Offer Ref................................ This Questionnaire duly filled in should be returned along with each copy of Un-priced Bid failing which Offer/Bid will not be considered for evaluation. Clauses confirmed hereunder should not be repeated in the Bid. S. No. Description Bidder's Confirmation
1 It is noted that deviations to Terms & Conditions shall lead to rejection of offer, as specified in the Bid Document.
2 Ensure and confirm that prices quoted in ‘Price Schedules / Schedule of Rates’ are for complete scope of work as defined in the Bid document.
2.1 Confirm Price Schedule / Schedule of Rates – 1 to 3 are submitted duly filled in & signed in Priced Bid.
2.2 Confirm Un-priced (i.e. with prices blanked out) submitted in un-priced bid.
3 Confirm that the offer shall remain valid for acceptance up to 4 months from Final Bid Due Date/Date of Opening of Bids
4 Confirm that quoted prices shall remain firm, Fixed and valid until completion of the contract Performance.
5 Please confirm the quoted prices are in Indian Rupees / US $ / Home Currency of the bidder.
5.1 Currency of Quote is:
6 Confirm acceptance of Completion period as per requirement Specified in Bid Document (to be reckoned from date of Fax of Acceptance)
7 Confirm complete technical literatures/ catalogues and Users reference list submitted along with offer.
8 Confirm acceptance of Price Reduction Schedule (PRS) for delay in completion beyond contractually agreed completion schedule as specified in the Bid Document.
9 Confirm that in case of delay in completion beyond contractual completion date the invoice shall be submitted for the amount duly reduced to the extent of PRS.
10 Confirm in case of delay in completion beyond contractual completion date, any new or additional taxes and duties imposed shall be to Consultant’s account.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 145 of 154
11 Confirm acceptance of relevant Terms of Payment as specified in the Bid Document.
12 Confirm that Contract Performance Bank Guarantee (CPBG) for 5% of order/contract value shall be furnished within 15 days of Fax of Intent, valid for period as per Bid Document.
13 Confirm acceptance in Toto of the Terms & Conditions contained in-
a) i) Instructions to Bidders ii) General Conditions of Contract & Special
Conditions of Contract iii) Scope of work & Schedule of Rates iv) All other commercial documents/ attachments of
Bid Document.
b) All the terms & conditions have been indicated in this format (including annexure, if any) and have not been repeated in the bid elsewhere. It is noted that Terms & Conditions indicated elsewhere including any printed Terms & Conditions, shall not be considered by Owner.
14 The bidder is required to state whether any of the Directors of bidder is a relative of any Director of Owner or the Bidder is a firm in which any Director of Owner or his relative is a partner or the Bidder is a private company in which any Director of Owner is a member or Director.
15 All correspondence must be in English Language only.
16 Indicate Name & Contact No. (Telephone/Fax No.) of person(s) to whom queries, if any, are to be addressed against your bid.
17 Owner reserves the right to make any change in the terms & conditions of the Bid Document and to reject any or all bids including those received late or incomplete.
18 Confirm that all Bank charges associated with Bidder’s Bank shall be borne by Bidder.
Signature ________________________ Name ________________________ Designation ________________________ Office Stamp ________________________ Tel No. ________________________ Fax No. ________________________ e-mail ________________________
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 146 of 154
ATTACHMENT- IV
INTEGRITY PACT
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 147 of 154
INTEGRITY PACT Bidder is required to sign the Integrity Pact with GAIL as per format & terms conditions enclosed with tender. In case a bidder does not sign the integrity Pact, his bid shall be liable for rejection.
COMMITMENTS AND OBLIGATIONS OF THE “COUNTERPARTY” a) The Counterparty, directly or indirectly (through agent, consultant, advisor, etc.), shall
not pay any bribe / influence or give undue / unlawful benefit to anyone to gain undue advantage in dealing with GAIL.
b) The Counterparty will not engage in collusion of any kind including price fixation etc. with other Counterparts.
c) The counterparty will not pass GAIL’s confidential information to any third party unless specifically authorized by GAIL in writing.
d) The Counterparties shall promote and observe best ethical practices within their respective organizations.
e) The Counterparty shall inform the Independent External Monitor. f) If it received any demand, directly or indirectly, for a bribe/ favour or any illegal
gratification / payment / benefit; g) If it comes to know of any unethical or illegal payment/benefit; h) If it makes any payment to any GAIL associate. i) The Counterparty shall not make any false or misleading allegations against GAIL or
its associates.
VIOLATIONS & CONSEQUENCES: a) If a Counterparty commits a violation of its Commitments and Obligations under the
Integrity Pact Programme during bidding process, their entire Earnest Money Deposit / Bid Security, would be forfeited and in addition, they may be blacklisted from the GAIL business in future.
b) In case of violation of the Integrity pact by Counterparty after award of the Contract, GAIL shall be entitled to terminate the Contract. GAIL would forfeit the security deposits, encash the bank guarantee(s) and other payments payable to Counterparty in such cases.
c) Subject to satisfaction of the Independent External Monitor, GAIL may ban / blacklist / put on holiday and exclude the Counterparty from future dealings until GAIL is satisfied that the Counterparty shall not commit any such violation in future.
d) In addition to above, GAIL reserves its right to initiate criminal proceedings against the violating Counterparty, if the allegations by Counterparty are found frivolous, untrue and misleading and may also impose exemplary cost for the same.
e) The Counterparty will be entitled to claim as determined by the Independent External Monitor, if the above (d) is found incorrect.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 148 of 154
INDEPENDENT EXTERNAL MONITORS (IEMS)
The following three Independent External Monitors (IEMs) have been appointed by GAIL, in terms of Integrity Pact (IP) which forms part of GAIL Tenders/ Contract.
(i) Dr A K Kundra sctripathi@yahoo.com (ii) Shri S C Tripathi kundraak@gmail.com (iii) Shri Mukesh Rohtagi mukeshrohatgi2008@gmail.com
This panel is authorized to examine / consider all references made to it under this tender. The bidder (s), in case of any dispute (s) / complaint (s) pertaining to this tender may raise the issue either with designated Tender Issuing Officer in GAIL or directly, with the IEMs on the panel c/o Chief Vigilance Officer, GAIL (India) Limited, GAIL Bhawan, 16, Bhikaiji Cama Place, R.K. Puram, New Delhi – 110066.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 149 of 154
INTEGRITY PACT
(To be executed on plain paper and applicable to all tenders of the value of Rs. one crore and above)
Between GAIL (India) Limited, a Government of India Public Sector, (here-in-after referred to as "Principal ").
AND
……………………….............. …… (Here-in-after referred to as "The Bidder/Contractor"). (Principal and the Bidder/Contractor are here-in-after are referred to individually as "Party" or collectively as "Parties").
PREAMBLE
The Principal intends to award under laid down organizational procedures, contract/s for ………………………………………………….. The Principal values full compliance with all relevant laws and regulations, and the principles of economic use of resources, and of fairness and transparency in its relations with its Bidder/s and Contractor/s. In order to achieve these goals, the Principal co-operates with the renowned International Non-Governmental Organization 'Transparency International' (TI). Following TI's national and international experience, the Principal will appoint an Independent External Monitor who will monitor the tender process, the execution of the contract etc. for compliance with the principles mentioned above.
Section 1 - Commitments of the Principal 1. The Principal commits itself to take all measures necessary to prevent corruption and
to observe the following Principles in this regard:-
i) No employee of the Principal, either in person or through family members, including relatives, will in connection with the tender for or the execution of a contract, demand or accept a promise for or accept for him/herself or for a third person, any material or immaterial benefit to which he/she is not legally entitled.
ii) The Principal shall, during the tender process treat all Bidders with equity. The
Principal undertakes and ensures that before and during the tender process shall provide and share 'the same information to all Bidders and will not provide to any Bidder confidential/additional information through which one particular Bidder could take an advantage in relation to the tender process or the contract execution.
iii) The Principal will exclude from the process all known prejudiced persons.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 150 of 154
2. If the Principal obtains information on the conduct of any of its employees which is a
criminal offence under the Anti-Corruption Laws of India, or if there be a substantive suspicion in this regard, the Principal will inform its Vigilance Office and in addition can initiate disciplinary actions.
Section 2 - Commitments and Undertakings by the Bidder/Contractor 1. The Bidder / Contractor commit and undertakes to take all measures necessary to
prevent malpractices & corruption. He commits himself to observe the following principles during his participation in the tender process and during the contract execution:
i) The Bidder / Contractor undertakes not to, directly or through any other
person or firm offer, promise or give or influence to any employee of the Principal associated with the tender process or the execution of the contract or to any other person on their behalf any material or immaterial benefit to which he / she is not legally entitled in order to obtain in exchange any advantage of any kind whatsoever during the tender process or during the execution of the contract.
ii) The Bidder / Contractor undertakes not to enter into any undisclosed
agreement or understanding, whether formal or informal with other Bidders. This applies in particular to prices, specifications, certifications, subsidiary contracts, submission or non-submission of bids or any other action to restrict competitiveness or to introduce cartelisation in the bidding process.
iii) The Bidder / Contractor undertakes not to commit any offence under the
relevant Anti-corruption Laws of India. Further, the Bidder / Contractor will not use improperly any information or document provided by the Principal as part of the business relationship regarding plans, technical proposals and business details, including information contained or transmitted electronically for the purposes of competition or personal gain and will not pass the information so acquired on to others.
iv) The Bidder / Contractor will, when presenting his bid undertakes to disclose
any and all payments made, is committed to or intends to make to agents, brokers or any other intermediaries in connection with the award of the contract.
2. The Bidder / Contractor will not instigate and allure third persons / parties to commit
offences outlined above or be an accessory to such offences.
Section 3 - Disqualification from tender process and exclusion from future contracts
If the Bidder, before the award of contract, has committed a transgression through a violation of any provisions of Section 2 or in any other form so as to put his reliability or credibility as Bidder into question, the Principal shall be entitled to disqualify, put on holiday or blacklist the Bidder including from the future tender process or to terminate the contract, if already signed, on that ground.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 151 of 154
1. If the Bidder/Contractor has committed a transgression through a violation of any
provisions of Section 2 so as to put his reliability or credibility into question, the Principal shall be entitled to exclude including blacklist and put on holiday the Bidder/Contractor from entering into any GAIL future contract tender processes. The imposition and duration of the exclusion will be determined by the severity of the transgression. The severity will be determined by the Principal taking into consideration the full facts and circumstances of each case particularly taking into account the number of transgressions, the position of the transgressors within the company hierarchy of the Bidder and the amount of the damage. The exclusion may be imposed for a minimum period of 6 months and maximum of three years.
2. A transgression is considered to have occurred if the Principal after due consideration
of the available evidence, concludes that no reasonable doubt is possible. 3. The Bidder with its free consent and without any influence agrees and undertakes to
respect and uphold the Principal's absolute rights to resort to and impose such exclusion and further accepts and undertakes not to challenge or question such exclusion on any ground, including the lack of any hearing before the decision to resort to such exclusion is taken. This undertaking is given freely and after obtaining independent legal advice.
4. Subject to the full satisfaction of the Principal, the exclusion of the Bidder /
Contractor could be revoked - by Principal prematurely if the bidder / contractor can prove that he has restored / recouped the damage caused by him and has installed a suitable corruption prevention system in his organization.
Section 4 - Forfeiture of EMD / Security Deposits
1. If the Principal has disqualified the Bidder from the tender process prior to the award
in terms of Section 3, and during the execution of the contract, the Principal shall forfeit earnest money deposit / bid security money, encash the bank guarantee including due payments in addition to blacklisting or putting on holiday the bidder and terminating the contract.
2. If the Principal has terminated the contract according to Section 3, or if the Principal
is entitled to terminate the contract according to Section 3, the Principal shall be entitled to demand and recover from the Contractor liquidated damages equivalent to Earnest Money Deposit / Security Deposit / Performance Bank Guarantee.
3. The bidder agrees and undertakes to pay the said amounts without protest or demur
subject only to condition that if the Bidder / Contractor can prove and establish that the exclusion of the Bidder from the tender process or the termination of the contract after the contract award has caused no damage or less damage than the amount of the liquidated damages, the Bidder / Contractor shall compensate the Principal only to the extent of the damage in the amount proved.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 152 of 154
Section 5 - Previous transgression
1. The Bidder swears on oath that no previous transgression has occurred during the last
three years with any other Company in any country conforming to the TI approach or including with any other Public Sector Enterprise / Undertaking in India that could justify his exclusion from the tender process.
2. If the Bidder makes incorrect statement on this subject, he shall be disqualified from
the tender process or the contract, if already awarded, could be liable to be terminated on this ground.
Section 6 - Equal treatment to all Bidders / Contractors / Subcontractors
1. The Bidder / Contractor undertakes to demand from all its sub-contractors, if any, an
undertaking and commitment in conformity with this Integrity Pact, and to submit it to the Principal before signing of the contract.
2. The Principal will enter into agreements with similar conditions, as stipulated herein,
with all Bidders, Contractors and Subcontractors. 3. The Principal shall disqualify from the tender process all Bidders who do not sign this
Pact or violate any of its provisions. Section 7 - Criminal charges against violating Bidders / Contractors / Sub-contractors
If the Principal obtains knowledge of conduct of a Bidder, Contractor or
Subcontractor, or of an employee or a representative or an associate of a Bidder, Contractor or Subcontractor which constitutes corruption, or if the Principal has substantive suspicion in this regard, the Principal will inform the Vigilance Office / Department for initiating appropriate action for above.
Section 8 -Independent External Monitor / Monitors
(Three in number depending on the size of the contract)
(To be decided by the Chairperson of the Principal)
1. The Principal appoints competent and credible external independent Monitor for this Pact. The task of the Monitor is to review independently and objectively, whether and to what extent the parties comply with the obligations under this agreement.
2. The Monitor is not subject to any instructions by the representatives of the parties and
performs his functions neutrally and independently. He reports to the Chairperson of the Board of the Principal.
3. The Contractor accepts that the Monitor has the right to access without restriction to
all Project documentation of the Principal including that provided by the Contractor. The Contractor will also grant the Monitor, upon his request and demonstration of a valid interest, unrestricted and unconditional access to his project documentation. The
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 153 of 154
same is applicable to Sub-contractors. The Monitor is under contractual obligation to treat the information and documents of the Bidder / Contractor / Sub-contractor with confidentiality.
4. The Principal will provide to the Monitor sufficient information about all meetings
among the parties related to the Project provided such meetings could have an impact on the contractual relations between the Principal and the Contractor. The parties offer to the Monitor the option to participate in such meetings.
5. As soon as the Monitor notices, or believes to notice, a violation of this agreement he
will so inform the Management of the Principal and request the Management to discontinue or heal the violation or to take other relevant action. The monitor can in this regard submit non-binding recommendations. Beyond this, the Monitor has no right to demand from the parties that they act in a specific manner, refrain from action or tolerate action. However, the Independent External Monitor shall give an opportunity to the bidder/contractor to present its case before making its recommendations to the Principal.
6. The Monitor will submit a written report to the Chairperson of the Board of the
Principal within 8 to 10 weeks from the date of reference or intimation to him by the 'Principal' and should the occasion arise, submit proposals for taking corrective measures.
7. Monitor shall be entitled to compensation by the Principal on the same terms &
conditions as being extended to/provided to Outside Expert Committee Members of ONGC.
8. If the Monitor has reported to the Chairperson of the Board a substantiated suspicion
of an offence under relevant Anti-Corruption laws of India, and the Chairperson has not, within reasonable time, taken visible action to proceed against such offence or reported it to the Vigilance Office, the Monitor may also transmit this information directly to the Central Vigilance Commissioner, Government of India.
9. The word 'Monitor' would include both singular and plural. 10. Independent External Monitor shall be required to maintain confidentiality of the
information acquired and gathered during their tenure / role as Independent Monitor. Any breach in this regard would be subject to the legal judicial system of India.
11. The Independent External Monitors - shall be responsible to oversee the
implementation of Integrity Pact Program to prevent corruption, bribes or any other unethical practices in the GAIL. However, Monitor(s) shall be personally and severally be liable for any action or suit brought by Bidder / Contractor / against the Monitor, in case the findings of Independent Monitor is / are found incorrect or biased or prejudiced.
12. Independent External Monitor(s) shall be required to furnish an Undertaking and shall
disclose before taking any assignment that he / she has no interest in the matter or connected with the party (bidder / contractor) in any manner.
GAIL (INDIA) LIMITED
Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 154 of 154
Section 9 - Pact Duration
The provisions of this Pact shall come into effect from the date of signing of this Pact by the both parties. It expires for the Contractor 12 months after the last payment under the respective contract, and for all other Bidders 6 months after the contract has been awarded.
If any claim is made / lodged by either party during this time, the same shall be binding and continue to be valid despite the lapse of this pact as specified above, unless it is discharged/determined by the Chairperson of the Principal.
Section 10 - Miscellaneous Provisions
1. This agreement is subject to Indian Law. Place of performance and jurisdiction is the
Registered Office of the Principal, i.e. New Delhi. The Arbitration clause provided in main tender document / contract shall not be applicable for any issue / dispute arising under Integrity Pact.
2. Changes and supplements as well as termination notices, if any, need to be made in
writing. Side Agreements have not been made. 3. If the Contractor / Bidder is a partnership concern or a consortium, this agreement
must be signed by all partners or consortium members. 4. In case any or several of the provisions of this agreement turn out to be void, the
remainder of this pact shall remain valid. The parties to this pact however, shall strive to come to an agreement to their original intentions in such a case.
______________________ _________________________ (Name & Designation) (Name & Designation) For the Principal For the Bidder/Contractor Place:__________________ Witness-1 : ________________________ Date:___________________ Witness-2 : ________________________