TOPO Cloning Lecture

Post on 21-Jul-2015

623 views 0 download

transcript

A Brief Diversion Concerning Negative Regulation

from Lehninger Principles of Biochemistry, 4th ed.

Before we discuss TOPO cloning, we need somebackground on the following:

Signalmoleculein lac operon isallolactose

What happens when a bacterium encounters milk sugar

IPTG is a structural analog ofallolactose and will induce tn.

from Lehninger Principles of Biochemistry, 4th ed.

The Frenchscientistswho elucidatedthe regulationof the lac operon

from Lehninger Principles of Biochemistry, 4th ed.

The lac operon

from Lehninger Principles of Biochemistry, 4th ed.

from Lehninger Principles of Biochemistry, 4th ed.

Note the conformationalchange in thebound (solid)vs. free (trans-parent).

TOPO Cloning from Invitrogen

Other TOPO Vectors

About Stewart Shuman

Stewart Shuman is Professor of Molecular Biology at the Memorial Sloan-Kettering Cancer Center, New York, United States. He obtained his M.D. and Ph.D. at the Albert Einstein College of Medicine, New York, and completed a residency in Internal Medicine at the Massachusetts General Hospital, USA. He was a medical staff fellow in virology at the National Institutes of Health before joining the Sloan-Kettering faculty in 1998. Shuman's laboratory is studying the mechanisms and structures of enzymes that catalyze essential RNA and DNA transactions. The laboratory is especially interested in the divergence of enzyme mechanisms between host and pathogen, and its implications for identifying new targets for the treatment of infectious diseases.

http://www.nature.com/nrm/journal/v3/n8/authors/nrm880.html

CAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTC ATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCAC CTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGATCTCGATCCCGCGAAATTA ATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAATTCAGGAGCCCTTCACCAAGGGCGAGCTCAATTCGAAGCTTGAAGGTAAGCCTATCCCTAAC CCTCTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGAGTTTGATCCGGCTGCT…

The pET101D vector sequence

The area of interest