The Molecular Biology of the Gene Identifying the Genetic Material Mendel’s experiments—inherit...

transcript

The Molecular Biology of the Gene

Identifying the Genetic Material

• Mendel’s experiments—inherit chromosomes that contain genes

• The Question now:– What are genes made of?

• Scientists searching for the answer:– Griffith and Avery– Hershey and Chase

Griffith-Avery Experiment:Transformation of Bacteria

Controls

THE STRUCTURE OF THE GENETIC MATERIAL

•Experiments showed that DNA is the genetic material– The Hershey-Chase experiment showed that certain

viruses reprogram host cells• To produce more viruses by injecting their DNA

Tail fiber

Bacteriophage-virus that infects only bacteria

Hershey-Chase Experiment:DNA, the Hereditary Material in Viruses

Bacterium

Radioactiveprotein

Phage DNA

Empty protein shell Radioactivity

in liquid

PelletCentrifuge

Batch 1Radioactiveprotein

Batch 2RadioactiveDNA

RadioactiveDNA

Centrifuge

Pellet

Radioactivityin pellet

Figure 10.1B

BacteriumBacterium

Radioactiveprotein

Phage DNA

Empty protein shell Radioactivity

in liquid

PelletCentrifuge

Batch 1Radioactiveprotein

Batch 2RadioactiveDNA

RadioactiveDNA

Centrifuge

Pellet

Radioactivityin pellet

Figure 10.1B

Mix radioactively labeled phages with bacteria. The phages infect the bacterial cells.

1 Mix radioactively labeled phages with bacteria. The phages infect the bacterial cells.

1 Agitate in a blender to separate phages outside the bacteria from the cells and their contents.

2 Agitate in a blender to separate phages outside the bacteria from the cells and their contents.

2 Centrifuge the mixture so bacteria form a pelletat the bottom of the testtube.

3 Centrifuge the mixture so bacteria form a pelletat the bottom of the testtube.

3 Measure the radioactivity in the pellet and the liquid.

4 Measure the radioactivity in the pellet and the liquid.

DNA and RNA are polymers of nucleotides

•DNA is a nucleic acid– Made of long chains of nucleotide monomers

Nucleotides of DNA

• Nucleotides are the monomeric units that make up DNA3 main parts:

5 carbon sugar—deoxyribose Phosphate groupNitrogenous base

Nitrogenous bases of DNA

• Pyrimidines: single-ring structuresThymine (T)Cytosine (C)

• Purines: larger, double-ring structuresAdenine (A)Guanine (G)

http://www.phschool.com/science/biology_place/biocoach/images/transcription/chembase.gif

• RNA is also a nucleic acid– But has a slightly

different sugar

– And has the pyrimidine, Uracil (U), instead of T

http://www.phschool.com/science/biology_place/biocoach/images/transcription/chembase.gif

Discovery of the Double Helix

• 1953—James Watson and Francis Crick determined the structure of the DNA molecule to be a double helix – 2 strands of nucleotides

twisted around each other

Discovery of the Double Helix

• Rosalind Franklin contributed to this discovery by producing an X-ray crystallographic picture of DNA– Determined helix was a uniform diameter and composed

of 2 strands of stacked nucleotides

– The structure of DNA• Consists of two polynucleotide strands wrapped

around each other in a double helix

Figure 10.3C Twist

Double Helix Structure

•Hydrogen bonds between bases– Hold the strands

together•Each base pairs with a complementary partner– A base pairs with T – G base pairs with C

Structure of DNA relates to its Function

Structure of DNA is related to 2 primary functions:1. Copy itself exactly for new cells that are created

2. Store and use information to direct cell activities

DNA Complementary Strands

• Strands run in opposite directions – Anti-parallel

• If one strand is known, the other strand can be determined

Complementary Strands of DNA

ACGGTATCC

= T= A

= T 5’

5’ G

DNA Replication

•DNA replication depends on specific base pairing– DNA replication

• Starts with the separation of DNA strands– Then enzymes use each strand as a template

• To assemble new nucleotides into complementary strands

Parental moleculeof DNA

Both parental strands serve as templates

Two identical daughtermolecules of DNA

Parental moleculeof DNA

Both parental strands serve as templates

Two identical daughtermolecules of DNA

Nucleotides

DNA Replication

• Replication occurs simultaneously at many sites (replication bubbles) on a double helixAllows DNA

replication to occur in a shorter period of time

DNA Replication Process

1. Helicase unwinds the double helix to expose DNA nucleotides

http://www.nature.com/nature/journal/v439/n7076/images/439542a-f1.2.jpg

2. Primase lays down an RNA primer to provide a 3’ OH group

http://www.nature.com/nature/journal/v439/n7076/images/439542a-f1.2.jpg

3. DNA polymerase attaches complementary DNA nucleotides to the 3’ end of a growing daughter strand

• Can only add bases to the exposed 3’-OH group

• Therefore, DNA Replication always occurs in the 5’→ 3’ direction

4. DNA polymerase then removes the RNA primer and replaces it with complementary DNA nucleotides

5. DNA Ligase creates a covalent bond between the DNA fragments

http://porpax.bio.miami.edu/~cmallery/150/chemistry/sf3x14a.jpg

DNA Replication “Problem”• DNA Polymerase can only replicate in the 5’→ 3’

direction• One of the template strands would require replication

in the 3’→ 5’ direction (WON’T WORK)• So, one daughter strand is made continuously while

the other strand is made in short pieces called Okazaki fragments

Overall Direction of Replication-toward the replication fork

DNA Replication

• Assures that daughter cells will carry the same genetic information as each other and as the parent cell.Each daughter DNA has one

old strand of DNA and one new strand of DNASemiconservative

Replication

Checking for Errors• 1/1,000,000,000 chance of an error in DNA

replication– Can lead to mutations

• DNA polymerases have a “proofreading” role– Can only add nucleotide to a growing strand if the

previous nucleotide is correctly paired to its complementary base

• If mistake happens, DNA polymerase backtracks, removes the incorrect nucleotide, and replaces it with the correct base

Flow of Genetic Information• Flow of genetic information from DNA to

RNA to protein

• The DNA genetic code (genotype) is expressed as proteins which provide the physical traits (phenotype) of an organism

GCTGCTAACGTCAGCTAGCTCGTAGC GCTAGCGCTTGCGTAGCTAAAGTCGAGCTCGCTTGCGTAGCTAAAGTCGAGCTGCTGCTAACGTCAGCTAGCTCGTAG AGCGCTTGCGTAGCTAAAGTCGAGCT AGCGCTTGCGTAGCTAAAGTCGAGCT GCTGCTAACGTCAGCTAGCTCGTAGC AGCGCTTGCGTAGCTAAAGTCGAGCT AGCGCTTGCGTAGCTAAAGTCGAGCT GCTGCTAACGTCAGCTAGCTCGTAGC AGCGCTTGCGTAGCTAAAGTCGAGCT AGCGCTTGCGTAGCTAAAGTCGAGCT GCTGCTAACGTCAGCTAGCTCGTAGC AGCGCTTGCGTAGCTAAAGTCGAGCT GCTGCTAACGTCAGCTAGCTCGTAGC AGCGCTTGCGTAGCTAAAGTCGAGC, cont.

RNA Proteins

Protein Synthesis

• TranscriptionProcess in which a

molecule of DNA is copied into a complementary strand of RNA

• TranslationProcess in which the

message in RNA is made into a protein

Forms of RNA

3 Main Types of RNA1) mRNA (messenger RNA) – RNA that decodes

DNA in nucleusbrings DNA message out of nucleus to the cytoplasm

Each 3 bases on mRNA is a “codon”

2) tRNA (transfer RNA) – RNA that has the “anticodon” for mRNA’s codon The anticodon matches with the codon from mRNA to determine which amino acid joins the protein chain

3) rRNA (ribosomal RNA) – make up the ribosomes—RNA that lines up tRNA molecules with mRNA molecules

Transcription produces genetic messages in the form of RNA

Figure 10.9A

RNApolymerase

RNA nucleotide

Direction oftranscription

Newly made RNA

Templatestrand of DNA

Transcription1. Initiation:

• RNA polymerase (enzyme) attaches to DNA at the promoter and “unzips” the two strands of DNA

2. Elongation:• RNA polymerase then

“reads” the bases of DNA and builds a single strand of complementary RNA called messenger RNA (mRNA)

3. Termination:• When the enzyme reaches the

terminator sequence, the RNA polymerase detaches from the RNA molecule and the gene

Transcription

The code on DNA tells how mRNA is put together.

Example: DNAACCGTAACG

mRNAUGGCAUUGC

• Each set of 3 bases is called a triplet or codon (in mRNA)

UGG CAU UGC

• Noncoding segments called introns are spliced out

• Coding segments called exons are bonded together

• A 5’cap and a 3’ poly-A tail are added to the ends

Eukaryotic RNA is processed before leaving the nucleus

Figure 10.10

RNAtranscriptwith capand tail

Exon Intron IntronExon Exon

TranscriptionAddition of cap and tail

Introns removed

Exons spliced together

Coding sequence

NUCLEUS

CYTOPLASM

Protein Synthesis

• Transcription

• TranslationProcess in which RNA is used to make a

protein

• In the cytoplasm, a ribosome attaches to the mRNA and translates its message into a polypeptide

• The process is aided by tRNAs

Transfer RNA molecules serve as interpreters during translation

Figure 10.11A

Hydrogen bond

Amino acid attachment site

RNA polynucleotide chain

Anticodon

Ribosomes build polypeptides

• The mRNA moves a codon at a time relative to the ribosome– A tRNA pairs with each codon, adding an amino

acid to the growing polypeptide

Elongation adds amino acids to the polypeptide chain until a stop codon terminates translation

Translation1. Initiation:

– mRNA molecule binds to the small ribosomal subunit

– Initiator tRNA binds to the start codon (AUG—Methionine) in the P-site of the ribosome

– The large ribosomal subunit binds to the small one so that the initiator tRNA is in the P-site to create a functional ribosome

Translation2. Elongation:– Codon recognition: anticodon

of incoming tRNA molecule, carrying its amino acid, pairs with the mRNA codon in the A-site of the ribosome

– Peptide formation: polypeptide separates from the tRNA in the P site and attaches by a peptide bond to the amino acid carried by the tRNA in the A site

– Translocation: the tRNA in the P-site now leaves the ribosome, and the ribosome moves along the mRNA so that the tRNA in the A-site, carrying the growing polypeptide, is now in the P-site. Another tRNA is brought into the A-site

Translation

3. Termination:– Elongation continues until a

stop codon is reached—UAA, UAG, or UGA

– The completed polypeptide is released, the ribosome splits into its subunits

• An exercise in translating the genetic code

Polypeptide

Startcodon

Stopcodon

Mutations

• Mutagenesis—creation of mutations

• Can result from Spontaneous Mutations• Errors in DNA replication or recombination

• Mutagens—physical or chemical agents– High-energy radiation (X-rays, UV light)

Types of Mutations

• Mutations within a gene– Can be divided into two general categories.

• Base substitution• Base deletion (or insertion)

– Can result in changes in the amino acids in proteins.

Normal hemoglobin DNA

Normal hemoglobin

Mutant hemoglobin DNA

Sickle-cell hemoglobin

Normal hemoglobin DNA

Normal hemoglobin

Mutant hemoglobin DNA

Sickle-cell hemoglobin

Sickle-CellDisease

Substitution Mutations• Missense mutation: altered

codon still codes for an amino acid, although maybe not the right one

• Nonsense mutation: altered codon is a stop codon and translation is terminated prematurely– Leads to nonfunctional

proteins

Insertions and Deletions

• Frameshift mutation: addition or loss of one or more nucleotide pairs in a gene shifts the reading frame for translation and incorrect protein is made

• Although mutations are often harmful,– They are the source of the rich diversity of

genes in the living world.– They contribute to the process of evolution by

natural selection.

Are all Mutations Bad?

The Molecular Biology of the Gene Identifying the Genetic Material Mendel’s experiments—inherit...

Documents