Post on 31-Mar-2019
transcript
University of Groningen
Antimicrobials of Bacillus species: mining and engineeringZhao, Xin
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.
Document VersionPublisher's PDF, also known as Version of record
Publication date:2016
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):Zhao, X. (2016). Antimicrobials of Bacillus species: mining and engineering. [Groningen]: University ofGroningen.
CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.
Download date: 31-03-2019
Antimicrobials of Bacillus species: mining and engineering
Xin Zhao
Paranymphs
Maike Bartholomae Haojie Cao
The work described in this thesis was carried out in the Molecular Genetics group of the Groningen Biomolecular Sciences and Biotechnology Institute (Faculty of Mathematics and Natural Sciences, University of Groningen, The Netherlands) and School of Chemical Engineering and Technology (Tianjin University, China); and was financially supported by China Scholarship Council, China. Printing of this thesis was financially supported by the Graduate School of Science and the University of Groningen.
Cover design by Xin Zhao Page layout by Zhibo Li Printed by Ipskamp Drukkers ISBN: 978-90-367-9420-6 (Printed version) 978-90-367-9419-0 (Digital version)
Antimicrobials of Bacillus species: mining and engineering
PhD thesis
to obtain the degree of PhD at the University of Groningen on the authority of the
Rector Magnificus Prof. E. Sterken and in accordance with
the decision by the College of Deans.
This thesis will be defended in public on
Monday 12 December 2016 at 9:00 hours
by
Xin Zhao
born on 4 November 1989 in Tianjin, China
Supervisors
Prof. O.P. Kuipers Prof. Z. Zhou
Assessment committee
Prof. L. Dijkhuizen Prof. G.P. van Wezel Prof. G.N. Moll
CONTENTS
CHAPTER 1 General introduction 7
CHAPTER 2 Identification and classification of known and putative 41 antimicrobial compounds produced by a wide variety of Bacillales species
CHAPTER 3 Isolation and identification of antifungal peptides from 109 Bacillus BH072, a novel bacterium isolated from honey
CHAPTER 4 Complete genome sequence of Bacillus amyloliquefaciens 135 strain BH072 isolated from honey
CHAPTER 5 Production of class I and II hybrid lantibiotics using the 141 nisin modification machinery NisBTC together with GdmD in Lactococcus lactis
CHAPTER 6 Summary and discussion 173
ABBREVIATIONS 186
NEDERLANDSE SAMENVATTING 187
ACKNOWLEDGMENTS 191
PUBLICATIONS 195
7
Chapter 1
General introduction
Chapter 1
8
1. Antimicrobial compounds produced by Bacillus
Bacillus represents a genus of Gram-positive, rod-shaped bacteria with significant
biotechnological applications [1]. The potential of Bacillus species to secrete
various secondary metabolites with distinct capabilities to inhibit pathogens has
been known for more than 50 years. Many of these compounds have become
increasingly important for different biotechnological applications in food, medicine
and agriculture [2, 3]. The wide arsenal of antimicrobial substances known to be
produced by Bacillus strains includes ribosomally synthesized peptides and non-
ribosomally synthesized peptides (NRPs) and polyketides (PKs) [1, 4]. Notably,
they sometimes display a rather broad spectrum of inhibition, which may include
not only Gram-positive bacteria, but also Gram-negative bacteria, yeasts or fungi,
some of which are known to be pathogenic to humans and/or animals. Reported
examples of antimicrobial compounds produced by Bacillus are listed in Table 1
that describes their classification and bioactivity. Additionally, their biosynthetic
gene cluster distribution among Bacillus species is shown in Fig. 1.
1.1. Bacteriocins of Bacillus
Bacteriocins are ribosomally synthesized peptides or proteins showing
antimicrobial activity against other bacteria, mainly closely related species [5, 6].
There are 3 major classes of bacteriocins produced by Bacillus, including class I
small ribosomally produced and posttranslationally modified peptides (RiPPs) (less
than 10 kDa); class II unmodified linear bacteriocins; and class III large
antimicrobial proteins (larger than 10 kDa) [5, 7]. RiPPs encompass all the peptides
that undergo enzymatic modification during their biosynthesis, resulting in unusual
amino acids and structures (e.g. dehydrated residues, lanthionines, heterocycles,
head-to-tail linkage, glycosylation, lasso structures) that have pronounced impacts
on their properties [7-9]. Bacilli also produce several unmodified bacteriocins,
General Introduction
9
some of which are similar to the pediocin-like bacteriocins of the lactic acid
bacteria (LAB) [10, 11], while others are beyond that of LAB’s with completely
unrelated sequences [4].
1.2. NRPs and PKs of Bacillus
NRPs and PKs are synthesized by large multimodular synthetases known as non-
ribosomal peptide synthetases (NRPS), polyketide synthetases (PKS) or hybrid
NRPS/PKS, respectively, thus produced by elongation of activated monomers of
amino- and hydroxyl acid building blocks [12, 13]. Based on a recent whole
genome mining study, 88% of the Bacillales are estimated to harbor known or
putative gene clusters of NRPS, PKS or NRPS/PKS hybrid secondary metabolites,
indicating that Bacilli are a rich source of NRPs and PKs with significant
antimicrobial activity (Table 1).
NRPSs are organized in modules responsible for the incorporation of a specific L-
or D-amino acid, which consist of three main core domains: adenylation domain
(A), thiolation domain (T) and condensation domain (C) [14]. Besides these three
main domains, many NRPSs feature more specialized domains within modules that
allow diversified residue modifications leading to a broader range of bioactivities,
namely epimerization (E), methylation (M), oxidation (Ox), reduction (R),
formylation (F) and heterocyclization (Cy) [14, 15]. The PKS machinery also
comprises three core domains: the acyl transferase (AT), the acyl carrier protein
(ACP) and the ketosynthase (KS) [16]. Several compounds isolated from bacteria
are synthesized by NRPS/PKS hybrid synthetases. These metabolites are composed
of a polyketide backbone featuring incorporated amino acids in the case of a PKS-
NRPS hybrid or a peptidyl chain harboring a ketone group characteristic of a
NRPS-PKS hybrid [17].
Chapter 1
10
General Introduction
11
Fig. 1. Distribution of gene clusters of known antimicrobial compounds among
Bacillales. The phylogenetic tree was constructed by bi-directional BLAST all
proteins of all genome of 328 Bacillales strains (in Chapter 2) using Proteinortho
[68]; the newick tree was generated by p02tree and visualized using FigTree v1.4.3
(http://tree.bio.ed.ac.uk/software/figtree/). Gene clusters distribution of
antimicrobial compounds (listed in Table 1) among different Bacillales are
summarized into different classifications with different colors.
Table 1. Classification and target organism of antimicrobials produced by
Bacillus sp.
Class/Names Producers Target organism References
Bacteriocins (Class I: small RiPPs)
Subtilin Bacillus subtilis ATCC 6633 Gram-positive bacteria (e.g. Staphylococcus
aureus)
[18]
Ericin A/S B. subtilis A1/3 Gram-positive bacteria (e.g. S. aureus) [19]
Entianin B. subtilis subsp. spizizenii DSM
15029(T)
several Gram-positive bacteria (e.g. S. aureus) [20]
Subtilomycin B. subtilis strain MMA7 Gram-positive and Gram-negative pathogens,
as well as several pathogenic Candida species
(e.g. Bacillus cereus, Vibrio anguillarum)
[21]
Thuricin Bacillus thuringiensis serovar,
thuringiensis (HD-2)
several Gram-positive bacteria (e.g. Bacillus
polyxyma)
[22]
Paenicidin Paenibacillus polymyxa NRRL B-
30509
Gram-negative bacteria (e.g. Campylobacter
jejuni)
[23]
Clausin Bacillus clausii Gram-positive bacteria [24]
Geobacillin Geobacillus thermodenitrificans
NG80-2
Gram-positive bacteria (e.g. Streptococcus
dysgalactiae)
[25]
Mersacidin Bacillus sp. HIL Y-85,54728 Gram-positive bacteria (e.g. S. aureus) [26]
Amylolysin Bacillus amyloliquefaciens GA1 Gram-positive bacteria (e.g. Listeria
monocytogenes)
[27]
Pseudomycoici
din
Bacillus pseudomycoides DSM
12442
most Gram-positive bacteria (e.g. Micrococcus
luteus)
[28]
Cerecidins Bacillus cereus strain As 1.1846 most Gram-positive bacteria (e.g. vancomycin-
resistant Enterococcus faecalis)
[29]
Chapter 1
12
Lichenicidin Bacillus licheniformis ATCC
14580
L. monocytogenes, methicillin-resistant S.
aureus, and vancomycin-resistant Enterococcus
strains
[30]
Haloduracin Bacillus halodurans C-125 most Gram-positive bacteria (e.g. L.
monocytogenes)
[31]
Amylocyclicin B. amyloliquefaciens FZB42 Gram-positive bacteria (e.g. B. subtilis) [32]
Subtilosin A B. subtilis 168 several Gram-positive bacteria (e.g.
Enterococcus faecium)
[33]
Plantazolicin B. amyloliquefaciens FZB42 Bacillus [34]
Thiocillin B. cereus ATCC 14579 B. subtilis, methicillin-resistant S. aureus [35]
Sublancin 168 B. subtilis 168 Gram-positive bacteria [36]
Bacteriocins (Class II: unmodified peptides)
Coagulin Bacillus coagulans I4 Enterococcus, Leuconostoc, Oenococcus,
Listeria and Pediococcus
[10]
Lichenin B. licheniformis 26 L-10/3RA Streptococcus bovis, Ruminococcus
flavefaciens and Eubacterium ruminantium
[37]
Cerein B. cereus 8A Gram-positive and Gram-negative bacteria (e.g.
L. monocytogenes and Escherichia coli)
[38]
Bacteriocins (Class III: large antimicrobial proteins)
Megacins B. megaterium ATCC 19213 B. megaterium [39]
NRPs
Surfactins B. subtilis, B. amyloliquefaciens Antibacterial, antiviral, antifungal, anti-
mycoplasma and hemolytic activities
[40]
Iturins B. subtilis, B. amyloliquefaciens pathogenic yeasts and fungi; but their
antibacterial activities are restricted to some
bacteria such as M. luteus
[41]
Fengycins B. subtilis, B. amyloliquefaciens Antifungal activity [42]
Kustakins B. thuringiensis Antifungal activities against Stachybotrys
charatum
[43]
Cerexins B. cereus Gram-postive bacteria (e.g. S. aureus) [44]
Locillomycins B. subtilis 916 Antibacterial and antiviral activities [45]
Polymyxins Paenibacillus polymyxa Gram-positive and Gram-negative bacteria [46]
Fusaricidins P. polymyxa Antifungal activity against Fusarium
oxysporum , Aspergillus niger, Aspergillus
oryzae, Penicillium thomii, Candida albicans
and Saccharomyces cerevisiae, Leptosphaeria
maculans, and also active against some bacteria
(e.g. S. aureus)
[47]
General Introduction
13
Tridecaptins P. polymyxa Gram-positive and Gram-negative bacteria [48]
Bacilysin B.subtilis S. aureus [49]
Bacitracin B. subtilis Gram-positive and Gram-negative bacteria [50]
Rhizocticins B. subtilis ATCC6633 Antifungal activity [51]
Paenibacterin Paenibacillus OSY-SE Gram-positive and Gram-negative bacteria [52]
Sevadicin Paenibacillus larvae Bacillus [53]
Gramicidin S Brevisbacilllus brevis Antibacterial and antifungal activities [54]
Tyrocidine B. brevis Gram-positive bacteria and toxic toward human
blood and reproductive cells
[55]
Polypeptin Bacillus circulans Gram-positive and Gram-negative bacteria [56]
Pelgipeptins Paenibacillus elgii B69 Gram-positive, Gram-negative bacteria and
some fungi like Candida albicans
[57]
Octapeptins Bacillus and Paenibacillus spp. Gram-positive, Gram-negative bacteria,
filamentous fungi, protozoa and yeasts.
[58]
Gavaserin P. polymyxa bacteria and fungi [59]
Saltavalin P. polymyxa bacteria and fungi [59]
PKs
Bacillaene B. subtilis human pathogens such as Serratia marcescens,
Klebsiella pneumoniae and S. aureus
[60]
Difficidin B. subtilis Gram-positive and Gram-negative bacteria [61]
Macrolactin B. amyloliquefaciens Selective antibacterial activities, inhibit B16-
F10 murine melanoma cancer cells and
mammalian Herpes simplex viruses, protect
lymphoblast cells against HIV by inhibiting
virus replication
[62]
Paenimacrolidi
n
Paenibacillus sp. F6-B70 methicillin-resistant S. aureus [63]
Basiliskamides Brevibacillus laterosporus C. albicans and Aspergillus fumigatus [64]
NRPS/PKS hybrid synthesized compounds
Paenilarvins P. larvae Antifungal activity [65]
Zwittermicin A B. cereus Gram-positive, Gram-negative, and eukaryotic
microorganisms
[66]
Paenilamicin P. larvae Antibacterial and antifungal activities [67]
Chapter 1
14
2. Genome mining: Prediction of antimicrobial
compounds
The constant increase of multi-drug resistant pathogenic microorganisms stimulates
more than ever the effort to identify and develop new antimicrobial compounds
[69]. Isolation and screening of microorganisms from natural sources have always
been powerful means to obtain useful and genetically-stable strains for industrially-
important antimicrobial products [70]. The development of genomics, particularly
high-throughput sequencing and effective in silico mining methods of the most
promising targets within genomes, allows the fast identification and
characterization of putative antimicrobial genes and has created new opportunities
for antibiotic discovery. Various powerful genome mining tools and extensive
databases have been created [71, 72]. Here, we describe 2 relevant automatic
genomic identification and prediction tools, i.e. BAGEL3
(http://bagel.molgenrug.nl/) and antiSMASH (http://antismash.secondary
metabolites.org/) (Table 2).
2.1. BAGEL3
BAGEL3 (http://bagel.molgenrug.nl/) is a versatile fast genome-mining tool
targeted to identify not only modified- and non-modified bacteriocins, but also
non-bactericidal ribosomally produced compounds and RiPPs with corresponding
databases [72, 73]. Each database contains all the records belonging to one of the
three classes of proteins being core to BAGEL3: Class I contains RiPPs of less than
10 kDa, which currently is divided into more than 12 supported subclasses; Class II
contains unmodified peptides not fitting the criteria of the first database; Class III
contains antimicrobial proteins larger than 10 kDa. BAGEL3 uses DNA nucleotide
sequences in FASTA format as input; multiple sequence entries per file are
allowed. The input DNA sequences are analyzed in parallel via two different
General Introduction
15
approaches; one is the context of bacteriocin- or RiPP gene-based mining, the other
is precursor (structural gene)-based mining directly by Glimmer, which increases
the success rate and lowers the need for manual evaluation of results. The output is
visualized in an html page, by a Table of putative bacteriocins or modified peptides
classified into the detailed bacteriocin class found in the mining sequence; graphics
of gene clusters; annotation of each ORF in the context; as well as detailed
information of putative bacteriocins, such as BLAST hits in the bacteriocin
database, or the pI (Isoelectric point) value.
2.2. antiSMASH
antiSMASH (http://antismash.secondarymetabolites.org) is another web server and
stand-alone tool for the automatic genomic identification and analysis of
biosynthetic gene clusters of secondary metabolite compounds such as NRPs, PKs
and other antimicrobials [71, 74, 75]. A database of classes specific for many types
of biosynthesis signature genes is constructed by Hidden Markov Models
(pHMMs) covering a wide range of known or putative secondary metabolite
compounds. The antiSMASH web server allows uploading of sequence files of not
only a variety of types (FASTA, GBK, or EMBL files), but also GenBank/RefSeq
accession numbers. Gene clusters are first predicted and identified by Glimmer and
pHMMs, respectively. Subsequently, several downstream analyses can be
performed by different modules: NRPS/PKS domain analysis and annotation;
prediction of the core chemical structure of PKSs and NRPSs; ClusterBlast gene
cluster comparative analysis; active enzyme site analysis; and secondary
metabolism Clusters of Orthologous Groups (smCOG) analysis. Moreover, the
ClusterFinder algorithm is used to detect putative gene clusters of unknown types.
Finally, an html output is generated and putative gene clusters are listed in a Table.
Further details including gene cluster description, annotation, percentage of gene
homology with known gene clusters or published genome sequences; genomic loci
Chapter 1
16
for this biosynthetic pathway are shown by clicking on the related words.
Biochemical properties of the putative compounds are also predicted, especially
chemical structures of NRPs and PKs. Results, stored in an EMBL/XLS/
GenBank/BiosynML file, can be downloaded for additional analysis.
Table 2. Comparison of applications between BAGEL3 and antiSMASH
BAGEL3 antiSMASH
Database modified or unmodified ribosomally
synthesized bacteriocins and other
non-bactericidal posttranslationally
modified peptides
many major classes of secondary metabolites
Classifi-
cation
Class I small RiPPs (Bottromycins,
Cyanobactins, Glycocins, Head-to-
tail cyclized peptides, Lanthipeptides
class I, Lanthipeptides class II,
Lanthipeptides class III,
Lanthipeptides class IV, Linear azole-
containing peptides (LAPs), Lasso
peptides, Linaridins, Microcins,
Sactipeptides and Thiopeptides);
Class II unmodified peptides;
Class III large proteins
Aminocoumarins, Aminoglycosides/aminocyclitols, Aryl
polyenes, Bacteriocins, Beta-lactams, Bottromycins,
Butyrolactones, ClusterFinder fatty acids, ClusterFinder
saccharides, Cyanobactins, (Dialkyl)resorcinols,
Ectoines, Furans, Glycocins, Head-to-tail cyclized
peptides, Heterocyst glycolipid PKS-like, Homoserine
lactones, Indoles, Ladderane lipids, Lantipeptides, LAPs,
Lasso peptides, Linaridins, Melanins, Microcins,
Microviridins, Non-ribosomal peptides, Nucleosides,
Oligosaccharide, Others, Phenazines,
Phosphoglycolipids, Phosphonates, Polyunsaturated fatty
acids, Trans-AT type I PKS, Type I PKS, Type II PKS,
Type III PKS, Proteusins, Sactipeptides, Siderophores,
Terpenes, Thiopeptides
Input DNA nucleotide sequences in FASTA
format
DNA sequence files of a variety of types (FASTA, GBK,
or EMBL files); GenBank/RefSeq accession number
Mining
procedure
In parallel using two different
approaches, one based on finding
genes commonly found in the context
of bacteriocin or RiPP genes, the other
based on finding the gene itself by
Glimmer.
Gene clusters prediction and identification by Glimmer
and pHMMs and analysis with following modules:
NRPS/PKS domain analysis and annotation; chemical
structure prediction; ClusterBlast and smCOG analysis;
Active Site Finder; ClusterFinder algorithm.
Output Html Html
Time cost Average 3 minutes per file Depends on the server working status (not so fast)
General Introduction
17
3. Lantibiotics
Many of the Bacillus bacteriocins belong to the lantibiotics class, a category of
posttranslationally modified peptides widely disseminated among different
bacterial clades [76]. The lantibiotics are a group of ribosomally synthesized,
posttranslationally modified peptides containing unusual amino acids, such as
dehydrated amino acids and lanthionine residues [8]. Lantibiotics are among the
best-characterized antimicrobial peptides at the level of classification,
posttranslational modifications (PTMs), biosynthesis mechanisms, peptide
structures and modes of action.
3.1. Classification of lantibiotics
Based on the pathway of maturation, lantibiotics are divided into four classes
following the classification of lanthipeptides (Class I, II, III and IV) [77].
Lanthipeptides with antimicrobial activity are the so-called lantibiotics. Class I
lanthipeptides are modified by two distinct enzymes: a LanB enzyme, which
dehydrates threonine (Thr) and serine (Ser) residues, and a LanC enzyme that
catalyzes cyclization with cysteine (Cys). The peptides are exported by an ABC
transporter, named LanT. Class I lanthipeptides’ leader peptides are cleaved by
either a LanP or general Ser proteases. Class II lanthipeptides are modified by a
bifunctional LanM-type modification enzymes, which exhibits both dehydratase
and cyclase activities. Class II lanthipeptides secretion and leader processing is
most frequently performed by a single, multifunctional protein LanT with a
conserved N-terminal Cys protease domain. Despite the functional difference
between class I and class II exporters, they share the designation LanT. Unique
within the class II lantibiotics are two-peptide assembled molecules. Each peptide
of two-component lanthipeptides is encoded by its own structural gene and
modified by separate LanM enzymes. Class III lanthipeptides are modified by a
Chapter 1
18
trifunctional synthetase, LanKC, with an N-terminal lyase domain, a central kinase
domain, and a putative C-terminal cyclase domain [78, 79]. Additionally, class IV
lanthipeptides are modified by a synthetase, LanL, containing an N-terminal lyase
and kinase domains as in class III, and a C-terminal cyclase domain [80]. LanKC
lacks the conserved zinc-binding motif (Cys-Cys-His/Cys) present in LanC and the
C-terminal domains of LanM and LanL [81].
3.2. Posttranslational modifications (PTMs) of lantibiotics
Lantibiotics are highly posttranslationally modified bacterial antimicrobial
molecules formed by the dehydration of selected Ser and Thr residues and the
intramolecular addition of Cys thiols to the resulting unsaturated amino acids
dehydroalanine (Dha) and dehydrobutyrine (Dhb) to form (2S,6R)-lanthionine
(Lan) and (2S,3S,6R)-3-methyllanthionine (MeLan) bridges, respectively.
However, additional PTMs have been documented in lantibiotics by various
scientists [82, 83], based on their structural and functional features. Examples of
PTMs of lantibiotics are listed in Table 3. This structural diversity releases the
peptides from the constraints imposed by the use of only 20 amino acids. C-
terminal Cys residues may form S-[(Z)-2-aminovinyl]-D-cysteine (AviCys) or S-
[(Z)-2-aminovinyl]-(3S)-3-methyl-D-cysteine (AviMeCys) residue structures, such
as those found in gallidermin, epidermin and mersacidin. Specific LanD enzymes
(EpiD, GdmD and MrsD) have been investigated for biosynthesis of the parent
peptide to generate an AviCys or AviMeCys at the C-terminal end of the mature
peptide [84-86]. L-Ser can be converted to D-Alanine (D-Ala) with Dha as an
intermediate, such as in lactocin S, lacticin 3147 and carnolysin. When this
phenomenon was first noted in lactocin S, it was postulated that a conversion of L-
Ser to D-Ala occurred via a two-step process of carbon stereo inversion [87]. LtnJ
and CrnJ are reductases responsible for the introduction of D-Ala or D-Abu in the
lantibiotic lacticin 3147 and carnolysin at the relevant locations, respectively [88-
General Introduction
19
91]. During the maturation of pep5, epicidin 280, and epilancin 15X [92-94], after
leader cleavage, Dha and Dhb residues exposed at the N-terminus will be
spontaneously hydrolyzed to yield 2-oxopropionyl (OPr) and 2-oxobutyryl (OBu).
Furthermore, EciO and ElxO catalyze Opr reduction to form an N-terminal D-
lactate (D-Lac) in epicidin 280 and epilancin 15X, respectively [93, 94]. Moreover,
cinnamycin contains a lysinoalanine bridge (catalyzed by Cinorf7) and a
hydroxylated aspartic acid (Asp) (catalyzed by CinX) [95]. Microbisporicin
(previously patented as antibiotic 107891 and NAI-107) contains two unique
modifications: a chlorinated tryptophan (Cl-Trp) and a hydroxylated proline (HPro)
[82, 96]. MibO might be responsible for the hydroxylation of Pro-14 of
microbisporicin, while MibV and MibH might be essential for chlorination of Trp
to occur [97]. GarO is a putative monooxygenase responsible for the formation of a
sulfoxide bond in actagardine [98]. The acetylase PaeN catalyzes the N-terminal
acetylation of paenibacillin during its biosynthesis [99]. Bovicin HJ50 is a
lantibiotic containing two β-methyllanthionines and a disulfide bond catalyzed by a
thiol–disulfide oxidoreductase encoding by sdb1 gene produced by Streptococcus
bovis HJ50 [100, 101]. Some class III lanthipeptides, but not all, contain the
unusual triamino acid labionin (Lab) or methyllabionin (Melab), which results
from cyclodehydration of Ser/Ser or Ser/Thr and one Cys residues in a mechanism
similar to that used for lanthionine formation catalyzed by LanKC. NAI-112
contains an N-terminal Lab, a C-terminal MeLab and a N-glycosylated Trp residue,
which is catalyzed by LabKC and a glycosyltransferase, respectively [102].
Table 3. Posttranslational modifications (PTMs) in lantibiotics that have been
reported to date
PTMs Structures Modification
enzymes
Lantibiotics
(e.g.)
References
Chapter 1
20
2,3-Didehydroalanine
(Dha)
LanB or
LanM
nisin,
mersacidin etc. [8]
(Z)-2,3-didehydrobutyrine
(Dhb)
Meso-lanthionine (Lan)
LanB and
LanC; or
LanM
All [8] (2S,3S,6R)-3-
methyllanthionine
(MeLan)
S-[(Z)-2-aminovinyl]-D-
cysteine (AviCys)
LanD
gallidermin,
epidermin [103]
S-[(Z)-2-aminovinyl]-(3S)-
3-methyl-D-cysteine
(AviMeCys)
mersacidin [84]
D-Alanine (D-Ala)
LtnJ, CrnJ,
lactocin S,
lacticin 3147,
carnolysin
[88-91]
D-Aminobutyrate (D-Abu)
CrnJ carnolysin [90]
2-Oxobutyryl (OBu)
LanB pep5 [92]
2-Oxopropionyl (OPr)
LanB epicidin 280,
epilancin 15X [93, 94]
General Introduction
21
D-lactate (D-Lac)
EciO, ElxO epicidin 280,
epilancin 15X [93, 94]
Erythro-3-hydroxy L-
aspartic acid (Asp-OH)
CinX
cinnamycin [95] (2S,9S)-lysinoalanine
(Ala-NH-Lys)
Cinorf7
Dihydroxyproline (HPro)
MibO
microbisporicin [97] Chlorinated trptophan
(Cl-Trp)
MibV and
MibH
β-Methyllanthionine
sulfoxide
GarO actagardine [98]
N-terminal acetylation
PaeN paenibacillin [99]
Disulfide bridge
Sdb1 bovicin J50 [100]
Labionin (Lab)
LabKC NAI-112 [102]
Chapter 1
22
Methyl-labionin (MeLab)
N-glycosylated Trp
Glycosyltrans
ferase
3.3. Structures and modes of action
Most class I lantibiotics are elongated, cationic peptides that show a similar
arrangement of their lanthionine bridges (e.g. nisin, subtilin, epidermin,
gallidermin) (Fig. 2). The lantibiotic nisin primarily binds to its docking molecule
(lipid II), which is an essential intermediate in cell wall biosynthesis, and
subsequently forms pores in the cell membrane [105, 106]. Consequently, this
unique double mode of action makes nisin highly potent at nanomolar
concentrations against many Gram-positive bacteria [107]. Unlike nisin, the C-
terminal tail of epidermin and gallidermin is shorter and unable to translocate the
cell membrane to form pores [103]. Class II lantibiotics such as mersacidin and
cinnamycin are globular and also bind to lipid II, but have no structural similarity
with nisin and epidermin (Fig. 2) [108, 109]. Mersacidin acts by disrupting the
enzyme function of cell wall biosynthesis, by the formation of a complex with lipid
II. Specifically, it prevents the activity of transglycosylases. It is important to note
that mersacidin does not form pores upon binding to lipid II. Mersacidin and
closely related lantibiotics show potential for chemotherapeutic application [108].
Cinnamycin and the duramycins contain an unusual lysinoalanine ring and have a
General Introduction
23
different mechanism of action. They bind to phosphatidylethanolamine in the cell
membrane, and then cause toxicity by inducing transbilayer lipid movement [109].
Some other class II lantibiotics such as lacticin 481 and its relatives display an N-
terminal linear region and a C-terminal globular region with overlapping
lanthionine bridges [110]. Lacticin 481 may form complexes with lipid II and
inhibits the transglycosylation reaction involved in peptidoglycan biosynthesis
[111]. The two-component lantibiotics, such as lacticin 3147, consist of two
modified peptides, namely Lanα and Lanβ, where Lanβ displays a relatively more
globular structure than Lanα (Fig. 2) [82]. In lacticin 3147, Ltnα binds to lipid II
first, then Ltnβ is recruited by the lipid II-Ltnα complex, leading to high-affinity,
three-component complex, finally resulting in inhibition of cell wall biosynthesis
and pore formation [112].
Due to the importance of the unusual structures of lantibiotics, structure-activity
relationships have been determined in many studies. Some conserved regions are
essential for activity. For instance, the A and B rings of nisin, which have been
shown to be responsible for binding to lipid II, in particular to the pyrophosphate
moiety, are also conserved in subtilin, epidermin and gallidermin [93]. The C-
terminal region of nisin, as well as the overall negative surface charge of the
membrane are important for binding and pore formation [113, 114]. Mersacidin
inhibits peptidoglycan biosynthesis at the level of transglycosylation by forming a
complex with the membrane-bound peptidoglycan precursor lipid II with its C-
terminal region [115, 116]. Natural variants of lantibiotics suggest that the presence
of certain amino acids in specific locations is crucial, whereas other amino acids
are flexible in nature [117]. Positively charged residues consistently play an
important role on activity within specific domains of some lantibiotics through
disruption of the anionic bacterial membrane [118]. Bonelli et al. showed that
gallidermin/epidermin has a higher affinity to lipid II than nisin and suggested that
this may be caused by a structural element, probably the lysine at position 4
Chapter 1
24
(isoleucine in nisin) [103]. No interaction of nisin was observed with the D-Ala-D-
Ala moiety of lipid II, which is the binding motif of the peptide antibiotic
vancomycin [119]. That is why nisin is still effective against vancomycin-resistant
strains that change their terminal D-Ala into D-Lac resulting in a high level of
vancomycin resistance.
Fig. 2. Structures of class I and class II lantibiotics
General Introduction
25
3.4. Mersacidin - a type II lantibiotic produced by Bacillus sp.
Mersacidin is a typical globular type II lantibiotic first isolated from Bacillus sp.
HIL Y-85, 54728. It shows activity against Gram-positive bacteria, such as S.
aureus [26]. It is the smallest lantibiotic (1825 Da) reported till now, and it is
synthesized as a 20 amino acid residues core peptide containing three MeLan rings,
one Dha and a C-terminal AviMeCys. The whole gene cluster of mersacidin covers
12.3 kb and contains 10 putative open reading frames, 3 of which were located on
the opposite strand of mrsA, the structural gene of the mersacidin prepeptide [120]
(Fig. 3). Besides the structural gene mrsA, there are two modification genes (i.e.
mrsM coding for both dehydration and cyclisation and mrsD coding for a C-
terminal AviMeCys formation enzyme), the gene mrsT coding for a transporter
with a cysteine protease domain, as well as three genes, mrsEFG, coding for
immunity and three genes, mrsR1,R2,K1, coding for regulation. Biosynthesis of
mersacidin can be regulated by an autoinducing mechanism, which is performed by
the MrsR2/K2 two-component system [121]. This system is probably involved in
the recognition of mersacidin in the supernatant, and the producer self-protection is
regulated by MrsR2/K2, i.e. transcription of the ABC transporter MrsFGE.
Transcription of mrsA and biosynthesis of the mature lantibiotic is regulated by
MrsR1 [122, 123]. Remarkably, based on genome mining, the complete mersacidin
operon was detected in several Bacillus sp. strains, such as B. amyloliquefaciens
YAU B9601-Y2, Bacillus sp. BH072 and HIL Y-85, 54728 [124-126]. The
mersacidin producing strain HIL Y-85 cannot be made naturally competent so far,
limiting the manipulation of the gene cluster. Therefore, researchers transferred the
mersacidin gene cluster into a naturally competent B. amyloliquefaciens strain
FZB42, which already harbors mersacidin immunity genes and thus active
mersacidin could be obtained [120].
Chapter 1
26
Fig. 3. Model for the biosynthesis of mersacidin (based on Barbosa et al. 2015)
3.5. Biosynthesis of nisin
Nisin autoregulates its biosynthesis by acting as a peptide pheromone via a 2-
component regulatory system, involving a histidine protein kinase NisK and a
response regulator protein NisR [127, 128] (Fig. 4). NisK senses the presence of
nisin in the medium and autophosphorylates. The phosphate-group is transferred to
NisR, which activates transcription of the operons nisABTCIP and nisFEG. The
ribosomally synthesized prepeptide NisA undergoes PTMs, including unusual
amino acid formation and transport by a membrane located multimeric complex
consisting of NisB, NisC, and NisT. NisFEG is a membrane protein complex that
functions as an ABC transporter to transport the produced nisin from the
cytoplasmic membrane into the extracellular space. The lipoprotein NisI intercepts
and binds to nisin at the surface of the cytoplasmic membrane [129]. The leader
peptide is proteolytically removed by the protease NisP outside the cell [130].
General Introduction
27
Fig. 4. Model for the biosynthesis of nisin (based on Kuipers et al.1995, Lubelski
et al. 2008)
3.6. Engineering and applications of lantibiotics
Lantibiotics show a marked potential in addition to traditional antibiotics due to
their significant applications in the food and medical field [131]. The best-studied
lantibiotic nisin has no known toxicity to humans for over 40 years in use in food
industry, and it has occupied a unique status worldwide. Nisin has been approved
by the Food and Drug Administration as a safe food additive that inhibits food
spoilage bacteria [2]. Genome-wide screening may contribute to the discovery of
novel lantibiotics to extend their applications. Lantibiotics are gene-encoded, and,
therefore, can be readily manipulated by genetic engineering. This provides another
way to produce various lantibiotic structural analogs by rational designing and
engineering. By characterization of site-directed mutants of nisin, valuable
information on biosynthetic requirements was obtained [132]. Several mutants,
such as M17Q/G18T nisin Z, showed increasing activity of wild-type nisin Z
Chapter 1
28
against Micrococcus flavus [133]; mutant T2S gave rise to a Dha residue and
displayed a twofold higher antimicrobial activity against M. flavus and
Streptococcus thermophilus [134]. Thus far, after many trials, the successful
generation of bioengineered nisin variants with improved specific activity against
Gram-positive and Gram-negative bacteria was recently reported by variation in
the hinge region (N20, M21, K22). Mutants N20P/M21V/K22S nisin A, showed
enhanced activity against Gram-positive pathogens including L. monocytogenes
and/or S. aureus [135]. By introducing a positive charge in the hinge region, the
mutant N20K/M21K nisin Z displayed antimicrobial activity against the Gram-
negative bacteria Shigella, Pseudomonas and Salmonella; and they had a higher
solubility than wild-type nisin Z [136]. Moreover, Zhou et al. enhanced the activity
of nisin against Gram-negative microorganisms by designing a tail that could
facilitate traversing the outer membrane [137]. Marked achievements on
engineering lantibiotics further encourage and also extend the possible applications
of these compounds.
The nisin-controlled gene expression system (NICE) employs an auto-induction
mechanism of nisin for gene expression, discovered by Kuipers et al. [127]. When
a gene of interest is placed behind the inducible promoter PnisA on a plasmid (e.g.
pNZ8048 [138]) or on the chromosome [139-142], expression of that gene can be
induced by the addition of sub-inhibitory amounts of nisin (0.1-5 ng/mL) to the
culture medium [143]. Depending on the presence or absence of the corresponding
targeting signals, the protein is expressed into the cytoplasm, into the membrane or
secreted into the medium. The NICE system has been used in various Gram-
positive hosts to express genes of different backgrounds (Gram-positive, Gram-
negative and eukaryotic origin) to study metabolic and enzyme functions and to
produce larger amounts of an enzyme for food, medical or technological
applications [144]. By integration of the nisA promoter upstream of the lantibiotic
gene under study, expression of lantibiotics can be controlled by the addition of
General Introduction
29
nisin to the medium. Therefore, development of genetic analysis and engineering
will facilitate the creation of novel lantibiotics for therapeutical purposes.
4. Scope of thesis
There are 6 chapters in this thesis. Chapter 1 contains a general introduction on
the background of antimicrobials produced by Bacillus, genome mining of
antimicrobial gene clusters and lantibiotics. Bacillus sp. have been successfully
used to suppress various bacterial and fungal pathogens. Due to the wide
availability of whole genome sequence data and the development of genome
mining tools, novel antimicrobials are being discovered and updated, not only
bacteriocins, but also NRPs and PKs. A new classification system of known and
putative antimicrobial compounds of Bacillus by genome mining is presented in
Chapter 2. Importantly, predicting, isolating and screening of Bacillus strains with
antimicrobial activity from natural sources keeps showing surprises and underlines
the wealth of antimicrobial power these organisms have. Chapter 3 describes the
bacterium Bacillus sp. BH072, isolated from a honey sample, with antifungal
activities against molds. In order to explain the antifungal activity, the peptides of
the fermentation broth were isolated and identified by a combination of several
purification methods, and their genes were identified and analyzed. Subsequently
in Chapter 4, the genome of Bacillus sp. BH072 was completely sequenced and it
was identified to be B. amyloliquefaciens. BAGEL3 mining results showed that the
whole mersacidin operon is present in the genome of BH072, while no mersacidin
product was obtained by direct production. Considering that the nisin synthetic
machinery with additional modification enzymes brings a new opportunity to
produce a broader range of lanthipeptides with various modifications, Chapter 5
describes production of class I and II hybrid lantibiotics (nisin and mersacidin)
using the nisin leader sequence and NisBC together with GdmD in Lactococcus
lactis. Finally in Chapter 6, all the results of this thesis are discussed and put in a
Chapter 1
30
further and future perspective.
References
1. Baruzzi F, Quintieri L, Morea M, Caputo L. Antimicrobial compounds produced by Bacillus spp. and
applications in food In: Science against microbial pathogens: communicating current research and
technological advances Edited by Méndez-Vilas A. Spain; 2011.
2. Lucera A, Costa C, Conte A, Del Nobile MA: Food applications of natural antimicrobial compounds.
Front Microbiol. 2012,3(287):1-13.
3. Nath S, Chowdhury S, Dora KC. Application of Bacillus sp. as a biopreservative for food preservation.
Int J Eng Res Appl. 2015,5(4):85-95.
4. Abriouel H, Franz CM, Ben Omar N, Galvez A. Diversity and applications of Bacillus bacteriocins.
FEMS Microbiol Rev. 2011,35(1):201-232.
5. Cotter PD, Ross RP, Hill C. Bacteriocins - a viable alternative to antibiotics?. Nat Rev Microbiol.
2013,11(2):95-105.
6. Riley MA, Wertz JE. Bacteriocin diversity: ecological and evolutionary perspectives. Biochimie.
2002,84(5-6):357-364.
7. Alvarez-Sieiro P, Montalban-Lopez M, Mu D, Kuipers OP. Bacteriocins of lactic acid bacteria:
extending the family. Appl Microbiol Biotechnol. 2016,100(7): 2939-2951.
8. McAuliffe O, Ross RP, Hill C. Lantibiotics: structure, biosynthesis and mode of action. FEMS
Microbiol Rev. 2001,25(3):285-308.
9. Velasquez JE, van der Donk WA. Genome mining for ribosomally synthesized natural products. Curr
Opin Chen Biol. 2011,15(1):11-21.
10. Hyronimus B, Le Marrec C, Urdaci MC. Coagulin, a bacteriocin-like inhibitory substance produced by
Bacillus coagulans I4. J Appl Microbiol. 1998,85(1):42-50.
11. Le Marrec C, Hyronimus B, Bressollier P, Verneuil B, Urdaci MC. Biochemical and genetic
characterization of coagulin, a new antilisterial bacteriocin in the pediocin family of bacteriocins,
produced by Bacillus coagulans I(4). Appl Environ Microbiol. 2000,66(12):5213-5220.
12. Wang H, Fewer DP, Holm L, Rouhiainen L, Sivonen K. Atlas of nonribosomal peptide and polyketide
biosynthetic pathways reveals common occurrence of nonmodular enzymes. Proc Natl Acad Sci USA.
2014,111(25):9259-9264.
13. Weissman KJ. The structural biology of biosynthetic megaenzymes. Nat Chem Biol. 2014,11(9):660-
670.
14. Felnagle E, Jackson E, Chan Y, Podevels A, Berti A, McMahon M, Thomas M. Nonribosomal peptide
synthetases involved in the production of medically relevant natural products. Mol Pharmaceut.
2008,5(2):191-211.
15. Fickers P. Antibiotic Compounds from Bacillus: Why are they so Amazing? . Am J Biochem
Biotechnol 2012,8(1):38-43.
General Introduction
31
16. Aleti G, Sessitsch A, Brader G. Genome mining: Prediction of lipopeptides and polyketides from
Bacillus and related Firmicutes. Comput Struct Biotechnol J. 2015,13:192-203.
17. Amoutzias GD, Chaliotis A, Mossialos D. Discovery strategies of bioactive compounds synthesized by
nonribosomal peptide synthetases and type-I polyketide synthases derived from marine microbiomes.
Mar Drugs. 2016,14(4):1-20.
18. Klein C, Kaletta C, Schnell N, Entian KD. Analysis of genes involved in biosynthesis of the lantibiotic
subtilin. Appl Environ Microbiol. 1992,58(1):132-142.
19. Stein T, Borchert S, Conrad B, Feesche J, Hofemeister B, Hofemeister J, Entian KD. Two different
lantibiotic-like peptides originate from the ericin gene cluster of Bacillus subtilis A1/3. J Bacteriol.
2002,184(6):1703-1711.
20. Fuchs SW, Jaskolla TW, Bochmann S, Kotter P, Wichelhaus T, Karas M, Stein T, Entian KD.
Entianin, a novel subtilin-like lantibiotic from Bacillus subtilis subsp. spizizenii DSM 15029T with
high antimicrobial activity. Appl Environ Microbiol. 2011,77(5):1698-1707.
21. Phelan RW, Barret M, Cotter PD, O'Connor PM, Chen R, Morrissey JP, Dobson AD, O'Gara F,
Barbosa TM. Subtilomycin: a new lantibiotic from Bacillus subtilis strain MMA7 isolated from the
marine sponge Haliclona simulans. Mar Drugs. 2013,11(6):1878-1898.
22. Favret ME, Yousten AA. Thuricin: the bacteriocin produced by Bacillus thuringiensis. J Invertebr
Pathol. 1989,53(2):206-216.
23. van Belkum MJ, Lohans CT, Vederas JC. Draft genome sequences of Paenibacillus polymyxa NRRL
B-30509 and Paenibacillus terrae NRRL B-30644, strains from a poultry environment that produce
tridecaptin A and paenicidins. Genome Announcements. 2015,3(2):e00372-00315.
24. Bouhss A, Al-Dabbagh B, Vincent M, Odaert B, Aumont-Nicaise M, Bressolier P, Desmadril M,
Mengin-Lecreulx D, Urdaci MC, Gallay J. Specific interactions of clausin, a new lantibiotic, with lipid
precursors of the bacterial cell wall. Biophys J. 2009,97(5):1390-1397.
25. Garg N, Tang W, Goto Y, Nair SK, van der Donk WA. Lantibiotics from Geobacillus
thermodenitrificans. Proc Natl Acad Sci USA. 2011,109(14):5241-5246.
26. Bierbaum G, Brötz H, Koller KP, Sahl HG. Cloning, sequencing and production of the lantibiotic
mersacidin. FEMS Microbiol Lett. 1995,127(1-2):121-126.
27. Arguelles Arias A, Ongena M, Devreese B, Terrak M, Joris B, Fickers P. Characterization of
amylolysin, a novel lantibiotic from Bacillus amyloliquefaciens GA1. Plos One. 2013,8(12):e83037.
28. Basi-Chipalu S, Dischinger J, Josten M, Szekat C, Zweynert A, Sahl HG, Bierbaum G.
Pseudomycoicidin, a class II lantibiotic from Bacillus pseudomycoides. Appl Environ Microbiol.
2015,81(10):3419-3429.
29. Wang J, Zhang L, Teng K, Sun S, Sun Z, Zhong J. Cerecidins, novel lantibiotics from Bacillus cereus
with potent antimicrobial activity. Appl Environ Microbiol. 2014,80(8):2633-2643.
30. Begley M, Cotter PD, Hill C, Ross RP. Identification of a novel two-peptide lantibiotic, lichenicidin,
following rational genome mining for LanM proteins. Appl Environ Microbiol. 2009,75(17):5451-
5460.
31. Lawton EM, Cotter PD, Hill C, Ross RP. Identification of a novel two-peptide lantibiotic, haloduracin,
produced by the alkaliphile Bacillus halodurans C-125. FEMS Microbiol Lett. 2007,267(1):64-71.
Chapter 1
32
32. Scholz R, Vater J, Budiharjo A, Wang Z, He Y, Dietel K, Schwecke T, Herfort S, Lasch P, Borriss R.
Amylocyclicin, a novel circular bacteriocin produced by Bacillus amyloliquefaciens FZB42. J
Bacteriol. 2014,196(10):1842-1852.
33. Kawulka K, Sprules T, McKay RT, Mercier P, Diaper CM, Zuber P, Vederas JC. Structure of
subtilosin A, an antimicrobial peptide from Bacillus subtilis with unusual posttranslational
modifications linking cysteine sulfurs to alpha-carbons of phenylalanine and threonine. J Am Chem
Soc. 2003,125(16):4726-4727.
34. Scholz R, Molohon KJ, Nachtigall J, Vater J, Markley AL, Sussmuth RD, Mitchell DA, Borriss R.
Plantazolicin, a novel microcin B17/streptolysin S-like natural product from Bacillus amyloliquefaciens
FZB42. J Bacteriol. 2011,193(1):215-224.
35. Wieland Brown LC, Acker MG, Clardy J, Walsh CT, Fischbach MA. Thirteen posttranslational
modifications convert a 14-residue peptide into the antibiotic thiocillin. Proc Natl Acad Sci USA.
2009,106(8):2549-2553.
36. Paik SH, Chakicherla A, Hansen JN. Identification and characterization of the structural and transporter
genes for, and the chemical and biological properties of, sublancin 168, a novel lantibiotic produced by
Bacillus subtilis 168. J Biol Chem. 1998,273(36):23134-23142.
37. Pattnaik P, Kaushik J, Grover S, Batish V. Purification and characterization of a bacteriocin-like
compound (Lichenin) produced anaerobically by Bacillus licheniformis isolated from water buffalo. J
Appl Microbiol. 2001,91(4):636-645.
38. Bizani D, Motta A, Morrissy J, Terra R, Souto A, Brandelli A. Antibacterial activity of cerein 8A, a
bacteriocin-like peptide produced by Bacillus cereus. Int Microbiol. 2005,8(2):125-131.
39. Von Terschm M, Carlton B. Bacteriocin from Bacillus megaterium ATCC 19213: comparative studies
with megacin A-216. J Bacteriol. 1983,155(2):866-871.
40. Pathak KV, Keharia H. Identification of surfactins and iturins produced by potent fungal antagonist,
Bacillus subtilis K1 isolated from aerial roots of banyan (Ficus benghalensis) tree using mass
spectrometry. 3 Biotech. 2013,4(3):283-295.
41. Maget-Dana R, Peypoux F. Iturins, a special class of pore-forming lipopeptides: biological and
physicochemical properties. Toxicology. 1994,87(1-3):151-174.
42. Cawoy H, Debois D, Franzil L, De Pauw E, Thonart P, Ongena M. Lipopeptides as main ingredients
for inhibition of fungal phytopathogens by Bacillus subtilis/amyloliquefaciens. Microb Biotechnol.
2015,8(2):281-295.
43. Bechet M, Caradec T, Hussein W, Abderrahmani A, Chollet M, Leclere V, Dubois T, Lereclus D,
Pupin M, Jacques P. Structure, biosynthesis, and properties of kurstakins, nonribosomal lipopeptides
from Bacillus spp. Appl Microbiol Biotechnol. 2012,95(3):593-600.
44. Shoji J, Hinoo H. Chemical characterization of new antibiotics, cerexins A and B. (Studies on
antibiotics from the genus Bacillus. II). J Antibiot (Tokyo). 1975,28(1):60-63.
45. Luo C, Liu X, Zhou X, Guo J, Truong J, Wang X, Zhou H, Li X, Chen Z. Unusual biosynthesis and
structure of locillomycins from Bacillus subtilis 916. Appl Environ Microbiol. 2015,81(19):6601-6609.
46. Choi SK, Park SY, Kim R, Kim SB, Lee CH, Kim JF, Park SH. Identification of a polymyxin
synthetase gene cluster of Paenibacillus polymyxa and heterologous expression of the gene in Bacillus
General Introduction
33
subtilis. J Bacteriol. 2009,191(10):3350-3358.
47. Li S, Zhang R, Wang Y, Zhang N, Shao J, Qiu M, Shen B, Yin X, Shen Q. Promoter analysis and
transcription regulation of fus gene cluster responsible for fusaricidin synthesis of Paenibacillus
polymyxa SQR-21. Appl Microbiol Biotechnol. 2013,97(21):9479-9489.
48. Shoji J, Hinoo H, Sakazaki R, Kato T, Wakisaka Y, Mayama M, Matsuura S, Miwa H. Isolation of
tridecaptins A, B and C (studies on antibiotics from the genus Bacillus. XXIII). J Antibiot (Tokyo).
1978,31(7):646-651.
49. Ozcengiz G, Ogulur I. Biochemistry, genetics and regulation of bacilysin biosynthesis and its
significance more than an antibiotic. New Biotechnol. 2015,32(6):612-619.
50. Azevedo EC, Rios EM, Fukushima K, Campos-Takaki GM. Bacitracin production by a new strain of
Bacillus subtilis. Extraction, purification, and characterization. Appl Biochem Biotechnol.
1993,42(1):1-7.
51. Borisova SA, Circello BT, Zhang JK, van der Donk WA, Metcalf WW. Biosynthesis of rhizocticins,
antifungal phosphonate oligopeptides produced by Bacillus subtilis ATCC6633. Chem Biol.
2010,17(1):28-37.
52. Huang E, Yousef AE. The lipopeptide antibiotic paenibacterin binds to the bacterial outer membrane
and exerts bactericidal activity through cytoplasmic membrane damage. Appl Environ Microbiol.
2014,80(9):2700-2704.
53. Tang Y, Frewert S, Harmrolfs K, Herrmann J, Karmann L, Kazmaier U, Xia L, Zhang Y, Muller R.
Heterologous expression of an orphan NRPS gene cluster from Paenibacillus larvae in Escherichia
coli revealed production of sevadicin. J Biotechnol. 2015,194:112-114.
54. Kleinkauf H, Gevers W. Nonribosomal polypeptide synthesis: the biosynthesis of a cyclic peptide
antibiotic, gramicidin S. Cold Spring Harb Sym. 1969,34:805-813.
55. Hansen J, Pschorn W, Ristow H. Functions of the peptide antibiotics tyrocidine and gramicidin.
Induction of conformational and structural changes of superhelical DNA. Eur J Biochem.
1982,126(2):279-284.
56. Howell SF. Polypeptin, an antibiotic rom a member of the Bacillus Circulans group II. Purification
crystallization, and properties of polypeptin. J Biol Chem. 1950,186(2):863-877.
57. Ding R, Wu XC, Qian CD, Teng Y, Li O, Zhan ZJ, Zhao YH. Isolation and identification of
lipopeptide antibiotics from Paenibacillus elgii B69 with inhibitory activity against methicillin-
resistant Staphylococcus aureus. J Microbiol. 2011,49(6):942-949.
58. Cochrane SA, Vederas JC. Lipopeptides from Bacillus and Paenibacillus spp.: A gold mine of
antibiotic candidates. Med Res Rev. 2016,36(1):4-31.
59. Pichard B, Larue JP, Thouvenot D. Gavaserin and saltavalin, new peptide antibiotics produced by
Bacillus polymyxa. FEMS Microbiol Lett. 1995,133(3):215-218.
60. Patel PS, Huang S, Fisher S, Pirnik D, Aklonis C, Dean L, Meyers E, Fernandes P, Mayerl F.
Bacillaene, a novel inhibitor of procaryotic protein synthesis produced by Bacillus subtilis: production,
taxonomy, isolation, physico-chemical characterization and biological activity. J Antibiot (Tokyo).
1995,48(9):997-1003.
61. Wu L, Wu H, Chen L, Yu X, Borriss R, Gao X. Difficidin and bacilysin from Bacillus
Chapter 1
34
amyloliquefaciens FZB42 have antibacterial activity against Xanthomonas oryzae rice pathogens. Sci
Rep. 2015,5:12975.
62. Gustafson K, Roman M, Fenical W. The macrolactins, a novel class of antiviral and cytotoxic
macrolides from a deep-sea marine bacterium. J Am Chem Soc. 1989,111(19):7519-7524.
63. Wu XC, Qian CD, Fang HH, Wen YP, Zhou JY, Zhan ZJ, Ding R, Li O, Gao H. Paenimacrolidin, a
novel macrolide antibiotic from Paenibacillus sp. F6-B70 active against methicillin-resistant
Staphylococcus aureus. Microb Biotechnol. 2011,4(4):491-502.
64. Barsby T, Kelly MT, Andersen RJ. Tupuseleiamides and basiliskamides, new acyldipeptides and
antifungal polyketides produced in culture by a Bacillus laterosporus isolate obtained from a tropical
marine habitat. J Nat Prod. 2002,65(10):1447-1451.
65. Sood S, Steinmetz H, Beims H, Mohr KI, Stadler M, Djukic M, von der Ohe W, Steinert M, Daniel R,
Muller R. Paenilarvins: Iturin family lipopeptides from the honey bee pathogen Paenibacillus larvae.
Chembiochem. 2014,15(13):1947-1955.
66. Luo Y, Ruan LF, Zhao CM, Wang CX, Peng DH, Sun M. Validation of the intact zwittermicin A
biosynthetic gene cluster and discovery of a complementary resistance mechanism in Bacillus
thuringiensis. Antimicrob Agents Chemother. 2011,55(9):4161-4169.
67. Garcia-Gonzalez E, Muller S, Hertlein G, Heid N, Sussmuth RD, Genersch E. Biological effects of
paenilamicin, a secondary metabolite antibiotic produced by the honey bee pathogenic bacterium
Paenibacillus larvae. Microbiology Open. 2014,3(5):642-656.
68. Lechner M, Findeiß S, L. S, Marz M, Stadler P, Prohaska S. Proteinortho: Detection of (co-)orthologs
in large-scale analysis. BMC Bioinformatics. 2011,12(1):124.
69. Davies J, Davies D. Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev.
2010,74(3):417-433.
70. Yang E, Fan L, Jiang Y, Doucette C, Fillmore S. Antimicrobial activity of bacteriocin-producing lactic
acid bacteria isolated from cheeses and yogurts. AMB Express. 2012,2(1): 1-12.
71. Medema MH, Blin K, Cimermancic P, de Jager V, Zakrzewski P, Fischbach MA, Weber T, Takano E,
Breitling R. antiSMASH: rapid identification, annotation and analysis of secondary metabolite
biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res.
2011,39(8):W339-346.
72. van Heel AJ, de Jong A, Montalban-Lopez M, Kok J, Kuipers OP. BAGEL3: Automated identification
of genes encoding bacteriocins and (non-)bactericidal posttranslationally modified peptides. Nucleic
Acids Res. 2013,41: 448-453.
73. de Jong A, van Hijum SA, Bijlsma JJ, Kok J, Kuipers OP. BAGEL: a web-based bacteriocin genome
mining tool. Nucleic Acids Res. 2006,34:273-279.
74. Blin K, Medema MH, Kazempour D, Fischbach MA, Breitling R, Takano E, Weber T. antiSMASH
2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res.
2013,41:204-212.
75. Weber T, Blin K, Duddela S, Krug D, Kim HU, Bruccoleri R, Lee SY, Fischbach MA, Muller R,
Wohlleben W. et al. antiSMASH 3.0-a comprehensive resource for the genome mining of biosynthetic
gene clusters. Nucleic Acids Res. 2015,43:237-243.
General Introduction
35
76. Lee H, Kim HY. Lantibiotics, class I bacteriocins from the genus Bacillus. J Microbiol Biotechnol.
2011,21(3):229-235.
77. Knerr PJ, van der Donk WA. Discovery, biosynthesis, and engineering of lantipeptides. Annu Rev
Biochem. 2012,81(1):479-505.
78. Wang H, van der Donk WA. Biosynthesis of the class III lantipeptide catenulipeptin. ACS Chem Biol.
2012,7(9):1529-1535.
79. Kodani S, Hudson ME, Durrant MC, Buttner MJ, Nodwell JR, Willey JM. The SapB morphogen is a
lantibiotic-like peptide derived from the product of the developmental gene ramS in Streptomyces
coelicolor. Proc Natl Acad Sci USA. 2004,101(31):11448-11453.
80. Goto Y, Okesli A, van der Donk WA. Mechanistic studies of Ser/Thr dehydration catalyzed by a
member of the LanL lanthionine synthetase family. Biochemistry. 2011,50(5):891-898.
81. Zhang Q, Yu Y, Velasquez JE, van der Donk WA. Evolution of lanthipeptide synthetases. Proc Natl
Acad Sci USA. 2012,109(45):18361-18366.
82. Willey JM, van der Donk WA. Lantibiotics: peptides of diverse structure and function. Annu Rev
Microbiol. 2007,61(1):477-501.
83. Montalban-Lopez M, Zhou L, Buivydas A, van Heel AJ, Kuipers OP. Increasing the success rate of
lantibiotic drug discovery by synthetic biology. Expert Opin Drug Dis. 2012,7(8):695-709.
84. Majer F, Schmid DG, Altena K, Bierbaum G, Kupke T. The flavoprotein MrsD catalyzes the oxidative
decarboxylation reaction involved in formation of the peptidoglycan biosynthesis inhibitor mersacidin.
J Bacteriol. 2002,184(5):1234-1243.
85. Kupke T, Stevanović S, Sahl H, Götz F. Purification and characterization of EpiD, a flavoprotein
involved in the biosynthesis of the lantibiotic epidermin. J Bacteriol. 1992,174(16):5354-5361.
86. Kupke T, Kempter C, Jung G, Götz F. Oxidative decarboxylation of peptides catalyzed by flavoprotein
EpiD. Determination of substrate specificity using peptide libraries and neutral loss mass spectrometry.
J Biol Chem. 1995,270(19):111282-111289.
87. Skaugen M, Abildgaard C, Nes I. Organization and expression of a gene cluster involved in the
biosynthesis of the lantibiotic lactocin S. Mol Gen Genet. 1997,253(6):674-686.
88. Mu D, Montalban-Lopez M, Deng J, Kuipers OP. Lantibiotic reductase LtnJ substrate selectivity
assessed with a collection of nisin derivatives as substrates. Appl Environ Microbiol.
2015,81(11):3679-3687.
89. van Heel AJ, Mu D, Montalban-Lopez M, Hendriks D, Kuipers OP. Designing and producing
modified, new-to-nature peptides with antimicrobial activity by use of a combination of various
lantibiotic modification enzymes. ACS Synth Biol. 2013,2(7):397-404.
90. Lohans CT, Li JL, Vederas JC. Structure and biosynthesis of carnolysin, a homologue of enterococcal
cytolysin with D-amino acids. J Am Chem Soc. 2014,136(38):13150-13153.
91. Cotter PD, O'Connor PM, Draper LA, Lawton EM, Deegan LH, Hill C, Ross RP. Posttranslational
conversion of L-serines to D-alanines is vital for optimal production and activity of the lantibiotic
lacticin 3147. Proc Natl Acad Sci USA. 2005,102(51):18584-18589.
92. Kaletta C, Entian K, Kellner R, Jung G, Reis M, Sahl H. Pep5, a new lantibiotic: structural gene
isolation and prepeptide sequence. Arch Microbiol. 1989,152(1):16-19.
Chapter 1
36
93. Heidrich C, Pag U, Josten M, Metzger J, Jack RW, Bierbaum G, Jung G, Sahl HG. Isolation,
characterization, and heterologous expression of the novel lantibiotic epicidin 280 and analysis of its
biosynthetic gene cluster. Appl Environ Microbiol. 1998,64(9):3140-3146.
94. Velasquez JE, Zhang X, van der Donk WA: Biosynthesis of the antimicrobial peptide epilancin 15X
and its N-terminal lactate. Chem Biol. 2011,18(7):857-867.
95. Okesli A, Cooper LE, Fogle EJ, van der Donk WA. Nine post-translational modifications during the
biosynthesis of cinnamycin. J Am Chem Soc. 2011,133(34):13753-13760.
96. Castiglione F, Lazzarini A, Carrano L, Corti E, Ciciliato I, Gastaldo L, Candiani P, Losi D, Marinelli F,
Selva E. et al. Determining the structure and mode of action of microbisporicin, a potent lantibiotic
active against multiresistant pathogens. Chem Biol. 2008,15(1):22-31.
97. Foulston LC, Bibb MJ. Microbisporicin gene cluster reveals unusual features of lantibiotic biosynthesis
in actinomycetes. Proc Natl Acad Sci USA. 2010,107(30):13461-13466.
98. Boakes S, Cortes J, Appleyard AN, Rudd BA, Dawson MJ. Organization of the genes encoding the
biosynthesis of actagardine and engineering of a variant generation system. Mol Microbiol.
2009,72(5):1126-1136.
99. Huang E, Yousef AE. Biosynthesis of paenibacillin, a lantibiotic with N-terminal acetylation, by
Paenibacillus polymyxa. Microbiol Res. 2015,181:15-21.
100. Liu G, Zhong J, Ni J, Chen M, Xiao H, Huan L. Characteristics of the bovicin HJ50 gene cluster in
Streptococcus bovis HJ50. Microbiology. 2009,155(2):584-593.
101. Xiao H, Chen X, Chen M, Tang S, Zhao X, Huan L. Bovicin HJ50, a novel lantibiotic produced by
Streptococcus bovis HJ50. Microbiology. 2004,150(1):103-108.
102. Iorio M, Sasso O, Maffioli SI, Bertorelli R, Monciardini P, Sosio M, Bonezzi F, Summa M, Brunati C,
Bordoni R. et al. A glycosylated, labionin-containing lanthipeptide with marked antinociceptive
activity. ACS Chem Biol. 2014,9(2):398-404.
103. Bonelli RR, Schneider T, Sahl HG, Wiedemann I. Insights into in vivo activities of lantibiotics from
gallidermin and epidermin mode-of-action studies. Antimicrob Agents Chemother. 2006,50(4):1449-
1457.
104. Yang X, van der Donk WA. Post-translational introduction of D-Alanine into ribosomally synthesized
peptides by the dehydroalanine reductase NpnJ. J Am Chem Soc. 2015,137(39):12426-12429.
105. Bauer R, Dicks LM: Mode of action of lipid II-targeting lantibiotics. Int J Food Microbiol.
2005,101(2):201-216.
106. Breukink E, Wiedemann I, van Kraaij C, Kuipers OP, Sahl HG, de Kruijff B. Use of the cell wall
precursor lipid II by a pore-forming peptide antibiotic. Science. 1999,286(5448):2361-2364.
107. Brötz H, Sahl H. New insights into the mechanism of action of lantibiotics--diverse biological effects
by binding to the same molecular target. J Antimicrobiol Chemother. 2000,46(1):1-6.
108. Brötz H, Bierbaum G, Leopold K, Reynolds PE, Sahl HG. The lantibiotic mersacidin inhibits
peptidoglycan synthesis by targeting lipid II. Antimicrob Agents Chemother. 1998,42(1):154-160.
109. Makino A, Baba T, Fujimoto K, Iwamoto K, Yano Y, Terada N, Ohno S, Sato SB, Ohta A, Umeda M.
et al. Cinnamycin (Ro 09-0198) promotes cell binding and toxicity by inducing transbilayer lipid
movement. J Biol Chem. 2003,278(5):3204-3209.
General Introduction
37
110. van den Hooven HW, Lagerwerf FM, Heerma W, Haverkamp J, Piard JC, Hilbers CW, Siezen RJ,
Kuipers OP, Rollema HS. The structure of the lantibiotic lacticin 481 produced by Lactococcus lactis:
location of the thioether bridges. FEBS Lett. 1996,391(3):317-322.
111. Knerr PJ, Oman TJ, Garcia De Gonzalo CV, Lupoli TJ, Walker S, van der Donk WA. Non-
proteinogenic amino acids in lacticin 481 analogues result in more potent inhibition of peptidoglycan
transglycosylation. ACS Chem Biol.2012,7(11):1791-1795.
112. Wiedemann I, Bottiger T, Bonelli RR, Wiese A, Hagge SO, Gutsmann T, Seydel U, Deegan L, Hill C,
Ross P. et al. The mode of action of the lantibiotic lacticin 3147--a complex mechanism involving
specific interaction of two peptides and the cell wall precursor lipid II. Mol Microbiol. 2006,61(2):285-
296.
113. van Kraaij C, Breukink E, Noordermeer MA, Demel RA, Siezen RJ, Kuipers OP, de Kruijff B. Pore
formation by nisin involves translocation of its C-terminal part across the membrane. Biochemistry.
1998,37(46):16033-16040.
114. Breukink E, van Kraaij C, Demel RA, Siezen RJ, Kuipers OP, de Kruijff B. The C-terminal region of
nisin is responsible for the initial interaction of nisin with the target membrane. Biochemistry.
1997,36(23):6968-6976.
115. Brötz H, Bierbaum G, Reynolds PE, Sahl HG. The lantibiotic mersacidin inhibits peptidoglycan
biosynthesis at the level of transglycosylation. Eur J Biochem. 1997,246(1):193-199.
116. Hoffmann A, Pag U, Wiedemann I, Sahl H. Combination of antibiotic mechanisms in lantibiotics.
Farmaco. 2002,57(8):685-691.
117. Asaduzzaman SM, Mahin A, Bashar T, Noor R. Lantibiotics: A candidate for future generation of
antibiotics. Stamford J Microbiol. 2011,1(1):1-11.
118. Suda S, Hill C, Cotter PD, Ross RP. Investigating the importance of charged residues in lantibiotics.
Bioeng Bugs, 2010,1(5):345-351.
119. Breukink E, de Kruijff B. Lipid II as a target for antibiotics. Nat rev Drug discov. 2006,5(4):321-332.
120. Altena K, Guder A, Cramer C, Bierbaum G. Biosynthesis of the lantibiotic mersacidin: organization of
a type B lantibiotic gene cluster. Appl Environ Microbiol. 2000,66(6):2565-2571.
121. Schmitz S, Hoffmann A, Szekat C, Rudd B, Bierbaum G. The lantibiotic mersacidin is an autoinducing
peptide. Appl Environ Microbiol. 2006,72(11):7270-7277.
122. Guder A, Schmitter T, Wiedemann I, Sahl HG, Bierbaum G. Role of the single regulator MrsR1 and
the two-component system MrsR2/K2 in the regulation of mersacidin production and immunity. Appl
Environ Microbiol. 2002,68(1):106-113.
123. Barbosa J, Caetano T, Mendo S. Class I and Class II Lanthipeptides Produced by Bacillus spp. J Nat
Prod. 2015,78(11):2850-2866.
124. Hao K, He P, Blom J, Rueckert C, Mao Z, Wu Y, He Y, Borriss R. The genome of plant growth-
promoting Bacillus amyloliquefaciens subsp. plantarum strain YAU B9601-Y2 contains a gene cluster
for mersacidin synthesis. J Bacteriol. 2012,194(12):3264-3265.
125. He P, Hao K, Blom J, Ruckert C, Vater J, Mao Z, Wu Y, Hou M, He P, He Y. et al. Genome sequence
of the plant growth promoting strain Bacillus amyloliquefaciens subsp. plantarum B9601-Y2 and
expression of mersacidin and other secondary metabolites. J Biotechnol. 2012,164(2):281-291.
Chapter 1
38
126. Zhao X, de Jong A, Zhou Z, Kuipers OP. Complete genome sequence of Bacillus amyloliquefaciens
Strain BH072, isolated from honey. Genome Announcements. 2015,3(2):e00098-00015.
127. Kuipers OP, Beerthuyzen MM, de Ruyter PG, Luesink EJ, de Vos WM. Autoregulation of nisin
biosynthesis in Lactococcus lactis by signal transduction. J Biol Chem. 1995,270(45):27299-27304.
128. Lubelski J, Rink R, Khusainov R, Moll GN, Kuipers OP. Biosynthesis, immunity, regulation, mode of
action and engineering of the model lantibiotic nisin. Cell Mol Life Sci. 2008,65(3):455-476.
129. Khosa S, Lagedroste M, Smits SH. Protein defense systems against the lantibiotic Nisin: function of the
immunity protein NisI and the resistance protein NSR. Front Microbiol. 2016,7:504.
130. Van der Meer JR, Polman J, Beerthuyzen MM, Siezen RJ, Kuipers OP, De Vos WM. Characterization
of the Lactococcus lactis nisin A operon genes nisP, encoding a subtilisin-like serine protease involved
in precursor processing, and nisR, encoding a regulatory protein involved in nisin biosynthesis. J
Bacteriol. 1993,175(9):2578-2588.
131. Nagao J, Asaduzzaman SM, Aso Y, Okuda K, Nakayama J, Sonomoto K. Lantibiotics: insight and
foresight for new paradigm. J Biosci Bioeng. 2006,102(3):139-149.
132. Kuipers OP, Bierbaum G, Ottenwalder B, Dodd HM, Horn N, Metzger J, Kupke T, Gnau V, Bongers
R, Van den Bogaard P. et al. Protein engineering of lantibiotics. Antonie Van Leeuwenhoek.
1996,69(2):161-169.
133. Kuipers OP, Yap W, oilema H, Beerthuyzen M, Siezen R, de Vos WM. Expression of wild-type and
mutant nisin genes in Lactococcus lactis in Nisin and novel lantibiotics. Leiden: Escom Publ; 1991.
134. Kuipers OP, Rollema HS, Bongers R, van den Bogaard P, Kosters H, de Vos WM, Siezen RJ.
Structure-function relationships of nisin studied by protein engineering. In: 2nd International Workshop
on Lantibiotics. Arnhem, the Netherlands; 1994.
135. Field D, Connor PM, Cotter PD, Hill C, Ross RP. The generation of nisin variants with enhanced
activity against specific Gram-positive pathogens. Mol Microbiol. 2008,69(1):218-230.
136. Yuan J, Zhang ZZ, Chen XZ, Yang W, Huan LD. Site-directed mutagenesis of the hinge region of
nisinZ and properties of nisin Z mutants. Appl Microbiol Biotechnol. 2004,64(6):806-815.
137. Zhou L, van Heel AJ, Montalban-Lopez M, Kuipers OP. Potentiating the activity of nisin against
Escherichia coli. Front Cell Dev Biol. 2016,4:7.
138. Kuipers OP, de Ruyter PG, Kleerebezem M, de Vos WM. Quorum sensing-controlled gene expression
in lactic acid bacteria. J Biotechnol. 1998,64:15-21.
139. Koebmann BJ, Nilsson D, Kuipers OP, Jensen PR. The membrane-bound H(+)-ATPase complex is
essential for growth of Lactococcus lactis. J Bacteriol. 2000,182(17):4738-4743.
140. Boels IC, Kleerebezem M, de Vos WM. Engineering of carbon distribution between glycolysis and
sugar nucleotide biosynthesis in Lactococcus lactis. Appl Environ Microbiol. 2003,69(2):1129-1135.
141. Boels IC, Beerthuyzen MM, Kosters MHW, Van Kaauwen MPW, Kleerebezem M, de Vos WM.
Identification and functional characterization of the Lactococcus lactis rfb operon, required for dTDP-
rhamnose biosynthesis. J Bacteriol. 2004,186(5):1239-1248.
142. Simoes-Barbosa A, Abreu H, Silva Neto A, Gruss A, Langella P. A food-grade delivery system for
Lactococcus lactis and evaluation of inducible gene expression. Appl Microbiol Biotechnol.
2004,65(1):61-67.
General Introduction
39
143. de Ruyter PG, Kuipers OP, de Vos WM. Controlled gene expression systems for Lactococcus lactis
with the food-grade inducer nisin. Appl Environ Microbiol. 1996,62(10):3662-3667.
144. Mierau I, Kleerebezem M. 10 years of the nisin-controlled gene expression system (NICE) in
Lactococcus lactis. Appl Microbiol Biotechnol. 2005,68(6):705-717.
40
41
Chapter 2
Identification and classification of known
and putative antimicrobial compounds
produced by a wide variety of Bacillales
species
Xin Zhao1,2
, Oscar P. Kuipers1*
1 Department of Molecular Genetics, University of Groningen, Nijenborgh 7, 9747AG
Groningen, the Netherlands
2 School of Chemical Engineering and Technology, Tianjin University, 300072 Tianjin,
P. R. China
This chapter has been published in BMC Genomics.
doi: 10.1186/s12864-016-3224-y (2016).
Chapter 2
42
Abstract
Gram-positive bacteria of the Bacillales are important producers of antimicrobial
compounds that might be utilized for medical, food or agricultural applications.
Thanks to the wide availability of whole genome sequence data and the
development of specific genome mining tools, novel antimicrobial compounds,
either ribosomally- or non-ribosomally produced, of various Bacillales species can
be predicted and classified. Here, we provide a classification scheme of known and
putative antimicrobial compounds in the specific context of Bacillales species. We
identify and describe known and putative bacteriocins, non-ribosomally
synthesized peptides (NRPs), polyketides (PKs) and other antimicrobials from 328
whole-genome sequenced strains of 57 species of Bacillales by using web-based
genome-mining prediction tools. We provide a new classification scheme for
bacteriocins, update the findings of NRPs and PKs and investigate their
characteristics and suitability for biocontrol by describing per class their genetic
organization and structure. Moreover, we highlight the potential of several known
and novel antimicrobials from various species of Bacillales. Our extended
classification of antimicrobial compounds demonstrates that the genus Bacillales
provides a rich source of novel antimicrobials that can now readily be tapped
experimentally, since many new gene clusters are identified.
Keywords: antimicrobials, Bacillales, Bacillus, genome-mining, lanthipeptides,
sactipeptides, thiopeptides, NRPs, PKs
Antimicrobial Compounds of Bacillales Species
43
1. Introduction
Most of the species of the genus Bacillus and related Firmicutes are Gram-positive,
aerobic endospore-forming and rod-shaped bacteria, which are found in diverse
environments such as soil and clay, rocks, dust, aquatic environments, on
vegetation, in food and in the gastrointestinal tracts of various insects and animals
[1]. Antimicrobial compounds have been used for a variety of purposes, such as
delaying spoilage by plant pathogens in agriculture and extending product shelf life
in the food industry [2, 3]. In particular, Bacillus strains are known to produce a
wide variety of biocontrol metabolites, including the ribosomally synthesized
antimicrobial peptides (bacteriocins) [4], as well as non-ribosomally synthesized
peptides (NRPs) and polyketides (PKs) [5].
The discovery of biosynthetic gene clusters of antimicrobial compounds by
genome mining is a rewarding task, because this methodology can lead to the
identification and subsequent isolation of novel molecules of pharmacological and
biotechnological interest [6]. Various powerful tools with broad databases have
been created for the automated screening of bacteriocin gene clusters. BAGEL3
(http://bagel.molgenrug.nl/) is a versatile fast genome-mining tool valid not only
for modified- and non-modified bacteriocins, but also for non-bactericidal
ribosomally produced and posttranslationally modified peptides (RiPPs) [7]. A
detailed prediction of the gene clusters of NRPs, PKs and other antimicrobials is
provided by antiSMASH (http://antismash.secondarymetabolites.org), a web server
and stand-alone tool for the automatic genomic identification and analysis of
biosynthetic gene clusters [8-10].
Although a description of Bacillus subtilis antimicrobials has been made before
(excellent review of Stein, 2005) [11], we aim to give an updated overview and
classification of bacteriocins covering various species of Bacillales, as well as
Chapter 2
44
NRPs and PKs, by genome mining of 57 different species within 328 whole-
genome sequenced strains of Bacillales reported before March 2016 (Table 1,
Table S1 and Fig. 1). We also highlight examples of each class by describing the
genetics, structure and mechanism of action, with a keen eye on biocontrol
properties and applications. Within the genus Bacillus, B. subtilis, B.
amyloliquefaciens, B. licheniformis, B. cereus and B. thuringiensis are the best-
studied species for antimicrobials production [12]. Genome mining and subsequent
analyses and classification of antimicrobials of other less explored Bacillales,
including Paenibacillus, Brevibacillus, Alicyclolacillus, Anoxybacillus,
Lysinibacillus and Geobacillus will be also included in this analysis, revealing
interesting new features and distributions.
2. Results
Classification of antimicrobial peptides encountered in
Bacillales
The main classification scheme for ribosomally synthesized antimicrobial peptides
currently available is that of the lactic acid bacteria (LAB) bacteriocins [13], which
was recently reviewed and revised by Alvarez-Sieiro et al (2016) [14]. The main
classification scheme for RiPPs (Class I) was provided by the paper of Arnison et
al (2013) [15]. Although some bacteriocins produced by Bacillus are similar to
those of LAB’s, the Bacillus antimicrobial compound classification system now is
lagging behind that of LAB classifications. Conveniently, BAGEL3 can be used
for mining bacteriocin gene clusters, some of which were not identified before.
Moreover, some cryptic gene clusters of bacteriocins were identified that have not
been isolated yet from wild-type microorganisms. In this study, we identified 583
putative bacteriocin gene clusters from 328 strains of 57 species of Bacillales
(Table 1), and these gene clusters were further classified into 3 classes harboring
Antimicrobial Compounds of Bacillales Species
45
46 types of bacteriocins covering 50 species of Bacillales (Table 2) according to
their gene organization and the homologies of their structural and biosynthetic
genes. In addition to the published bacteriocins, many novel putative bacteriocin
gene clusters were discovered. Combining this with the genome mining results of
antiSMASH, we also address the non-ribosomally synthesized and polyketide
synthesized antimicrobial compounds. In total 1231 putative non-ribosomal
antimicrobial gene clusters were detected and subgrouped into 23 types of NRPs, 5
types of PKs and 3 types of NRPS/PKS hybrid synthesized compounds distributed
over 49 species of Bacillales (Table 3). In the following sections, we will describe
the various classes of ribosomally synthesized peptides, NRPs, PKs and other
antimicrobials present in Bacillales and indicate their presence in the various
genomes.
2.1. Ribosomally synthesized antimicrobial peptides
The classification system used in this paper for Bacillus ribosomally synthesized
antimicrobial peptides (Table 1) comprises the major Class I: small RiPPs (based
on Arnison et al) [15] Class II: unmodified bacteriocins; Class III: large
antimicrobial proteins (see also Alvarez-Sieiro et al 2016) [14]. Characteristics of
the identified bacteriocins of Bacillales are listed in Table 2, describing their
precursor sequences, gene clusters and predicted producer species, respectively.
2.1.1. Class I: Ribosomally produced and posttranslationally modified peptides
(RiPPs)
This class consists of antimicrobial peptides (less than 10 kDa) that are ribosomally
synthesized, undergoing posttranslational modifications (PTMs), resulting in
different structures and properties. In this study, we found 438 putative gene
clusters of class I bacteriocins, widely distributed over 49 species of Bacillales
(Table 1). According to the modification differences, this class can be subdivided
Chapter 2
46
into 7 subclasses. Subclass 1 includes peptides with modifications typical for
lantibiotics (e.g. lanthionine), while subclasses 2-7 include peptides with other
unique modifications [15-17].
Subclass 1: Lanthipeptides
Lanthipeptides are peptides containing unusual amino acids, such as
dehydroalanine/dehydrobutyrine, lanthionine/methyl-lanthionine residues,
introduced by different kinds of PTMs [15]. Lanthipeptides with antimicrobial
activity form the so-called lantibiotics [17], which can be subdivided into 4
subclasses, following the classification scheme of lanthipeptides [18]. The main
differences between class I, II, III and IV lanthipeptides are the PTM enzymes
involved. Class I lanthipeptides are modified by two distinct enzymes that carry out
the PTM process: dehydratase LanB and cyclase LanC, while class II peptides are
modified by a bifunctional lanthionine-introducing enzyme, called LanM. There
are also two-component lanthipeptides consisting of two peptides, which belong to
class II lanthipeptide, because they are processed by a single modifying enzyme,
called LanM [19-23]. For other lanthipeptides (class III and IV), the dehydration
and cyclization reactions are catalyzed by multifunctional enzymes (RamC/LabKC
or LanL) or they lack significant antibiotic activity, which are not further described
here [24].
Subtilin is a well-investigated class I lanthipeptide produced by B. subtilis, the
encoding gene cluster of which is also found in the genome of Bacillus sp. YP1.
The gene encoding subtilin encodes a 56-residue peptide precursor that is
processed to yield the 32-residue mature peptide, which is structurally related to
the lantibiotic nisin of Lactococus lactis [25]. The subtilin gene cluster includes the
structural gene spaS, encoding its prepeptide; PTM genes precursor subtilin spaB
and spaC, encoding a dehydratase and a cyclase for lanthionine formation,
respectively; transporter gene spaT for modified precursor export and immunity
Antimicrobial Compounds of Bacillales Species
47
genes spaIFEG (Table 2) [26-28]. The presubtilin will be converted to mature
subtilin by serine proteases secreted by B. subtilis [29]. Subtilin exhibits
bactericidal activity against a broad spectrum of Gram-positive bacteria, based on
pore formation in the cytoplasmic membrane, using cell wall precursors such as
lipid II and undecaprenyl pyrophosphate, the hydrophobic carrier module for
peptidoglycan monomers, as docking module and as a central constituent of the
pore [30-31]. The class II lanthipeptide mersacidin produced by several B.
amyloliquefaciens strains [32-34], with a more globular structure comprising 20
amino acid residues, inhibits cell wall biosynthesis by binding to lipid II [35-36].
The mersacidin gene cluster includes the structural gene mrsA, two modification
genes (Table 2), i.e. mrsM coding for both dehydration and cyclation and mrsD
coding for a C-terminal S-[(Z)-2-aminovinyl]-3methyl-D-cysteine formation
enzyme, and the gene mrsT coding for a transporter with an associated protease
domain, as well as three genes, mrsEFG, coding for immunity and three genes,
mrsR1,R2,K1, coding for regulation [37-39].
A total of 105 putative lanthipeptide gene clusters were discovered in Bacillales in
this study (Table 1). Among them, gene clusters of class I lanthipeptides distribute
over the genomes of B. subtilis, B. thuringinensis, B. cereus, B. megaterium, B.
mycoides, B. clausii, Bacillus sp., Geobacillus thermodenitrificans, Geobacillus
kaustophilus, Paenibacillus polymyxa, Paenibacillus larvae, Paenibacillus peoriae
and Paenibacillus durus, while gene clusters of class II lanthipeptides distribute
over the genomes of B. thuringinensis, B. cereus, B. amyloliquefaciens, B.
licheniformis, B. mycoides, B. halodurans, B. methylotrophicus, B.
paralicheniformis, B. endophyticus, B. pseudomycoides, Bacillus sp., G.
thermodenitrificans, P. polymyxa, P. durus and Paenibacillus sp. (Table 2 and Fig.
2). Class I lanthipeptides identified by BAGEL3 includes subtilin, clausin,
subtilomycin and geobacillin I [22, 40-42]. Gene clusters of entianin, ericinA/S,
paenibacillin, paenicidin A, B, thuricin 4A and its derivative thuricin 4D were not
Chapter 2
48
found by genome mining tools (because whole genome sequences of the producing
organisms were not available in most cases) but were also added to the list (Table
2) [43-47]. Class II lanthipeptides usually exhibit a globular structure, including
mersacidin, amylolysin, pseudomycoicidin, cerecidin A1-A6 and geobacillin II;
also two-component class II lanthipeptides including haloduracin and lichenicidin
were identified [19, 22, 23, 48-52]. It is notable that gene clusters of two novel
subtilin-like lantibiotics were found in several P. polymyxa strains. By further
analysis, both of their sequence of core peptides showed high similarity with the N-
terminal part of subtilin but were quite different in the C-terminal part. Moreover,
we report a novel gallidermin/nisin-like lantibiotic from genomes of Bacillus
mycoides ATCC 6462, B. mycoides 2048 and B. cereus AH1272. Looking into the
sequence of its precursor peptide (see Table 2), it has the conserved F(N/D)LD
motif in its leader and theoretically could form the same rings as gallidermin/nisin
according to the position of serine and cysteine residues. All of the 3 putative
lantibiotics have lanBC genes in their gene clusters, which suggest they are
involved in their production. A gene cluster of a two-peptide bacteriocin was found
in the genome of B. cereus Q1. Due to the existence of a lanM gene, it was
predicted to be a class II lanthipeptide. Interestingly, the C-terminal parts of both
its core peptides are similar to lichenicidin and haloduracin, and the N-terminal
part of one of the core peptides shows high similarity with one of cytolysins
produced by Enterococcus faecalis [53].
Subclass 2: Head to tail cyclized peptides
Head to tail cyclic peptides are named by their unifying feature, which is the head
to tail circularization of their peptide backbones by direct linkage of their N- and
C-terminal amino acids, resulting in a well-defined three-dimensional structure, by
folding in α-helical manner [54-57]. To our knowledge, these peptides contain no
lanthionine, β-methyl-lanthionine, and dehydrated residues, making them clearly
Antimicrobial Compounds of Bacillales Species
49
distinguishable from lanthipeptides [58].
Amylocyclicin was recently reported to be produced by B. amyloliquefaciens
FZB42 and identified as a novel circular bacteriocin [59], which is derived from
the 112 amino acid precursor AcnA (Table 2) encoded by acnA, with a 48 amino
acid derived leader cleaved by a protease that is still unknown, and then
circularization occurring between Leu-1 and Trp-64 [59]. There are gene clusters
present, regulating their maturation (e.g. circularization and cleavage),
transportation and self-protection. The first gene of the putative operon, acnB,
encodes a membrane-anchored protein comprising five transmembrane helices with
unknown function. acnD is likely to encode the transporter complex, whereas
AcnC might act as circularization enzyme showing high similarity with the
sequence of UclB, which brings uberlysin to maturation [60]. AcnEF are proposed
to be the putative immunity genes. Amylocyclicin has the ability to inhibit Gram-
positive bacteria like B. subtilis, but not against Gram-negative bacteria.
There are 52 gene clusters of putative head to tail cyclized peptides identified in
this genome-mining study, which distribute over the genomes of B. thuringiensis,
B. cereus, B. coagulans, B. pumilus, B. paralicheniformis, B. gobiensis, Bacillus
sp., Kyrpidia tusciae, Geobacillus stearothermophilus, G. kaustophilus,
Geobacillus sp., P. larvae and Paenibacillus mucilaginosus (Table 1 and Fig. 2).
An amylocyclicin-like circular bacteriocin gene cluster was found in the genomes
of B. coagulans. The core peptide sequence is identical to that of amylocyclicin of
B. amyloliquefaciens FZB42, but the leader peptide sequence is quite different
(Table 2). It is noteworthy that a gene cluster of an uberolysin-like peptide was
detected in the genome of Bacillus sp. 1NAL3E and gene clusters of circularin
A/bacteriocin AS-48 like peptide were detected in several Geobacillus sp., while
uberolysin was produced by Streptococcus uberis, circularin A was produced by
Clostridium beijerinckii and bacteriocin AS-48 was produced by E. faecalis [54,
Chapter 2
50
60-63]. From the core peptide sequences, their circularization is most likely being
formed between leucine and tryptophan (Table 2). There are also other putative
gene clusters of head to tail cyclized peptides found in this study, but notably these
show no similarity with reported peptides. Whether these are real circular
bacteriocins or not, need to be further investigated experimentally.
Subclass 3: Sactipeptides
Sactipeptides form a class of cyclic antimicrobial peptides with unusual sulfur to α-
carbon cross-links, which are catalyzed by radical S-adenosylmethionine (SAM)
enzymes in a leader peptide-dependent manner [64, 65]. Posttranslational linkage
of a thiol to the α-carbon of an amino acid residue responsible for their
antimicrobial bioactivities is rare in ribosomal synthesized peptides and they are
classified as an independent group [66-68]. These unusual linkages differ from
lanthionine bridges containing sulfur to β-carbon linkages.
Subtilosin A is a 35-residue peptide, formed by cleavage of a seven amino acid
leader peptide, cyclization of the N- and C-terminal parts, and further modification
of cysteine, threonine and phenylalanine residues. The maturation of subtilosin A
begins with the transcription and translation of the sbo-alb genes (Table 2),
resulting in the precursor peptide SboA [69, 70]. Subsequently, the radical SAM
enzyme AlbA generates the thioether linkages between the sulfur atom of the
cysteine residue and the α-carbon of the threonine residue [68]. Afterwards, either
AlbE or AlbF (putative proteases) cleaves off the leader peptide. In the last step,
the peptide backbone is circularized by one of the two proteases, resulting in
subtilosin A, which is subsequently exported by the putative ABC transporter
AlbC. The operon is induced under anaerobic conditions and is controlled by the
transition state regulatory protein AbrB [4]. It shows antibacterial activity against
Bacillus spp., E. faecalis, Gardnerella vaginalis and Listeria monocytogenes by
targeting their membranes and forming pores [71-73].
Antimicrobial Compounds of Bacillales Species
51
In this study, we found 87 putative gene clusters of sactipeptides in the genomes of
Bacillales (Table 1), most of which belong to 3 reported types of sactipeptides
(Table 2): subtilosin A from B. subtilis, B. atrophaeus, B. simthii and Bacillus sp.
strains; sporulation killing factor (SKF) from B. atrophaeus, B. pumilus and B.
subtilis strains; and thuricins, such as thuricin H (17) and thuricin CD from B.
thuringiensis and B. cereus [67, 74-77]. We found several other putative gene
clusters of sactipeptides in the genomes of B. clausii, G. stearothermophilus,
Brevibacillus laterosporus, P. larvae, Paenibacillus odorifer, Paenibacillus
graminis, Paenibacillus riograndensis and Paenibacillus sp. (Table 2 and Fig. 2),
which showed very limited similarity with reported sactipeptides, and that need to
be further experimentally confirmed.
Subclass 4: Linear azole-containing peptides (LAPs)
The linear azole-containing peptides (LAPs), form an important subgroup of RiPPs
with a distinguishing heterocyclic ring of oxazoles and thiazoles derived from
serine/threonine and cysteine by enzymatic cyclodehydration and dehydrogenation
[78-81]. Prominent natural products such as microcin B17 produced by
Escherichia coli and streptolysin S produced by LAB, are model of representive
LAPs peptides [82-86]. The LAP family has already been extended with
plantazolicin A and B produced by B. amyloliquefaciens and B. methylotrophicus
[80, 81].
Plantazolicin A (Table 2) and its desmethyl analogue plantazolicin B represent an
unusual type of thioazole/oxazole-containing peptide antibiotic with a hitherto
unknown mechanism of action, which show inhibition against Bacillus [80, 87].
The mature product plantazolicin is a linear 41 amino acid precursor peptide with
the 14 amino acid core-peptide encoded by the structural gene pznA. The trimeric
protein complex PznBCD (cyclodehydratase, dehydrogenase, and
docking/scaffolding protein) likely catalyzes PTMs of ten cyclodehydrations
Chapter 2
52
followed by nine dehydrogenations. After the protease PznE cleaves off the leader
peptide to yield desmethylplantazolicin plantazolicin B, a final N, N-
bismethylation by methyltransferase PznL gives plantazolicin A [80, 81].
A total of 117 putative gene clusters of LAPs occupy 20 % of the total putative
gene clusters of bacteriocins in this study and are widely distributed in more than
20 species of Bacillales (Table 1 and Fig. 2). However, only plantazolicin A and B
produced by B. amyloliquefaciens and B. methylotrophicus have been reported
before (Table 2). This means that many novel LAPs can be found and need further
experimental investigation.
Subclass 5: Thiopeptides
Thiopeptides, or thiazolyl peptides are highly modified via either non-ribosomal or
ribosomal assembly, with a six-membered nitrogenous macrocycle being central of
piperidine/pyridine/dehydropiperidine and including additional thiazoles and
dehydrated amino acid residues [15, 88, 89]. Because of the trithiazolyl
(tetrahydro) pyridine core, they display high affinity binding to either the 50S
ribosomal subunit or elongation factor Tu.
In the thiocillins, found in the producer B. cereus ATCC 14579, at least 10 and up
to 13 of the 14 C-terminal residues undergo PTM to generate a set of eight related
antibiotics. The thiocillin gene cluster contains four identical copies of a gene
encoding a 52-residue precursor peptide (tclE-H), which is thought to be
posttranslationally modified to yield the mature antibiotic scaffold (Table 2). Four
of the eight thiocillins produced abundantly by B. cereus display similar efficacies
against B. subtilis and two methicillin-resistant Staphylococcus aureus (MRSA)
strains [90, 91].
Antimicrobial Compounds of Bacillales Species
53
Thiopeptide gene clusters involved in ribosomal synthesis are found in the genome
sequences of several B. cereus, B. subtilis and Lysinibacillus sphaericus (Table 2
and Fig. 2), which might go beyond the classification for LAB bacteriocins [14].
Subclass 6: Glycocins
Glycocins are bacteriocins with glycosylated residues. There are various unique
and diverse putative glycopeptide containing bacteriocins named glycocins in
Firmicutes [15, 92].
There is one model glycopeptide bacteriocin, sublancin 168 (Table 2), produced by
B. subtilis with a β-S-linked glucose moiety attached to cysteine22 and two
disulfides [92-95]. The sublancin 168 biosynthetic gene cluster contains the
precursor gene sunA coding a 56-residue polypeptide consisting of a 19-residue
leader peptide and a 37-residue mature peptide and genes bdbA and bdbB encoding
two thiol-disulfide oxidoreductases, i.e. BdbA and BdbB [95, 96]. In addition, it
contains two open reading frames of unknown function, yolJ and yolF. YolF was
recently suggested to be important for immunity of the producing strain and was
renamed SunI; the function of YolJ has not yet been reported [97]. SunT is
responsible for transport. The antimicrobial activity spectrum of sublancin 168 was
like that of lantibiotics, inhibiting Gram-positive bacteria, but not Gram-negative
bacteria; and acts also similar to the lantibiotics nisin and subtilin in its ability to
inhibit both bacterial spore outgrowth and vegetative cell growth [17].
In addition to sublancin 168 found in B. subtilis, genome-mining study indicated
that 9 other putative gene clusters of glycocins were found in genomes of B.
thuringiensis, B. cereus, B. weihenstephanensis, B. lehensis, Bacillus sp.,
Geobacillus sp. and Paenibacillus sp., which need further characterization (Table 1
and Fig. 2).
Chapter 2
54
Subclass 7: Lasso peptides
Lasso peptides, which form an emerging class of RiPPs from bacteria, were first
described in 1991 [98]. Their defining structural feature is an N-terminal
macrolactam ring that is threaded by the C-terminal tail resulting in a unique lasso
structure - the so-called lariat knot. The ring is formed by an isopeptide bond
between the N-terminal α-amino group of a glycine, alanine, serine, or cysteine and
the carboxylic acid side chain of an aspartate or glutamate, which can be located at
positions 7, 8, or 9 of the amino acid sequence [16, 99].
In general, lasso peptide production requires at least three genes encoding a
precursor peptide A, a cysteine protease B, and an ATP-dependent lactam
synthetase C. Gene clusters might contain additional genes, but so far no system
was proven to be in need of an additional enzyme to produce mature lasso peptides
[100-104]. Microcin J25 produced by E. coli AY25 has served as a model for
studies of lasso peptides [105]. Known lasso peptides display antimicrobial activity
by enzyme inhibition [106, 107].
Genome mining of Bacillales indicated 48 gene clusters of hypothetical peptides,
which are likely lasso peptides in the genomes of 20 Bacillales species (Table 1
and Fig. 2), but these still need to be experimentally confirmed.
2.1.2. Class II: unmodified bacteriocins
Class II bacteriocins include small (less than 10 kDa), ribosomally synthesized,
heat-stable, membrane-active linear peptides [4, 108, 109]. According to genome
mining results, we found in total 121 putative gene clusters of class II bacteriocins
distributed over 16 species of Bacillales (Table 1 and Fig. 2). This class can be
subdivided into 2 subclasses: 1. Pediocin-like peptides; 2. Other unmodified
peptides (Table 2).
Antimicrobial Compounds of Bacillales Species
55
Subclass 1: Pediocin-like peptides
The pediocin-like bacteriocins are antilisterial peptides that have a YGNGVXC
consensus motif [110, 111]. Coagulin produced by B. coagulans I4 is a peptide of
44 residues has an amino acid sequence similar to that described for pediocins AcH
and PA-1 [109, 112]. Coagulin and pediocin differ only by a single amino acid at
their C-terminus (asparagine41threonine). Gene clusters of coagulin are located on
a plasmid including the structural gene coaA, immunity gene coaB, and ABC
transporter genes coaC and coaD [113].
Subclass 2: Other unmodified peptides
Subclass 2 includes other unmodified peptides, such as lichenin produced by B.
licheniformis, or cereins produced by B. cereus, which have already been described
in a previous review although not yet detected in the reported complete genome
sequences [4]. We found a lactobin A family protein [114] and a lactococcin A1
family protein [115] belonging to class II bacteriocins from Anoxybacillus
flavithermus WK1. Here, we mainly added some new members of Bacillus class II
bacteriocins detected by BAGEL3, in particular holins and holin-like peptide BhlA,
antimicrobial peptide LCI, and leaderless bacteriocin aureocin A53 (Table 2).
Analysis of all Bacillales genome sequences revealed the presence of a structural
gene encoding a holin in Geobacillus sp. WCH70 and BhlA encoding genes in
most of B. subtilis, B. amyloliquefaciens, B. mycoides, B. pseudomycoides, B.
licheniformis, B. pumilus and B. thuringiensis, and further structural analysis of
their sequence revealed features similar to holin (Table 2) [116, 117]. Holins are
phage-encoded proteins involved in the disruption of bacterial membrane to
facilitate the release of progeny phage particles [118-121]. However, the functions
of these specific ORFs have not yet been identified. The bacteriocin-related holin-
like peptide BhlA from Bacillus showed antibacterial activity against several
Chapter 2
56
Gram-positive bacteria, including MRSA and Micrococcus luteus by destroying
cell membranes [122]. BhlA consists of 70 amino acid residues with a single
transmembrane domain at the N-terminus, a number of highly charged amino acid
residues at the C-terminus. The presence of hydrophilic residues and the membrane
topology of BhlA make it different from holins [122].
The lci gene encoding LCI was found in the genomes of B. amyloliquefaciens and
B. methylotrophicus strains (Table 2), sharing 98%-100% identity with the LCI
sequence of B. subtilis. The antimicrobial peptide LCI was first identified and
isolated by Liu et al (1990) [123] from a B. subtilis strain named A014 that
possesses very strong antagonistic activity against the Gram-negative pathogen
Xanthomonas campestris pv oryzea causing rice leaf-blight disease, which is a
serious threat to rice production and causes great losses in yields in most rice fields
annually. LCI is a β-structure antimicrobial peptide containing 47 residues of 5460
Da with no disulfide bridge or circular structure. It also contains a hydrophobic
core formed by valine5, tyrosine41 and tryptophan44 as well as 23 H-bonds which
contribute to its considerable thermal stability [124, 125]. According to our
BAGEL3 gene cluster mining results, there are 2 genes: a structural gene lci and an
immunity/transporter-like gene which was still unknown. LCI’s positively charged
residues lead to a short-lived channel in the bacterial membrane of sensitive strains
[126].
Another new member of Bacillus class II bacteriocins is leaderless aureocin A53,
whose gene cluster was identified in the genome sequence of B. pumilus strains
(Table 2). It is active against L. monocytogenes by dissipating the membrane
potential and simultaneously stopped biosynthesis of DNA, polysaccharides, and
protein [127]. Aureocin A53 is a highly cationic 49-residue peptide containing six
lysine and four tryptophan residues. Unlike most class II bacteriocins, aureocin
A53 is synthesized without a leader peptide and retains a formylated N-terminus.
Antimicrobial Compounds of Bacillales Species
57
Notably, genes for biosynthetic enzymes, immunity functions, or regulation of
biosynthesis are not found in the vicinity of the aureocin A53 structural gene [128].
2.1.3. Class III: large antimicrobial proteins
This group includes large proteins (larger than 10 kDa) with antimicrobial activity.
Gene clusters of these proteins normally include an immunity gene and a structural
gene [126]. We found 24 putative gene clusters of class III bacteriocins distributed
over 7 species of Bacillales (Table 1 and Fig. 2). In a previous review, megacins
produced by B. megaterium ATCC 19213 were reported as class III bacteriocins [4,
129]. Here, we identified and introduced some class III bacteriocins by BAGEL3
respresented by colicin, M23 peptidase and pyocin AP41 (Table 2).
Gene clusters of colicins were identified in the genomes of B. thuringiensis, B.
cereus and Bacillus sp. BH072 (Table 2). Channel-forming colicins (colicins A, B,
E1, Ia, Ib, and N) are transmembrane proteins that depolarize the cytoplasmic
membrane, leading to dissipation of cellular energy. Their immunity gene is often
produced constitutively, while the bacteriocin release protein is generally produced
only as a read-through of the stop codon on the colicin structural gene. The colicin
itself is repressed by the SOS response and may be regulated in other ways, as well
[130]. Pyocin AP41 is also discovered as a large bacteriocin from B. thuringiensis
(Table 2), which was first isolated from Pseudomonas aeruginosa PAF41.
According to literature, it showed a similar mode of action to that of colicin [131].
Interestingly, we found gene clusters of M23 peptidase in the genomes of B.
thuringiensis, B. coagulans and B. halodurans (Table 2), while M23 peptidase has
not been reported to be secreted by Bacillus before, and so needs to be further
experimentally confirmed. Over the past years, many members of the M23
metallopeptidase family have been identified and biochemically characterized.
Structures have been determined for some of them, e.g. LytM, LasA and recently
lysostaphin, a prototypic enzyme of the M23B group and the best-studied
Chapter 2
58
bacteriocin of this group [132, 133].
2.2. Non-ribosomal synthesized peptides (NRPs) and polyketides (PKs) of
Bacillales
NRPs and PKs encompass a variety of linear, cyclic and branched structures, which
are generated by complex enzymes known as non-ribosomal peptide synthetases
(NRPS), polyketide synthetases (PKS) and hybrid NRPS/PKS, respectively [134,
135]. Among them, NRPs produced by Bacillales include lipopeptides (LPs) and
others, with significant antimicrobial activity [136]. Here we present an extended
collection based on members described in a previous review by Aleti et al (2015)
[136]. By use of antiSMASH, we identified 31 types of putative NRPs, PKs and
NRPS/PKS hybrid synthesized antimicrobials, which will be described in detail
below. Characteristics of them are listed in Table 3 by displaying their chemical
structures, gene clusters and predicted producer species, respectively.
2.2.1. Lipopeptides (LPs)
Lipopeptides (LPs) are natural compounds of bacterial origin consisting of a
hydrophobic long alkyl chain linked to a hydrophilic polypeptide to form a cyclic
or linear structure [137]. According to our mining results, B. amyloliquefaciens, B.
methylotrophicus, B. atrophaeus, B. subtilis, B. licheniformis, B. paralicheniformis,
B. pumilus, B. lehensis, B. laterosporus, Bacillus sp., P. polymyxa, P. larvae, P.
mucilaginosus, P. peoriae, P. bovis, Paenibacillus terrae and Paenibacillus sp. are
likely to be the main producers of LPs, which are mainly known for their
antifungal properties [138-140]. Based on a previous genome mining work (see
review Aleti et al 2015), we identified locillomycins as novel members of LPs in
species of Bacillales (Table 3).
Traditional LPs (comprising the surfactins, iturins and fengycins) from Bacillus are
homologues differing in length, branching, and saturation of their acyl chain. The
Antimicrobial Compounds of Bacillales Species
59
surfactin family (exemplified by surfactin, lichenysins and pumilacidins) contain a
cyclic heptapeptide that forms a lactone bridge with ß hydroxy fatty acids [141].
The iturin group includes A, C, D and E isoforms, bacillomycin D, F and L and
mycosubtilin. All these compounds contain a cyclic heptapeptide acylated with ß
amino fatty acids [142, 143]. The fengycin family comprises the decapeptide
fengycin A and fengycin B, which differ in a single amino acid at the sixth position
(D-alanine and D-valine, respectively) [144]. Kurstakins form another family of
LPs composed of four partially cyclic heptalipopeptides, which differ only in their
fatty acid chains [145]. The gene clusters of the Bacillus LPs encoding the
surfactin, fengycin, iturin and kurstakin families have been described and
summarized in a number of recent reviews [6, 11, 136, 145]. Cerexins are linear
LPs with strong antimicrobial activity against S. aureus and Streptococcus
pneumoniae [146]. Kurstakins and cerexins are isolated and identified from B.
thuringiensis and B. cereus strains before, respectively [146, 147]. Locillomycins
(locillomycin A, B, and C derivatives), a novel family of cyclic lipopeptides active
against bacteria and viruses produced by B. subtilis 916 [148, 149], include a
unique nonapeptide sequence and macrocyclization. The locillomycin biosynthetic
gene cluster encodes 4 proteins (LocA, LocB, LocC, and LocD) that form a
hexamodular NRPS to biosynthesize cyclic nonapeptides.
Paenibacillus now are found to produce a large number of LPs [136]. Polymyxins
are cyclic cationic LPs which contain the non-proteogenic amino acid 2, 4-
diaminobutyric acid contributing to the overall positive charge of the cationic LPs,
exhibiting antibacterial activity against both Gram-positive and Gram-negative
bacteria by acting on their membranes. The gene cluster consists of five genes, of
which pmxA, B and E encode the polymyxin synthetase, whereas pmxC and D are
involved in transport [136, 150]. Another cationic lipopeptide, paenibacterin is a
new broad-spectrum antimicrobial agent consisting of a cyclic 13-residue peptide
and an N-terminal C15 fatty acyl chain [151]. There are also cyclic noncationic
Chapter 2
60
LPs from Paenibacillus comprising fusaricidins containing a cyclic hexapeptide
structure with antagonistic activity against Fusarium oxysporum, tridecaptins with
strong antimicrobial activity against Gram-negative bacteria. Polypeptins,
octapeptins, pelgipeptins, gavaserin and saltavalin are LPs isolated from
Paenibacillus sp. strains, reported before by other scientists, and should also be
included in this collection [136, 152-155].
2.2.2. Other NRPs
By antiSMASH, we also found non-lipopeptide but NRPSs gene clusters putatively
encoding NRPs with antimicrobial activity mainly in the species of Bacillus,
Paenibacillus and Brevibacilllus. We collected them as a group of other NRPs,
which is exemplified by the following NRPs (Table 3).
The non-ribosomal dodecapeptide bacitracin, released by some B. licheniformis
and B. subtilis strains, proved to be an inhibitor of cell wall biosynthesis of Gram-
positive bacteria [156, 157]. Small peptide bacilysin secreted by B. subtilis, B.
amyloliquefaciens and B. pumilus contains an N-terminal alanine residue and L-
anticapsin with antibacterial activity against S. aureus [158]. B. subtilis also
produces rhizocticins, phosphonate oligopeptide antibiotics containing the C-
terminal non-proteinogenic amino acid (Z)-1-2-amino-5-phosphono-3-pentenoic
acid displaying antifungal activity [159]. Petrobactin and bacillibactin produced by
several Bacillus strains under iron-limited conditions, are catecholate siderophores
associated with two operons, asb (for petrobactin) and bac (for bacillibactin) [160].
Sevadicin is a tripeptide (D-phenylalanine-D-alanine-tryptophan) produced by a
NRPS encoded by a gene cluster found in the genome of P. larvae, which was
shown to have antibacterial activity [161].
Both the cyclic peptides gramicidin S and tyrocidine, produced by Brevisbacillus,
consist of 10 amino acid residues [162]. Gramicidin S consists of 2 identical
Antimicrobial Compounds of Bacillales Species
61
pentapeptides, which are linked head to tail, and together form the stable
amphiphilic cyclic decapeptide. The first amino acid residue of the 2 pentapeptides
is in the D-configuration [163]. The peptide exhibits strong antibacterial and
antifungal activity [164]. Tyrocidine, actually a mixture of slightly different
decapeptides, is active against several Gram-positive bacteria and it has been
suggested that this peptide plays a role in the regulation of sporulation of B. brevis
[162]. The gramicidin S biosynthesis operon (grs) contains 3 genes, which are
grsA, encoding the gramicidin S synthetase 1; grsB, encoding the gramicidin S
synthetase 2, and grsT, encoding a protein of unknown function. The sequence of
the grsA gene product showed a high similarity with the tyrocidine synthetase 1
(TycA protein) [165, 166].
2.2.3. Polyketides (PKs)
Polyketides represent a group of secondary metabolites, exhibiting remarkable
diversity both in terms of their structure and function. Polyketide natural products
are known to possess a wealth of pharmacologically important activities, including
antimicrobial, antifungal, antiparasitic, antitumor and agrochemical properties
(http://www.nii.ac.in/~pksdb/polyketide.html). Novel gene clusters likely encoding
similar PKSs were identified using antiSMASH. They were most prominent in B.
subtilis, B. amyloliquefaciens, B. methylotrophicus, B. atrophaeus, B. laterosporus
and Paenibacillus sp. (Table 3 and Fig. 2). The genus Bacillus produces 3 types of
PKs including bacillaene, difficidin and macrolactin; Paenibacillus produces
paenimacrolidin [6, 167]. B. laterosporus also produced the polyketide
basiliskamide with antifungal activity [168], and it was added as a novel member
of PKs in species of Bacillales (Table 3).
Bacillaene was first isolated from B. subtilis strains [169], are found to display a
linear structure comprising a conjugated hexane, while its gene clusters bae (baeJ,
L, M, N and R) has now been discovered in several other Bacillus genomes,
Chapter 2
62
including B. amyloliquefaciens, B. atrophaeus and P. polymyxa. It is an inhibitor of
prokaryotic protein synthesis, constituted by an open-chain enamine acid with an
extended polyene system and shows good antimicrobial activity against human
pathogens such as Serratia marcescens, Klebsiella pneumoniae and S. aureus [37,
169, 170]. Difficidin is known to be produced by B. amyloliquefaciens strains,
which is active against the phytopathogen Erwinia amylovora causing fire blight,
and contains a highly unsaturated macrocyclic polyene comprising a 22 membered
carbon skeleton with a phosphate group rarely found in secondary metabolites
[171]. Difficidin is encoded by the gene cluster dif with 14 open reading frames
from difA to difN and difY. The contribution of the genes difJ and difK are unclear
and their potential activities are not seen in the final product [172]. Macrolactin has
also been isolated from B. amyloliquefaciens strains [173]. Most macrolactins
consist of a 24 membered lactone ring with three diene moieties in the carbon
backbone, which is encoded by the gene cluster mln, containing nine operons
including mlnA-I [174]. As the other Bacillus polyketides, macrolactins show
antibacterial activity and might have the potential to be used in medical
application. Moreover, they could inhibit the proliferation of murine melanoma
cancer cells and the replication of mammalian Herpes simplex virus and HIV in
lymphoblast cells [136, 173]. Paenimacrolidin was isolated from Paenibacillus sp.
F6-B70 with a 22 membered lactone ring showed high similarity with difficidin,
which has antimicrobial activity against Staphylococcus [167]. The polyketide
antibiotics basiliskamides A and B, which exhibit potent activity against Candida
albicans and Aspergillus fumigatus, both comprise a 21 membered carbon skeleton,
structurally identical in every respect, except for the position of the cinnamate
ester: C9 in basiliskamide A and C7 in basiliskamide B [175, 176].
2.2.4. NRPS/PKS hybrid synthesized compounds
There are 3 NRPS/PKS hybrid synthesized NRPs or PKs of Bacillales identified in
this study (Table 3). Paenilarvins are iturinic LPs exhibiting strong antifungal
Antimicrobial Compounds of Bacillales Species
63
activities [177-180]. Paenilarvin A and B were first isolated from P. larve strain,
whose NRPS gene clusters showed similarities with those of the iturin family LPs
[180]. Zwittermicin A is also a hybrid polyketide-nonribosomal peptide produced
by certain B. cereus group strains, inhibiting certain Gram-positive, Gram-
negative, and eukaryotic microorganisms [181, 182]. Paenilamicin is another
hybrid NRPS/PKS synthesized peptide with antibacterial and antifungal activity,
whose encoded gene clusters (pam) were found the genomic sequence of the Gram-
positive bacterium P. larvae [183].
In this study, 10 novel gene clusters encoding putative NRPs, PKs or NRPS/PKS
hybrids were predicted from the genome of B. brevis NBRC 100599, B. cereus
AH820, B. cereus G9842, B. cereus B4264, B. cereus E33L, B. thuringiensis
HD771, B. thuringiensis HD789, B. amyloliquefaciens DSM7, B.
amyloliquefaciens CC178, B. methylotrophicus NAU-B3, B. anthracis str. A0248,
B. anthracis str. H9401 and Bacillus sp. BH072. The identified gene clusters
(uncharacterized) show limited homology with gene clusters in the integrated
databases. Related genes encoding the biosynthesis, predicted structures and
antimicrobial activity of these compounds deserve to be experimentally validated.
Chapter 2
64
Table 1. Number of putative antimicrobial gene clusters identified in 328 Bacillales genomes (reported in Genbank)
Class RPs* RPs RPs RPs RPs RPs RPs RPs RPs RPs RPs NRPs PKs
I I I I I I I I II III TOT
AL
Genera Lanthipeptides
type I
Lanthipeptides
type II
Head to
tail
cyclized
peptides
Sacti-
peptides
Glyco-
cins
Lasso
peptides
LAPs Thio
pepti
des
Bacillus subtilis (39) 6 53 15 1 1 8 84 168 66
Bacillus thuringiensis
(46)
4 8 6 5 3 4 24 31 14 99 152
Bacillus anthracis (39) 25 25 117
Bacillus cereus (55) 1 16 11 4 1 9 34 3 22 4 105 144 1
Bacillus
amyloliquefaciens (13)
16 1 12 1 30 59 48
Bacillus licheniformis (3) 1 3 4 6 3
Bacillus coagulans (5) 6 1 7
Bacillus megaterium (5) 1 1 2 5 5
Bacillus pumilus (8) 8 2 14 24 17 8
Bacillus atrophaeus (4) 5 4 9 20 8
Bacillus
weihenstephanensis (2)
1 1 2 8
Bacillus mycoides (5) 2 4 5 5 4 20 14
Bacillus cytotoxicus (1) 1 1
Antimicrobial Compounds of Bacillales Species
65
Bacillus clausii (2) 1 2 3 2
Bacillus halodurans (1) 2 1 3
Bacillus cellulosilyticus
(1)
Bacillus infantis (1)
Bacillus selenitireducens
(1)
Bacillus methylotrophicus
(15)
7 4 15 26 68 58
Bacillus
paralicheniformis (3)
3 3 3 9 12 2
Bacillus methanolicus (1) 1 1 1
Bacillus endophyticus (1) 2 1 1 4 2 1
Bacillus smithii (1) 1 1 1
Bacillus pseudomycoides
(1)
1 1 1 1 4 3
Bacillus pseudofirmus (1) 1 1
Bacillus bombysepticus
(1)
4
Bacillus lehensis (1) 1 1 4
Bacillus toyonensis (1) 1 1 1 3 3
Bacillus gobiensis (1) 1 1 2 2 1
Bacillus sp. (13) 3 1 3 5 1 1 2 6 2 24 36 24
Kyrpidia tusciae (1) 3 3 1
Alicyclobacillus
Chapter 2
66
acidocaldarius (2)
Anoxybacillus
flavithermus (1)
2 2 1
Geobacillus
stearothermophilus (2)
1 1 1 3 2
Geobacillus
thermodenitrificans (1)
1 1 2 1
Geobacilllus kaustophilus
(1)
1 1 2 1
Geobacillus sp. (9) 5 1 2 1 9 3 6
Lysinibacillus sphaericus
(1)
1 1 3 1
Lysinibacillus fusiformis
(1)
1 1
Brevibacillus
laterosporus (1)
1 1 1 3 5
Brevibacillus brevis (1) 1 1 2 3 3
Paenibacillus polymyxa
(7)
11 3 7 21 39 7
Paenibacillus larvae (1) 1 2 2 1 1 7 4
Paenibacillus
mucilaginosus (3)
2 3 5 10 4
Paenibacillus peoriae (1) 1 1 2 6
Paenibacillus odorifer (1) 1 1 1
Paenibacillus stellifer (1) 1 1 1
Paenibacillus borealis (1) 1 1 1 2
Antimicrobial Compounds of Bacillales Species
67
Paenibacillus bovis (1) 1 1 4
Paenibacillus
naphthalenovorans (1)
1 1 1
Paenibacillus beijingensis
(1)
1
Paenibacillus graminis
(1)
1 1 4
Paenibacillus durus (2) 1 3 2 1 7 4 1
Paenibacillus terrae (1) 1 1 3
Paenibacilllus
riograndensis (1)
1 1 4
Paenibacillus sabinae (1) 1 1 1
Paenibacillus sp. (12) 3 3 1 3 1 11 22 6
TOTAL 34 71 52 87 24 48 117 5 121 24 583 964 267
Numbers in parentheses () indicate the number of genomes analyzed per genus.*RPs is short for ribosomally synthesized peptides.
Chapter 2
68
Table 2. Characteristics of ribosomally synthesized antimicrobial peptides of Bacillales
Name Precursor sequence (core peptide in
bold) Gene cluster*
Predicted
producer species
Examples
Classification Class I small RiPPs Subclass 1 Lanthipeptides Lanthipeptides class I
Subtilin MSKFDDFDLDVVKVSKQDSKI
TPQWKSESLCTPGCVTGALQ
TCFLQTLTCNCKISK
Bacillus subtilis,
Bacillus sp.
26, Bacillus sp. YP1
Ericin A MTNMSKFDDFDLDVVKVSKQ
DSKITPQVLSKSLCTPGCITGP
LQTCYLCFPTFAKC
B. subtilis
46
Ericin S MSKFDDFDLDVVKVSKQDSKI
TPQWKSESLCTPGCVTGVLQ
TCFLQTITCNCHISK
B. subtilis
46
Entianin MSKFDDFDLDVVKVSKQDSKI
TPQWKSESLCTPGCVTGLLQT
CFLQTITCNCKISK
B. subtilis 45
Subtilomyc
in
MEKNNIFDLDINKKMESTSEVS
AQTWATIGKTIVQSVKKCRTF
TCGCSLGSCSNCN
B. subtilis 42, B. subtilis OH 311
Paenibacilli
n
MKVDQMFDLDLRKSYEASELS
PQASIIKTTIKVSKAVCKTLTC
ICTGSCSNCK
Paenibacillus
polymyxa
43
Thuricin
4A
MNKELFDLDINKKMETPTEMT
AQTWTTIVKVSKAVCKTGTCI
Bacillus
thuringiensis
47
Antimicrobial Compounds of Bacillales Species
69
CTTSCSNCK
Clausin MEKAFDLDLEVVHTKAKDVQP
DFTSVSFCTPGCGETGSFNSF
CC
Bacillus clausii 41, B. clausii ENTPro
Paenicidin
A
MAENLFDLDIQVNKSQGSVEPQ
VLSIVACSSGCGSGKTAASCV
ETCGNRCFTNVGSLC
P. polymyxa,
Paenibacillus
terrae
44
Paenicidin
B
MANNLFDLDVQVNKSQGSVEP
QVLSIVACSSGCGSGKTAASC
VATCGNKCFTNVGSLC
P. polymyxa,
P. terrae,
Paenibacillus sp.
44
Geobacillin
I
MAKFDDFDLDIVVKKQDDVVQ
PNVTSKSLCTGCITGVLMCLT
QNSCVSCNSCIRC
Geobacillus
thermodenitrifica
ns
22, G. thermodenitrificans
NG80-2
Galidermin/
Nisin like
lantibiotic
MINEKNLFDLDVQTTASGDVDP
QITSISACTPGCGNTGSFNSFC
C
Bacillus
mycoides,
Bacillus cereus
B. mycoides ATCC 6462, B.
mycoides 2048, B. cereus
AH1272
Subtilin
like
lantibiotic
MKNQFDLDLQVAKNEVAPKG
VQPASGIICTPSCATGTLNCQ
VSLTFCKTC
P. polymyxa P. polymyxa SQR 21, P.
polymyxa CF05, P.
polymyxa CR1, P.
Polymyxa E681, P.
polymyxa M1, P. polymyxa
SC2
Subtilin
like
lantibiotic
MKNQFDLDLQVTKSESASKEL
QADSGIICTPTCLTSILNCYTSI
SHCGPC
P. polymyxa P. polymyxa M1, P.
polymyxa SC2
Classification Class I small RiPPs Subclass 1 Lanthipeptides Lanthipeptides class II
Chapter 2
70
Mersacidin MSQEAIIRSWKDPFSRENSTQN
PAGNPFSELKEAQMDKLVGAG
DMEAACTFTLPGGGGVCTLT
SECIC
Bacillus
amyloliquefaciens
,
Bacillus sp.
32, 33, 34, Bacillus sp.
BH072
Amylolysin MNEKMYRFAGDLREELEEISLS
EFSGGGGAEQRGISQGNDGKL
CTLTWECGLCPTHTCWC
B.
amyloliquefaciens
,
Bacillus
methylotrophicus
50, B. methylotrophicus
B25, B. methylotrophicus
NJN-6, B.
amyloliquefaciens LH15, B.
amyloliquefaciens LS60
Pseudomyc
oicidin
MNDKIIQYWNDPAKRSTLSAAE
LSKMPVNPAGDILAELSDADLD
KVVGAGDCGGTCTWTKDCSI
CPSWSCWSWSC
Bacillus
pseudomycoides
51, B. pseudomycoides
DSM 12442
Cerecidins MSKGYKFTKEELVEAWKDPQV
REKLNDLPKHPSGKALNELSEE
ELAEIQGASDVQPETTPLCVG
VIIGLTTSIKICK
B. cereus 52
Geobacillin
II
MKGGIQMEKQEQTFVSKISEEE
LKKLAGGYTEVSPQSTIVCVSL
RICNWSLRFPSFKVRCPM
G.
thermodenitrifica
ns
22, G. thermodenitrificans
NG80-2
Lichenicidi
n
A1:MSKKEMILSWKNPMYRTES
SYHPAGNILKELQEEEQHSIAG
GTITLSTCAILSKPLGNNGYLC
TVTKECMPSCN
A2:MKTMKNSAAREAFKGANH
PAGMVSEEELKALVGGNDVNP
Bacillus
licheniformis
21, B. licheniformis WX-02
Antimicrobial Compounds of Bacillales Species
71
ETTPATTSSWTCITAGVTVSAS
LCPTTKCTSRC
Haloduraci
n
A1:MTNLLKEWKMPLERTHNNS
NPAGDIFQELEDQDILAGVNGA
CAWYNISCRLGNKGAYCTLT
VECMPSCN
A2:MVNSKDLRNPEFRKAQGLQ
FVDEVNEKELSSLAGSGDVHA
QTTWPCATVGVSVALCPTTK
CTSQC
Bacillus
halodurans
19, B. halodurans C-125
Cytolysin/
Lichenicidi
n/
Haloduraci
n like
lantibiotic
A1:MSSKKVVESWKNPVLRSKN
EDAPSHPAGEVDSKEIKELFGA
GEGDVTPEGLSSWLGNKGGY
CTLTKECMPSCN
A2:MSKNEKLNKLRDQEFDTKE
LIGSVDENDLKQVAGAGDVNP
ETTPATPTIVAVSLGICPTTKC
TSKC
B. cereus B. cereus Q1
Classification Class I small RiPPs Subclass 2 Head to tail cyclized peptides
Amylocycli
cin
MMNLVKSNKKSFILFGAALAA
ATLVYALLLTGTELNVAAAHA
FSANAELASTLGISTAAAKKAI
DIIDAASTIASIISLIGIVTGAGA
ISYAIVATAKTMIKKYGKKYA
AAW
B.
methylotrophicus
59, B. methylotrophicus
FZB42
Chapter 2
72
Amylocycli
cin like
circular
bacteriocin
MVNSLSNKKRVFLFVVIGLVLA
TLSSVAYISTLQITIHQTAVLPG
NAYLASTLGISTAAAKKAIDII
DTASTIASIISLIGVVTGAGAIS
YAVVATAKAMIKKYGKKYAA
AW
Bacillus
coagulans
B. coagulans HM08
Uberolysin
like circular
bacteriocin
MLEAMGFFGVGKTLATQIVN
VVDAVGYAAIAVSTIMAILSA
GGLAPTAAAIDFAIIYIKKKIA
NNLKAQAIVW
Bacillus sp. Bacillus sp. 1NAL3E
Circularin
A/
Bacteriocin
AS-48 like
circular
bacteriocin
MSLLALVAGTLGVSQSIATTV
VSIVLTGSTLISIILGITAILSGG
VDAILEIGWSAFVATVKKIVA
ERGKAAAIAW
Geobacillus
stearothermophilu
s,
Geobacillus
kaustophilus,
Geobacillus sp.
G. stearothermophilus 10,
G. kaustophilus HTA426,
Geobacillus sp. C56T3,
Geobacillus sp. LC300
Classification Class I small RiPPs Subclass 3 Sactipeptides
Subtilosin
A
MKKAVIVENKGCATCSIGAAC
LVDGPIPDFEIAGATGLFGLW
G
B. subtilis,
Bacillus
atrophaeus,
Bacillus smithii,
Bacillus sp.
67, B. atrophaeus subsp.
globigii BSS, B. atrophaeus
1942, B. atrophaeus NRS
1221A, B. atrophaeus
UCMB-5137, B. smithii
DSM 4216, Bacillus sp. JS,
Bacillus sp. YP1, Bacillus
sp. BS34A, Bacillus sp. LM
4-2
Antimicrobial Compounds of Bacillales Species
73
SKF MKRNQKEWESVSKKGLMKPG
GTSIVKAAGCMGCWASKSIA
MTRVCALPHPAMRAI
B. subtilis,
Bacillus pumilus,
B. atrophaeus,
Bacillus sp.
74, B. pumilus NJ-M2, B.
pumilus NJ-V2, B.
atrophaeus UCMB-5137
Thuricin
H(17)
METPVVQPRDWTCWSCLVCA
ACSVELLNLVTAATGASTAS
B. thuringiensis,
B. cereus
75, B. cereus Rock4-2
Thuricin
CD
α:MEVMNNALITKVDEEIGGNA
ACVIGCIGSCVISEGIGSLVGTAF
TLGGNAACVIGCIGSCVISEGI
GSLVGTAFTLG
β:MEVLNKQNVNIIPESEEVGG
WVACVGACGTVCLASGGVGTE
FAAASYFLGWVACVGACGTV
CLASGGVGTEFAAASYFL
B. thuringiensis,
B. cereus
77, B. cereus 95-8201
Classification Class I small RiPPs Subclass 4 LAPs
Plantazolici
n
MTQIKVPTALIASVHGEGQHLF
EPMAARCTCTTIISSSSTF
B. subtilis,
B.
amyloliquefaciens
,
B.
methylotrophicus,
Bacillus sp.
80, B. subtilis B1, B.
amyloliquefaciens CC178,
B. methylotrophicus JJ-D34,
B. methylotrophicus FZB42,
B. methylotrophicus CAU
B946, B. methylotrophicus
UCMB5036, Bacillus sp.
WP8
Classification Class I small RiPPs Subsclass 5 Thiopeptides
Chapter 2
74
Thiocillin MSEIKKALNTLEIEDFDAIEMV
DVDAMPENEALEIMGASCTTC
VCTCSCCTT
B. cereus 91
Classification Class I small RiPPs Subclass 6 Glycocins
Sublancin
168
MEKLFKEVKLEELENQKGSGL
GKAQCAALWLQCASGGTIGC
GGGAVACQNYRQFCR
B. subtilis,
Bacillus sp.
92, Bacillus sp. BS34A
Classification Class II unmodified bacteriocins Subclass1 Pediocin-like peptides
Coagulin MKKIEKLTEKEMANIIGGKYYG
NGVTCGKHSCSVDWGKATTC
IINNGAMAWATGGHQGTHKC
B. coagulans 109
Classification Class II unmodified bacteriocins Subclass 2 Other unmodified peptides
Lichenin ISLEICXIFHDN - B. licheniformis 4
Cerein MENLQMLTEEELMEIEGGGW
WNSWGKCVAGTIGGAGTGG
LGGAAAGSAVPVIGTGIGGAI
GGVSGGLTGAATFC
-
B. cereus 4
Lactobin A
family
protein
MEGVVFTMELMLEKNGSISFLS
EEELKEIDGGRGSWTNAVIGAG
TLSPIVASAVRGAQQGVRFGRL
GGPWGVVAGAVVGAVVGGYL
GYDG
Anoxybacillus
flavithermus
A. flavithermus WK1
Lactococin
A1 family
protein
MFQELNHVELQGIDGGSWKSH
VVNLVGVVSGFGTTGAVIGGSF
GGPLGAAAGGFVGAHYGAVA
A. flavithermus A. flavithermus WK1
Antimicrobial Compounds of Bacillales Species
75
YAIGVLLDSSNRRK
Holin MDLTSIPIEQFVSNGVFALLFV
WLLVDTRKESKQREEKLIQQIE
KQNEAQERIVQAIERIEQKIEKL
EVSMNG
Geobacillus sp. Geobacillus sp. WCH70
BhlA MEMDISQYLITQGPFAVLFCWL
LFYVMKTSKERESKLYDQIDSQ
NEVLGKFSEKYDVVIEKLDKIE
SKVQ/MEEQIFNSMIQQGAFAA
LFVWMLFTTQKKNEQREEQYQ
KVIEKNQDVITKQAEAFGDLSK
DVSEIKQKILGSGDVQ/MEVDV
VQNLMTQGPFAVLFCWILFYVL
NTTKERENKLNEQIEAQNDVLA
KFSEKYDVVIDKLDKIERNLK
B. subtilis,
B. thuringiensis,
B. pumilus,
B. mycoides,
B.
pseudomycoides,
B.
amyloliquefaciens
B. subtilis T30, B. subtilis
subsp. inaquosorum, B.
subtilis subsp. spizizenii
NRS 231, B. thuringiensis
Bt407, B. thuringiensis
HD1002, B. thuringiensis
IBL4222, B. thuringiensis
serovar berliner ATCC
10792, B. thuringiensis
serovar thuringiensis str.
T01001, all B. pumilus in
this study, B. mycoides
Rock1-4, B. mycoides
219298, B. mycoides
Rock3-17, B.
pseudomycoides DSM
12442, B. amyloliquefaciens
DSM 7, B.
amyloliquefaciens XH7, B.
amyloliquefaciens
Chapter 2
76
MBE1283
LCI MKFKKVLTGSALSLALLMSAA
PAFAASPTASASAENSPISTKAD
AGINAIKLVQSPNGNFAASFVL
DGTTWIFKSKYYDSSKGYWV
GIYESVDK
B. subtilis,
B.
amyloliquefaciens
,
B.
methylotrophicus,
Bacillus sp.
123, B. amyloliquefaciens
IT-45, B. amyloliquefaciens
Y2, B. amyloliquefaciens
CC178, B.
amyloliquefaciens LFB112,
B. amyloliquefaciens L-
H15, B. amyloliquefaciens
KHG19, B.
amyloliquefaciens L-S60, B.
amyloliquefaciens G341, B.
amyloliquefaciens
MBE1283, all B.
Methylotrophicus in this
study, Bacillus sp. BH072
Aureocin
A53
MVAFLKLVAQLGTKAAKWAW
DNKSTVINWIKNGATFQWISDK
IDSIING
B. pumilus B. pumilus W3, B. pumilus
GR-8, B. pumilus TUAT1
Classification Class III large antimicrobial proteins
Antimicrobial Compounds of Bacillales Species
77
Colicin MSLNMYLGQVKAQTESMNAF
CNATIQGMEQIIHSINAFALDTV
LQGQTYSSAKAYFLQTFRPLAQ
GIIYLCEELIRQNDAFPRDFQSQ
VASTDVIEQEILEQIREIDRMIAS
TEALNQTMPIPGMDAMVNLFT
VMRQKLQEKLEHLYEFNYTSS
NNYDTALQLAASIATGLAEVQS
GKGFSPASGTFSTQGLNMEWT
GPIQAITEEKKRKADHLIKDGE
MCGRLEETSAIKKAWGDKVDS
VVEMFETVKKIWNGTVIGTGKS
VEDAIKSMETLSNMNIRNMDIE
TFINVTYAILHLDETAKNMWHT
FSSTVKRDMINGDAESRTQWIT
YALTQIGIGLIADKGLGRAGLVI
KGVKASSGASTLTKGVTLIKEM
KHASEILQSFKKDVSYAFSGGTI
ITKIPQSELNQAYYNFAKTTISS
AQKRNSPGTVTSSFNLERSLGT
QKKLMYNKGSIGVIPQEIRNKLI
GKNFNSFDDFRKEFWKTVADS
DYATEFNQRNINLMKEGKAPF
APLSEKYGQHNQYILHHKQPIH
QGGDVYNLDNLIIVSPKMHQN
VLDRSYHFGKKG
B. thuringiensis,
B. cereus,
Bacillus sp.
B. thuringiensis IBL-200, B.
thuringiensis serovar
morrisoni BGSC 4AA1, B.
thuringiensis HD-771, B.
thuringiensis serovar sotto
str T04001, B. thuringiensis
serovar huazhongensis
BGSC 4BD1, B. cereus
FORC-005, B. cereus
m1550, Bacillus sp. BH072
Chapter 2
78
Pyocin
AP41
MGQVRVDPDKLESAANSMSRN
RESMESIIRELLQVTFELQMSWE
GMAYQRFFDEFFSKKRSMDDL
VKHLHHTELELKKAAKTFREA
DEKAFGDFNQMGKLWDAFQR
GSGKAAGDTIFDPLKKGWNQT
SDFFGNLVDNPMDALEDAKYG
LTDFVESSIDDTKEEFRDKYEF
MKDMWNNPIGTLKHELDEEVQ
EMYAIRNVLSDWYVENIKYGD
AESITESVAYGATNLAFFGLVT
RGASAVGNGARWGKNLSSISK
LQLENRLEPAFAYGKIDYKVDT
IKPSDTYMFAKTSSAVKRKTPG
TVTSSFNLERSLGTQKKLMYND
GAIGIIPQEVREKLVGREFKSFD
DFREEFWKTLSDSSYAKEFSPM
NIKLMKQGKAPYSPRAEHYGN
HNKYILHHKQPIDKGGDVYNL
DNLIIVSPKMHQNVLDPAYHFG
TKGL
B. thuringiensis B. thuringiensis serovar
thuringiensis str. IS5056, B.
thuringiensis serovar
chinensis CT-43
M23
Peptidase
MKKRSILPAAVVCTLSLGGLFG
YQSNASAAGDLQQKKSEIESKL
SNVQSEMDKKDNQISNIQDKQ
ASLGSQLEAIESKIQSANKKISE
QEQNISTTKSQIADLKKNIAEIK
B. thuringiensis,
B. coagulans,
B. halodurans
B. thuringiensis HD-789, B.
thuringiensis IBL 4222, B.
coagulans 2-6, B.
halodurans C-125
Antimicrobial Compounds of Bacillales Species
79
KRIEDRNAILEDRARAMQKNG
GGSVNYLDVFLEAKSVGDFIDR
FSAVKTLVEADRQILEEQKKDE
QDLKDKQASVEKKLSDLESML
SDLQSLKDSLKQDESEKSALIK
QLDKQKDSLKEEKMSLSEQKSI
LADQKASIEKAIAFAKKQAEAR
KEAAAKADAAAKAQTNTNAG
STGSKAGTTSAASSASPSSGSHS
GGPLPEVSSGAFTRPASGYISSG
FGGRSGGFHPGVDIANSIGTPV
VAAADGVVFRAYRSSSYGNCV
MITHYINGKLYTTVYAHLSSYS
VSTGQHVSKGQQIGAMGNTGE
STGPHLHFEIYNGRWTPPPHAG
AQNPRNYVNF
Megacins MKDLNYGLEMIGVKNMWKHS
FLGEGVVVAVIDSGAEKEHPAI
HSNIIGGFNFTNDDGGEENKYID
YIGHGTHVAGIIAGYDRDLKKII
GVAPLAKLLILKIIDKDGQATID
NACKAIEYALNWRGENGEKVN
VMNMSFGTNKDNEHLKSLIKE
TYSENVIMVASSGNYGDGNAL
TNELLYPAYYKEVIEVGAVKQ
NFEIYDYSNSNDEIDFVAPGYKI
Bacillus
megaterium
129
Chapter 2
80
LSSYLNETYVKLSGTSMAAPHV
SGAMALLINKFQKEDKEINYKS
FYSYLRKDAKKLNYPITLQGHG
LIQFKNSKI
*Structural genes are indicated in black. The genes involved in maturation are indicated in gray. Genes coding for transport and
immunity proteins are indicated in white filled solid black box. The white and black grid denotes regulatory genes. The dotted black box
denotes gene functions not clearly conserved among the clusters or function unknown. “-” means lack of information. References
(presented as numbers) refer to examples of reported peptides and strains of predicted gene clusters in this study.
Antimicrobial Compounds of Bacillales Species
81
Table 3. Characteristics of NRPs, PKs and NRPS/PKS hybrid synthesized antimicrobials of Bacillales
Name Structure Gene cluster of NRPS/PKS* Predicted producer
species
Examples
Classification NRPs Lipopeptides
Surfactins
(e.g.
surfactin)
Bacillus subtilis,
Bacillus
amyloliquefaciens,
Bacillus
methylotrophicus,
Bacillus
licheniformis,
Bacillus
paralicheniformis,
Bacillus pumilus,
Bacillus atrophaeus,
Bacillus sp.
141, most of the predicted
species strains in this
study
Iturins
(e.g. iturinA)
B. atrophaeus,
Bacillus lehensis,
Bacillus sp.,
Paenibacillus
polymyxa
142, all B. atrophaeus
strains in this study, B.
lehensis G1, Bacillus sp.
BH072, P. polymyxa Sb3-
1, P. polymyxa M1, P.
polymyxa CF05, P.
polymyxa SC2
Chapter 2
82
Fengycins
(e.g.
fengycin)
B. subtilis,
B. amyloliquefaciens,
B. methylotrophicus,
B. paralicheniformis,
Bacillus sp.
144, most of the predicted
species strains in this
study
Kustakins
(e.g.
kurstakin)
Bacillus thuringiensis 147
Cerexins
(e.g. cerexin
B)
- Bacillus cereus 146
Locillomycin
s
(e.g.
locillomycin)
B. subtilis,
B. amyloliquefaciens,
B. methylotrophicus,
Paenibacillus
mucilaginosus
149, B. subtilis subsp.
inaquosorum, B.
amyloliquefaciens
LFB112, B.
methylotrophicus NJN-6,
P. mucilaginosus
KNP414, P.
mucilaginosus K02
Polymyxins
(e.g.
polymyxin A)
P. polymyxa,
Paenibacillus peoriae
150, P. polymyxa SQR-
21, P. polymyxa Sb3-1, P.
polymyxa M1, P.
polymyxa E681, P.
polymyxa SC2, P. peoriae
HS311
Antimicrobial Compounds of Bacillales Species
83
Paenibacterin Brevibacillus
laterosporus,
P. mucilaginosus,
P. peoriae,
Paenibacillus terrae,
Paenibacillus sp.
151, B. laterosporus LMG
15441, P. mucilaginosus
KNP414, P.
mucilaginosus 3016, P.
peoriae HS311, P. terrae
HPL-003, Paenibacillus
sp. FSL H7-0357
Fusaricidins
(e.g.
fusaricidin
C)
P. polymyxa,
P. peoriae,
Paenibacillus bovis,
Paenibacillus sp.
136, P. polymyxa SQR-
21, P. polymyxa Sb3-1, P.
polymyxa M1, P.
polymyxa E681, P.
polymyxa SC2, P.
polymyxa CF05, P.
peoriae HS311, P. bovis
BD3526, Paenibacillus
sp. IHB B 3084
Tridecaptins
(e.g.
tridecaptin
A1)
P. polymyxa,
P. mucilaginosus,
P. peoriae,
P. terrae,
Paenibacillus sp.
136, all P. Polyxyma, P.
mucilaginosus, P. Peoriae
and P. terrae strains in
this study, Paenibacillus
sp. IHBB 10380
Polypeptin
- Paenibacillus sp. 154
Chapter 2
84
Pelgipeptins
(e.g.
pelgipeptinC)
Paenibacillus sp. 152
Octapeptins
(e.g.
octapeptinD)
- Paenibacillus sp. 155
Gavaserin - - P. polymyxa 153
Saltavalin - - P. polymyxa 153
Classification NRPs Others
Bacitracin
B. cereus,
B. paralicheniformis,
P. bovis,
Paenibacillus durus
156, 157, B. cereus ATCC
10876, B. cereus m1550,
B. cereus Rock3-28, B.
cereus Rock3-29, B.
cereus Rock4-18, all B.
paralicheniformis strains
in this study, P. bovis
BD3526, P. durus DSM
1735
Bacilysin
B. subtilis,
B. amyloliquefaciens,
B. methylotrophicus,
Bacillus pumilus,
Bacillus sp.
158, most of the predicted
species strains in this
study
Antimicrobial Compounds of Bacillales Species
85
Rhizocticins
(e.g.
rhizocticinA)
B. subtilis,
B. atrophaeus,
Bacillus sp.
159, most of B. subtilis
and
B. atrophaeus strains in
this study, Bacillus sp.
BS34A
Petrobactin
B. thurigiensis,
B. anthracis,
B. cereus,
Bacillus mycoides,
Bacillus
weihenstephanensis,
Bacillus
bombysepticus,
Bacillus toyonensis,
B. laterosporus,
Brevibacillus brevis,
P. mucilaginosus
160, most of the predicted
species strains in this
study
Chapter 2
86
Bacillibactin B. subtilis,
B. thuringiensis,
B. anthracis,
B. cereus,
B. amyloliquefaciens,
B. methylotrophicus,
B. licheniformis,
B. paralicheniformis,
B. atrophaeus,
B. mycoides,
B.
weihenstephanensis,
Bacillus cytotoxicus,
Bacillus
endophyticus,
Bacillus
pseudomcoides,
B. bombysepticus,
B. toyonensis,
Bacillus sp.,
Geobacillus sp.,
P. larvae,
P. bovis,
Paenibacillus sp.
160, most of the predicted
species strains in this
study
Sevadicin P. polymyxa,
P. larvae
161, P. polymyxa SQR-
21, P. larvae subsp.
Antimicrobial Compounds of Bacillales Species
87
larvae DSM 25430
Gramicidin S B. brevis 163, B. brevis NBRC
100599
Tyrocidine B. laterosporus,
B. brevis
166, B. brevis NBRC
100599, B. laterosporus
LMG 15441
Classification PKs
Bacillaene
B. subtilis,
B. amyloliquefaciens,
B. methylotrophicus,
B. atrophaeus,
Bacillus sp.,
P. polymyxa
P. durus
Paenibacillus sp.
169, most of the predicted
species strains in this
study, Paenibacillus sp.
FSL P4-0081
Difficidin
B. amyloliquefaciens,
B. methylotrophicus,
Bacillus sp.,
Paenibacillus sp.
171, most of the predicted
species strains in this
study, Bacillus sp.
BH072, Bacillus sp.
SDLI1, Paenibacillus sp.
FSL R7-0273
Chapter 2
88
Macrolactin
B. amyloliquefaciens,
B. methylotrophicus,
Bacillus sp.
173, most of the
predicted species strains
in this study, Bacillus sp.
BH072, Bacillus sp.
SDLI1
Paenimacroli
din
Paenibacillus sp. 167
Basiliskamid
es
B. laterosporus 175
Classification NRPS/PKS hybrid synthesized compounds
Antimicrobial Compounds of Bacillales Species
89
Paenilarvins
(e.g.
paenilarvin
A)
P. polymyxa,
P. larvae
180, P. polymyxa SC2, P.
polymyxa E681, P.
polymyxa CF05, P.
polymyxa M1, SQR2-1, P.
larvae subsp. larvae DSM
25430,
Zwittermicin
A
B. thurigiensis,
B. cereus
181, B. thuringiensis
serovar thuringiensis str.
IS5056, B. thuringiensis
serovar galleriae HD-29,
B. thuringiensis serovar
kurstaki str. HD-1, B.
thuringiensis serovar
kurstaki str. YBT-1520,
B. thuringiensis YC-10, B.
cereus ATCC 10876, B.
cereus F65185
Paenilamicin
s
(e.g.
paenilamicin
A1)
B.
weihenstephanensis,
B. endophyticus,
Bacillus gobiensis,
P. larvae
183, most of the predicted
species strains in this
study
*Gene clusters encoding NRPSs or PKSs or NRPS/PKS hybrids are indicated in different arrow boxes. “-” means lack of information.
Structures of compounds are drawn by ChemDraw. References (presented by numbers) refer to examples of reported peptides and strains
of predicted gene clusters in this study.
Chapter 2
90
Fig. 1. Potential of different Bacillales for ribosomally synthesized peptides,
NRPs and PKs production. Phylogenetic tree was constructed by bi-directional
BLAST all proteins of all genome of 328 Bacillales strains using Proteinortho; the
newick tree was generated by p02tree and visualized using FigTree v1.4.3
(http://tree.bio.ed.ac.uk/software/figtree/). The percentage of strains harboring
putative gene clusters of different antimicrobial compounds was calculated.
Numbers in parentheses () indicate the number of genomes analyzed per genus.
Antimicrobial Compounds of Bacillales Species
91
Bacillus subtilis (39)
Bacillus thuringiensis (46)
Bacillus anthracis (39)
Bacillus cereus (55)
Bacillus amyloliquefaciens (13)
Bacillus licheniformis (3)
Bacillus coagulans (5)
Bacillus megaterium (5)
Bacillus pumilus (8)
Bacillus atrophaeus (4)
Bacillus weihenstephanensis (2)
Bacillus mycoides (5)
Bacillus cytotoxicus (1)
Bacillus clausii (2)
Bacillus halodurans (1)
Bacillus cellulosilyticus (1)
Bacillus infantis (1)
Bacillus selenitireducens (1)
Bacillus methylotrophicus (15)
Bacillus paralicheniformis (3)
Bacillus methanolicus (1)
Bacillus endophyticus (1)
Bacillus smithii (1)
Bacillus pseudomycoides (1)
Bacillus pseudofirmus (1)
Bacillus bombysepticus (1)
Bacillus lehensis (1)
Bacillus toyonensis (1)
Bacillus gobiensis (1)
Bacillus sp. (13)
Kyrpidia tusciae (1)
Alicyclobacillus acidocaldarius (2)
Anoxybacillus flavithermus (1)
Geobacillus stearothermophilus (2)
Geobacillus thermodenitrificans (1)
Geobacilllus kaustophilus (1)
Geobacillus sp. (9)
Lysinibacillus sphaericus (1)
Lysinibacillus fusiformis (1)
Brevibacillus laterosporus (1)
Brevibacillus brevis (1)
Paenibacillus polymyxa (7)
Paenibacillus larvae (1)
Paenibacillus mucilaginosus (3)
Paenibacillus peoriae (1)
Paenibacillus odorifer (1)
Paenibacillus stellifer (1)
Paenibacillus borealis (1)
Paenibacillus bovis (1)
Paenibacillus naphthalenovorans (1)
Paenibacillus beijingensis (1)
Paenibacillus graminis (1)
Paenibacillus durus (2)
Paenibacillus terrae (1)
Paenibacilllus riograndensis (1)
Paenibacillus sabinae (1)
Paenibacillus sp. (12)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
No.
Type I Lanthipeptide Type II Lanthipeptide Head to tail peptide
Glycocin
LAP Lasso peptide Thiopeptide
Class I Ribosomally synthesized
peptide
A
Class II Ribosomally synthesized peptide
Class III Ribosomally synthesized peptide
B C
D
Ribosomally synthesized peptide NRPs PKs
Sactipeptide
Fig. 2. Distribution of antimicrobials biosynthetic gene clusters among different
Bacillales. (A) Class I ribosomally synthesized peptides; (B) Class II ribosomally
synthesized peptides; (C) Class III ribosomally synthesized peptides; (D) Total
ribosomally synthesized peptides, NRPs and PKs, respectively.
Chapter 2
92
3. Discussion
An extensive investigation of 328 published whole genome sequences of Bacillales
for the presence of ribosomally synthesized antimicrobials, NRPs or PKs encoding
genes, revealed that most species of the genus Bacillus, Paenibacillus and
Geobacillus have good potential to produce a wide variety of antimicrobials and
there is a high occurrence of putative biosynthetic gene clusters. The ability of
Bacillus from different species to produce putative antimicrobial compounds relate
to their phylogenetic relationship. According to the phylogenetic tree (Fig. 1),
Bacillales are divided into several groups. Among them, the group of B. subtilis
and B. atrophaeus, the group of B. amyloliquefaciens, B. methylotrophicus, B.
paralicheniformis, B. licheniformis, B. pumilus and B. endophyticus are excellent
producers of all the three kinds of antimicrobials. Additionally, the B. cereus
group, Paenibacillus strains are rich sources of bacteriocins and NRPs, while
Geobacillus strains mainly produce bacteriocins and PKs.
More than 89% strains covering 50 species have a predisposition towards
producing ribosomally synthesized peptides (Fig. 1), some gene clusters of which
show similarity with those of known bacteriocins, while some are uncharacterized
or show limited homology. When it comes to the distribution of biosynthetic gene
clusters of ribosomally synthesized antimicrobials among different Bacillales,
lanthipeptides, head to tail cyclized peptides, sactipeptides, lasso peptides and
LAPs of Class I are the most common types (Fig. 2), whilst glycocin and
thiopeptide genes are present predominantly in B. subtilis and B. cereus strains,
respectively. Gene clusters of class II and III appear to be also regularly contained
within genus Bacillus genomes.
Although the emphasis here is on ribosomally synthesized peptide classes, several
new NRPs and PKs with potential antimicrobial activity were also identified.
Antimicrobial Compounds of Bacillales Species
93
Bacillales are potential NRPs producers, and the gene clusters are widely spread in
40 species of the sequenced genomes in our analysis (Fig. 1). In contrast, only half
of the genomes of these organisms appear to have PKs encoding genes. Bacillus
and Paenibacillus genera in particular are well noted for their capability to produce
structurally diverse NRPs and PKs. Approximately 35% strains of the Bacillale
species analyzed have the ability to produce all 3 types of antimicrobial compounds
simultaneously. In this study, most of the genomes (255 of 328) were completely
sequenced yielding one or only a few contigs, while there are some other level
sequence data (shown in Table S1) composed of relatively many single contigs.
Some of these contigs are not in the correct order, which can result in higher
mining counts of NRPs (caused by duplications or multiplications) than actual
correct. In order to avoid this overestimation, the numbers of putative gene clusters
of NRPs identified in Bacillales genomes, especially for B. cereus group strains,
were adjusted by removing duplications or multiplications of NRPs manually. It is
valuable to take this issue into account in further and future data mining and
analyses.
The massive numbers of bacteria with whole genome sequence data and the
development of various specific genome mining tools have made it possible to
identify an informative set of putative antimicrobial gene clusters across the
genomes that can be developed into new antimicrobials. Novel information found
in this genome mining study includes 3 types that are novel: class I bacteriocins
with either a new leader sequence or new core sequence; known antimicrobial
compounds previously produced by other microorganisms; and completely novel
gene clusters that need experimental confirmation. Another value of this study is
that the post-genome mining analysis includes a number of potential species never
considered to be antimicrobial producers before and provide a reference for future
Bacilli to be sequenced.
Chapter 2
94
4. Conclusions
A multitude of antimicrobial compounds have been found to be produced by a
variety of Bacillus strains. In the past, these compounds had to be identified by
intensive screening for antimicrobial activity against appropriate targets and
subsequently purified using fastidious methods prior to assess their potential
utilization as antibacterial or antifungal compound. Nowadays, gene clusters
encoding for ribosomally produced bacteriocins, NRPs and PKs can readily be
identified in the genomic sequences by genome-mining tools that not only add
missing ones, but also predict novel ones. Notably, genomic tools like BAGEL3
and antiSMASH combined with specific BLAST searches, makes the identification
of new compounds much easier. Although several novel gene clusters of putative
antimicrobials were found, they are as yet uncharacterized and their functions
remain to be studied. Our extended classification of antimicrobial compounds
demonstrates that Bacillales provides a rich source of novel antimicrobials that can
now be readily tapped experimentally, since many new gene clusters were
identified.
5. Methods
5.1. Genome sequences
Whole genome sequences of 328 strains of Bacillales (Additional file: Table S1)
were obtained from NCBI Genome database (http://www.ncbi.nlm.
nih.gov/genome). All proteins of all genomes were compared by bi-directional
BLAST using Proteinortho and newick tree file was generated by p02tree [184].
The newick tree file was visualized using FigTree v1.4.3
(http://tree.bio.ed.ac.uk/software/figtree/).
Antimicrobial Compounds of Bacillales Species
95
5.2. Genome mining for gene clusters of putative antimicrobials by BAGEL 3
and antiSMASH
Genomes were analyzed for gene clusters of putative bacteriocins, NRPs, PKs or
other antimicrobials by using web-based genome mining tools BAGEL3
(http://bagel.molgenrug.nl/) [7] and antiSMASH (http://antismash.secondary
metabolites.org) [8-10]. Genome mining data were collected and putative gene
clusters were classified manually. By BLAST, known and novel antimicrobials
were predicted and identified.
Additional file
Additional file 1: Table S1. Accession numbers of whole genome sequences
(reported in Genbank) of Bacillales analyzed in this study.
Availability of data and materials
Genome mining work was done base on the whole genome sequences of 328
strains of Bacillales listed in Additional file: Table S1, which can be obtained from
NCBI Genome database by corresponding accession numbers
(http://www.ncbi.nlm.nih.gov/genome). All the other data supporting the findings
is contained within the manuscript.
Reference
1. Nicholson WL. Roles of Bacillus endospores in the environment. Cell Mol Life Sci. 2002,59:410-416.
2. Lucera A, Costa C, Conte A, Del Nobile MA. Food applications of natural antimicrobial compounds.
Front Microbiol. 2012,3:287.
3. Sumi CD, Yang BW, Yeo I-C, Hahm YT. Antimicrobial peptides of the genus Bacillus: a new era for
antibiotics. Can J Microbiol. 2015,61(2):93-103.
4. Abriouel H, Franz CM, Ben Omar N, Galvez A. Diversity and applications of Bacillus bacteriocins.
FEMS Microbiol Rev. 2011,35(1):201-232.
Chapter 2
96
5. Finking R, Marahiel MA. Biosynthesis of nonribosomal peptides1. Annu Rev Microbiol. 2004,58:453-
488.
6. Fickers P. Antibiotic Compounds from Bacillus: Why are they so Amazing?. Am J Biochem Biotechnol.
2012,8(1):38-43.
7. van Heel AJ, de Jong A, Montalban-Lopez M, Kok J, Kuipers OP. BAGEL3: Automated identification
of genes encoding bacteriocins and (non-)bactericidal posttranslationally modified peptides. Nucleic
Acids Res. 2013,41:448-453.
8. Medema MH, Blin K, Cimermancic P, de Jager V, Zakrzewski P, Fischbach MA, et al. antiSMASH:
rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in
bacterial and fungal genome sequences. Nucleic Acids Res. 2011,39:339-346.
9. Blin K, Medema MH, Kazempour D, Fischbach MA, Breitling R, Takano E, et al. antiSMASH 2.0--a
versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res.
2013,41:204-212.
10. Weber T, Blin K, Duddela S, Krug D, Kim HU, Bruccoleri R, et al. antiSMASH 3.0-a comprehensive
resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 2015,43:237-243.
11. Stein T: Bacillus subtilis antibiotics: structures, syntheses and specific functions. Mol Microbiol.
2005,56(4):845-857.
12. Mondol MA, Shin HJ, Islam MT. Diversity of secondary metabolites from marine Bacillus species:
chemistry and biological activity. Mar Drugs. 2013,11(8):2846-2872.
13. Klaenhammer TR. Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiol Rev.
1993,12:39-86.
14. Alvarez-Sieiro P, Montalban-Lopez M, Mu D, Kuipers OP. Bacteriocins of lactic acid bacteria:
extending the family. Appl Microbiol Biotechnol. 2016,100(7):2939-51.
15. Arnison PG, Bibb MJ, Bierbaum G, Bowers AA, Bugni TS, Bulaj G, et al. Ribosomally synthesized
and post-translationally modified peptide natural products: overview and recommendations for a
universal nomenclature. Nat Prod Rep. 2013,30(1):108-160.
16. Velasquez JE, van der Donk WA. Genome mining for ribosomally synthesized natural products. Curr
Opin Chem Biol. 2011,15(1):11-21.
17. McAuliffe O, Ross RP, Hill C. Lantibiotics: structure, biosynthesis and mode of action. FEMS
Microbiol Rev. 2001,25:285-308.
18. Knerr PJ, van der Donk WA. Discovery, biosynthesis, and engineering of lantipeptides. Annu Rev
Biochem. 2012,81:479-505.
19. McClerren AL, Cooper LE, Quan C, Thomas PM, Kelleher NL, van der Donk WA. Discovery and in
vitro biosynthesis of haloduracin, a two-component lantibiotic. Proc Natl Acad Sci USA.
2006,103(46):17243-17248.
20. Takami H, Nakasone K, Takaki Y, Maeno G, Sasaki R, Masui N, et al. Complete genome sequence of
the alkaliphilic bacterium Bacillus halodurans and genomic sequence comparison with Bacillus subtilis.
Nucleic Acids Res. 2000,28(21):4317–4331.
21. Begley M, Cotter PD, Hill C, Ross RP. Identification of a novel two-peptide lantibiotic, lichenicidin,
following rational genome mining for LanM proteins. Appl Environ Microbiol. 2009,75(17):5451-5460.
Antimicrobial Compounds of Bacillales Species
97
22. Garg N, Tang W, Goto Y, Nair SK, van der Donk WA. Lantibiotics from Geobacillus
thermodenitrificans. Proc Natl Acad Sci USA. 2011,109(14):5241-5246.
23. Caetano T, Barbosa J, Moesker E, Sussmuth RD, Mendo S. Bioengineering of lanthipeptides in
Escherichia coli: assessing the specificity of lichenicidin and haloduracin biosynthetic machinery. Res
Microbiol. 2014,165(7):600-604.
24. Khusainov R, van Heel AJ, Lubelski J, Moll GN, Kuipers OP. Identification of essential amino acid
residues in the nisin dehydratase NisB. Front Microbiol. 2015,6:102.
25. Lee H, Kim HY. Lantibiotics, class I bacteriocins from the genus Bacillus. J Microbiol Biotechnol.
2011,21(3):229-235.
26. Stein T, Heinzmann S, Kiesau P, Himmel B, Entian KD. The spa-box for transcriptional activation of
subtilin biosynthesis and immunity in Bacillus subtilis. Mol Microbiol. 2003,47(6):1627-1636.
27. Kleerebezem M. Quorum sensing control of lantibiotic production; nisin and subtilin autoregulate their
own biosynthesis. Peptides. 2004,25(9):1405-1414.
28. Kleerebezem M, Bongers R, Rutten G, de Vos WM, Kuipers OP. Autoregulation of subtilin
biosynthesis in Bacillus subtilis: the role of the spa-box in subtilin-responsive promoters. Peptides.
2004,25(9):1415-1424.
29. Corvey C, Stein T, Düsterhus S, Karas M, Entian KD. Activation of subtilin precursors by Bacillus
subtilis extracellular serine proteases subtilisin (AprE), WprA, and Vpr. Biochem Bioph Res C.
2003,304(1):48-54.
30. Breukink E, Wiedemann I, van Kraaij C, Kuipers OP, Sahl HG, de Kruijff B. Use of the cell wall
precursor lipid II by a pore-forming peptide antibiotic. Science. 1999,286(5448):2361-2364.
31. Parisot J, Carey S, Breukink E, Chan WC, Narbad A, Bonev B. Molecular mechanism of target
recognition by subtilin, a class I lanthionine antibiotic. Antimicrob Agents Chemother. 2008,52(2):612-
618.
32. Bierbaum G, Brötz H, Koller KP, Sahl HG. Cloning, sequencing and production of the lantibiotic
mersacidin. FEMS Microbiol Lett. 1995,127(1-2):121-126.
33. Hao K, He P, Blom J, Rueckert C, Mao Z, Wu Y, et al. The genome of plant growth-promoting
Bacillus amyloliquefaciens subsp. plantarum strain YAU B9601-Y2 contains a gene cluster for
mersacidin synthesis. J Bacteriol. 2012,194(12):3264-3265.
34. Zhao X, de Jong A, Zhou Z, Kuipers OP. Complete genome sequence of Bacillus amyloliquefaciens
strain BH072, isolated from honey. Genome Announcements. 2015,3(2):e00098–00015.
35. Brötz H, Bierbaum G, Reynolds PE, Sahl HG. The lantibiotic mersacidin inhibits peptidoglycan
biosynthesis at the level of transglycosylation. Eur J Biochem. 1997,246(1):193-199.
36. Hsu ST, Breukink E, Bierbaum G, Sahl HG, de Kruijff B, Kaptein R, et al. NMR study of mersacidin
and lipid II interaction in dodecylphosphocholine micelles. Conformational changes are a key to
antimicrobial activity. J Biol Chem. 2003,278(15):13110-13117.
37. He P, Hao K, Blom J, Ruckert C, Vater J, Mao Z, et al. Genome sequence of the plant growth
promoting strain Bacillus amyloliquefaciens subsp. plantarum B9601-Y2 and expression of mersacidin
and other secondary metabolites. J Biotechnol. 2012,164(2):281-291.
Chapter 2
98
38. Schmitz S, Hoffmann A, Szekat C, Rudd B, Bierbaum G. The lantibiotic mersacidin is an autoinducing
peptide. Appl Environ Microbiol. 2006,72(11):7270-7277.
39. Guder A, Schmitter T, Wiedemann I, Sahl HG, Bierbaum G. Role of the single regulator MrsR1 and
the two-component system MrsR2/K2 in the regulation of mersacidin production and immunity. Appl
Environ Microbiol. 2002,68(1):106-113.
40. Klein C, Kaletta C, Schnell N, Entian KD. Analysis of genes involved in biosynthesis of the lantibiotic
subtilin. Appl Environ Microbiol. 1992; doi: 10.1111/j.1432-1033.1992.tb16605.x.
41. Bouhss A, Al-Dabbagh B, Vincent M, Odaert B, Aumont-Nicaise M, Bressolier P, et al. Specific
interactions of clausin, a new lantibiotic, with lipid precursors of the bacterial cell wall. Biophys J.
2009,97(5):1390-1397.
42. Phelan RW, Barret M, Cotter PD, O'Connor PM, Chen R, Morrissey JP, et al. Subtilomycin: a new
lantibiotic from Bacillus subtilis strain MMA7 isolated from the marine sponge Haliclona simulans.
Mar Drugs. 2013,11(6):1878-1898.
43. He Z, Yuan C, Zhang L, Yousef AE. N-terminal acetylation in paenibacillin, a novel lantibiotic. FEBS
Lett. 2008,582(18):2787-2792.
44. van Belkum MJ, Lohans CT, Vederas JC. Draft Genome sequences of Paenibacillus polymyxa NRRL
B-30509 and Paenibacillus terrae NRRL B-30644, strains from a poultry environment that produce
tridecaptin A and paenicidins. Genome Announcements. 2015,3(2):e00372-00315.
45. Fuchs SW, Jaskolla TW, Bochmann S, Kotter P, Wichelhaus T, Karas M, et al. Entianin, a novel
subtilin-like lantibiotic from Bacillus subtilis subsp. spizizenii DSM 15029T with high antimicrobial
activity. Appl Environ Microbiol. 2011,77(5):1698-1707.
46. Stein T, Borchert S, Conrad B, Feesche J, Hofemeister B, Hofemeister J, et al. Two different
lantibiotic-like peptides originate from the ericin gene cluster of Bacillus subtilis A1/3. J Bacteriol.
2002,184(6):1703-1711.
47. Xin B, Zheng J, Xu Z, Song X, Ruan L, Peng D, et al. The Bacillus cereus group is an excellent
reservoir of novel lanthipeptides. Appl Envrion Microbiol. 2015,81(5):1765-1774.
48. Altena K, Guder A, Cramer C, Bierbaum G. Biosynthesis of the lantibiotic mersacidin: organization of
a type B lantibiotic gene cluster. Appl Envrion Microbiol. 2000,66(6):2565–2571.
49. Herzner AM, Dischinger J, Szekat C, Josten M, Schmitz S, Yakéléba A, et al. Expression of the
lantibiotic mersacidin in Bacillus amyloliquefaciens FZB42. Plos One. 2011,6(7):e22389.
50. Arguelles Arias A, Ongena M, Devreese B, Terrak M, Joris B, Fickers P. Characterization of
amylolysin, a novel lantibiotic from Bacillus amyloliquefaciens GA1. Plos One. 2013,8(12):e83037.
51. Basi-Chipalu S, Dischinger J, Josten M, Szekat C, Zweynert A, Sahl HG, et al. Pseudomycoicidin, a
class II lantibiotic from Bacillus pseudomycoides. Appl Envrion Microbiol. 2015,81(10):3419-3429.
52. Wang J, Zhang L, Teng K, Sun S, Sun Z, Zhong J. Cerecidins, novel lantibiotics from Bacillus cereus
with potent antimicrobial activity. Appl Envrion Microbiol. 2014,80(8):2633-2643.
53. Coburn PS, Gilmore MS. The Enterococcus faecalis cytolysin: a novel toxin active against eukaryotic
and prokaryotic cells. Cell Microbiol. 2003,5(10):661-669.
54. Montalbán-López M, Sánchez-Hidalgo M, Cebrián R, Maqueda M. Discovering the bacterial circular
proteins: bacteriocins, cyanobactins, and pilins. J Biol Chem. 2012,287(32):27007-27013.
Antimicrobial Compounds of Bacillales Species
99
55. Maqueda M, Sanchez-Hidalgo M, Fernandez M, Montalban-Lopez M, Valdivia E, Martinez-Bueno M.
Genetic features of circular bacteriocins produced by Gram-positive bacteria. FEMS Microbiol Rev.
2008,32(1):2-22.
56. Conlan BF, Gillon AD, Craik DJ, Anderson MA. Circular proteins and mechanisms of cyclization.
Biopolymers. 2010,94(5):573-583.
57. Van Belkum MJ, Martin-Visscher LA, Vederas JC. Structure and genetics of circular bacteriocins.
Trends Microbiol. 2011,19(8):411-418.
58. Gonzalez C, Langdon GM, Bruix M, Galvez A, Valdivia E, Maqueda M, et al. Bacteriocin AS-48, a
microbial cyclic polypeptide structurally and functionally related to mammalian NK-lysin. Proc Natl
Acad Sci USA. 2000,97(21):11221-11226.
59. Scholz R, Vater J, Budiharjo A, Wang Z, He Y, Dietel K, et al. Amylocyclicin, a novel circular
bacteriocin produced by Bacillus amyloliquefaciens FZB42. J Bacteriol. 2014,196(10):1842-1852.
60. Wirawan RE, Swanson KM, Kleffmann T, Jack RW, Tagg JR. Uberolysin: a novel cyclic bacteriocin
produced by Streptococcus uberis. Microbiology. 2007,153(5):1619-1630.
61. Grande Burgos MJ, Pulido RP, Del Carmen Lopez Aguayo M, Galvez A, Lucas R. The cyclic
antibacterial peptide enterocin AS-48: isolation, mode of action, and possible food applications. Int J
Mol Sci. 2014,15(12):22706-22727.
62. Kawai Y, Kemperman R, Kok J, Saito T. The circular bacteriocins gassericin A and circularin A. Curr
Protein Pept Sc. 2004,5(5):393-398.
63. Borrero J, Brede DA, Skaugen M, Diep DB, Herranz C, Nes IF, et al. Characterization of garvicin ML,
a novel circular bacteriocin produced by Lactococcus garvieae DCC43, isolated from mallard ducks
(Anas platyrhynchos). Appl Envrion Microbiol. 2011,77(1):369-373.
64. Azevedo AC, Bento CB, Ruiz JC, Queiroz MV, Mantovani HC. Distribution and genetic diversity of
bacteriocin gene clusters in rumen microbial genomes. Appl Envrion Microbiol. 2015,81(20):7290-
7304.
65. Yang X, van der Donk WA. Ribosomally synthesized and post-translationally modified peptide natural
products: new insights into the role of leader and core peptides during biosynthesis. Chemistry.
2013,19(24):7662-7677.
66. Fluhe L, Marahiel MA. Radical S-adenosylmethionine enzyme catalyzed thioether bond formation in
sactipeptide biosynthesis. Curr Opin Chem Biol. 2013,17(4):605-612.
67. Kawulka K, Sprules T, McKay RT, Mercier P, Diaper CM, Zuber P, et al. Structure of subtilosin A, an
antimicrobial peptide from Bacillus subtilis with unusual posttranslational modifications linking
cysteine sulfurs to alpha-carbons of phenylalanine and threonine. J Am Chem Soc. 2003,125(16):4726-
4727.
68. Flühe L, Knappe TA, Gattner MJ, Schäfer A, Burghaus O, Linne U, et al. The radical SAM enzyme
AlbA catalyzes thioether bond formation in subtilosin A. Nat Chem Biol. 2012,8(4):350-357.
69. Zheng G, Yan LZ, Vederas JC, Zuber P. Genes of the sbo-alb locus of Bacillus subtilis are required for
production of the antilisterial bacteriocin subtilosin. J Bacteriol. 1999,181(23):7346-7355.
70. Zheng G, Hehn R, Zuber P. Mutational analysis of the sbo-alb locus of Bacillus subtilis: identification
of genes required for subtilosin production and immunity. J Bacteriol. 2000,182(11):3266-3273.
Chapter 2
100
71. Noll KS, Sinko PJ, Chikindas ML. Elucidation of the molecular mechanisms of action of the natural
antimicrobial peptide subtilosin against the bacterial vaginosis-associated pathogen Gardnerella
vaginalis. Probiotics Antimicrob. 2011,3(1):41-47.
72. Sutyak KE, Wirawan RE, Aroutcheva AA, Chikindas ML. Isolation of the Bacillus subtilis
antimicrobial peptide subtilosin from the dairy product-derived Bacillus amyloliquefaciens. J Appl
Microbiol. 2008,104(4):1067-1074.
73. Huang T, Geng H, Miyyapuram VR, Sit CS, Vederas JC, Nakano MM. Isolation of a variant of
subtilosin A with hemolytic activity. J Bacteriol. 2009,191(18):5690-5696.
74. Allenby NE, Watts CA, Homuth G, Pragai Z, Wipat A, Ward AC, et al. Phosphate starvation induces
the sporulation killing factor of Bacillus subtilis. J Bacteriol. 2006,188(14):5299-5303.
75. Lee H, Churey JJ, Worobo RW. Biosynthesis and transcriptional analysis of thurincin H, a tandem
repeated bacteriocin genetic locus, produced by Bacillus thuringiensis SF361. FEMS Microbiol Lett.
2009,299(2):205-213.
76. Rea MC, Sit CS, Clayton E, O’Connor PM, Whittal RM, Zheng J, et al. Thuricin CD, a
posttranslationally modified bacteriocin with a narrow spectrum of activity against Clostridium difficile.
Proc Natl Acad Sci USA. 2010,107(20):9352-9357.
77. Favret ME, Yousten AA. Thuricin: the bacteriocin produced by Bacillus thuringiensis. J Invertebr
Pathol. 1989,53(2):206-216.
78. Li YM, Milne JC, Madison LL, Kolter R, Walsh CT. From peptide precursors to oxazole and thiazole-
containing peptide antibiotics: microcin B17 synthase. Science. 1996,274(5290):1188-1193.
79. Melby JO, Nard NJ, Mitchell DA. Thiazole/oxazole-modified microcins: complex natural products
from ribosomal templates. Curr Opin Chem Biol. 2011,15(3):369-378.
80. Banala S, Ensle P, Sussmuth RD. Total synthesis of the ribosomally synthesized linear azole-
containing peptide plantazolicin A from Bacillus amyloliquefaciens. Angew Chem Int Edit.
2013,52(36):9518-9523.
81. Scholz R, Molohon KJ, Nachtigall J, Vater J, Markley AL, Sussmuth RD, et al. Plantazolicin, a novel
microcin B17/streptolysin S-like natural product from Bacillus amyloliquefaciens FZB42. J Bacteriol.
2011,193(1):215-224.
82. Davagnino J, Herrero M, Furlong D, Moreno F, Kolter R. The DNA replication inhibitor microcin B17
is a forty-three-amino-acid protein containing sixty percent glycine. Proteins. 1986,1(3):230-238.
83. Heddle JG, Blance SJ, Zamble DB, Hollfelder F, Miller DA, Wentzell LM, et al. The antibiotic
microcin B17 is a DNA gyrase poison: characterisation of the mode of inhibition. J Mol Biol.
2001,307(5):1223-1234.
84. Cox CL, Doroghazi JR, Mitchell DA. The genomic landscape of ribosomal peptides containing thiazole
and oxazole heterocycles. BMC Genomics. 2015,16(1):1-16.
85. Lee SW, Mitchell DA, Markley AL, Hensler ME, Gonzalez D, Wohlrab A, et al. Discovery of a widely
distributed toxin biosynthetic gene cluster. Proc Natl Acad Sci USA. 2008,105(15):5879-5884.
86. Nizet V, Beall B, Bast DJ, Datta V, Kilburn L, Low DE, et al. Genetic locus for streptolysin S
production by group A Streptococcus. Infect Immun. 2000,68(7):4245-4254.
Antimicrobial Compounds of Bacillales Species
101
87. Liu Z, Budiharjo A, Wang P, Shi H, Fang J, Borriss R, et al. The highly modified microcin peptide
plantazolicin is associated with nematicidal activity of Bacillus amyloliquefaciens FZB42. Appl
Microbiol Biotechnol. 2013,97(23):10081-10090.
88. Just-Baringo X, Albericio F, Alvarez M. Thiopeptide antibiotics: retrospective and recent advances.
Mar Drugs. 2014,12(1):317-351.
89. Bowers AA, Walsh CT, Acker MG. Genetic interception and structural characterization of thiopeptide
cyclization precursors from Bacillus cereus. J Am Chem Soc. 2010,132(35):12182-12184.
90. Wieland Brown LC, Acker MG, Clardy J, Walsh CT, Fischbach MA. Thirteen posttranslational
modifications convert a 14-residue peptide into the antibiotic thiocillin. Proc Natl Acad Sci USA.
2009,106(8):2549-2553.
91. Shoji J, Hinoo H, Wakisaka Y, Koizumi K, Mayama M. Isolation of three new antibiotics, thiocillins I,
II and III, related to micrococcin P. Studies on antibiotics from the genus Bacillus. VIII. J Antibiot
(Tokyo). 1976,29(4):366-374.
92. Stepper J, Shastri S, Loo TS, Preston JC, Novak P, Man P, et al. Cysteine S-glycosylation, a new post-
translational modification found in glycopeptide bacteriocins. FEBS Lett. 2011,585(4):645-650.
93. Hsieh YS, Wilkinson BL, O'Connell MR, Mackay JP, Matthews JM, Payne RJ. Synthesis of the
bacteriocin glycopeptide sublancin 168 and S-glycosylated variants. Org Lett. 2012,14(7):1910-1913.
94. Oman TJ, Boettcher JM, Wang H, Okalibe XN, van der Donk WA. Sublancin is not a lantibiotic but an
S-linked glycopeptide. Nat Chem Biol. 2011,7(2):78-80.
95. Paik SH, Chakicherla A, Hansen JN. Identification and characterization of the structural and transporter
genes for, and the chemical and biological properties of, sublancin 168, a novel lantibiotic produced by
Bacillus subtilis 168. J Biol Chem. 1998,273(36):23134-23142.
96. Bolhuis A, Venema G, Quax WJ, Bron S, van Dijl JM. Functional analysis of paralogous thiol-
disulfide oxidoreductases in Bacillus subtilis. J Biol Chem. 1999,274(35):24531-24538.
97. Serizawa M, Kodama K, Yamamoto H, Kobayashi K, Ogasawara N, Sekiguchi J. Functional analysis
of the YvrGHb two-component system of Bacillus subtilis: identification of the regulated genes by
DNA microarray and northern blot analyses. Biosci Biotech Biochem. 2005,69(11):2155-2169.
98. Weber W, Fischli W, Hochuli E, Kupfer E, Weibel EK. Anantin--a peptide antagonist of the atrial
natriuretic factor (ANF). I. Producing organism, fermentation, isolation and biological activity. J
Antibiot (Tokyo). 1991,44(2):164-171.
99. Hegemann JD, Zimmermann M, Xie X, Marahiel MA. Lasso peptides: an intriguing class of bacterial
natural products. Accounts Chem Res. 2015,48(7):1909-1919.
100. Maksimov MO, Pelczer I, Link AJ. Precursor-centric genome-mining approach for lasso peptide
discovery. Proc Natl Acad Sci USA. 2012,109(38):15223-15228.
101. Maksimov MO, Pan SJ, James Link A. Lasso peptides: structure, function, biosynthesis, and
engineering. Nat Prod Rep. 2012,29(9):996-1006.
102. Maksimov MO, Link AJ. Discovery and characterization of an isopeptidase that linearizes lasso
peptides. J Am Chem Soc. 2013,135(32):12038-12047.
Chapter 2
102
103. Solbiati JO, Ciaccio M, Farías RN, González-Pastor JE, Moreno F, Salomón RA. Sequence analysis of
the four plasmid genes required to produce the circular peptide antibiotic microcin J25. J Bacteriol.
1999,181(8):2659-2662.
104. Yan KP, Li Y, Zirah S, Goulard C, Knappe TA, Marahiel MA, Rebuffat S. Dissecting the maturation
steps of the lasso peptide microcin J25 in vitro. Chembiochem. 2012,13(7):1046-1052.
105. Mukhopadhyay J, Sineva E, Knight J, Levy RM, Ebright RH. Antibacterial peptide microcin J25
inhibits transcription by binding within and obstructing the RNA polymerase secondary channel. Mol
Cell. 2004,14(6):739-751.
106. Helynck G, Dubertret C, Mayaux JF, Leboul J. Isolation of RP 71955, a new anti-HIV-1 peptide
secondary metabolite. J Antibiot (Tokyo). 1993,46(11):1756-1757.
107. Delgado MA, Rintoul MR, Farias RN, Salomon RA. Escherichia coli RNA polymerase is the target of
the cyclopeptide antibiotic microcin J25. J Bacteriol. 2001,183(15):4543-4550.
108. Cotter PD, Ross RP, Hill C. Bacteriocins - a viable alternative to antibiotics?. Nat Rev Microbiol.
2013,11(2):95-105.
109. Le Marrec C, Hyronimus B, Bressollier P, Verneuil B, Urdaci MC. Biochemical and genetic
characterization of coagulin, a new antilisterial bacteriocin in the pediocin family of bacteriocins,
produced by Bacillus coagulans I(4). Appl Environ Microbiol. 2000,66(12):5213-5220.
110. Kjos M, Borrero J, Opsata M, Birri DJ, Holo H, Cintas LM, et al. Target recognition, resistance,
immunity and genome mining of class II bacteriocins from Gram-positive bacteria. Microbiology.
2011,157(12):3256-3267.
111. Cui Y, Zhang C, Wang Y, Shi J, Zhang L, Ding Z, et al. Class IIa bacteriocins: diversity and new
developments. Int J Mol Sci. 2012,13(12):16668-16707.
112. Miller KW, Ray P, Steinmetz T, Hanekamp T, Ray B. Gene organization and sequences of pediocin
AcH/PA-1 production operons in Pediococcus and Lactobacillus plasmids. Lett Appl Microbiol.
2005,40(1):56-62.
113. Hyronimus B, Le Marrec C, Urdaci MC. Coagulin, a bacteriocin-like inhibitory substance produced by
Bacillus coagulans I4. J Appl Microbiol. 1998,85(1):42-50.
114. De Vuyst L, Avonts L, Neysens P, Hoste B, Vancanneyt M, Swings J, et al. The lactobin A and
amylovorin L471 encoding genes are identical, and their distribution seems to be restricted to the
species Lactobacillus amylovorus that is of interest for cereal fermentations. Int J Food Microbiol.
2004,90(1):93-106.
115. Requena T, Yu W, Stoddard GW, McKay LL. Lactococcin A overexpression in a Lactococcus lactis
subsp. lactis transformant containing a Tn5 insertion in the lcnD gene. Appl Microbiol Biotechnol.
1995,44(3-4):413-418.
116. Kyogoku K, Sekiguchi J. Cloning and sequencing of a new holin-encoding gene of Bacillus
licheniformis. Gene. 1996,168(1):61-65.
117. Oki M, Kakikawa M, Nakamura S, Yamamura ET, Watanabe K, Sasamoto M, et al. Functional and
structural features of the holin HOL protein of the Lactobacillus plantarum phage φg1e: analysis in
Escherichia coli system. Gene. 1997,197(1-2):137-145.
Antimicrobial Compounds of Bacillales Species
103
118. Ziedaite G, Daugelavicius R, Bamford JK, Bamford DH. The Holin protein of bacteriophage PRD1
forms a pore for small-molecule and endolysin translocation. J Bacteriol. 2005,187(15):5397-5405.
119. Anthony T, Chellappa GS, Rajesh T, Gunasekaran P. Functional analysis of a putative holin-like
peptide-coding gene in the genome of Bacillus licheniformis AnBa9. Arch Microbiol. 2010,192(1):51-
56.
120. Young R, Bläsi, U. Holins: form and function in bacteriophage lysis. FEMS Microbiol Rev.1995,17(1-
2):191-205.
121. Young R. Bacteriophage lysis: mechanism and regulation. Microbiol Rev. 1992,56(3):430-481.
122. Aunpad R, Panbangred W. Evidence for two putative holin-like peptides encoding genes of Bacillus
pumilus strain WAPB4. Curr Microbiol. 2012,64(4):343-348.
123. Liu J, Pan N, Chen Z. Characterization of an anti-rice bacterial blight polypeptide LCI. Rice Genet
Newsl. 1990,7:151-154.
124. Gong W, Wang J, Chen Z, Xia B, Lu G. Solution structure of LCI, a novel antimicrobial peptide from
Bacillus subtilis. Biochemistry. 2011,50(18):3621-3627.
125. Liu J, Li Z, Pan N, Chen Z. Purification and partial characterization of an antibacterial protein LCIII.
Chin J Biotechnol. 1992,8(3):187-193.
126. Wang G. Antimicrobial peptides: discovery, design and novel therapeutic strategies. CAB International;
2010.
127. Netz DJA, Bastos MdCdF, Sahl HG. Mode of action of the antimicrobial peptide aureocin A53 from
Staphylococcus aureus. Appl Environ Microbiol. 2002,68(11):5274-5280.
128. Netz DJA, Pohl R, Beck-Sickinger AG, Selmer T, Pierik AJ, Bastos MdCdF, et al. Biochemical
characterisation and genetic analysis of aureocin A53, a new, atypical bacteriocin from Staphylococcus
aureus. J Mol Biol. 2002,319(3):745-756.
129. Von Tersch MA, Carlton BC. Bacteriocin from Bacillus megaterium ATCC 19213: comparative
studies with megacin A-216. J Bacteriol. 1983,155(2):866-871.
130. Zakharov SD, Cramer WA. Colicin crystal structures: pathways and mechanisms for colicin insertion
into membranes. Biochim Biophys Acta. 2002,1565(2):333-346.
131. Michel-Briand Y, Baysse C. The pyocins of Pseudomonas aeruginosa. Biochimie. 2002,84(5-6):499-
510.
132. Bamford CV, Francescutti T, Cameron CE, Jenkinson HF, Dymock D. Characterization of a novel
family of fibronectin-binding proteins with M23 peptidase domains from Treponema denticola. Mol
Oral Microbiol. 2010,25(6):369-383.
133. Grabowska M, Jagielska E, Czapinska H, Bochtler M, Sabala I. High resolution structure of an M23
peptidase with a substrate analogue. Sci Rep. 2015,5:14833.
134. Wang H, Fewer DP, Holm L, Rouhiainen L, Sivonen K. Atlas of nonribosomal peptide and polyketide
biosynthetic pathways reveals common occurrence of nonmodular enzymes. Proc Natl Acad Sci USA.
2014,111(25):9259-9264.
135. Weissman KJ. The structural biology of biosynthetic megaenzymes. Nat Chem Biol. 2014,11(9):660–
670.
Chapter 2
104
136. Aleti G, Sessitsch A, Brader G. Genome mining: prediction of lipopeptides and polyketides from
Bacillus and related Firmicutes. Comput Struct Biotechnol J. 2015,13:192-203.
137. Baltz RH. Combinatorial biosynthesis of cyclic lipopeptide antibiotics: a model for synthetic biology to
accelerate the evolution of secondary metabolite biosynthetic pathways. ACS Synth Biol.
2014,3(10):748-758.
138. Meena KR, Kanwar SS. Lipopeptides as the antifungal and antibacterial agents: applications in food
safety and therapeutics. Biomed Res Int. 2015; doi:10.1155/2015/473050.
139. Ongena M, Jacques P. Bacillus lipopeptides: versatile weapons for plant disease biocontrol. Trends
Microbiol. 2008,16(3):115-125.
140. Cawoy H, Debois D, Franzil L, De Pauw E, Thonart P, Ongena M. Lipopeptides as main ingredients
for inhibition of fungal phytopathogens by Bacillus subtilis/amyloliquefaciens. Microb biotechnol.
2015,8(2):281-295.
141. Raaijmakers JM, De Bruijn I, Nybroe O, Ongena M. Natural functions of lipopeptides from Bacillus
and Pseudomonas: more than surfactants and antibiotics. FEMS Microbiol Rev. 2010,34(6):1037-1062.
142. Pathak KV, Keharia H. Identification of surfactins and iturins produced by potent fungal antagonist,
Bacillus subtilis K1 isolated from aerial roots of banyan (Ficus benghalensis) tree using mass
spectrometry. 3 Biotech. 2013,4(3):283-295.
143. Zhao X, Han Y, Tan XQ, Wang J, Zhou ZJ. Optimization of antifungal lipopeptide production from
Bacillus sp. BH072 by response surface methodology. J Microbiol. 2014,52(4):324-332.
144. Malfanova N, Franzil L, Lugtenberg B, Chebotar V, Ongena M. Cyclic lipopeptide profile of the plant-
beneficial endophytic bacterium Bacillus subtilis HC8. Arch Microbiol. 2012,194(11):893-899.
145. Abderrahmani A, Tapi A, Nateche F, Chollet M, Leclere V, Wathelet B, et al. Bioinformatics and
molecular approaches to detect NRPS genes involved in the biosynthesis of kurstakin from Bacillus
thuringiensis. Appl Microbiol Biotechnol. 2011,92(3):571-581.
146. Shoji J, Hinoo H. Chemical characterization of new antibiotics, cerexins A and B. (Studies on
antibiotics from the genus Bacillus. II). J Antibiot (Tokyo). 1975,28(1):60-63.
147. Hathout Y, Ho YP, Ryzhov V, Demirev P, Fenselau C. Kurstakins: a new class of lipopeptides isolated
from Bacillus thuringiensis. J Nat Prod. 2000,63(11):1492-1496.
148. Luo C, Liu X, Zhou X, Guo J, Truong J, Wang X, et al. Unusual Biosynthesis and Structure of
Locillomycins from Bacillus subtilis 916. Appl Environ Microbiol. 2015,81(19):6601-6609.
149. Luo C, Liu X, Zhou H, Wang X, Chen Z. Nonribosomal peptide synthase gene clusters for lipopeptide
biosynthesis in Bacillus subtilis 916 and their phenotypic functions. Appl Environ Microbiol.
2015,81(1):422-431.
150. Choi SK, Park SY, Kim R, Kim SB, Lee CH, Kim JF, et al. Identification of a polymyxin synthetase
gene cluster of Paenibacillus polymyxa and heterologous expression of the gene in Bacillus subtilis. J
Bacteriol. 2009,191(10):3350-3358.
151. Huang E, Yousef AE. The lipopeptide antibiotic paenibacterin binds to the bacterial outer membrane
and exerts bactericidal activity through cytoplasmic membrane damage. Appl Environ Microbiol.
2014,80(9):2700-2704.
Antimicrobial Compounds of Bacillales Species
105
152. Ding R, Wu XC, Qian CD, Teng Y, Li O, Zhan ZJ, et al. Isolation and identification of lipopeptide
antibiotics from Paenibacillus elgii B69 with inhibitory activity against methicillin-resistant
Staphylococcus aureus. J Microbiol. 2011,49(6):942-949.
153. Pichard B, Larue JP, Thouvenot D. Gavaserin and saltavalin, new peptide antibiotics produced by
Bacillus polymyxa. FEMS Microbiol Lett. 1995,133(3):215-218.
154. Huang Z, Hu Y, Shou L, Song M. Isolation and partial characterization of cyclic lipopeptide antibiotics
produced by Paenibacillus ehimensis B7. BMC Microbiol. 2013,13:87.
155. Qian CD, Wu XC, Teng Y, Zhao WP, Li O, Fang SG, et al. Battacin (Octapeptin B5), a new cyclic
lipopeptide antibiotic from Paenibacillus tianmuensis active against multidrug-resistant Gram-negative
bacteria. Antimicrob Agents Chemother. 2012,56(3):1458-1465.
156. Azevedo EC, Rios EM, Fukushima K, Campos-Takaki GM. Bacitracin production by a new strain of
Bacillus subtilis. Extraction, purification, and characterization. Appl Biochem Biotechnol.
1993,42(1):1-7.
157. Ducluzeau R, Dubos F, Raibaud P, Abrams GD. Inhibition of Clostridium perfringens by an antibiotic
substance produced by Bacillus licheniformis in the digestive tract of gnotobiotic mice: effect on other
bacteria from the digestive tract. Antimicrob Agents Chemother. 1976,9(1):20-25.
158. Ozcengiz G, Ogulur I. Biochemistry, genetics and regulation of bacilysin biosynthesis and its
significance more than an antibiotic. New biotechnol. 2015,32(6):612-619.
159. Borisova SA, Circello BT, Zhang JK, van der Donk WA, Metcalf WW. Biosynthesis of rhizocticins,
antifungal phosphonate oligopeptides produced by Bacillus subtilis ATCC6633. Chem Biol.
2010,17(1):28-37.
160. Lee JY, Passalacqua KD, Hanna PC, Sherman DH. Regulation of petrobactin and bacillibactin
biosynthesis in Bacillus anthracis under iron and oxygen variation. Plos One. 2011,6(6):e20777.
161. Tang Y, Frewert S, Harmrolfs K, Herrmann J, Karmann L, Kazmaier U, et al. Heterologous expression
of an orphan NRPS gene cluster from Paenibacillus larvae in Escherichia coli revealed production of
sevadicin. J Biotechnol. 2015,194:112-114.
162. Hansen J, Pschorn W, Ristow H. Functions of the peptide antibiotics tyrocidine and gramicidin.
Induction of conformational and structural changes of superhelical DNA. Eur J Biochem.
1982,126(2):279-284.
163. Kleinkauf H, Gevers W. Nonribosomal polypeptide synthesis: the biosynthesis of a cyclic peptide
antibiotic, gramicidin S. Cold Spring Harb Sym. 1969,34:805-813.
164. Kondejewski LH, Farmer SW, Wishart DS, Kay CM, Hancock RE, Hodges RS. Modulation of
structure and antibacterial and hemolytic activity by ring size in cyclic gramicidin S analogs. J Biol
Chem. 1996,271(41):25261-25268.
165. Krätzschmar J, Krause M, Marahiel MA. Gramicidin S biosynthesis operon containing the structural
genes grsA and grsB has an open reading frame encoding a protein homologous to fatty acid
thioesterases. J Bacteriol. 1989,171(10):5422-5429.
166. Mootz HD, Marahiel MA. The tyrocidine biosynthesis operon of Bacillus brevis: complete nucleotide
sequence and biochemical characterization of functional internal adenylation domains. J Bacteriol.
1997,179(21):6843-6850.
Chapter 2
106
167. Wu XC, Qian CD, Fang HH, Wen YP, Zhou JY, Zhan ZJ, et al. Paenimacrolidin, a novel macrolide
antibiotic from Paenibacillus sp. F6-B70 active against methicillin-resistant Staphylococcus aureus.
Microb Biotechnol. 2011,4(4):491-502.
168. Barsby T, Kelly MT, Andersen RJ. Tupuseleiamides and basiliskamides, new acyldipeptides and
antifungal polyketides produced in culture by a Bacillus laterosporus isolate obtained from a tropical
marine habitat. J Nat Prod. 2002,65(10):1447-1451.
169. Patel PS, Huang S, Fisher S, Pirnik D, Aklonis C, Dean L, et al. Bacillaene, a novel inhibitor of
procaryotic protein synthesis produced by Bacillus subtilis: production, taxonomy, isolation, physico-
chemical characterization and biological activity. J Antibiot (Tokyo). 1995,48(9):997-1003.
170. Moldenhauer J, Chen XH, Borriss R, Piel J. Biosynthesis of the antibiotic bacillaene, the product of a
giant polyketide synthase complex of the trans-AT family. Angew Chem Int Edit. 2007,46(43):8195-
8197.
171. Wu L, Wu H, Chen L, Yu X, Borriss R, Gao X. Difficidin and bacilysin from Bacillus
amyloliquefaciens FZB42 have antibacterial activity against Xanthomonas oryzae rice pathogens. Sci
Rep. 2015,5:12975.
172. Chen XH, Vater J, Piel J, Franke P, Scholz R, Schneider K, et al. Structural and functional
characterization of three polyketide synthase gene clusters in Bacillus amyloliquefaciens FZB 42. J
Bacteriol. 2006,188(11):4024-4036.
173. Gustafson K, Roman M, Fenical W. The macrolactins, a novel class of antiviral and cytotoxic
macrolides from a deep-sea marine bacterium. J Am Chem Soc. 1989,111(19):7519-7524.
174. Schneider K, Chen XH, Vater J, Franke P, Nicholson G, Borriss R, et al. Macrolactin is the Polyketide
Biosynthesis Product of the pks2 Cluster of Bacillus amyloliquefaciens FZB42. J Nat Prod. 2007,70
(9):1417-1423.
175. Lipomi DJ, Langille NF, Panek JS. Total synthesis of basiliskamides A and B. Org Lett.
2004,6(20):3533-3536.
176. Yadav JS, Rao PP, Reddy MS, Prasad AR. Stereoselective synthesis of basiliskamides A and B via
Prins cyclisation. Tetrahedron Lett. 2008,49(37):5427-5430.
177. Li S, Zhang R, Wang Y, Zhang N, Shao J, Qiu M, et al. Promoter analysis and transcription regulation
of fus gene cluster responsible for fusaricidin synthesis of Paenibacillus polymyxa SQR-21. Appl
Microbiol Biotechnol. 2013,97(21):9479-9489.
178. Yu WB, Yin CY, Zhou Y, Ye BC. Prediction of the mechanism of action of fusaricidin on Bacillus
subtilis. Plos One. 2012,7(11):e50003.
179. Cochrane SA, Lohans CT, van Belkum MJ, Bels MA, Vederas JC. Studies on tridecaptin B(1), a
lipopeptide with activity against multidrug resistant Gram-negative bacteria. Org Biomol Chem.
2015,13(21):6073-6081.
180. Sood S, Steinmetz H, Beims H, Mohr KI, Stadler M, Djukic M, et al. Iturin family lipopeptides from
the honey bee pathogen Paenibacillus larvae. Chembiochem. 2014,15(13):1947-1955.
181. Luo Y, Ruan LF, Zhao CM, Wang CX, Peng DH, Sun M. Validation of the intact zwittermicin A
biosynthetic gene cluster and discovery of a complementary resistance mechanism in Bacillus
thuringiensis. Antimicrob Agents Chemother. 2011,55(9):4161-4169.
Antimicrobial Compounds of Bacillales Species
107
182. Kevany BM, Rasko DA, Thomas MG. Characterization of the complete zwittermicin A biosynthesis
gene cluster from Bacillus cereus. Appl Environ Microbiol. 2009,75(4):1144-1155.
183. Garcia-Gonzalez E, Muller S, Hertlein G, Heid N, Sussmuth RD, Genersch E. Biological effects of
paenilamicin, a secondary metabolite antibiotic produced by the honey bee pathogenic bacterium
Paenibacillus larvae. Microbiologyopen. 2014,3(5):642-656.
184. Lechner M, Findeiß S, L. S, Marz M, Stadler P, Prohaska S. Proteinortho: Detection of (Co-)Orthologs
in Large-Scale Analysis. BMC Bioinformatics. 2011,12(1):124.
108
109
Chapter 3
Isolation and identification of antifungal
peptides from Bacillus BH072, a novel
bacterium isolated from honey
Xin Zhao1, Zhijiang Zhou
1, Ye Han
1, Zhanzhong Wang
1, Jie Fan
1, Huazhi Xiao
1*
1 School of Chemical Engineering and Technology, Tianjin University, 300072 Tianjin,
P. R. China
This chapter has been published in Microbiological Research.
doi: org/10.1016/j.micres.2013.03.001 (2013).
Chapter 3
110
Abstract
A bacterial strain BH072 isolated from a honey sample showed antifungal activity
against molds. Based on the morphological, biochemical, physiological tests, and
analysis of the 16S rDNA sequence, the strain was identified to be a new
subspecies of Bacillus sp.. It had a broad spectrum of antifungal activity against
various molds such as Aspergillus niger, Pythium, and Botrytis cinerea. Six pairs of
primers of antifungal genes were designed and synthesized, and ituA, hag and tasA
genes were detected by PCR analysis. The remarkable antifungal activity could be
corresponding to the above-mentioned genes. One of these three antifungal
peptides was purified by 30%-40% ammonium sulfate precipitation, Sephadex G-
75 gel filtration and anion exchange chromatography on D201 resin. The purified
peptide was estimated to be 35.615 kDa and identified to be flagellin by
micrOTOF-Q II. By using methanol extraction, another substance was isolated
from fermentation liquor, and determined to be iturin with liquid chromatograph-
mass spectrometer (LC-MS) method. The third possible peptide encoded by tasA
was not isolated in this study. The culture liquor displayed antifungal activity in a
wide pH range (5.0-9.0) and at 40 °C-100 °C. The result of the present work
suggested that Bacillus BH072 might be a bio-control bacterium of research value.
Keywords: Bacillus, antifungal peptide, purification, identification
Antifungal peptides from Bacillus BH072
111
1. Introduction
Fungi are widespread in nature. It frequently contaminates food crops, food raw
materials and processed products. Fungal contamination causes not only huge
economic losses, but also food safety issues, some of which result in human and
animal diseases [1]. Prevention and control of fungal contamination is an important
issue in the field of industry, agriculture and medicine. By the food
industry, chemical preservatives are generally used to control the growth and
reproduction of fungi. Due to the chemical residue, food safety issues become more
and more serious. Some microbes can produce antimicrobial metabolites which can
inhibit or kill other microorganisms. Antifungal peptides are one of the most
important natural defenses against the invading of most fungal pathogens.
Some have been developed to be the food preservatives and bio-pesticides, which
has provided a new choice to prevent and control the fungal contamination of
agricultural products.
Through the research of bio-control against fungi, antifungal peptides play an
important role. According to the Antimicrobial Peptide Database (APD), 756
different antifungal peptides were isolated from different organisms, such as
humans, animals, reptiles, birds, insects and microbes
(http://aps.unmc.edu/AP/main.php). By blocking its synthesis or destroying the
synthesis of fungal cell wall or forming holes in lipid membranes leading to
leakage of the important contents of the fungi that cause death. Some peptides
reacted to fungal mitochondria and nucleic acid within cells causes death, too.
According to reports, Pseudomonas, Bacillus, Aspergillus, Streptomyces, edible
fungi and other microorganisms can produce different antifungal substances, such
as antifungal polypeptide. Among them, the Bacillus species are widely used [2].
Therefore, the study of the unknown bacteria and their antibiotic substances is of
great significance.
Chapter 3
112
Most bacteria of the genus Bacillus are Gram-positive, aerobic endospore-forming
and rod-shaped bacteria, which are found in diverse environments such as soil and
clays, rocks, dust, aquatic environments, vegetation, food and the gastrointestinal
tracts of various insects and animals [2]. Commercial products including enzymes,
antibiotics, amino acids and insecticides are produced by Bacillus sp.. The potential
of Bacillus species to secrete various peptides which have shown distinct capacities
to inhibit plant pathogens, such as fungi and bacteria with high concentrations,
have been known for more than 50 years. To date, a lot of antimicrobial peptides
produced by Bacillus sp. were reported. A Bacillus amyloliquefaciens CCMI 1051
strain was isolated which had strong inhibition capacity on both Rhizopus sp. L-
122 and Trichoderma harzianum CCMI 783 [3, 4]. Arrebola et al. reported that B.
amyloliquefaciens PPCB004 could inhibit Penicillium crustosum hyphal extension
[5]. Lee et al. discovered Botrytis cinerea was inhibited by Bacillus WJ5
(Paenibacillus lentimorbus) and its antifungal substances were extracted [6]. Quan
et al. and Zhang et al. isolated B. amyloliquefaciens Q-12 and NK10.B and
displayed a strong inhibitory effect on Fusarium oxysporum, Fusarium solani and
other fungi [7, 8]. Many researches indicated that the Bacillus sp. strains
themselves and their antimicrobial substances had huge application potential in
bio-control of plant diseases. Some antibiotics have been a certain degree of
application. The United States has 4 bio-control B. subtilis strains including GBO3,
MBI600, QST713 and B. subtilis var. amyloliquefaciens FZB24, obtained the
Environmental Protection Agency (EPA) approval, which can be applied to
commercial production (http://www.epa.gov/pesticides/biopesticides).
Antifungal materials produced by Bacillus strains have the following two kinds of
molecules. Ribosomal synthesized antimicrobial proteins contain bacteriocins [9,
10], cell wall degrading enzymes (such as proteases, chitinase, β-1, 3-glucan) as
well as some unidentified inhibitory proteins [11, 12]. The non-ribosomal
synthesized antibiotics primarily include lipopeptide antibiotics, such as surfactin,
Antifungal peptides from Bacillus BH072
113
iturin and fengycin [13-20]. Lipopeptide antibiotics with antimicrobial activity
against filamentous fungi and yeasts are mostly D-type and L-type amino acid
cyclic peptides, with a fatty acid chain.
According to literature, most strains of Bacillus sp. produced only one or two
antimicrobial substances. Mora et al. cloned six antimicrobial peptide genes from
Bacillus strains of environment origin, and determined that they encoded different
lipopeptides [21]. Large molecular antimicrobial proteins have rarely been
reported. Hammami et al. pointed out that B. subtilis 14B produced a novel
bacteriocin (Bac 14B) weighted 31 kDa that was highly effective as a bio-control
agent against crown gall disease [22, 23]. Most of the references reported that
TasA and flagellin were obtained through genetic engineering method. Yang et al.
cloned and expressed the tasA gene, and the expressed product showed antifungal
activity against cucumber gray mold [24]. Asano et al. cloned the hag gene, the
antifungal activity of its expressed product flagellin explained the inhibitory
appearance of Bacillus strains B-3, NK-330 and NK-C-3 [25]. By now, TasA and
flagellin have not been purified directly by normal protein extract methods from
Bacillus strains fermentation liquor. The novel bacterium BH072 isolated from
honey showed strong antifungal activity against a lot of molds. In order to explain
the antifungal activity, the peptides of fermentation broth were isolated and
identified by a combination of several purification methods, and their genes were
retrieved and analyzed. We try to elucidate the nature of antifungal substances and
explore the possibility of their further application.
2. Materials and methods
2.1. Microbial strains and culture medium
The microorganism BH072 used in this study was isolated from a honey sample.
Three Bacillus strains B. subtilis BH121, B. licheniformis BH122 and B. subtilis
Chapter 3
114
Natto BH123 and the indicator strains of Escherichia coli, Staphylococcus aureus,
Pythium, Penicillium, Colletotrichum orbiculare and Saccharomyces cerevisiae
were preserved at Food biotechnology laboratory of Tianjin University. The
indicator Aspergillus niger CGMCC3.03928, B. cinerea CGMCC3.4584 and F.
oxysporum CGMCC3.2830 were purchased from China General Microbiological
Culture Collection Center. All the medium components used in this study were
reagent pure grade purchased from Jiangtian Chemical Technology Co., Ltd.
(Tianjin, China). Solid media used in the antifungal study consisted of potato
dextrose agar for fungi (PDA: potato, 200 g; glucose, 20 g; agar, 18 g; and distilled
water, 1L) and Luria-Bertani agar for bacteria (LBA: peptone, 10 g; yeast extracts,
5 g; NaCl, 10 g; agar, 18 g; and distilled water, 1L). Liquid media, the same agar-
lacking LBA, were used for fermentation test. The strain BH072 was activated by
transferring single colonies of the strain from plates to 10 mL activation LB
medium extract in 50-mL flasks. The flasks were shaken at 37 °C, 150 rpm for 16
h.
2.2. Microscopic examination and Physiological-biochemical identification
According to Deng et al., the sample was prepared and applied to scanning electron
microscope (XL-30 TMP, Philips, the Netherlands) [26]. Physiological-
biochemical tests include sugar fermentation experiments, acid yield experiment,
optimum growth temperature and pH measurement, salt tolerance test, resistance to
organic acid experiment, gelatin puncture, casein and starch hydrolysis.
2.3. 16S Ribosomal DNA sequence analysis
The genomic DNA of strain BH072 was used as a template. The 16S ribosomal
DNA sequence was amplified and sequenced using universal primers 8F:5'-
AGAGTTTGATCATGGCTCAG-3' and 1492R: 5'-ACGGTTACCTTGTTACG
ACTT-3' [27]. The amplification was conducted by polymerase chain reaction in a
Antifungal peptides from Bacillus BH072
115
PCR thermal cycler (MyCycler, Bio-Rad Laboratories Inc., USA). The PCR
amplification system was 25 µL, including 0.2 µL Taq enzyme (0.5 U/mL), 2.5 µL
10× Buffer, 1.8 µL Mg2+
, 1 µL dNTPs Mixture, 1 µL template DNA, 0.5 µL
forward primer (10 µM), 0.5 µL reverse primer (10 µM) and 17.5 µL ddH2O.
Amplification factor: 95 °C, 3 min; 95 °C, 30 s, 55 °C, 60 s, 72 °C 90 s, 30 cycle;
72 °C, 5 min; 4 °C termination reaction. The amplified products were purified and
sequenced by Sangon Biotech Co., Ltd. (Shanghai, China).
2.4. Phylogenic tree construction
According to 16S rDNA sequencing results, combined with GenBank in the genus
Bacillus in 16S rDNA sequences, using MEGA 4.0 [28] software by the neighbor-
joining analysis [29], phylogenetic tree was constructed.
2.5. Cloning of antifungal genes by PCR analysis
DNA was extracted respectively from an overnight culture of Bacillus BH072, B.
subtilis BH121, B. licheniformis BH122 and B. subtilis Natto BH123. Specific
primers for the functional genes of the peptides [30]: ituA (iturin A), hag
(flagellin), tasA (TasA), srf (surfactin), spaS (subtilin) and mrsA (mersacidin)
genes are listed in Table1. The amplification system was the same as 16S rDNA
sequences amplification system. Amplification factor: 95 °C, 3 min; 95 °C, 30 s, 51
°C, 60 s, 72 °C, 90 s, 30 cycle; 72 °C, 5 min; 4 °C termination reaction. The PCR
product was gel-purified and ligated to pUCm-T vector (Sangon Biotech Co., Ltd.,
Shanghai, China) to facilitate DNA sequencing. After transformation into
competent cells of E. coli DH5α, the recombinants were selected on LB agar plates
supplemented with ampicillin. By a colonial PCR reaction using the corresponding
primers, further identification was conducted. And the aimed plasmid was
sequenced by Sangon Biotech Co., Ltd. (Shanghai, China). Sequencing data were
applied to retrieve for homologous sequences with the BLAST algorithm in
Chapter 3
116
GenBank (National Center for Biotechnology Information [http://www.ncbi. nlm.
nih.gov]).
Table 1. Specific primers for the functional genes of the peptides
Genes Primers
ituA (D21876.1) ituAF: 5’- atgaaaatttacggagtatatatg - 3’
ituAR: 5’- ttataacagctcttcatacgtt - 3’
hag (AB033501.1) hagF: 5’- atgagaatcaaccacaatatcgc - 3’
hagR: 5’- ttaacctttaagcaattgaagaac - 3’
tasA (JF791687.1) tasAF: 5’- atgggtatgaaaaagaaattaag - 3’
tasAR: 5’- ttagtttttatcctcactgtga - 3’
srf (EU882341.1) srfF: 5’- atgaagatttacggaatttatatg - 3’
srfR: 5’- ttataaaagctcttcgtacgag- 3’
spaS (DQ452514.1) spaSF: 5’- atgtcaaagttcgatgatttcga - 3’
spaSR: 5’- ttatttagagattttgcagttaca - 3’
mrsA (Z47559.1) mrsAF: 5’- atgagtcaagaagctatcattcg - 3’
mrsAR: 5’- ttaacaaatacattcagaagttag - 3’
2.6. Purification and identification of flagellin
For the production of flagellin, the strain Bacillus BH072 was grown in 500 mL
LB medium at 37 °C in a shaker at 150 rpm for 24 h from a seed culture medium.
After cultivation, the cells were harvested by centrifugation at 4200 rpm for 20
min. The culture supernatant was sterilized by filtration with 0.22 µm membranes
(Millipore, USA). The filtrate was precipitated with ammonium sulfate at 30%-
40% (w/v) saturation and the resulting pellet was dissolved in 10 mM Tris-HCl
buffer of pH 9.0 (buffer A). This solution was further purified by gel filtration
chromatography using a 2.5 cm×25 cm Sephadex G-75 column eluted with buffer
A. The peak with antifungal activity was collected to anion exchange
chromatography on D201 resin eluted using a linear NaCl gradient (0-1.0 M in
buffer A). Fractions were also monitored for A280 nm using a spectrophotometer
Antifungal peptides from Bacillus BH072
117
(HD-3 Ultraviolet Detector, shanghai, China). The antifungal activity peak was
freeze-dried and suspended in buffer A. During purification, the arbitrary activity
units (AU) was quantified as described elsewhere using A. niger CGMCC3.03928
as indicator organism [31].
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) [32] was
performed to determine the molecular weight of the peptide showing antifungal
activity. The agents used in SDS-PAGE were all purchased from Dingguo
Chemical Technology Co., Ltd. (Beijing, China). The electrophoresis was
accomplished with a 5% stacking gel, 12% running gel, and a sample buffer
containing 1.0 M Tris-HCl (pH 6.8), 20% glycerol, 4% SDS, 10% 2-
mercaptoethanol, and 0.4% bromophenol blue. After electrophoresis at 120 V and
30 mA for 0.5 h in the spacer gel, 180 V and 60 mA for 1 h in the separation gel,
the gel was stained with a solution composed of 0.25% Coomassie Brilliant Blue
R-250, 5% methanol, 7.5% acetic acid, and distilled water and was destained using
a solution of methanol: acetic acid: ddH2O (4.5:4.5:1 v/v/v). The electrophoretic
band was cut off, enzymolyzed and analyzed by mass spectrometry in a
micrOTOF-Q II mass spectrometer (Autoflex tof/tof III, Bruker Daltonic Inc.,
USA). Then the antifungal substance was identified through searching the Protein
Data Base (PDB).
2.7. Isolation and identification of iturin A
Strain BH072 was incubated from a seed culture medium in 500 mL shake flask
with 200 mL LB medium, at 30 °C, 150 rpm for 60 h. After cultivation, the culture
was centrifuged at 4200 rpm for 20 min. In order to adjust to pH of 2.0, 6 M HCl
was added to cell-free supernatant, then stored at 4 °C overnight [33]. The
precipitate was collected by centrifugation at 4200 rpm for 20 min at 4 °C and
dried by freeze-drying, and the residue was extracted with 200 mL of methanol
under shaking for 24 h at room temperature. The crude product was obtained by
Chapter 3
118
centrifugation at 4200 rpm for 20 min and applied to liquid chromatograph-mass
spectrometer (Thermo Fisher Corporate, USA). The iturin A in filtrate was purified
with a reverse-phase high-performance liquid chromatography (RP-HPLC) column
C18 (Venusil XBP, 5 μm,2.1 mm×150 mm, Agela Corporate, USA) operated at a
flow rate of 1.0 mL/min. A mixture of acetonitrile and 0.1% methane acid was used
as the eluent and the elution was monitored by MS through 600 m/z-1300 m/z, and
determined its molecular weight [34].
2.8. Inhibitory spectrum of the strain BH072
To test antifungal activity, the strain was inoculated into 10 mL of LB liquid
medium at 37 °C, 150 rpm for 12 h, and then transferred to 500 mL shake flask.
The obtained culture was centrifuged at 4200 rpm at 0 °C for 30 min. The cell-free
supernatant was extracted drastically at room temperature as crude extract. The
ability of the strain BH072 to produce antifungal substances was assessed using the
Oxford cup method [35], which was briefly described as followed. 1 mL fungal
spore suspension was uniformly added into 100 mL PDA medium at 40 °C-50 °C,
which coated on solid beef extract peptone plate with oxford cup in. Then 5 μL
crude extract was added in the midpoint of the oxford cup, cultivated at 30 °C for
48 h, and antimicrobial circle diameter was measured. The spectrum of
antimicrobial activity was determined by screening against cultures of A. niger
CGMCC3.03928, B. cinerea CGMCC3.4584, F. oxysporum CGMCC3.2830, E.
coli, S. aureus, Pythium, Penicillium, C. orbiculare, S. cerevisiae. In order to
certify the wide antifungal property of the strain BH072, the spectrum of
antimicrobial activity of B. subtilis BH121, B. licheniformis BH122 and B. subtilis
Natto BH123 was also detected by antimicrobial assays as control.
2.9. Effects of enzymes, pH and heat on antifungal activity
A. niger CGMCC3.03928 was used as the indicator to detect the antifungal
Antifungal peptides from Bacillus BH072
119
activity. The cell-free supernatant was treated at 37 °C for 1 h with 2 mg/mL final
concentration of proteinase K. To analyze thermal stability, the supernatant
exposed to temperatures ranging 20 °C to 100 °C for 30 min respectively, and 121
°C for 20 min. The pH stability was determined by adding a series of solutions (pH
2 to 12) and assaying the activity after 2 h at 37 °C. The antifungal activity was
checked using the oxford cup method. Then antimicrobial circle diameter was
measured.
3. Results
3.1. Characteristics of morphology, physiology and biochemistry
The colony of the strain on LBA plate was flat, slightly rough, nearly circular,
white (approximate candle color) and displayed as Gram-positive Bacillus under
microscopy. As is shown in the strain scanning electron micrographs (Fig. 1), the
cells were rod-shaped and have a length of (0.8-1.5) µm. Based on the
physiological and biochemical character of Bacillus sp. [36], biochemical tests
(Table 2) indicated that the most probable identity of the isolate was B. subtilis and
B. amyloliquefaciens. The optimum culture condition was at 37 °C, pH 7.4.
Fig. 1. Scanning electron micrograph of strain BH072 cultivated in LB liquid
Chapter 3
120
medium at 37 °C, 150 rpm for 24 h.
Table 2. Biochemical tests used to identify Bacillus BH072
Physiological and biochemical
tests
Results
Bacillus BH072 B. subtilis B. amyloliquefaciens
glucose + + +
fructose + + +
maltose + + +
lactose - - +
Splitting of urea - + +
Amylolysis test + + +
Gelatin liquefaction test + + +
Caseinde composition test + + +
Growth in 5% NaCl + + +
Growth in 10% NaCl + + +
Growth in 5% CH3COOH - - -
‘+’ indicates reaction-positive, ‘-’ indicates reaction-negative.
3.2. 16S Ribosomal DNA sequence analysis and phylogenic tree construction
The 16S rDNA sequence of the amplified PCR product was determined. Sequences
of 992 bp fragments showed similarity (minimum identity 98%) with the Bacillus
sp.. The phylogenetic tree (Fig. 2) inferred from the 16S rDNA sequences showed
that the strain formed a monophyletic clad, which was closest to but could be
clearly distinguished from B. subtilis and B. amyloliquefaciens. Both molecular and
phenotypic characterization showed that the Bacillus BH072 might belong to a new
subspecies of Bacillus sp..
Antifungal peptides from Bacillus BH072
121
Fig. 2. Phylogenetic tree based on the 16S rDNA sequences showing the
position of strain BH072. The type strains of Bacillus sp. and representatives of
some other related taxa. Scale bar represents 0.001 substitutions per nucleotide
position.
3.3. Inhibitory spectrum of the antifungal peptides
Spectrum of antifungal activity of Bacillus strains was determined based on the
degree of growth inhibition of some fungi and other microbes by direct antagonism
on agar plates using Oxford cup method [35]. In this study, strain BH072 showed
inhibition against A. niger CGMCC3.03928 (inhibition zone >10 mm), F.
oxysporum CGMCC3.2830 (inhibition zone >10 mm), Pythium (1 mm < inhibition
zone <10 mm) and B. cinerea CGMCC3.4584 (1 mm < inhibition zone <10 mm),
but it had no inhibition on E. coli, S. aureus, Penicillium, C. orbiculare and S.
cerevisiae. B. subtilis BH121 had antifungal activity against F. oxysporum
Chapter 3
122
CGMCC3.2830 (1 mm < inhibition zone <10 mm) and B. cinerea CGMCC3.4584
(1 mm < inhibition zone <10 mm). B. licheniformis BH122 could inhibit F.
oxysporum CGMCC3.2830 (1 mm < inhibition zone <10 mm) and B. subtilis Natto
BH123 had no inhibition on all the indicators.
3.4. Detection of genes related to antifungal peptides
Six pairs of primers of antifungal genes were designed and synthesized and three of
them including ituA, hag and tasA genes were detected by PCR analysis and
sequenced, but srf, spas and mrsA genes were not. The first sequence possesses 675
bp in length was 99% homology with gene ituA, and 10 point mutations were
observed. The second sequence of 786 bp showed a 99% similar identify to gene
tasA, and 6 point mutations were observed. The third 1002 bp fragment showed
elevated similarity (96%) with the gene hag, and 37 point mutations were
observed. An agarose gel is shown in Fig. 3. The detection of genes related to
antifungal peptides about B. subtilis BH121, B. licheniformis BH122 and B. subtilis
Natto BH123 was listed in Table 3.
Table 3. Detection of genes related to antifungal peptides
Strains Genes
tasA ituA hag
B. subtilis BH121 + - +
B. licheniformis BH122 - + +
B. subtilis Natto BH123 - - -
Bacillus BH072 + + +
‘+’ indicates reaction-positive, ‘-’ indicates reaction-negative.
Antifungal peptides from Bacillus BH072
123
Fig. 3. Agarose gel electrophoresis of aimed DNA detected from strain BH072;
Lane 1, PCR product generated by primer hagF and hagR; Lane 2, PCR product
generated by primer ituAF and ituAR; Lane 3, PCR product generated by primer
tasAF and tasAR; Lane M 5000bp DNA marker SGM03.
3.5. Purification and identification of flagellin
Proteins present in the cell-free supernatant were collected by ammonium sulfate
precipitation (30%-40%, w/v) (fraction I) followed by Sephadex G-75 column
chromatography (Fig. 4A peak 1, fraction II) and anion exchange chromatography
on D201 resin (Fig. 4B peak 1, fraction III). Peak 1 in anion-exchange
chromatography graph and peak 1 in gel chromatography diagram showed
antifungal activity against A. niger. To obtain a highly purified peptide, fraction III
was freeze-dried and dissolved in buffer A, which was subjected to SDS-PAGE. It
also revealed a single monomeric protein band with a molecular mass estimated to
be 35 kDa (Fig. 5). MicrOTOF-Q II analysis indicated that this peptide had a
molecular mass of 35.615 kDa and identified as flagellin. The purification process
was summarized in Table 4 and the antifungal peptide purity was estimated to be
approximately 69-fold greater than that of the crude extract. The yield of the
purified peptide preparation was approximately 40% based on total activity, while
its specific activity was 7168.5 AU/mg.
Chapter 3
124
Fig. 4. (A) Gel filtration chromatography of the active fractions from gel
column chromatography on Sephadex G-75. Column size, 2.5 cm×25 cm; flow
rate, 1 mL/min; eluent, buffer A; fraction size, 2 mL; absorbance, 280 nm. (B)
Anion-exchange chromatography of the active fraction (peak 1 in A) from anion-
exchange column chromatography on D201 resin. Column size, 2.5 cm×25 cm;
flow rate, 1 mL/min; eluent, a linear NaCl gradient (0-1.0 M in buffer A); fraction
size, 2 mL; absorbance, 280 nm.
Fig. 5. Molecular weight and SDS-PAGE of the purified peptide. Lane M,
molecular mass standard (Protein Molecular Weight Marker BM524), Lane 1,
crude peptide, fraction I, Lane 2, purified peptide, fraction III.
Antifungal peptides from Bacillus BH072
125
Table 4. Purification summary of flagellin produced by Bacillus BH072
Purification step Total activity
(AU) ×103
Total protein
(mg)
Specific
activity(AU/mg)
Yield
(%)
Purification
(factor)
Crude extract 500 ± 11 4745.1 ± 13 105.3 100 1
(NH4)2SO4
Fractionation
(30%-40%)
360 ± 9 250.8 ± 4 1435.4 72 14
Sephadex G-75 220 ± 4 73.2 ± 3 3005.4 44 29
Ion Exchange
chromatography 200 ± 1 27.9 ± 3 7168.5 40 68
3.6. Determination of antifungal product iturin A with LC-MS
LC-MS of total methanol extract fraction was used to confirm and analyze the
composition of the total active fraction. Fig. 6 showed the current chromatograms
obtained at different corresponding molecular weights (2-8). The first peak was
stood for the solvent. Seven compounds designated as 2, 3, 4, 5, 6, 7 and 8 were
visualized at 4.72 min (M = 1057.6 Da), 6.80 min (M = 1071.5 Da), 14.00 min (M
= 1016.7 Da), 16.34 min (M = 1030.5 Da), 19.67 min (M = 1044.8 Da), 21.72 min
(M = 1034.7 Da) and 22.41 min (M = 1058.9 Da) respectively. Compounds
corresponding to a mass 1016 Da-1071 Da might actually be isomers. The species
B. amiloliquefaciens has been reported to produce lipopeptides with antifungal
activity. Hiradate et al. isolated iturin A2-A8 (m/z values 1043-iturin A2; 1057-
iturin A3-A5; 1071-iturin A6 and A7; 1085-iturin A8) from B. amiloliquefaciens
RC-2 [37]. Yu et al. demonstrated that the antifungal compounds produced by the
strain B94 of B. amiloliquefaciens (m/z values 1044.3, 1047.9 and 1069.5) were
isomers of iturin A [38]. Caldeira et al. using LS-ESI-MS also identified 2 iturin
isomers (m/z values 1031.5 and 1045.5) [39]. The results suggested that the
compounds between 1000 Da and 1100 Da produced by Bacillus BH072 were
iturin.
Chapter 3
126
Antifungal peptides from Bacillus BH072
127
Fig. 6. (A) RP-HPLC Chromatogram corresponding to LC-MS of the
methanolic fraction. A C18 semi-preparative column (2.1 mm×150 mm) was used
with flowing phase, a mixture of acetonitrile and 0.1% methane acid, and eluted at
a flow rate of 1.0 mL/min. (B) Chromatogram corresponding to LC-MS of mass
spectra of the compounds(1-8). (1) Mass spectra corresponding to the peak 1 m/z
1067.7. (2) Mass spectra corresponding to the peak 2 m/z 1057.6. (3) Mass spectra
corresponding to the peak 3 m/z 1071.5. (4) Mass spectra corresponding to the
peak 4 m/z 1016.7. (5) Mass spectra corresponding to the peak 5 m/z 1030.8. (6)
Mass spectra corresponding to the peak 6 m/z 1044.8. (7) Mass spectra
corresponding to the peak 7 m/z 1034.7. (8) Mass spectra corresponding to the
peak 8 m/z 1058.9.
3.7. Effect of enzymes, pH and temperature
The antifungal activity was stable in the pH range from 5.0 to 9.0 (Fig. 7A),
resistant to heating at temperatures higher than 100 °C (Fig. 7B) and treating with
protease K.
Fig. 7. (A) Antifungal activity of the supernatant in different pH solutions
against Aspergillus niger. (B) Antifungal activity of the heat-treated
supernatant against Aspergillus niger.
Chapter 3
128
4. Discussion
The genus Bacillus sp. was a kind of Gram-positive organism which can produce
spores in the environment. Among them, the most important value of Bacillus sp. is
that, it can secrete a variety of peptides and bacteriocins with antimicrobial activity.
For the result of identification of BH072 strain, the sequence of 16S rDNA had
98% homologous with B. subtilis, but according to the phylogenetic tree, it showed
that the strain formed a monophyletic clad, which was closest to but could be
clearly distinguished from B. subtilis and B. amyloliquefaciens. Both molecular and
phenotypic characterization indicated that the Bacillus BH072 might belong to a
new subspecies of Bacillus sp..
The genes ituA, tasA and hag, related to production of antifungal peptides iturin A,
Tas A and flagellin were identified in the same Bacillus strain BH072. However, it
showed a negative PCR for sfp, spaS and mrsA. The co-production of antifungal
substances by the same strain consists of macromolecular proteins flagellin, TasA
and micromolecular lipopeptides iturin A had never been reported before. Co-
production of three or more antibiotics is not usual, but it has been described that
two or three lipopeptides simultaneously produced by the same strain. Kim et al.
demonstrated the production of iturin, fengycin, and surfactin by B. subtilis
CMB32 [40], similar to that observed in strain P7 [41, 42]. The co-production of
different lipopeptides by Bacillus spp. may worsen the purification, and the huge
structural variability makes it complicated to definitively identify different
lipopeptides and their homologs [4, 43]. For the purpose of demonstrating that the
co-production of these three antifungal peptides is really new in Bacillus strains
isolated from honey, three other Bacillus strains stored in our laboratory were
tested to observe whether they have these three antifungal genes or not. The result
showed that the genes ituA, tasA and hag could be detected only in strain BH072
simultaneously.
Antifungal peptides from Bacillus BH072
129
Bacillus BH072 simultaneously has ituA, tasA and hag genes and it is supposed to
produce these three peptides theoretically. Iturin A and flagellin have been purified
and identified in this study. TasA is difficult to be isolated and purified for the
possibility that it might only be produced in spore generation phase. Iturin A was
extracted by methanol from fermentation liquor after cultivated at 30 °C for 60 h.
Flagellin was isolated and purified by a combination of antifungal tests and
chromatography assays from fermentation liquor after cultivated at 37 °C for 24 h.
The specific methods were used to the purification and identification according to
the properties of the peptides. MicrOTOF-Q II [44] has been used as an efficient
tool for identification of high molecular weight peptides, because of its excellent
quality and accuracy, true isotopic distribution pattern with Sigma Fit algorithm
and incomparable quality resolution. The data of the mass spectra of antifungal
peptides from Bacillus sp. was analyzed and blasted to search the homologous
protein from PDB. A combined use of purification methods and antifungal tests
allowed a rapid identification of antifungal peptides.
These three antifungal peptides have their own characteristics and antifungal
spectrum. The iturin family is a kind of cyclic lipopeptide containing 7 amino
acids, with strong antifungal activity. The antifungal mechanism of iturin is putting
its hydrophobic tails insert into the plasma membrane of indicator cells, and
automatically gathering to form ion Channel, thereby enabling cytoplasm leakage.
In addition, iturin A can release electrolyte and polymer aggregate, increase the
electric conductivity and permeability of biomass membrane which results in cell
membrane surface tension effects, inhibiting pathogenic spore formation. Chen et
al. recently isolated the active substance from B. subtilis JA by reversed phase
HPLC separation, identified two iturin A homologs through ESI-CID mass
spectrometry analysis and their molecular weight respectively is 1042 Da and 1056
Da [10]. Antifungal activity test showed that B. subtilis JA could inhibit wheat scab
(F. graminearum), rice sheath blight (R. solani), watermelon fusarium wilt (F.
Chapter 3
130
oxysporum), Pythium irregulare, B. cinerea and other various plant pathogenic.
Flagella is bacterial movement organ, composed of basal body, hook sheath and
flagellar filament. The flagellar filament covered 98% of the total length of the
flagellum, were formed by a single protein subunit - flagellin [45, 46]. Flagellin is
a highly conserved sequence, used as bacterial classification mark [47, 48]. Asano
et al. used flagellin as molecular markers to isolate 60 strains of B. subtilis, based
on flagellin central district (FCD) sequence differences. B. subtilis strains can be
divided into 2 subgroups [3]. A strain DB9011 was the representative of the first
subgroup, in which flagellin generally had antifungal activity, and some strains can
secrete lipopeptide antibiotics similar to the iturin family. Hu et al. isolated B.
subtilis B-FS01 from rape stem which had inhibitory on wheat scab (F.
graminearum) [49]. TasA (translocation-dependent antimicrobial spore protein) is
a kind of spore binding protein of B. subtilis, synthesized from early sporulation to
the cell stationary phase, and then secreted into the culture medium [50, 51, 52].
TasA had a broad spectrum of antimicrobial activity against Gram-positive, Gram-
negative bacteria and some pathogen fungi, such as B. cinerea [53]. According to
the literature, iturin A, flagellin and TasA have their specific antimicrobial
spectrum. Iturin A showed inhibition mainly against F. oxysporum, Bipdaris
maydis and A. niger. TasA had strong antifungal activity against B. cinerea and
flagellin against Fusarium. Based on the antimicrobial assays results of Bacillus
BH072, B. subtilis BH121, B. licheniformis BH122 and B. subtilis Natto BH123,
the new strain Bacillus BH072 possessed a combination of these three peptide
genes and might have a broader antimicrobial spectrum than that occurred in the
previously reported strains.
To sum up, this study identified a novel bacterium isolated from honey sample
which showed significant antifungal activity. The genes of iturin A, flagellin and
TasA were cloned and sequenced. Flagellin and iturin A were purified and
identified by a combined use of several purification methods. The characteristics of
Antifungal peptides from Bacillus BH072
131
these antifungal proteins were primarily tested. The antifungal spectrum needs to
be determined and the antifungal mechanisms should be explored in the future
study. We expect that the strain or its antimicrobial products would contribute to
the bio-control of agricultural pathogens and be used in the field of food safety.
References
1. Hawksworth DL. The magnitude of fungal diversity: the 1.5 million species estimate revisited. Mycol
Res. 2001,105(12):1422-1432.
2. Nicholson WL. Roles of Bacillus endospores in the environment. Cell Mol Life Sci. 2002,59(3):410-
416.
3. Caldeira AT, Feio SS, Arteiro JMS, Roseiro JC. Bacillus amyloliquefaciens CCMI 1051 in vitro activity
against wood contaminant fungi. Ann Microbiol. 2007,57(1):29-33.
4. Caldeira AT, Feio SS, Arteiro JMS, Coelho AV, Roseiro JC. Environmental dynamics of Bacillus
amyloliquefaciens CCMI 1051 antifungal activity under different nitrogen patterns. J Appl Microbiol.
2008,104(3):808-816.
5. Arrebola E, Sivakumar D, Korsten L. Effect of volatile compounds produced by Bacillus strains on
postharvest decay in citrus. Biol Control. 2010,53(1):122-128.
6. Lee YK, Senthilkumar M, Kim JH, Swarnalakshmi K, Annapurna K. Purification and partial
characterization of antifungal metabolite from Paenibacillus lentimorbus WJ5. World J Microbiol
Biotechnol. 2008,24:3057-3062.
7. Quan CS, Wang JH, Xu HT, Fan SD. Identification and characterization of
a Bacillus amyloliquefaciens with high antifungal activity. Acta Microbiologica Sinica. 2006,46(1):7-12.
8. Zhang YS, Wang J, Hao JA, Zhang XZ, Cheng Y. Flocculating activity of Penicillium purpurogenum
EL-02 and its flocculating activity. Acta Microbiologica Sinica. 2010,50(7):917-922.
9. Oscáriz JC, Pisabarro AG. Characterization and mechanism of action of cerein 7, a bacteriocin
produced by Bacillus cereus BC7. J Appl Microbiol. 2000,89(2):361-369.
10. Zheng G, Slavik MF. Isolation, partial purification and characterization of a bacteriocin produced by a
newly isolated Bacillus subtilis strain. Lett. Appl Microbiol. 1999,28(5):363-367.
11. Manjula K,Kishore GK,Podile AR. Whole cells of Bacillus subtilis AF1 proved more effective than
cell-free and chitinase-based formulations in biological control of citrus fruit rot and groundnut rust.
Can J Microbiol. 2004,50(9):737-744.
12. Simi K. The chitinase encoding to based chiA gene endows Pseudornonas fluorescens with the capacity
to control plant pathogens in soil. Gene. 1994,147(1):81-83.
13. Bonmatin JM, Laprévote O, Peypoux F. Diversity among microbial cyclic lipopeptides: iturins and
surfactins. Activity-structure relationships to design new bioactive agents. Comb Chem High T Scr.
2003,6(6):541-556.
Chapter 3
132
14. Huszcza E, Burczyk B. Surfactin isoforms from Bacillus coagulans. Z Naturforsch C. 2006,61(9-
10):727-733.
15. Jacques P, Hbid C, Destain J, Razafindralambo H, Paquot M, De Pauw E, Thonart P. Optimization of
biosurfactant lipopeptide production from Bacillus subtilis S499 by Plackett-Burman design. Appl
Biochem Biotech. 1999,77(1):223-233.
16. Kim PI, Bai H, Bai D, Chae H, Chung S, Kim Y, Park R, Chi YT. Purification and characterization of a
lipopeptide produced by Bacillus thuringiensis CMB26. J Appl Microbiol. 2004,97(5):942-949.
17. Koumoutsi A , Chen XH, Henne A, Liesegang H, Hitzeroth G, Franke P, Vater J, Borriss R. Structural
and functional characterization of gene clusters directing nonribosomal synthesis of bioactive cyclic
lipopeptides in Bacillus amyloliquefaciens strain FZB42. J Bacteriol. 2013,29(12):177-184.
18. Mukherjee AK, Das K. Correlation between diverse cyclic lipopeptides production and regulation of
growth and substrate utilization by Bacillus subtilis strains in a particular habitat. FEMS Microbiol
Ecol. 2005,54(3):479-489.
19. Peypoux F, Bonmatin JM, Wallach J. Recent trends in the biochemistry of surfactin. Appl Microbiol
Biot. 1999,51(5):553-563.
20. Tsuge K, Ano T, Hirai M, Nakamura Y, Shoda M. The genes degQ, pps, and Ipa-8 (sfp) are responsible
for conversion of Bacillus subtilis 168 to plipastatin production. Antimicrob Agents Chemother.
1999,43:2183-2192.
21. Mora I, Cabrefiga J, Montesinos E. Antimicrobial peptide genes in Bacillus strains from plant
environments. Int Microbiol. 2011,14(4):213-224.
22. Jia S, Kang YP, Park JH, Lee J, Kwon SW. Determination of biogenic amines in Bokbunja (Rubus
coreanus Miq.) wines using a novel ultra-performance liquid chromatography coupled with
quadrupole-time of flight mass spectrometry. Food Chem. 2012,132(3):1185-1190.
23. Hammami I, Rhouma A, Jaouadi B, Rebai A, Nesme X. Optimization and biochemical characterization
of a bacteriocin from a newly isolated Bacillus subtilis strain 14B for bio-control of Agrobacterium spp.
strains. Lett Appl Microbiol. 2009,48(2):253-260.
24. Yang LR, Wang ZJ, Xue BG, Liu HY, Ma JG, Zheng YP. Clonging of antagonistic protein TasA gene in
Bacillus amyloliquefaciens YN-1 and its prokaryotic expression. Genom Appl Biol. 2010,29(5):823-
828.
25. Asano Y, Onishi H, Tajima K, Shinozawa T. Flagellin as a biomarker for Bacillus subtilis strains:
application to the DB9011 strain and the study of interspecific diversity in amino-acid sequences.
Biosci Biotech Bioch. 2001,65(5):1218-1222.
26. Deng HH, Han Y, Liu YY, Jia W, Zhou ZJ. Identification of a newly isolated erythritol-producing yeast
and cloning of its erythritol reductase genes. J Ind Microbiol Biotechnol. 2012,39(11):1663-1672.
27. Maiwald M, Kappe R, Sonntag HG. Rapid presumptive identification of medically relevant yeasts to
the species level by polymerase chain reaction and restriction enzyme analysis. Med Vet Mycol.
1994,32(32):115-122.
28. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA)
software version 4.0. Mol Biol Evol. 2007,24(8):1596-1599
29. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees.
Antifungal peptides from Bacillus BH072
133
Mol Biol Evol. 1987,4(6):406-425.
30. Abriouel H, Franz CMAP, Ben Omar N, Galvez A. Diversity and applications of Bacillus bacteriocins.
FEMS Microbiol Rev. 2011,35(1):201-232.
31. Motta AS, Brandelli A. Characterization of an antibacterial peptide produced by Brevibacterium linens.
J Appl Microbiol. 2002,92(1):63-70.
32. Lim JH, Jeong HY, Kim SD. Characterization of the bacteriocin J4 produced by Bacillus
amyloliquefaciens J4 isolated from Korean traditional fermented soybean paste. J Korean Soc Appl Biol
Chem. 2011,54:68-474.
33. Yao DH, Ji ZX, Wang CJ, Qi GF, Zhang LL, Ma X, Chen SW. Co-producing iturin A and poly-c-
glutamic acid from rapeseed meal under solid state fermentation by the newly isolated Bacillus subtilis
strain 3-10. World J Microbiol Biotechnol. 2012,28(3):985-991.
34. Chen H, Wang L, Yuan CL, Zheng ZM, Yu ZL. Isolation and identification of lipopeptides produced
by Bacillus subtilis using high performance liquid chromatography and electrospray ionization mass
spectrometry. Chin J Chromatogr. 2008,26:343-347.
35. Zhang Y, Zhang QJ, Feng XH, Li S, Xia J, Xu H. A novel agar diffusion assay for qualitative and
quantitative estimation of epsilon-polylysine in fermentation broths and foods. Food Res Int.
2012,48(1):49-56.
36. Buchanan RE, Gibbons NE. Bergey's Manual of Determinative Bacteriology, translated by Institute of
Microbiology of Chinese Academy of Sciences. Beijing, China; 1984.
37. Hiradate S, Yoshida S, Sugie H, Yada H, Fujii Y. Mulberry anthracnose antagonists (iturins) produced
by Bacillus amyloliquefaciens RC-2. Phytochemistry 2002,61(6):693-698.
38. Yu GY, Sinclair JB, Hartman GL, Bertagnolli BL. Production of iturin A by Bacillus amylolequefaciens
suppressing Rhizoctonia solani. Soil Biol Biochem. 2002,34(7):955-963.
39. Caldeira AT, Arteiro JMS, Coelho AV, Roseiro JC. Combined use of LC–ESI-MS and antifungal tests
for rapid identification of bioactive lipopeptides produced by Bacillus amyloliquefaciens CCMI 1051.
Process Biochem. 2011,46(9):1738-1746.
40. Kim PI, Ryu J, Kim YH, Chi YT. Production of biosurfactant lipopeptides Iturin A Fengycin and
Surfactin A from Bacillus subtilis CMB32 for control of Colletotrichum gloeosporioides. J Microbiol
Biotechnol. 2010,20(1):138-145.
41. Stein T. Bacillus subtilis antibiotics: structures, syntheses and specific functions. Mol Microbiol.
2005,56(4):845-857.
42. Yao S, Gao X, Fuchsbauer N, Hillen W, Vater J, Wang J. Cloning, sequencing, and characterization of
the genetic region relevant to biosynthesis of the lipopeptides iturin A and surfactin in Bacillus subtilis.
Curr Microbiol. 2003,47(4):272-277.
43. Chen H, Wang L, Su CX, Gong GH, Wang P, Yu ZL. Isolation and characterization of lipopeptide
antibiotics produced by Bacillus subtilis. Lett Appl Microbiol. 2008,47(3):180-186.
44. Hammami I, Jaouadi B, Ben Bacha A, Rebai A, Bejar S, Nesme X, Rhouma A. Bacillus subtilis
Bacteriocin Bac 14B with a Broad Inhibitory Spectrum: Purification, Amino Acid Sequence Analysis,
and Physicochemical Characterization. Biotechnol Bioproc E. 2012,17(1):41-49.
45. Chang JY, Delange RJ, Shaper JH, Glazer AN. Amino acid sequence of flagellin of Bacillus subtilis 16
Chapter 3
134
8. I. Cyanogen bromide peptides. J Biol Chem. 1976,251(3):695-700.
46. Delange RJ, Chang JY, Shaper JH, Martinez RJ, Komatsu SK, Glazer AN. On the amino-acid sequence
of flagellin from Bacillus subtilis168: comparison with other bacterial flagellins. Proc Natl Acad Sci.
USA 1973,70(12):3428-3431.
47. Denning N, Morgan JAW, Whipps JM, Saunders JR, Winstanley C. The flagellin gene as a stable
marker for detection of Pseudomonas fluorescens SBW25. Lett Appl Microbiol. 1997,24(3):198-202.
48. Winstanley C, Morgan JAW. The bacterial flagellin gene as a biomarker for detection, population
genetics and epidemiological analysis. Microbiology. 1997,143(10):3071-3084.
49. Hu LB, Shi ZQ, Zhang T, Yang ZM. Fengycin antibiotics isolated from B-FS01 culture inhibit the
growth of Fusarium moniliforme Sheldon ATCC38932. FEMS Microbiol Lett. 2007,272(1):91-98.
50. Stover AG, Driks A. Control of synthesis and secretion of the Bacillus subtilis protein YqxM. J
Bacteriol. 1999,181(22):7065-7069.
51. Stover AG, Driks A. Regulation of synthesis of the Bacillus subtilis transition-phase, spore-associated
antimicrobial protein TasA. J Bacteriol. 1999,181(1):5476-5481.
52. Tamehiro N, Okamoto-Hosoya Y, Okamoto S, Ubukata M, Hamada M, Naganawa H, Ochi K.
Bacilysocin, a novel phospholipid antibiotic produced by Bacillus subtilis 168. Antimicrob Agents
Chemother. 2002,46(2):315-320.
53. Stover AG, Driks A. Secretion, localization and antimicrobial activity of TasA, a Bacillus subtilis spore-
associated protein. J Bacteriol. 1999,181(5):1664-1672.
135
Chapter 4
Complete genome sequence of Bacillus
amyloliquefaciens strain BH072 isolated
from honey
Xin Zhao1,2
, Anne de Jong1, Zhijiang Zhou
2, Oscar P. Kuipers
1*
1 Department of Molecular Genetics, University of Groningen, Nijenborgh 7, 9747AG
Groningen, the Netherlands
2 School of Chemical Engineering and Technology, Tianjin University, 300072 Tianjin,
P. R. China
This chapter has been published in Genome Announcements.
doi: 10.1128/genomeA.00098-15 (2015).
Chapter 4
136
Abstract
The genome of Bacillus amyloliquefaciens strain BH072, isolated from a honey
sample, and showing strong antimicrobial activity against plant pathogens, is
4.07Mb in size and harbors 3,785 coding sequences (CDS). Several gene clusters
for non-ribosomal synthesis of antimicrobial peptides and a complete gene cluster
for biosynthesis of mersacidin were detected.
Complete Genome Sequence of Bacillus amyloliquefaciens Strain BH072
137
Among bio-control microorganisms, Bacillus amyloliquefaciens subsp. strains have
the ability to enhance the yield of crop plants and to suppress microbial plant
pathogens [1]. Recently, B. amyloliquefaciens subsp. strain DSM7 [2] and plant-
associated B. amyloliquefaciens subsp. plantarum group strain FZB42, YAU
B9601-Y2, CAU B946 [3-6] have been completed sequenced. All these strains
contain 7 or more gene clusters for either ribosomally encoded bacteriocins or non-
ribosomal antimicrobial polyketides or lipopeptides. Here, we report the genome
sequence of the B. amyloliquefaciens strain BH072 that also contains similar gene
clusters as the 4 strains mentioned above, but in a different combination.
Strain BH072, a novel bacterium isolated from a honey sample, was identified as
being B. amloliquefaciens by 16S rDNA gene and gyrA gene sequencing [7],
physiological and biochemical analysis. It had a broad spectrum of antifungal
activity against various molds, such as Aspergillus niger, Pythium, Fusarium
oxysporum and Botrytis cinerea. The ituA, hag and tasA genes, encoding iturin A,
flagellin and TasA, were detected by PCR analysis and flagellin and iturin A were
purified and identified by Zhao et al. [8].
Genomic DNA prepared from strain BH072 was sequenced using Pacific
Biosciences RS sequencing technology (Pacific Biosciences, Menlo Park, CA),
yielding >100× average genome coverage. The sample was prepared as a 10-kb
insert library and sequenced on a SMRT v.2.3. cell. The Hierarchical Genome
Assembly Process (HGAP3) workflow (PacBio DevNet; Pacific Biosciences) was
used to perform a de-novo assembly. The genome was annotated at the NCBI
(National Center for Biotechnology Information) using the Annotation pipeline 2.9
(rev. 452132).
The complete genome sequence of BH072 was composed of one circular contig of
4,069,641-bp chromosome with a G+C value of 46.4%. The genome was larger
than strain FZB42, CAU B946 and DSM7, but smaller than strain YAU B9601-Y2.
Chapter 4
138
The chromosome consisted of 3,943 genes, 3,785 CDS’s, 44 pseudo-genes, 27
rRNAs (5S, 16S, 23S) and 86 tRNAs. Phylogenetically the strain YAU B9601-Y2
is the closest neighbor of B. amyloliquefaciens strain BH072. Remarkably, based
on BAGEL3 mining [9], the whole mersacidin operon was detected in BH072,
making it the third mersacidin producer strain till now, the other two being YAU
B9601-Y2 and HIL Y-85 [6, 10].
Nucleotide sequence accession number
The genome sequence of B. amyloliquefaciens BH072 has been deposited in
Genbank, under the accession number of CP009938.
References
1. Borriss R. Use of plant-associated Bacillus strains as biofertilizers and biocontrol agents. In:
Maheshwari, D.K. (Ed.), Bacteria in Agrobiology: Plant Growth Responses. Springer Heidelberg,
Heidelberg, Germany, 2011, pp. 41-76.
2. Rueckert C, Blom J, Chen XH, Reva O, Borriss R. Genome sequence of Bacillus amyloliquefaciens
type strain DSM7 reveals differences to plant-associated Bacillus amyloliquefaciens FZB42. J
Biotechnol. 2011,155(1):78-85.
3. Chen XH, Koumoutsi A, Scholz R, Eisenreich A, Schneider K, Heinemeyer I, Morgenstern B, Voss B,
Hess WR, Reva O, et al. Comparative anaylsis of the complete genome sequence of the plant growth-
promoting bacterium Bacillus amyloliquefaciens FZB42. Nat Biotechnol 2007,25(9):1007-1014.
4. Hao K, He P, Blom J, Ruckert C, Mao Z, Wu YX, He YQ, Borriss R. The genome of plant growth-
promoting Bacillus amyloliquefaciens subsp. plantarum strain YAU B9601–Y2 contains a gene cluster
for mersacidin synthesis. J Bacteriol. 2012,194(12):3264-3265.
5. Blom J, Rueckert C, Niu B, Borriss R. The complete genome of Bacillus amyloliquefaciens subsp.
Plantarum CAU B946 contains a gene cluster for nonribosomal synthesis of iturin A. J Bacteriol.
2012,194(7):1845-1846.
6. He PF, Hao K, Blom J, Rückertc C, Vaterd J, Mao ZC, Wu YX, Hou MS, He PB, He YQ, et al.
Genome sequence of the plant growth promoting strain Bacillus amyloliquefaciens subsp. plantarum
B9601-Y2 and expression of mersacidin and other secondary metabolites. J Biotechnol.
2012,164(2):281-291.
7. Borriss R, Chen XH, Rueckert C, Blom J, Becker A, Baumgarth B, Fan B, Pukall R, Schumann P,
Spröer C, et al. Relationship of Bacillus amyloliquefaciens clades associated with strains DSM7 and
FZB42: a proposal for Bacillus amyloliquefaciens subsp. amyloliquefaciens subsp. nov. and Bacillus
Complete Genome Sequence of Bacillus amyloliquefaciens Strain BH072
139
amyloliquefaciens subsp. plantarum subsp. nov. based on complete genome sequence comparisons. Int
J Syst Evol Microbiol. 2011,61(8):1786-1801.
8. Zhao X, Zhou ZJ, Han Y, Wang ZZ, Fan J, Xiao HZ. Isolation and identification of antifungal peptides
from Bacillus BH072, a novel bacterium isolated from honey. Microbiol Res. 2013,168(9):598-606.
9. van Heel AJ, de Jong A, Montalbán-López M, Kok J, Kuipers OP. BAGEL3: Automated identification
of genes encoding bacteriocins and (non-)bactericidal posttranslationally modified peptides. Nucleic
Acids Res. 2013,41:448-453.
10. Chatterjee S, Lad SJ, Phansalkar MS, Rupp RH, Ganguli BN, Fehlhaber HW, Kogler H. Mersacidin, a
new antibiotic from Bacillus: fermentation, isolation, purification and chemical characterization. J
Antibiot. 1992,45(6):832-838.
140
141
Chapter 5
Production of class I and II hybrid
lantibiotics using the nisin modification
machinery NisBTC together with GdmD in
Lactococcus lactis
Xin Zhao1,2
, Manuel Montalbán-López1, Oscar P. Kuipers
1*
1 Department of Molecular Genetics, University of Groningen, Nijenborgh 7, 9747AG
Groningen, the Netherlands
2 School of Chemical Engineering and Technology, Tianjin University, 300072 Tianjin,
P. R. China
Chapter 5
142
Abstract
The nisin modification machinery can successfully dehydrate serines and
threonines, and introduce lanthionine rings in diverse core peptides that are fused
to the nisin leader sequence. Moreover, different lanthipeptide modification
enzymes can work together in an in vivo system, which extends the possibilities to
produce and engineer a wide range of antimicrobial peptides. Here, we employ the
production machinery of the class I lantibiotic nisin (composed of the dehydratase
NisB, the cyclase NisC and the transporter NisT) with an additional C-terminal
decarboxylase (GdmD) to generate, modify, and secrete biologically active class I
and II hybrid lantibiotics. These are genetically engineered by fusing coding
sequences of the first three (methyl-)lanthionine rings of class I nisin, the second
methyl-lanthionine ring of class II mersacidin and the C-terminal S-[(Z)-2-
aminovinyl]-D-cysteine (AviCys) of gallidermin, fused to the nisin leader-
encoding sequence. Modified prepeptides were secreted by Lactococcus lactis,
purified and further characterized. Chemical derivatization and mass spectrometry
analyses demonstrated the presence and localization of multiple dehydrated serines
and threonines and (methyl-)lanthionines in the hybrid prepeptides. After cleavage
of the leader peptide from the prepeptides by trypsin, modified hybrid peptides
containing the decarboxylated C-terminus were shown to have a more potent
antimicrobial activity against Micrococcus flavus than the ones without C-terminal
AviCys.
Key words: lantibiotics, hybrid peptide, nisin, mersacidin, S-[(Z)-2-aminovinyl]-D-
cysteine
Production of Class I and II Hybrid Lantibiotics
143
1. Introduction
Lanthipeptides are peptides defined by the presence of posttranslational
modifications (PTMs), namely the thioether-linked amino acid lanthionine and
methyl-lanthionine. Lanthipeptides with antimicrobial activity are referred to as
lantibiotics. In fact, the term lantibiotic is derived from lanthionine-containing
antibiotics [1, 2]. They show inhibitory activity against a variety of (mostly) Gram-
positive bacteria at nanomolar levels, which demonstrates promising
chemotherapeutic potential. Lanthipeptides can be subdivided into 4 classes [3].
The main differences between them are the PTM enzymes involved. Class I
lantibiotics are modified by two distinct enzymes that carry out the PTM process (a
dehydratase LanB and a cyclase LanC), while class II lantibiotics are modified by a
bifunctional enzyme termed LanM. The remaining classes established for
lanthionine-containing peptides are modified by other multifunctional synthetases
(LanKC or LanL), and commonly lack significant antimicrobial activity [4].
One of the most studied and best characterized lantibiotics is nisin (Fig. 1), a class I
lantibiotic produced by certain Lactococcus, Streptococcus and Enterococcus
strains, displaying a broad activity spectrum against Gram-positive pathogens [5-
7]. It has been used commercially, with a 50-year history, as a preservative in food
products. The nisin dehydratase NisB dehydrates serines and threonines of the nisin
core peptide [8-10]. Subsequently, the nisin cyclase NisC couples the dehydrated
residues dehydroalanine (Dha) or dehydrobutyrine (Dhb) with cysteines to form
lanthionine or methyl-lanthionine, respectively [8, 10]. Subsequently, the ABC-
transporter NisT exports the modified prenisin, and the peptidase NisP cleaves off
the leader peptide [8, 9, 11].
Mersacidin (Fig. 1) is a potent class II lantibiotic produced by several Bacillus
amyloliquefaciens strains, showing in vivo activity against Gram-positive bacteria,
Chapter 5
144
such as methicillin-resistant Staphylococcus aureus [12]. The gene clusters of
mersacidin possess a bifunctional MrsM enzyme which catalyzes dehydration as
well as thioether formation, while the MrsD enzyme (same function as
GdmD/EpiD of gallidermin/epidermin) catalyzes the oxidative decarboxylation of
the C-terminal cysteine residue of MrsA to a S-[(Z)-2-aminovinyl]-3methyl-D-
cysteine (AviMeCys) (Fig. 1), and a MrsT transporter with an associated cysteine
protease domain secretes the final modified peptide precursor [13, 14]. By genome
mining of bacteriocin gene clusters of B. amyloliquefaciens BH072, a complete
mersacidin biosynthetic gene cluster was found [15]. However, no mersacidin
could be detected in the supernatant by direct production by B. amyloliquefaciens
BH072.
Previous studies demonstrated that the nisin production machinery can be used to
produce and posttranslationally modify silent lantibiotics [16, 17]. It was shown
that designed peptides fused to the nisin leader peptide can be successfully
modified by NisB and NisC and exported out of Lactococcus lactis by NisT [16-
20]. In addition, there is already experimental proof that different lantibiotic
modification enzymes can work together in an in vivo production system including
NisBTC and GdmD/LtnJ [20]. The combination of the nisin synthetic machinery
with additional modification enzymes brings a new opportunity to use them as a
tool to produce more lantibiotics with various modifications and improve their
stability [21].
Here, we present a successful application of the lantibiotic nisin expression system
(NisBTC) with the additional oxidative decarboxylase GdmD to produce, modify,
and secrete class I and II hybrids designed by fusing the nisin leader sequence to
the N-terminal (methyl-)lanthionine rings of nisin (nisin part) and a large globular
methyl-lanthionine ring of class II mersacidin (mersacidin part), including a C-
terminal S-[(Z)-2-aminovinyl]-D-cysteine (AviCys) ring. Moreover, we assess
Production of Class I and II Hybrid Lantibiotics
145
their antimicrobial actvities and compare the production and modification between
strains containing either GdmD or MrsD.
Fig. 1. Primary structures of nisin, mersacidin and gallidermin. Dha:
dehydroalanine; Dhb: dehydrobutyrine; Abu: aminobutyric acid; Ala-S-Ala:
lanthionine, Abu-S-Ala: methyl-lanthionine; Structure in orange dotted line: S-
[(Z)-2-aminovinyl]-D-cysteine/S-[(Z)-2-aminovinyl]-3methyl-D-cysteine.
2. Materials and methods
2.1. Bacterial strains, plasmids and growth conditions
Strains and vectors used in this work are given in Table 1. L. lactis NZ9000 [22]
was used for expression of the modification enzymes and hybrid peptides and
cultured in M17 medium supplemented with 0.5% glucose at 30 °C for genetic
manipulation or a minimal expression medium (MEM) for protein expression and
purification assays [21]. Micrococcus flavus B423 was grown in LB medium with
shaking at 30 °C. Chloramphenicol and/or erythromycin were used at 5 μg/mL
Chapter 5
146
when necessary. Plasmids pIL3EryBTC and pIL3BTC encoding the nisin
modification machinery were used to produce and modify prepeptides [20, 21].
2.2. Molecular cloning
Molecular cloning techniques were performed according to Sambrook and Russell
[23]. Fast digest restriction enzymes and ligase were purchased from Thermo
Scientific and used according to the manufacturer’s instructions. Preparation of L.
lactis NZ9000 competent cells and transformation was performed as described
previously [24]. The plasmid was transformed into L. lactis NZ9000, isolated using
a commercial plamid extraction kit (Macherey-Nagel), and checked by sequencing
(Macrogen).
Table 1. Strains and vectors used in this work
Strains/Vectors Characteristic Purpose References
L. lactis NZ9000 pepN::nisRK expression host 22
B. amyloliquefaciens
BH072
mrs operon mersacidin source 15
Micrococcus flavusB423 sensitive strain 20
pNZ8048 CmR expression vector 22
pNZnisA-E3 EryR, nisA nisin expression 11
pNZnisA CmR, nisA nisin expression 20
pNZnisA-ltnJ CmR, nisA attenuator source 20
pIL3BTC nisBTC under the control
of PnisA, CmR
modification and transport of
lantibiotics
21
pIL3EryBTC nisBTC under the control
of PnisA, EryR
modification and transport of
lantibiotics
20
pNZE-nisA(Δ23-34)-
SFNSYCC-gdmD
EryR, nisA(Δ23-34)-
SFNSYCC
expression of hybrid peptide with
GdmD
20
pNZE-nisA(Δ23-34)-
SFNSYCC
EryR, nisA(Δ23-34)-
SFNSYCC
expression of hybrid peptide 20
pNZE-nisleader-mrsA’ EryR, mrsA’ mersacidin expression this work
pNZE-nisleader-mrsA’-
gdmD
EryR, mrsA’ mersacidin expression with GdmD this work
pNZE-nisleader-nis(1-7)- EryR, nis(1-7)-mrsA’(4- expression of hybrid peptide this work
Production of Class I and II Hybrid Lantibiotics
147
mrsA’(4-20) 20)
pNZE-nisleader-nis(1-7)-
mrsA’(4-20)-gdmD
EryR, nis(1-7)-mrsA’(4-
20)
expression of hybrid peptide with
GdmD
this work
pNZE-nisleader-nis(1-22)-
mrsA’(4-20)
EryR, nis(1-22)-mrsA’(4-
20)
expression of hybrid peptide this work
pNZE-nisleader-nis(1-22)-
mrsA’(4-20)-gdmD
EryR, nis(1-22)-mrsA’(4-
20)
expression of hybrid peptide with
GdmD
this work
pNZE-nisleader-nis(1-28)-
mrsA’(4-20)
EryR, nis(1-28)-mrsA’(4-
20)
expression of hybrid peptide this work
pNZE-nisleader-nis(1-28)-
mrsA’(4-20)-gdmD
EryR, nis(1-28)-mrsA’(4-
20)
expression of hybrid peptide with
GdmD
this work
pNZE-nisleader-nis(1-22)-
mrsA’
EryR, nis(1-22)-mrsA’ expression of hybrid peptide this work
pNZE-nisleader-nis(1-22)-
mrsA’-gdmD
EryR, nis(1-22)-mrsA’ expression of hybrid peptide with
GdmD
this work
pNZE-nisleader-nis(1-22)-
mrsA’(3-20)
EryR, nis(1-22)-mrsA’(3-
20)
expression of hybrid peptide this work
pNZE-nisleader-nis(1-22)-
mrsA’(3-20)-gdmD
EryR, nis(1-22)-mrsA’(3-
20)
expression of hybrid peptide with
GdmD
this work
pNZE-nisleader-nis(1-22)-
mrsA’(4-12)-ASFNSYCC
EryR, nis(1-22)-mrsA’(4-
12) -ASFNSYCC
expression of hybrid peptide this work
pNZE-nisleader-nis(1-22)-
mrsA’(4-12)-ASFNSYCC-
gdmD
EryR, nis(1-22)-mrsA’(4-
12) -ASFNSYCC
expression of hybrid peptide with
GdmD
this work
pNZE-nisleader-nis(1-22)-
mrsA’(4-12)-TLTSYCC
EryR, nis(1-22)-mrsA’(4-
12)-TLTSYCC
expression of hybrid peptide this work
pNZE-nisleader-nis(1-22)-
mrsA’(4-12)-TLTSYCC-
gdmD
EryR, nis(1-22)-mrsA’(4-
12)-TLTSYCC
expression of hybrid peptide with
GdmD
this work
pNZE-nisleader-nis(1-22)-
mrsA’(4-12)
EryR, nis(1-22)-mrsA’(4-
12)
expression of hybrid peptide this work
pNZE-nisleader-nis(1-22)-
mrsA’(4-12)-gdmD
EryR, nis(1-22)-mrsA’(4-
12)
expression of hybrid peptide with
GdmD
this work
pNZ-nisleader-nis(1-22)-
mrsA’(4-20)
CmR, nis(1-22)-mrsA’(4-
20)
expression of hybrid peptide this work
pNZ-nisleader-nis(1-22)-
mrsA’(4-20)-mrsD
CmR, nis(1-22)-mrsA’(4-
20)
expression of hybrid peptide with MrsD this work
pNZ-nisleader-nis(1-22)-
mrsA’(4-12)-ASFNSYCC
CmR, nis(1-22)-mrsA’(4-
12)-ASFNSYCC
expression of hybrid peptide this work
Chapter 5
148
pNZ-nisleader-nis(1-22)-
mrsA’(4-12)-ASFNSYCC-
mrsD
CmR, nis(1-22)-mrsA’(4-
12)-ASFNSYCC
expression of hybrid peptide with MrsD this work
pNZ-nisleader-nis(1-22)-
mrsA’(4-12)-TLTSYCC
CmR, nis(1-22)-mrsA’(4-
12)-TLTSYCC
expression of hybrid peptide this work
pNZ-nisleader-nis(1-22)-
mrsA’(4-12)-TLTSYCC-
mrsD
CmR, nis(1-22)-mrsA’(4-
12)-TLTSYCC expression of hybrid peptide with MrsD this work
pNZ-nisleader-nis(1-22)-
mrsA’(4-12)-mrsD
CmR, nis(1-22)-mrsA’(4-
12) expression of hybrid peptide with MrsD this work
Fig. 2. Organization of gene expression for the hybrid peptides. (A) pNZE-
derived vectors harboring nisin/mersacidin hybrid genes, with/without gdmD. (B)
pNZE-derived vectors harboring nisin/mersacidin hybrid genes containing different
C-terminal tails (green arraow head), with/without gdmD. (C) pNZ8048-derived
vectors harboring nisin/mersacidin hybrid genes adding different C-terminal tails,
with/without mrsD. PnisA denotes the nisin inducible promotor gene; RBS stands
for ribosome binding site.
Production of Class I and II Hybrid Lantibiotics
149
2.3. Construction of expression vectors
2.3.1. Construction of vectors harboring nisin/mersacidin hybrid genes
Vectors harboring different nisin and mersacidin hybrid peptides, namely pNZE-
nisleader-nis/mrsA’ and the counterpart constructs containing gdmD, namely
pNZE-nisleader-nis/mrsA’-gdmD listed in Table 1 were obtained as described
below. Primers and templates of PCR used in this study with the corresponding
amplified products are listed in Table S1. The nisin inducible promotor gene,
ribosome binding site (RBS) and leader sequence of nisin were amplified from
plasimid pNZnisA-E3 [11], using the primers P-nisl-for (5’ BglII) and one of the P-
nisl-rev series. The mersacidin core peptide encoding gene mrsA’ was amplified
from genomic DNA of B. amyloliquefaciens BH072 [15] using the primers P-mrsa-
for series and P-mrsA-rev (5’ PstI). In addition, a DNA sequence with a
transcription attenuator function was amplified from pNZnisA-ltnJ [20], using the
primers P-att-for (5’ PstI) and P-att-rev (5’ HindIII). By a 2-step overlap PCR (last
step primers: P-nisl-for (5’ BglII)/P-att-rev (5’ HindIII)), the three DNA fragments
were sequentially connected. After amplification, the fused DNA sequences were
digested using BglII and HindIII, and ligated into pNZE-empty and pNZE-gdmD
[20] digested with the same enzymes, resulting in pNZE-nisleader-nis/mrsA’ series
and pNZE-nisleader-nis/mrsA’-gdmD series (Fig. 2A).
2.3.2. Construction of vectors by changing the C-terminus of hybrid substrates
In order to get the construction of the gallidermin tail (-SFNSYCC) replacing the
C-terminus of mersacidin, first, we used the primers P-nisl-for (5’ BglII)/P-gtail1-
rev (5’ PstI) and P-nisl-for (5’ BglII)/P-gtail2-rev (5’ PstI), respectively, with
pNZE-nisleader-nis(1-22)-mrsA’(4-20)-gdmD as the template.Subsequently, by
digestion with BglII and PstI and ligation into pNZE-nisleader-nis(1-22)-mrsA’(4-
20) and pNZE-nisleader-nis(1-22)-mrsA’(4-20)-gdmD digested with the same
Chapter 5
150
restriction enzymes, respectively, pNZE-nisleader-nis(1-22)-mrsA’(4-12)-
ASFNSYCC and pNZE-nisleader-nis(1-22)-mrsA’(4-12)-ASFNSYCC-gdmD;
pNZE-nisleader-nis(1-22)-mrsA’(4-12)-TLTSYCC and pNZE-nisleader-nis(1-22)-
mrsA’(4-12)-TLTSYCC-gdmD were constructed. Similarly, pNZE-nisleader-nis(1-
22)-mrsA’(4-12) and pNZE-nisleader-nis(1-22)-mrsA’(4-12)-gdmD were
constructed as a control lacking C-terminal AviCys using the primer P-nisl-for (5’
BglII)/P-deltail-rev (5’ PstI), with pNZ-nisleader-nis(1-22)-mrsA’(4-20) as the
template, and then cloning as a BglII and PstI fragment into pNZE-nisleader-nis(1-
22)-mrsA’(4-20) and pNZE-nisleader-nis(1-22)-mrsA’(4-20)-gdmD (Fig. 2B).
2.3.3. Construction of vectors by changing the LanD encoding gene
The mersacidin LanD enzyme gene mrsD and its RBS sequences were amplified
from genomic DNA of B. amyloliquefaciens BH072 with the primers P-mrsD-for
(5’ KpnI)/P-mrsD-rev (5’ XhoI) and cloned as a KpnI and XhoI fragment into
pNZ8048 [25], generating pNZ8048-mrsD. Moreover, after amplification (primers:
P-nisl-for (5’ BglII)/P-att-rev (5’ KpnI); templates: plasmid of pNZE-nisleader-
nis(1-22)-mrsA’(4-20), pNZE-nisleader-nis(1-22)-mrsA’(4-12)-ASFNSYCC and
pNZE-nisleader-nis(1-22)-mrsA’(4-12)-TLTSYCC) and digestion of the PCR
products with BglII and KpnI, the substrate fragments were inserted into pNZ8048-
mrsD and pNZ8048 vectors between the restriction sites BglII and KpnI to obtain
pNZE-nisleader-nis(1-22)-mrsA’(4-20)-mrsD, pNZ-nisleader-nis(1-22)-mrsA’(4-
12)-ASFNSYCC-mrsD and pNZ-nisleader-nis(1-22)-mrsA’(4-12)-TLTSYCC-
mrsD; and the counterpart constructs pNZE-nisleader-nis(1-22)-mrsA’(4-20), pNZ-
nisleader-nis(1-22)-mrsA’(4-12)-ASFNSYCC and pNZ-nisleader-nis(1-22)-
mrsA’(4-12)-TLTSYCC (Fig. 2C).
2.4. Protein expression and purification
The vectors containing the structural gene and the additional modification enzyme
Production of Class I and II Hybrid Lantibiotics
151
GdmD or MrsD, either derived from pNZE-empty or pNZ8048, were transformed
into NZ9000 (pIL3BTC) or NZ9000 (pIL3EryBTC), respectively. MEM medium
was inoculated at 2% from an overnight culture of the producer strain grown in
GM17. When the culture reached an OD (600 nm) of 0.4-0.6, nisin was added at a
final concentration of 10 ng/mL. Cells were harvested after 3 h of induction by
centrifugation at 4 °C for 15 min at 5000 rpm, and the supernatant was kept for the
isolation of the peptides. To concentrate protein from supernatant, trichloroacetic
acid (TCA) precipitation was performed according to Sambrook et al. [23].
Prepeptides were analyzed on Tricine SDS-PAGE gels and stained with Coomassie
(Fermentas) [26, 27].
Alternatively, when higher amounts of prepeptide were required, larger volumes of
supernatant were concentrated by fast flow cationic exchange chromatography.
Thus, 1 L cell-free supernatant was mixed 1:1 with a 100 mM lactic acid solution
and applied to a 5 mL HiTrap SP-Sepharose (GE Healthcare) column equilibrated
with 50 mM lactic acid pH 4.0. Peptides were washed with 50 mM lactic acid pH
4.0, and then eluted with 50 mM lactic acid 1 M NaCl pH 4.0 [28]. Subsequently a
PD-10 Desalting Column (GE Healthcare) was used to desalt the sample. The
desalted peptides were freeze-dried and dissolved in 0.05% acetic acid.
2.5. MALDI-TOF mass spectrometry
A 1-μL sample of TCA precipitated supernatant was spotted, dried, and
subsequently washed with Milli-Q water on the target. Afterwards, 1 μL of matrix
solution (5 mg/mL α-cyano-4-hydroxycinnamic acid from Sigma-Aldrich dissolved
in 50% acetonitrile and 0.1% trifluoroacetic acid) was spotted on top of the washed
sample. A Voyager DE PRO MALDI-TOF mass spectrometer (Applied
Biosystems) was used to obtain mass spectra using conditions previously
established [20]. Data were analyzed with “Data Explorer” software version 4.0.0.0
(Applied Biosystems).
Chapter 5
152
2.6. CDAP labeling for the assignment of free cysteines
1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) was used to react
with free cysteine residues. The reactions with CDAP were performed as described
previously [16, 29]. Purified samples were collected, freeze-dried, and resuspended
in 9 μL of 0.5 M HCl at pH 3.0 and reduced with 1 μL of 100 mg/mL Tris [2-
carboxyethyl] phosphine (TCEP). After 10 min incubation at room temperature, 2
μL of 100 mg/mL CDAP was added, followed by 15 min of incubation at room
temperature. Then samples were collected and analyzed by MALDI-TOF.
2.7. Antimicrobial activity assays
A culture of M. flavus OD (600 nm) = 0.5 was added at 1% (v/v) into melted LB-
agar at 45 °C and poured in plates. Once the agar was solid, wells of 8 mm were
created and filled with 50 μL of the lantibiotic solution. Lantibiotics were activated
with 2 μL of 1 mg/mL trypsin stock solution added directly to the well [16].
3. Results
3.1. Production, secretion and purification of prepeptides
To investigate the production and secretion of mersacidin in L. lactis NZ9000, we
first tried heterologous expression of mersacidin fused directly to the nisin leader
peptide. Either pNZE-nisleader-mrsA’ or pNZE-nisleader-mrsA’-gdmD was
introduced into L. lactis NZ9000 containing pIL3BTC. Cultures of L. lactis
NZ9000 transformed with pIL3BTC and either pNZE-derivative were induced with
subinhibitory amounts of nisin. Subsequently, the supernatants were collected and
the prepeptides were concentrated by TCA precipitation. We checked the
production with Tricine SDS-PAGE and MALDI-TOF mass spectrometry.
However, no expression product was obtained (data not shown). NisB and NisC
Production of Class I and II Hybrid Lantibiotics
153
can form lanthionine/methyl-lanthionine rings in non-cognate peptides but so far
only when serines/threonines are positioned N-terminally of the cysteines to be
coupled. However, the first ring of mersacidin is formed by cysteine and threonine
with the position of cysteine before threonine, which is unnatural for NisBC-
modified peptides. In addition, mersacidin contains a negatively charged residue
typical of the lipid II-binding motif of class II lantibiotics and a globular structure
that might not be correctly processed by the NisBC system.
van Heel et al. [17, 20] showed that peptides with an N-terminus similar to nisin
can be modified by NisBC even when the C-terminus is different to that of nisin. A
hybrid peptide consisting of the first three lanthionine rings of nisin and its so-
called hinge region (NMK) followed by the C-terminal motif of gallidermin
(SFNSYCC) was successfully expressed, and native nisin ABC fragments and the
rest of the peptides were separately obtained via enzymatic digestion. Thus, the
following hybrids were designed containing a native nisin N-terminal part and a
mersacidin part in order to test its activity as a full-length hybrid [20, 30]. We
considered removing the first ring of mersacidin (CTF) and replacing it by the first
ring of nisin (ITSISLC) in the construct pNZE-nisleader-nis(1-7)-mrsA’(4-20), the
first three rings of nisin (ITSISLCTPGCKTGALMGCNMK) using the construct
pNZE-nisleader-nis(1-22)-mrsA’(4-20) and all the five rings of nisin
(ITSISLCTPGCKTGALMGCNMKTATCHC) in the mutant pNZE-nisleader-
nis(1-28)-mrsA’(4-20) to help driving expression of the mersacidin part. An
overview of all hybrid molecules with the expected modifications is presented
below in Fig. 3. As expected, constructs with three and five rings of nisin promoted
the production of mersacidin and nisin hybrids (data not shown). Next, we repeated
the expression assays of full mersacidin fused to the first 22 amino acids of nisin
on pNZE-nisleader-nis(1-22)-mrsA’ and avoiding the first ring (CT) of mersacidin
maintaining the phenylalanine (F) on pNZE-nisleader-nis(1-22)-mrsA’(3-20). The
product with F and lacking the first ring of mersacidin was detected, while that
Chapter 5
154
with CTF was not (data not shown). It was confirmed that the first ring of
mersacidin (CT) inhibited the production of nisin and mersacidin hybrids using the
nisin synthetic machinery and leader sequence.
To test whether the nisin and mersacidin hybrid peptides were modified or not,
they were analyzed by MALDI-TOF mass spectrometry. Supernatants of induced
L. lactis NZ9000 (pIL3BTC) transformed with pNZE-nisleader-nis(1-22)-mrsA’(4-
20) or pNZE-nisleader-nis(1-22)-mrsA’(4-20)-gdmD were purified on a HiTrap SP
cation exchange column. The same procedure was applied for prenisin as positive
control. All prepeptides were produced, secreted and analyzed by MALDI-TOF
mass spectrometry. Table 2 presents a summary of the obtained masses. Nis(1-
22)Mrs(4-20) showed at most 7 dehydrations, most likely 5 of them in the nisin
part and 2 in the mersacidin part. There was no C-terminal decarboxylation by
GdmD observed in any of the constructs.
3.2. Class I and II hybrid lantibiotics are modified by nisin modification
enzymes and GdmD
The dehydration state and recognition by the decarboxylase play a significant role
on the C-terminal AviMeCys formation. To investigate this point, we designed
various hybrids and investigated their modification. Two designed hybrid peptides
with the gallidermin C-terminal tail (i.e. providing the natural recognition
sequence), replacing the intertwined terminal rings of mersacidin, were
constructed: Nis(1-22)Mrs(4-12)G1 and Nis(1-22)Mrs(4-12)G2. L. lactis NZ9000
harboring pIL3BTC and pNZE-nisleader-nis(1-22)-mrsA’(4-12)-ASFNSYCC-
gdmD yielded a class I and II hybrid peptide termed Nis(1-22)Mrs(4-12)G1 which
was 7-fold dehydrated and decarboxylated at the C-terminus. CDAP treatment of
the sample revealed that one of the cysteines had an available thiol group. The
control strain NZ9000 harboring pIL3BTC and pNZE-nisleader-nis(1-22)-
mrsA’(4-12)-ASFNSYCC, which does not contain a decarboxylase, only produced
Production of Class I and II Hybrid Lantibiotics
155
the 7-fold dehydrated fusion peptide without the decarboxylated C-terminus (Table
2 and Fig. 4).
In addition, L. lactis NZ9000 harboring pIL3BTC and pNZE-nisleader-nis(1-22)-
mrsA’(4-12)-TLTSYCC-gdmD yielded another class I and II hybrid peptide
designated Nis(1-22)Mrs(4-12)G2 carrying up to 9 dehydrations and a
decarboxylation of the C-terminus. However, the yield of fully modified product
containing both dehydrations and decarboxylation was low. The strain NZ9000
harboring pIL3BTC and pNZE-nisleader-nis(1-22)-mrsA’(4-12)-TLTSYCC, with
no decarboxylase co-expressed, only produced the dehydrated fusion peptide
(Table 2 and Fig. 4).
In order to assess which serine or threonine is dehydrated in the hybrids, we
constructed a pNZE-nisleader-nis(1-22)-mrsA’(4-12) and transformed it into L.
lactis NZ9000 containing pIL3BTC. Hybrid Nis(1-22)Mrs(4-12) with no C-
terminal AviCys tail was fully dehydrated (6-fold), and the CDAP test indicated
that there was no free cysteine in the peptides. Therefore, we concluded that the
large mersacidin methyl-lanthionine ring was correctly formed (Table 2). Looking
back at the hybrid Nis(1-22)Mrs(4-20), the mass results indicated that there were at
most 2 dehydrations in the mersacidin part. It is supposed that if only one
dehydration exists, it might be T4 (wild-type mersacidin amino acid order, number
marked in Fig. 1) to allow the formation of the large mersacidin ring. If there are
two dehydrations, T13 or S16 might be dehydrated. CDAP treated Nis(1-22)Mrs(4-
20) produced from the strain with GdmD showed a 50 Da shift compared to the
one without CDAP reaction, indicating that the two cysteines at the C-terminus are
free, because formation of one isothiocyanate part from free cysteine will result in
a mass increase of 25 Da. In the designed hybrid Nis(1-22)Mrs(4-12)G1, the two
dehydrations in the mersacidin part most likely come from T4 (as in the mutant
Nis(1-22)Mrs(4-12)) and S17 (resembling the wild-type configuration of the
Chapter 5
156
gallidermin decarboxylated C-terminus) (Fig. 4), and 1 free cysteine was detected.
Moreover, analysis of hybrid peptide Nis(1-22)Mrs(4-12)G2 indicated that T4,
T13, T15 and S16 could be dehydrated and form the intertwined rings with
cysteine downstream (Fig. 4). Further structural analyses of the hybrids are needed
to confirm the exact modification pattern. Therefore, the two designed class I and
II lantibiotic hybrids Nis(1-22)Mrs(4-12)G1 and Nis(1-22)Mrs(4-12)G2 (Table 2
and Fig. 4) were modified by the nisin modification enzymes NisBC and GdmD.
Nis(1-22)Mrs(4-12)G2 sometimes showed a non-decarboxylated mass weight
when co-expressed with GdmD, which can be due to a sequence different from the
typical gallidermin C-terminus that might be more poorly recognized by the
decarboxylase.
Fig. 3. Overview of all hybrid molecules with the expected (left in substrate)
and detected (right in result) modifications. Putative dehydratable amino acids
in the wild type sequence are in red. Putative (methyl-)lanthionine are in black, and
C-terminal AviCys/AviMeCys are in orange.
Production of Class I and II Hybrid Lantibiotics
157
Table 2. NisBC-mediated dehydration and GdmD/MrsD-mediated
decarboxylation of prepeptides and CDAP alkylated prepeptides analyzed by
MALDI-TOF mass spectrometry
Peptide
(fragmen
t)
Amino acid
sequence
Modification
enzyme
No. of
observed
dehydratio
ns
No. of
observed
decarboxylat
ions
Mass (M+H+) without Met1
(Da)
Observed Calculat
ed
CDAP-
reacted
Nis(1-
22)Mrs(4
-20)
Nisleader
ITSISLCTPGCK
TGALMGCNMK
TLPGGGGVCTL
TSECIC
NisBC,
GdmD
7, 6 0 6030.83,
6048.63
6030.17,
6048.17
6080.7
4
(+50)
NisBC, MrsD 6 0 6047.69 6048.17
NisBC 6 0 6047.41 6048.17
Nis(1-
22)Mrs(4
-12)G1
Nisleader
ITSISLCTPGCK
TGALMGCNMK
TLPGGGGVCAS
FNSYCC
NisBC,
GdmD
7 1 6007.05 6009.14 6034.2
5
(+25)
NisBC, MrsD 7 0 6055.27 6055.15
NisB 7 0 6054.32 6055.14
Nis(1-
22)Mrs(4
-12)G2
Nisleader
ITSISLCTPGCK
TGALMGCNMK
TLPGGGGVCTL
TSYCC
NisBC,
GdmD
9, 8 1 5871.23,
5886.06,
5929.51
5869.07,
5887.07
5874.8
0,
5933.3
0
NisBC, MrsD 9, 8 0 5910.49,
5929.23
5915.07,
5933.07
NisBC 9, 8, 7 0 5916.06,
5951.52
5915.07,
5933.07,
5951.07
Nis(1-
22)Mrs(4
-12)
Nisleader
ITSISLCTPGCK
TGALMGCNMK
TLPGGGGVC
NisBC,
GdmD
6 0 5197.50 5197.17 5195.5
0
NisBC 6 0 5196.89 5197.17
Nisleader: mstkdfnldlvsvskkdsgaspr
Chapter 5
158
Production of Class I and II Hybrid Lantibiotics
159
Fig. 4. Comparison of the mass spectra of class I and II hybrid prepeptides
with/without GdmD modification and CDAP reaction. A clear mass shift of
approximately 46 Da is visible indicating that GdmD has modified the substrates;
also a clear mass shift of approximately 25 Da is visible indicating that Nis(1-
22)Mrs(4-12)G1 has a free cysteine.
We tried the functional expression of MrsD to replace GdmD by co-expression of
pNZ-nisleader-nis(1-22)-mrsA’(4-20)-mrsD, pNZ-nisleader-nis(1-22)-mrsA’(4-
12)-ASFNSYCC-mrsD, pNZ-nisleader-nis(1-22)-mrsA’(4-12)-TLTSYCC-mrsD,
respectively with pIL3EryBTC in L. lactis NZ9000. The constructs without mrsD
were also tested for production as control. All the expressed propeptides were
visible on Coomassie-blue stained Tricine SDS-PAGE (Fig. 5). The MS results
showed that there was no difference between constructs with MrsD and without
MrsD (data not shown), as well as those without GdmD (Table 2). MrsD did not
modify the C-terminal sequences (-SECIC/-SFNSYCC/-TLTSYCC) in the
conditions tested. Even fully dehydrated Nis(1-22)Mrs(4-12)G2 also showed no
decarboxylation at the C-terminus, which suggests that unlike GdmD, MrsD might
be a leader dependent enzyme [14].
Chapter 5
160
Fig. 5. Coomassie-blue stained Tricine SDS-PAGE. Each well contained TCA-
precipitated prepeptides from 600μL supernatant. M: protein marker; nisA: positive
control NisA as substrate; Mrs(4-20): Nisin leader-Nis(1-22)-Mrs(4-20); Mrs(4-
12): Nisin leader-Nis(1-22)-Mrs(4-12); G1: -ASFNSYCC; G2: -TLTSYCC; NC1:
negative control with no substrate on pNZE-empty; NC2: negative control with no
strain but nisin induced.
3.3. The modified hybrids have significant antimicrobial activity
To investigate the antimicrobial activity of the modified class I and II hybrids, the
prepeptides were incubated with trypsin to cleave the nisin leader peptide.
Leaderless peptides were released and tested for antimicrobial activity against M.
flavus. In the activity assay, we tested the peptides Nis(1-22)Mrs(4-12)G1, Nis(1-
22)Mrs(4-12)G2, Nis(1-22)Mrs(4-20) and Nis(1-22)Mrs(4-12) without the C-
terminal AviCys motive. Hybrid peptides are active with and without
GdmD/MrsD. However, samples containing the decarboxylated C-terminus
showed larger zones of inhibition of growth of indicators (see Fig. 6). The radius of
the growth inhibition zone suggests that the decarboxylated tail improves the
activity when compared to the non-decarboxylated tail, although the test is only
qualitative. The observed growth inhibition suggests that nisin synthetic machinery
Production of Class I and II Hybrid Lantibiotics
161
with additional GdmD produced more active class I and II lantibiotic hybrids in L.
lactis.
Fig. 6. Antimicrobial activity of hybrids against M. flavus. 1:NisA; 2: Nis(1-
22)Mrs(4-12)G1(no LanD); 3: Nis(1-22)Mrs(4-12)G1 (GdmD);4: Nis(1-22)Mrs(4-
12)G1 (MrsD); 5: Nis(1-22)Mrs(4-12)G2(no LanD); 6: Nis(1-22)Mrs(4-12)G2
(GdmD); 7: Nis(1-22)Mrs(4-12)G2 (MrsD); 8: Nis(1-22)Mrs(4-20) (no LanD); 9:
Nis(1-22)Mrs(4-20) (GdmD); 10: Nis(1-22)Mrs(4-20) (MrsD); 11: Nis(1-
22)Mrs(4-12) (no LanD)
Chapter 5
162
4. Discussion
Due to the crisis of antibiotic-resistance, a larger collection of novel antimicrobials
is needed to be explored for possible application. The development of strategies to
engineer lantibiotics has provided researchers with the means to access powerful
antimicrobials with a widening array of structures and functions. By rational
designing of fusing different core peptides found in lantibiotics, with the help of
various lantibiotic modification enzymes, novel molecules with hybrid structures
can be obtained to potentially increase the antimicrobial activity of lantibiotics
[31]. Recently, van Heel et al. presented the successful additional modification
enzymes GdmD and LtnJ in combination with the nisin production machinery,
which could produce lantibiotics containing either AviCys or D-alanines,
respectively [20]. Zhou et al. improved the activity of lantibiotics against Gram-
negative bacteria by fusion of anti-Gram-negative peptides tails [32]. The major
advantages of bioengineering approaches include relatively high possible product
yields and easy downstream processing steps. Moreover, many lantibiotic gene
clusters, either silent or active, have been identified through the in silico inspection
of bacterial genomic DNA. Several of them were heterologously produced using
the nisin modification machinery [17]. In this study, we successfully used the nisin
modification system with the additional enzyme GdmD in vivo to modify and
produce active class I and II hybrid lantibiotics with the N-terminal structure of
nisin, the C-terminal structure of mersacidin and additional AviCys.
The class I lantibiotics (e.g. nisin and epidermin in Fig. 1) are screw-shaped,
positively charged, amphipathic molecules that exert their primary bactericidal
action by the formation of pores in the cytoplasmic membrane [4]. The class II
lantibiotics, as defined so far (e.g. mersacidin), usually possess a globular shape
and are described as inhibitors of peptidoglycan biosynthesis on the level of
transglycosylation by binding to lipid II [12]. In addition, the thickness of the cell
Production of Class I and II Hybrid Lantibiotics
163
wall of treated cells is markedly reduced. Thus this makes mersacidin an
interesting tool for the investigation of peptidoglycan biosynthesis of Gram-
positive bacteria. The N-terminal segment of nisin is essential for binding, whereas
the C-terminal part translocates across the membrane, in accordance to pore
formation in the absence of lipid II. The molecular target site of mersacidin on lipid
II differs from that of nisin, which binds to lipid II pyrophosphate; in contrast,
mersacidin rather interacts with the disaccharide-pyrophosphate moiety of lipid II
and its C-terminal structure seems to be important for activity [2]. Previous studies
showed that designed peptides formed by the first three rings of nisin carrying the
gallidermin C-terminal decarboxylated tail (-SFNSYCC) show improved the
activity when compared to the non-decarboxylated tail [20]. This is also observed
in our class I and II lantibiotic hybrids, which might inhibit various processes of
cell wall biosynthesis by synergetic functions, such as inhibiting
transglycosylation. We suggest that when the nisin N-terminus and C-terminal
AviCys are combined, the overall activity is improved.
The so-called LanD enzyme is responsible for catalyzing the oxidative
decarboxylation of C-terminal cysteines in several lantibiotics (e.g. mersacidin,
epidermin, microbisporicin). MrsD shows 26% sequence identity to EpiD and 29%
identity to GdmD. Despite this low sequence identity, it was assumed that MrsD is
involved in the formation of the C-terminal S-[(Z)-2-aminovinyl]-3-methyl-D-
cysteine residue of mersacidin [14]. GdmD showed high similarity with EpiD.
MrsD differs significantly from the prototype EpiD/GdmD by its substrate
specificity and coenzyme requirement. Previous study on the substrate specificity
of EpiD indicated that the C-terminal consensus sequence of the EpiD substrates is
[V/I/L/(M)/F/Y/W]-[A/S/V/T/C/(I/L)]-C which is not present at the C-terminus of
MrsA (-TLTSECIC) and, therefore, it is not surprising that the C-terminal peptide -
TLTSECIC was not a substrate for GdmD [33]. Nothing is known about the
substrate specificity of MrsD untill now. But according to our study, MrsD is
Chapter 5
164
unable to oxidize and decarboxylate the precursor peptide with a C-terminal tail of
gallidermin/epidermin. We suggest there are two possible reasons explaining this:
MrsD only recognizes substrates with the MrsA leader sequence; or the lack of
dehydrations abolishes the decarboxylation.
NisB dehydrates specific serine and threonine residues in prenisin, whereas the
cyclase NisC catalyzes the (methyl-)lanthionine formation [8, 9]. LanM enzymes
show no similarity to LanB, but the C-terminal domain of LanM keeps the LanC-
like cyclase domain [34]. There are several functional differences between MrsM
and NisB and NisC found in this study. We demonstrate that NisB and NisC could
not recognize the precursor peptide with the position of cysteine before threonine,
and this even abolished the production. NisB was able to dehydrate the threonines
or serines in the C-terminal tail -SYCC/-TLTSYCC, but not in C-terminal part of
MrsA (-TLTSECIC), which can be caused by the presence of the negative residue,
which is detrimental for NisB modification. It has already been demonstrated that
EpiD does not react with a C-terminal meso-lanthionine structure [33]. Considering
that the C-terminal sequence of -TLTSYCC is dehydrated by NisB, it is still an
open question whether lanthionine or methyl-lanthionine might be formed prior to
AviCys or not.
In conclusion, our results show that it is possible to extend the in vivo nisin
production system consisting of NisBTC with the additional enzymes GdmD, for
production of class I nisin and class II mersacidin hybrid lantibiotics. These
molecules show it is possible to extend the diversity of lantibiotics, achieving
unique structures and constitute a potential starting point for engineering hybrid
lantibiotics with improved activity against important pathogens.
Production of Class I and II Hybrid Lantibiotics
165
References
1. Willey JM, van der Donk WA. Lantibiotics: peptides of diverse structure and function. Ann. Rev
Microbiol. 2007,61(1):477-501.
2. McAuliffe O, Ross RP, Hill C. Lantibiotics: structure, biosynthesis and mode of action. FEMS
Microbiol Rev. 2001,25(3):285-308.
3. Knerr PJ, van der Donk WA. Discovery, biosynthesis, and engineering of lantipeptides. Ann Rev
Microbiol. 2012,81(1):479-505.
4. Yu Y, Zhang Q, van der Donk WA. Insights into the evolution of lanthipeptide biosynthesis. Protein
science : a publication of the Protein Society. 2013,22(11):1478-1489.
5. Hurst A. Nisin and other inhibitory substances from lactic acid bacteria. In A. L. Branen and P. M.
Davidson (ed.), Antimicrobials in foods. Marcel Dekker, Inc., New York. 1983. p. 327-351.
6. Perin LM, Todorov SD, Nero LA. Investigation of genes involved in nisin production in Enterococcus
spp. strains isolated from raw goat milk. Antonie Van Leeuwenhoek. 2016. Doi:10.1007/s10482-016-
0721-6
7. Hirsch A. Growth and nisin production of a strain of Streptococcus lactis. J Gen Microbiol.
1951,5(1):208-21.
8. Kuipers OP, Beerthuyzen MM, Siezen RJ, De Vos WM. Characterization of the nisin gene cluster
nisABTCIPR of Lactococcus lactis. Requirement of expression of the nisA and nisI genes for
development of immunity. Eur J Biochem. 1993,216(1):281-91.
9. Kluskens LD, Kuipers A, Rink R, de Boef E, Fekken S, Driessen AJ, Kuipers OP, Moll GN. Post-
translational modification of therapeutic peptides by NisB, the dehydratase of the lantibiotic nisin.
Biochem. 2005,44(38):12827-12834.
10. Lubelski J, Rink R, Khusainov R, Moll GN, Kuipers OP. Biosynthesis, immunity, regulation, mode of
action and engineering of the model lantibiotic nisin. Cell Mol Life Sci. 2008,65(3):455-476.
11. Kuipers A, de Boef E, Rink R, Fekken S, Kluskens LD, Driessen AJ, Leenhouts K, Kuipers OP, Moll
GN. NisT, the transporter of the lantibiotic nisin, can transport fully modified, dehydrated, and
unmodified prenisin and fusions of the leader peptide with non-lantibiotic peptides. J Biol Chem.
2004,279(21):22176-22182.
12. Chatterjee S, Lad S, Phansalkar M, Rupp R, Ganguli B, Fehlhaber H, Kogler H. Mersacidin, a new
antibiotic from Bacillus. Fermentation, isolation, purification and chemical characterization. J Antibiot.
(Tokyo) 1992,45(6):832-838.
13. Altena K, Guder A, Cramer C, Bierbaum G. Biosynthesis of the Lantibiotic Mersacidin: Organization
of a type B lantibiotic gene cluster. Appl Environ Microbiol. 2000,66(6):2565-2571.
14. Majer F, Schmid DG, Altena K, Bierbaum G, Kupke T. The flavoprotein MrsD catalyzes the oxidative
decarboxylation reaction involved in formation of the peptidoglycan biosynthesis inhibitor mersacidin.
J Bacteriol. 2002,184(5):1234-1243.
15. Zhao X, de Jong A, Zhou Z, Kuipers OP. Complete genome sequence of Bacillus amyloliquefaciens
strain BH072, isolated from honey. Genome Announcements. 2015,3(2):e00098–00015.
Chapter 5
166
16. Majchrzykiewicz JA, Lubelski J, Moll GN, Kuipers A, Bijlsma JJ, Kuipers OP, Rink R. Production of
a class II two-component lantibiotic of Streptococcus pneumoniae using the class I nisin synthetic
machinery and leader sequence. Antimicrob Agents Chemother. 2010,54(4):1498-1505.
17. van Heel AJ, Kloosterman TG, Montalbán-López M, Deng J, Plat A, Baudu B, Hendriks D, Moll GN,
Kuipers OP. Discovery, production and modification of five novel lantibiotics using the promiscuous
nisin modification machinery. ACS Synth Biol. 2016. DOI: 10.1021/acssynbio.6b00033.
18. Kuipers A, Meijer-Wierenga J, Rink R, Kluskens LD, Moll GN. Mechanistic dissection of the enzyme
complexes involved in biosynthesis of lacticin 3147 and nisin. Appl Environ Microbiol.
2008,74(21):6591-6597.
19. Khusainov R, van Heel AJ, Lubelski J, Moll GN, Kuipers OP. Identification of essential amino acid
residues in the nisin dehydratase NisB. Front Microbiol. 2015,6:102.
20. van Heel AJ, Mu D, Montalbán-López M, Hendriks D, Kuipers OP. Designing and producing
modified, new-to-nature peptides with antimicrobial activity by use of a combination of various
lantibiotic modification enzymes. Acs Synth Biol. 2013,2(7):397-404.
21. Rink R, Kuipers A, de Boef E, Leenhouts KJ, Driessen AJ, Moll GN, Kuipers OP. Lantibiotic
structures as guidelines for the design of peptides that can be modified by lantibiotic enzymes.
Biochem. 2005,44(24):8873-8882.
22. Kuipers OP, de Ruyter PG, Kleerebezem M, de Vos WM. Controlled overproduction of proteins by
lactic acid bacteria. Trends Biotechnol. 1997,15(4):135-140.
23. Sambrook J, Russell D. Molecular cloning: a laboratory manual. New York: Cold Spring Harbor
Laboratory Press; 2001.
24. Holo H, Nes IF. Transformation of Lactococcus by Electroporation. Methods Mol Biol. 1995,47:195-
199.
25. De Ruyter P, Kuipers OP, De Vos W. Controlled gene expression systems for Lactococcus lactis with
the food-grade inducer nisin. Appl Environ Microbiol. 1996,62:3662−3667.
26. Schägger H. Tricine-SDS-PAGE. Nat Protoc. 2006,1(1):16-22.
27. Schägger H, von Jagow G. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the
separation of proteins in the range from 1 to 100 kDa. Anal Biochem. 1987,166(2):368-379.
28. Lubelski J, Khusainov R, Kuipers OP. Directionality and coordination of dehydration and ring
formation during biosynthesis of the lantibiotic nisin. J Biol Chem. 2009,284(38):25962-25972.
29. Pipes GD, Kosky AA, Abel J, Zhang Y, Treuheit MJ, Kleemann GR. Optimization and applications of
CDAP labeling for the assignment of cysteines. Pharm Res. 2005,22(7):1059-1068.
30. Slootweg JC, Peters N, Quarles van Ufford HL, Breukink E, Liskamp RM, Rijkers DT. Semi-synthesis
of biologically active nisin hybrids composed of the native lanthionine ABC-fragment and a cross-
stapled synthetic DE-fragment. Bioorg Med Chem. 2014,22(19):5345-53.
31. Kuipers OP, Rollema HS, Bongers R, van den Bogaard P, Kosters H, de Vos WM, Siezen RJ. Structure-
function relationships of nisin studied by protein engineering. In: 2 nd Int. Workshop Lantibiotics.
Arnhem, the Netherlands; 1994.
32. Zhou L, van Heel AJ, Montalbán-López M, Kuipers OP. Potentiating the Activity of Nisin against
Escherichia coli. Front Cell Dev Biol. 2016,4:7.
Production of Class I and II Hybrid Lantibiotics
167
33. Kupke T, Kempter C, Jung G, Götz F. Oxidative decarboxylation of peptides catalyzed by flavoprotein
EpiD. Determination of substrate specificity using peptide libraries and neutral loss mass spectrometry.
J Biol Chem. 1995,270(19):111282-111289.
34. Zhang Q, Yu Y, Velasquez JE, van der Donk WA. Evolution of lanthipeptide synthetases. Proc Natl
Acad Sci USA. 2012,109(45):18361-18366.
Chapter 5
168
Table S1. Primers and templates used in this work
No. Product Template Primer (forward) Primer (reverse)
Name Sequence Name Sequence
1 PnisA+nislead
er
plasmid
pNZnisA
E3 [11]
P-nisl-for (5’BglII) GCGCAGATCTAGTCTTATAACTATAC
TG
P-nisl-
rev
series
P-nisl-
rev
CCAGGCAATGTAAAAGTACAGCGTGGT
GATGCACCTGAATC
2 PnisA+nislead
er+nis(1-7)
P-
nis1rin
g-rev
CCGCCGCCACCAGGCAATGTACATAGC
GAAATACTTGTAATG
3 PnisA+nislead
er+nis(1-22)
P-
nis3rin
g-rev
CCGCCGCCACCAGGCAATGTTTTCATGT
TACAACCCATCAG
4 PnisA+nislead
er+nis(1-28)
P-
nis5rin
g-rev
CCGCCGCCACCAGGCAATGTACAATGA
CAAGTTGCTGTTTTC
5 PnisA+nislead
er+nis(1-
22)+CTF
P-
nis3rin
gctf-
rev
CCAGGCAATGTAAAAGTACATTTCATGT
TACAACCCATCAGAG
Production of Class I and II Hybrid Lantibiotics
169
6 PnisA+nislead
er+nis(1-
22)+F
P-
nis3rin
gf-rev
CCGCCACCAGGCAATGTAAATTTCATGT
TACAACCCATCAGAG
7 mrsA’(core
peptide)
genomic
DNA of
strain
BH072
[15]
P-mrsa-
for
series
P-mrsa-
for
ATTCAGGTGCATCACCACGCTGTACT
TTTACATTGCCTGGTGGCGGCGGTG
P-mrsa-rev
(5’PstI)
ATCCTTTGATTTGGCTGCAGTTAACAAA
TACATTCAGAAGTTAG
8 mrsA’(4-20) P-
mrsa(nis
1ring)-
for
TTACAAGTATTTCGCTATGTACATTG
CCTGGTGGCGGCGGTG
9 mrsA’(4-20) P-
mrsa(nis
3ring)-
for
TGATGGGTTGTAACATGAAAACATT
GCCTGGTGGCGGCGGTG
10 mrsA’(4-20) P-
mrsa(nis
5ring)-
for
AAACAGCAACTTGTCATTGTACATTG
CCTGGTGGCGGCGGTG
11 mrsA’ P-
mrsactf(
nis3ring)
-for
GTAACATGAAATGTACTTTTACATTG
CCTGGTGGCGGCGGTG
Chapter 5
170
12 mrsA’(3-20) P-
mrsaf(nis
3ring)-
for
TGGGTTGTAACATGAAATTTACATTG
CCTGGTGGCGGCGGTG
13 attenuator plasmid
pNZnisA-
ltnJ [20]
P-att-for (5’PstI) AATGTATTTGTTAACTGCAGCCAAAT
CAAAGGATAGTATTTTGTTAG
P-att-rev
(5’HindIII)
GCGCAAGCTTCTCTTTATTTTTATAAGC
14 PnisA+nislead
er+mrsA’+att
enuator
product
1+7+13
P-nisl-for (5’BglII) GCGCAGATCTAGTCTTATAACTATAC
TG
P-att-rev
(5’HindIII) or P-
att-rev (5’KpnI)
GCGCAAGCTTCTCTTTATTTTTATAAGC
or
ATATGGTACCAAGCTTCTCTTTATTTTTA
TAAGC
15 PnisA+nislead
er+nis(1-
7)+mrsA’(4-
20)+attenuato
r
product
2+8+13
16 PnisA+nislead
er+nis(1-
22)+mrsA’(4-
20)+attenuato
r
product
3+9+13
17 PnisA+nislead
er+nis(1-
product
4+10+13
Production of Class I and II Hybrid Lantibiotics
171
28)+mrsA’(4-
20)+attenuato
r
18 PnisA+nislead
er+nis(1-
22)+mrsA’+at
tenuator
product
5+11+13
19 PnisA+nislead
er+nis(1-
22)+mrsA’(3-
20)+attenuato
r
product
6+12+13
20 PnisA+nislead
er+nis(1-
22)+mrsA’(4-
12)+ASFNSY
CC
product
16
P-gtail1-rev
(5’PstI)
GCGCCTGCAGTTAACAACAATATGAATT
AAATGAAGCACAAACACCGCCGCCACC
21 PnisA+nislead
er+nis(1-
22)+mrsA’(4-
12)+TLTSYC
C
product
16
P-gtail2-rev
(5’PstI)
GCGCCTGCAGTTAACAACAATAAGAAG
TTAGAGTACAAACACCGCCGCCAC
Chapter 5
172
22 PnisA+nislead
er+nis(1-
22)+mrsA’(4-
12)
product
16
P-deltail-
rev(5’PstI)
GCGCCTGCAGTTAACAAACACCGCCGC
CACCAGGCAATG
23 mrsD genomic
DNA of
strain
BH072
[15]
P-mrsD-for (5’KpnI) ATATGGTACCAGGAGGCGGAGGATG
AGTATTTCAATATTAAAAG
P-mrsD-rev
(5’XhoI)
GCGCCTCGAGTTATGTTAGTGAGGGGTG
TTTTG
173
Chapter 6
Summary and discussion
Chapter 6
174
The ongoing increase of antibiotic-resistance among pathogenic bacteria reduces
the efficacy of most conventional antimicrobial drugs and threatens global health
care [1, 2]. The development of novel antimicrobial alternatives is one of the needs
to combat this problem. Among these diverse compounds, those produced by
bacteria have been most successfully applied as agents in the fields of food,
medicine and agriculture [3]. Antimicrobials produced by members of the genus
Bacillus have been shown to have a broad spectrum of antimicrobial activity
against pathogenic microbes [4, 5]. This thesis addresses different strategies
employed to discover new antimicrobials of Bacillus strains (Fig. 1), including
genome mining and bioinformatics analysis of reported Bacillus species for
antimicrobials, screening and isolating microbes able to produce antimicrobial
compounds from natural sources, and genetic engineering to obtain novel
antimicrobial compounds.
Fig. 1. Scheme of different strategies for discovery of new antimicrobials from
Summary and Discussion
175
Bacillus. Genome mining represents a core activity for discovery of new
antimicrobials: 1. giving a guideline for isolation of antimicrobials from potential
microbes; 2. providing a reference for future Bacilli to be sequenced; 3. offering
valuable sequencing information for genetic engineering.
By genome-based mining, a large number of putative antimicrobial gene clusters
are predicted and identified, which has made it possible to isolate new
antimicrobial compounds [6-9]. The central part of this approach is not only to
identify the product but also to predict the gene clusters for biosynthesis. One of
the advantages of such in silico approaches is that a large variety of gene clusters,
either known or novel, active or cryptic, encoding putative antimicrobial
compounds can be uncovered. We point out another advantage of this strategy,
which is that the post-genome mining analysis includes a number of potential
species never considered to be antimicrobial producers before and which provides
hints for future Bacilli to be sequenced. The challenge that this strategy poses, is
that several uncharacterized gene clusters, predicted to encode putative
antimicrobials, need to be further experimentally confirmed and characterized.
A combined application of BAGEL3 and antiSMASH as shown in chapter 2,
successfully enabled the discovery of novel antimicrobial gene clusters and
allowed for a new classification of putative and known antimicrobial compounds of
a wide variety of Bacillus species. This study highlights the specific ability of
Bacillus sp. to produce a wider variety of putative antimicrobial compounds,
relative to other bacterial genera. Novel information found by this genome mining
study includes 3 types of novel class I bacteriocins: 1. with either a new leader
sequence or new core sequence; 2. known antimicrobial compounds previously
identified in other microorganisms; and 3. completely novel gene clusters
(uncharacterized) encoding potential antimicrobials that need experimental
confirmation. Mining for bacteriocin clusters in genomic DNA sequences mainly
Chapter 6
176
considers the properties of the putative structural gene and the surrounding ORFs
and their homology to modification enzymes, such as lanthionine synthetases
(LanBC, LanM, LanKC or LanL) [10]. We reported several novel class I
bacteriocins by genome mining and further analysis. Two subtilin-like lantibiotics
and a gallidermin/nisin-like lantibiotic were discovered, all sharing the conserved
F(N/D)LD motif in the leader sequence [11], as well as available serine and
cysteine residues for (methyl-)lanthionine formation, and the presence of lanBC
genes in their gene clusters involved in their production [12]. Due to the existence
of a lanM gene, a novel gene cluster of a two-component peptide was found in the
genome of Bacillus cereus Q1 and it was predicted to be a type II lanthipeptide.
Moreover, an amylocyclicin-like circular bacteriocin gene cluster was found in the
genomes of several Bacillus coagulans strains. The core peptide sequence is totally
identical to that of amylocyclicin of Bacillus amyloliquefaciens FZB42, but the
leader peptide sequence is quite different. There are also gene clusters of
antimicrobial peptides not previously reported to be produced by Bacillus, but by
other classes of bacteria. For instance, a gene cluster of an uberolysin-like peptide
was detected in the genome of Bacillus sp. 1NAL3E and gene clusters of circularin
A/bacteriocin AS-48 like peptides were detected in several Geobacillus sp., while
uberolysin was known to be produced by Streptococcus uberis, circularin A is
produced by Clostridium beijerinckii and bacteriocin AS-48 is produced by
Enterococcus faecalis [13-16]. Several new members of Bacillus class II and III
bacteriocins were detected by BAGEL3, in particular holins and holin-like peptide
BhlA, antimicrobial peptide LCI, and leaderless bacteriocin aureocin A53; and
some class III bacteriocins, respresented by colicin, M23 peptidase and pyocin
AP41[17-24]. We also found a lactobin A family protein and a lactococcin A1
family protein known to be produced by lactic acid bacteria belonging to class II
bacteriocins, now detected in Anoxybacillus flavithermus WK1 [25, 26]. These
results indicate a relatively high occurrence of horizontal gene transfer between
these rather unrelated species. These efforts for identification of novel
Summary and Discussion
177
antimicrobial peptides also helps to improve annotation of novel genomes, because
small ORFs are easily overlooked using existing automated genome annotation
tools.
Genome mining results of biosynthetic gene clusters of NRPs and PKs in various
Bacilli indicated that they have a high potential to produce these antimicrobial
compounds and that more attentions should be paid to these newly sequenced
genomes to discover novel antimicrobials. Whether these will provide real potent
antimicrobials or not, needs to be further investigated experimentally.
Most of the known antimicrobial compounds have been discovered using
traditional microbiology isolation and screening techniques [27, 28]. The first step
in that process is to screen for potential producer-bacteria showing antimicrobial
activity. Antimicrobial activity might be associated with the co-production of more
than one type of antimicrobial compound, thus, further in-depth purification and
characterization are necessary to identify the specific nature of the compound(s)
and to ascertain their novelty. By application of mass spectrometry, particularly
MALDI-TOF, the mass of peptides produced can be easily assessed. The
advantage of using compounds that are identified in this way is that they are wild-
type and have already been selected for appropriate expression and activity levels
under standard laboratory conditions, unlike ‘sleeping’ compounds that need
specific inducers or elicitors to be expressed [29]. The main disadvantage of this
strategy is that a wide screening spectrum has to be covered, and that it is only
suitable to isolate compounds that are expressed under laboratory conditions.
Moreover, the success of this strategy is limited by the nature of the antimicrobial
activity test during the screening, since many compounds might have a relatively
narrow target specificity.
In chapter 3, we isolated and identified a B. amyloliquefaciens strain BH072 from a
honey sample, which showed significant antifungal activity. The co-production of
Chapter 6
178
antifungal substances by the same strain involving the macromolecular proteins
flagellin, TasA and the lipopeptide iturin A had never been reported before. Co-
production of three or more antibiotics is not common, but it has been described
that two or three lipopeptides can be simultaneously produced by the same strain
[30-32]. According to the genome mining study of Bacillus species, it was found
that most of the B. amyloliquefaciens strains contain 7 or more gene clusters for
either ribosomally encoded bacteriocins or non-ribosomal antimicrobial
polyketides or lipopeptides [33, 34]. In chapter 4 we showed that the genome
sequence of the B. amyloliquefaciens strain BH072 also contains gene clusters
similar to those of the reported strains, but in a different combination. Further
analysis of the BH072 genome demonstrates that 3 gene clusters of bacteriocins, 5
gene clusters of NRPs and 3 gene clusters of PKs are present. According to the
literature, the presence of unique gene clusters responsible for the synthesis of the
antibacterial polyketides difficidin and macrolactin is a typical feature of most
representatives of the subspecies “plantarum” investigated sofar. In addition, the
presence of enzymes (encoded by the kdg operon) catalyzing formation of triose
from 2-keto-3-deoxygluconate by a pathway different from the Entner-Doudoroff
pathway, were also detected in the genome of BH072, which was a special feature
of the subspecies “plantarum”, distinguishing their representatives from the closely
related subspecies “amyloliquefaciens” and other representatives of the Bacillus
subtilis species group [34]. In conclusion, B. amyloliquefaciens BH072 might
belong to the B. amyloliquefaciens subsp. plantarum and is likely of plant-
associated biocontrol value.
The entire type II lantibiotic mersacidin operon is perfectly conserved in the
genome of BH072. Unfortunately, the mersacidin product could not be detected
directly from the culture of BH072, so the mersacidin encoding gene cluster might
be cryptic or need specific elicitors.
Summary and Discussion
179
Because bacteriocins are directly encoded by genes (often more amenable to
engineering than classical antibiotics), the development of strategies to engineer
bacteriocins has also provided researchers with the means to access the many
apparently silent bacteriocin gene clusters that have been identified through the in
silico inspection of bacterial genomic DNA. The major advantages of the
bioengineering approach include relatively high product yields and easy
downstream processing steps. Rational exploiting the structure-function
relationship contributes to the possibility of artificial production of novel
antimicrobials. Structural characterization of these compounds including net
charge, molecular size and structure determinations, which are known to affect
antimicrobial activity, may enable the design of novel peptides with an improved
therapeutic index. In addition, to address the crisis of antibiotic resistance,
scientists should pay keen attention to the construction of new antimicrobials by
bioengineering, with the goal of obtaining molecules with unique antimicrobial
modes of action [29, 35, 36].
Various approaches have been employed to optimize the original sequence of
lantibiotics, such as site-directed mutagenesis, random mutagenesis and ring
shuffling [37, 38, Montalbán-López, Kuipers et al., manuscript in preparation]. The
possibility of fusing different modifications found in lantibiotics to form novel
modified molecules with rational designed structures opens up new avenues for
obtaining powerful antimicrobials [39]. It is noteworthy that co-expression of
lantibiotic modification enzymes functioning on various lantibiotic substrates can
increase the potency of lantibiotics by making hybrid structures. In chapter 5, We
designed novel hybrid class I and II hybrid lantibiotics with the goal of increasing
the antimicrobial activity, by combining the activities of individual
transglycosylation inhibitor domains and lipid II binding, by using hybrids
consisting of the N-terminal region of nisin and the C-terminal region of
mersacidin [40]. It has been possible to heterologously express the silent lantibiotic
Chapter 6
180
genes of Bacillus in Lactococcus lactis which leads to the improvement of the
production yield. These hybrid compounds might inhibit various processes of cell
wall biosynthesis, generated by lipid II-targeting moieties and synergetic functions,
such as inhibiting transglycoylation. Antimicrobial activity tests suggest that when
the nisin N-terminus and the C-terminal AviCys are combined, the activity of the
hybrid is improved relative to the wildtype molecules. With the first trials of hybrid
biosynthetic lipid II-targeting moieties in hand, a variety of compounds known to
inhibit different aspects of cell wall biosynthesis will be designed, such as
transglycosylase inhibitors, transpeptidase inhibitors, and synthetic pore forming
peptides [41]. In addition to cell envelope inhibitors, there are other mechanisms of
action that are affecting gene expression and protein production within the cell
[42]. Furthermore, the structure-activity relationship of each hybrid, especially the
lipid II binding properties, will in the future be investigated by a number of
structural and functional analyses. Antimicrobial peptides have attracted
considerable attention because of their broad-spectrum antimicrobial activity which
can be either antibacterial, antifungal or even antiviral. The method to design
hybrid peptide integrating different functional domains of peptides together with
antibacterial and antifungal regions will greatly extend the engineering
possibilities.
Type II lantibiotic LanM enzymes are bifunctional proteins that catalyze both the
dehydration and cyclization of LanA substrates. The N-terminal domain of LanM
is responsible for dehydration of Ser and Thr residues and the C-terminal domain
for cyclization, while showing low sequence homology with the type I lantibiotic
cyclase LanC [43]. Since LanM enzymes show no similarity to LanB dehydratases,
this suggests that LanM might have another mode of action for the dehydratase
reaction, independent of glutamylation [44]. There are several functional
differences discovered in this study (chapter 5) between MrsM and NisB and NisC.
We demonstrate that NisB and NisC cannot recognize and modify the precursor
Summary and Discussion
181
peptide when the position of cysteine is upstream of threonine, which even
abolishes the production. However, NisB was able to dehydrate the threonines or
serines at the C-terminus (-SYCC/-TLTSYCC), but not in the C-terminal part of
MrsA (-TLTSECIC). It has already been demonstrated that EpiD does not react
with a C-terminal meso-lanthionine structure [45]. Considering that the C-terminal
sequence of -TLTSYCC is dehydrated by NisB, it is still an open question whether
lanthionine or methyl-lanthionine might be formed prior to AviCys or not. LanD
catalyzes the oxidative decarboxylation of a C-terminal cysteine residue to a
reactive thio-enol intermediate, which then cyclises with a Dha or Dhb residue,
respectively, yielding AviCys or AviMeCys [45]. The decarboxylase MrsD differs
significantly from the prototype EpiD/GdmD by its substrate specificity and
coenzyme requirement [46]. Previous studies on the substrate specificity of EpiD
[45] indicated that the C-terminal consensus sequence of the EpiD substrates is
[V/I/L/(M)/F/Y/W]-[A/S/V/T/C/(I/L)]-C which is not present at the C-terminus of
MrsA (-TLTSECIC) and, therefore, it is not surprising that the C-terminal peptide -
TLTSECIC is not a substrate of GdmD. According to our study, MrsD is unable to
oxidize and decarboxylate the precursor peptide with a dehydrated C-terminal tail
of gallidermin/epidermin. The substrate specificity of MrsD needs to be further
experimentally investigated.
In summary, a combination of screening and isolation of bacteria from natural
sources to obtain potential antimicrobial producers has great strength. Genome
mining procedures to detect novel antimicrobial gene clusters, followed by genetic
engineering and heterologous production of novel antimicrobial compounds, offers
a promising strategy (Fig 1). The extended classification of antimicrobial
compounds suggests that the genus Bacillus provides a rich source of novel
antimicrobials that can now be readily tapped experimentally, since many new
gene clusters will be identified. Other applications of in silico analysis, more
oriented into microbial ecology, can give valuable information about which
Chapter 6
182
environments to screen for novel antimicrobials producers and elicitors
Considering the current prevalence of antibiotic-resistant pathogens, there is
obviously an immediate need to discover and develop novel classes of potent
antibiotics with new inhibitory mechanisms.
References
1. Spellberg B, Guidos R, Gilbert D, Bradley J, Boucher HW, Scheld WM, Bartlett JG, Edwards J, Jr,
Infectious Diseases Society of America. The epidemic of antibiotic-resistant infections: a call to action
for the medical community from the infectious diseases society of America. Clin Infect Dis.
2008,46(2):155-164.
2. Ventola CL. The Antibiotic Resistance Crisis: Part 1: Causes and Threats. J Clin Pharm Ther.
2015,40(4):277-283.
3. Demain AL, Sanchez S. Microbial drug discovery: 80 years of progress. J Antibiot (Tokyo).
2009,62(1):5-16.
4. Abriouel H, Franz CM, Ben Omar N, Galvez A. Diversity and applications of Bacillus bacteriocins.
FEMS Microbiol Rev. 2011,35(1):201-232.
5. Sumi CD, Yang BW, Yeo IC, Hahm YT. Antimicrobial peptides of the genus Bacillus: a new era for
antibiotics. Can J Microbiol. 2015,61(2):93-103.
6. Krzyżanowska DM, Ossowicki A, Rajewska M, Maciąg T, Jabłońska M, Obuchowski M, Heeb S, Jafra
S. When genome-based approach meets the “Old but Good”: revealing genes involved in the
antibacterial activity of Pseudomonas sp. P482 against soft rot pathogens. Front Microbiol.
2016,7:782.
7. Weber T, Kim HU. The secondary metabolite bioinformatics portal: Computational tools to facilitate
synthetic biology of secondary metabolite production. Synth Sys Biotechnol. 2016,1(2):69-79.
8. Huang C, Leung RK, Guo M, Tuo L, Guo L, Yew WW, Lou I, Lee SM, Sun C. Genome-guided
investigation of antibiotic substances produced by Allosalinactinospora lopnorensis CA15-2(T) from
lop nor region, China. Sci Rep. 2016,6:20667.
9. Bonacina J SN, Saavedra L HEM. Genome mining and transcriptional analysis of bacteriocin genes in
Enterococcus faecium CRL1879. J Data Mining in Genomics Proteomics. 2015,06(03).
10. Goto Y, Okesli A, van der Donk WA. Mechanistic studies of Ser/Thr dehydration catalyzed by a
member of the LanL lanthionine synthetase family. Biochemistry. 2011,50(5):891-898.
11. Plat A, Kluskens LD, Kuipers A, Rink R, Moll GN. Requirements of the engineered leader peptide of
nisin for inducing modification, export, and cleavage. Appl Environ Microbiol. 2011,77(2):604-611.
12. Knerr PJ, van der Donk WA. Discovery, biosynthesis, and engineering of lantipeptides. Annu Rev
Biochem. 2012,81(1):479-505.
13. Montalbán-López M, Sánchez-Hidalgo M, Cebrián R, Maqueda M. Discovering the bacterial circular
Summary and Discussion
183
proteins: bacteriocins, cyanobactins, and pilins. J Biol Chem. 2012,287(32):27007-27013.
14. Wirawan RE, Swanson KM, Kleffmann T, Jack RW, Tagg JR. Uberolysin: a novel cyclic bacteriocin
produced by Streptococcus uberis. Microbiol. 2007,153(5):1619-1630.
15. Grande Burgos MJ, Pulido RP, Del Carmen Lopez Aguayo M, Galvez A, Lucas R. The cyclic
antibacterial peptide enterocin AS-48: isolation, mode of Action, and possible food applications. Int J
Mol Sci. 2014,15(12):22706-22727.
16. Kawai Y, Kemperman R, Kok J, Saito T. The circular bacteriocins gassericin A and circularin A. Curr
Protein Pept Sci. 2004,5(5):393-398.
17. Young RB, Bläsi U. Holins: form and function in bacteriophage lysis. FEMS Microbiol Rev.1995,17(1-
2):191-205.
18. Anthony T, Chellappa GS, Rajesh T, Gunasekaran P. Functional analysis of a putative holin-like
peptide-coding gene in the genome of Bacillus licheniformis AnBa9. Arch Microbiol. 2010,192(1):51-
56.
19. Aunpad R, Panbangred W. Evidence for two putative holin-like peptides encoding genes of Bacillus
pumilus strain WAPB4. Curr Microbiol. 2012,64(4):343-348.
20. Liu J, Pan N, Chen Z. Characterization of an anti-rice bacterial blight polypeptide LCI. Rice Genet
Newsl.1990,7:151-154.
21. Netz DJA, Pohl R, Beck-Sickinger AG, Selmer T, Pierik AJ, Bastos MdCdF, Sahl HG. Biochemical
characterisation and genetic analysis of aureocin A53, a new, atypical bacteriocin from Staphylococcus
aureus. J Mol Biol. 2002,319(3):745-756.
22. Zakharov SD, Cramer WA. Colicin crystal structures: pathways and mechanisms for colicin insertion
into membranes. Biochim Biophys Acta. 2002,1565(2):333-346.
23. Bamford CV, Francescutti T, Cameron CE, Jenkinson HF, Dymock D. Characterization of a novel
family of fibronectin-binding proteins with M23 peptidase domains from Treponema denticola. Mol
Oral Microbiol. 2010,25(6):369-383.
24. Sano Y, Kageyama M. Purification and properties of an S-type pyocin, pyocin AP41. J
Bacteriol.1981,146(2):733-739.
25. Contreras BG, De Vuyst L, Devreese B, Busanyova K, Raymaeckers J, Bosman F, Vandamme
EJ.Isolation, purification, and amino acid sequence of lactobin A, one of the two bacteriocins produced
by Lactobacillus amylovorus LMG P-13139. Appl Environ Microbiol.1997,63(1):13-20.
26. Requena T, Yu W, Stoddard GW, McKay LL. Lactococcin A overexpression in a Lactococcus lactis
subsp. lactis transformant containing a Tn5 insertion in the lcnD gene. Appl Microbiol
Biotechnol.1995,44(3-4):413-418.
27. Ananthanarayanan L, Dubhashi A. Characterization of Bacillus species isolated from natural sources
for probiotic properties. Int J Curr Biotechnol. 2015,3(8):22-27.
28. Amin M, Rakhisi Z, Zarei Ahmady A. Isolation and identification of Bacillus Species from soil and
evaluation of their antibacterial properties. Avicenna J Clin Microb Infec. 2015,2(1).
29. Montalbán-López M, Zhou L, Buivydas A, van Heel AJ, Kuipers OP.Increasing the success rate of
lantibiotic drug discovery by synthetic biology. Expert Opin Drugs Dis. 2012,7(8):695-709.
30. Jeukens J, Kukavica-Ibrulj I, Freschi L, Jabaji S, Levesque R. Draft Genome Sequences of Two
Chapter 6
184
Lipopeptide-Producing Strains of Bacillus methylotrophicus. Genome Announcements.
2015,3(5):e01176-01115.
31. Roongsawang N, Thaniyavarn J, Thaniyavarn S, Kameyama T, Haruki M, Imanaka T, Morikawa M,
Kanaya S. Isolation and characterization of a halotolerant Bacillus subtilis BBK-1 which produces
three kinds of lipopeptides: bacillomycin L, plipastatin, and surfactin. Extremophiles. 2002,6(6):499-
506.
32. Koumoutsi A, Chen XH, Henne A, Liesegang H, Hitzeroth G, Franke P, Vater J, Borriss R. Structural
and functional characterization of gene clusters directing nonribosomal synthesis of bioactive cyclic
lipopeptides in Bacillus amyloliquefaciensstrain FZB42. J Bacteriol. 2004,186(4):1084-1096.
33. Hao K, He P, Blom J, Rueckert C, Mao Z, Wu Y, He Y, Borriss R. The genome of plant growth-
promoting Bacillus amyloliquefaciens subsp. plantarum strain YAU B9601-Y2 contains a gene cluster
for mersacidin synthesis. J Bacteriol. 2012,194(12):3264-3265.
34. He P, Hao K, Blom J, Ruckert C, Vater J, Mao Z, Wu Y, Hou M, He P, He Y. et al. Genome sequence
of the plant growth promoting strain Bacillus amyloliquefaciens subsp. plantarum B9601-Y2 and
expression of mersacidin and other secondary metabolites. J Biotechnol. 2012,164(2):281-291.
35. Field D, Cotter PD, Hill C, Ross RP. Bioengineering lantibiotics for therapeutic success. Front
Microbiol. 2015,6:1578-1592.
36. Nagao J, Asaduzzaman SM, Aso Y, Okuda K, Nakayama J, Sonomoto K: Lantibiotics. insight and
foresight for new paradigm. J Biosci Bioeng. 2006,102(3):139-149.
37. Khusainov R, van Heel AJ, Lubelski J, Moll GN, Kuipers OP.Identification of essential amino acid
residues in the nisin dehydratase NisB. Front Microbiol. 2015,6:102.
38. Yuan J, Zhang ZZ, Chen XZ, Yang W, Huan LD. Site-directed mutagenesis of the hinge region of
nisinZ and properties of nisinZ mutants. Appl Microbiol Biotechnol. 2004,64(6):806-815.
39. van Heel AJ, Mu D, Montalbán-López M, Hendriks D, Kuipers OP.Designing and producing
modified, new-to-nature peptides with antimicrobial activity by use of a combination of various
lantibiotic modification enzymes. ACS Synth. Biol. 2013,2(7):397-404.
40. Hoffmann A, Pag U, Wiedemann I, Sahl H. Combination of antibiotic mechanisms in lantibiotics.
Farmaco. 2002,57(8):685-691.
41. Bauer R, Dicks LM. Mode of action of lipid II-targeting lantibiotics. Int J Food Microbiol.
2005,101(2):201-216.
42. Cotter PD, Ross RP, Hill C. Bacteriocins - a viable alternative to antibiotics? Nat Rev Microbiol.
2013,11(2):95-105.
43. Siezen RJ, Kuipers OP, de Vos WM.Comparison of lantibiotic gene clusters and encoded proteins.
Antonie Van Leeuwenhoek. 1996,69(2):171-184.
44. Ortega MA, Hao Y, Zhang Q, Walker MC, van der Donk WA, Nair SK. Structure and Mechanism of
the tRNA-Dependent Lantibiotic Dehydratase NisB. Nature. 2015,517(7535):509-512.
45. Kupke T, Kempter C, Jung G, Götz F. Oxidative decarboxylation of peptides catalyzed by flavoprotein
EpiD. Determination of substrate specificity using peptide libraries and neutral loss mass spectrometry.
J Biol Chem.1995,270(19):111282-111289.
46. Majer F, Schmid DG, Altena K, Bierbaum G, Kupke T. The flavoprotein MrsD catalyzes the oxidative
Summary and Discussion
185
decarboxylation reaction involved in formation of the peptidoglycan biosynthesis inhibitor mersacidin.
J Bacteriol. 2002,184(5):1234-43.
Abbreviations
186
Abbreviations
LAB- lactic acid bacteria
LAP(s)- linear azole-containing peptide(s)
LPs- lipopeptides
MRSA- methicillin-resistant Staphylococcus aureus
NRPs -non-ribosomally synthesized peptides
NRPS- non-ribosomal peptide synthetases
PKs- polyketides
PKS- polyketide synthetases
PTM(s)- posttranslational modification(s)
RiPPs- ribosomally produced and posttranslationally modified peptides
SAM- S-adenosylmethionine
SKF- sporulation killing factor
Nederlandse Samenvatting
187
Nederlandse Samenvatting
De voortdurende toename van resistentie bij pathogene bacteriën vermindert de
effectiviteit van de meeste conventionele antibiotica en bedreigt een goed
functionerende wereldwijde gezondheidszorg. De ontwikkeling van nieuwe
antimicrobiële alternatieven is een van de manieren om dit probleem te bestrijden.
Van deze groep verschillende verbindingen zijn de stoffen die geproduceerd zijn
door bacteriën het meest succesvol toegepast als antimicrobiële middelen op het
gebied van voeding, medicijnen en landbouw. Antimicrobiële stoffen die door vele
soorten van het genus Bacillus worden geproduceerd, laten een breed spectrum van
antimicrobiële activiteit tegen pathogene microben zien. Dit proefschrift beproeft
verschillende strategieën om nieuwe antimicrobiële stoffen uit Bacillus stammen te
verkrijgen. Hierbij zijn genoomdata onderzocht, zijn bio-informatica analyses
uitgevoerd aan genomen van van Bacillus soorten die antimicrobiële stoffen
produceren, zijn micro-organismen gescreend en geïsoleerd die in staat zijn om
antimicrobiële stoffen te produceren uit natuurlijke bronnen en is genetische
modificatie toegepast om nieuwe antimicrobiële verbindingen te verkrijgen.
Een gecombineerde toepassing van BAGEL3 en antiSMASH zoals beschreven in
hoofdstuk 2, heeft geleid tot de succesvolle ontdekking van nieuwe antimicrobiële
genclusters en maakt een aangepaste classificatie mogelijk van voorspelde en
bekende antimicrobiële verbindingen in een groot aantal Bacillus soorten. Deze
studie wijst op het specifieke vermogen van Bacillus sp. om een grotere
verscheidenheid aan potentiële antimicrobiële verbindingen te produceren, in
vergelijking met andere bacteriële genera. Nieuwe informatie gevonden door dit
genoomonderzoek omvat 3 typen van klasse I bacteriocins: 1. met ofwel een
nieuwe leadersequentie of een nieuwe mature sequentie; 2. bekende antimicrobiële
verbindingen eerder geïdentificeerd in andere micro-organismen; en 3. volledig
nieuwe genclusters (nog niet gekarakteriseerd) die mogelijk voor antimicrobiële
Nederlandse Samenvatting
188
stoffen coderen en die experimenteel bevestigd dienen te worden.
Genoomonderzoeksresultaten van biosynthetische genclusters van NHP's en PK's
in diverse Bacilli geven aan dat zij een groot potentieel hebben om deze
antimicrobiële stoffen te produceren. Om deze reden zou meer aandacht besteed
moeten worden aan deze genomen die recent zijn gesequenced om nieuwe
antibiotica te ontdekken. Of deze zoektocht werkelijk krachtige nieuwe
antimicrobiële middelen zal opleveren of niet, zal verder experimenteel moeten
worden onderzocht.
In hoofdstuk 3 is uit honing de B. amyloliquefaciens stam BH072 geïsoleerd en
geïdentificeerd, die een aanzienlijke antischimmel activiteit laat zien. De
coproductie van antischimmel stoffen door dezelfde stam met betrekking tot de
macromoleculaire eiwitten flagellin, TasA en het lipopeptide iturin A was nog
nooit eerder gerapporteerd. Coproductie van drie of meer antibiotica is niet
gebruikelijk, maar het is wel beschreven dat twee of drie lipopeptiden gelijktijdig
geproduceerd kunnen worden door dezelfde stam. Met behulp van het
genoomonderzoek aan diverse Bacillus soorten werd vastgesteld dat de meeste van
de B. amyloliquefaciens stammen 7 of meer genclusters bevatten, voor zowel
ribosomaal gecodeerde bacteriocines als niet-ribosomale antimicrobiële
polyketiden of lipopeptiden. In hoofdstuk 4 wordt aangetoond dat de
genoomsequentie van B. amyloliquefaciens stam BH072 genclusters bevat die
vergelijkbaar zijn met die van de vermelde stammen, maar in een andere
combinatie. Nader onderzoek van het genoom BH072 toont aan dat er 3
genclusters van bacteriocines, 5 genclusters van NRP’s en 3 genclusters van PK's
aanwezig zijn. Het volledige operon van het type II lantibioticum mersacidine is
volledig geconserveerd in het genoom van BH072. Helaas is het product
mersacidine niet rechtstreeks gedetecteerd in het cultuur supernatant van BH072.
Mogelijk is het mersacidine coderende gencluster cryptisch of zijn specifieke
activators noodzakelijk.
Nederlandse Samenvatting
189
Omdat bacteriocines rechtstreeks door genen zijn gecodeerd (en daardoor
gemakkelijker te modificeren dan de klassieke antibiotica), kunnen ook strategieën
worden ontwikkeld om bacteriocines te produceren vanuit in silico voorspelde
genclusters die blijkbaar niet of nauwelijks tot expressie komen. In hoofdstuk 5
ontwierpen we nieuwe klasse I en II hybride lantibiotica met als doel het verhogen
van de antimicrobiële activiteit, door het combineren van de activiteiten van
individuele transglycosylering inhibitiedomeinen en lipide II binding, door
hybriden te construeren bestaande uit het N-terminale deel van nisine en het C-
terminale deel van mersacidine. Het was mogelijk om de niet tot expressie
komende lantibioticum genen van Bacillus heteroloog tot expressie te brengen in
Lactococcus lactis. Dit leidde tot een verbetering van het productieniveau. Deze
hybride verbindingen kunnen verschillende processen van de celwand biosynthese
remmen, bijvoorbeeld door aan te grijpen op lipid II en synergistische functies
zoals het remmen van transglycosylatie. Antimicrobiële activiteitstesten suggereren
dat indien het N-terminale deel van nisine gecombineerd is met het C-terminale
AviCys, de activiteit van de hybride verbeterd is ten opzichte van de wildtype
moleculen.
Samenvattend geeft een combinatie van screening en de isolatie van bacteriën uit
natuurlijke bronnen om potentiële antimicrobiële producenten te verkrijgen veel
mogelijkheden. Software om genomen te doorzoeken op nieuwe antimicrobiële
genclusters, gevolgd door genetische engineering en heterologe productie van
nieuwe antimicrobiële verbindingen, levert een veelbelovend resultaat op. De
uitgebreide classificatie van antimicrobiële verbindingen laat zien dat het genus
Bacillus een rijke bron vormt van nieuwe antimicrobiele stoffen, vormt die nu
gemakkelijk experimenteel kunnen worden benut omdat veel nieuwe genclusters
zijn geïdentificeerd. Andere toepassingen van deze in silico analyses, meer
georiënteerd naar de microbiële ecologie, kunnen waardevolle informatie
verschaffen over welke omgevingen gescreend moeten worden om nieuwe
producenten en activators van antibiotica te vinden. Gezien de huidige prevalentie
Nederlandse Samenvatting
190
van antibioticaresistente pathogenen, is er een urgente behoefte om nieuwe klassen
van krachtige antibiotica met nieuwe mechanismen te ontdekken en te
ontwikkelen.
Acknowledgment
191
Acknowledgment
Groningen is early winter turning cold again in November, the sky is blue, the
clouds are white and the grass in accordance with the rain is still green. I am sitting
in Linnaeusborg sixth floor office, recalling my doctoral thesis writing process as
well as 5 years of research life - edge of love and pain.
I started my successive postgraduate and doctoral programs of study in September
2011, in Tianjin University, P. R. China. Afterwards, I got the qualification of
Chinese Scholarship Council (CSC) and came to Molgen, University of Groningen,
the Netherlands in September 2014, to finish my PhD study. During this period,
many people have given me helps and I would like to thank you all sincerely.
My deepest gratitude goes first and foremost to my supervisor in the Netherlands,
Prof. Oscar P. Kuipers, for his constant encouragement and guidance. I am grateful
to have had this opportunity to do research as his PhD student. He has taken me
into the genetic world of antimicrobials and walked me through all the stages of the
writing of this thesis. Without his consistent and insightful instruction, this thesis
could not have reached its present form.
I also would like to express my heartfelt gratitude to my co-supervisor in China,
Prof. Zhijiang Zhou. He not only gave patient instruction and expert guidance, but
also offered me valuable suggestions in the academic studies. In addition, I deeply
appreciate the contribution to the chapter 3 of this thesis made in China together
with him and his support of my study in the Netherlands.
I also owe a special debt of gratitude to Prof. Jan Kok, Prof. Jan-Willem Veening
and Prof. Gert Moll for all the suggestions.
Grateful acknowledgment is made to my daily supervisor dear Manolo who gave
me considerable help by means of experimental suggestion and manuscript
Acknowledgment
192
revising. His encouragement and unwavering support has sustained me through
frustration and depression. He is always pushing me ahead till the completion of
this thesis.
I also want to thank Dr. Anne de Jong. From the genome sequencing to data
analyzing, he gave me valuable bioinformatics advice and help.
I would like to thank Maike and Chunxu for devoting their valuable time to read
my thesis and provide comments.
My gratitude also goes to Sjoerd for his help on the Dutch abstract and summary of
this thesis and Zhibo for his help on the thesis layout.
To my officemates Elrike, Tonia, Robyn, Clement, Lance and Stefano, I really
enjoy sitting in the same office with them. They are always very kind and provide a
lot of help and encouragement in my study. I appreciate all the happy time with
you.
My grateful thanks go to Molgen Bacillus group Lab 0651, Mirjam, Barbara, Ard
Jan, Luiza, Marielle, Jason, Yi and Zhibo. I really enjoy working in the same lab
with them. They are always very kind and provide a lot of technical help in the lab.
I would like to thank all the members of Molgen Lanti group. They always provide
a lot of theoretical and technical help on lantibiotics and Lactococcus lactis in my
study. Especially, I would like to express my deepest gratitude to Auke, Maike,
Dongdong, Qian, Jingjing, Ana and Andrius. They are always willing to help me
with smiles.
I would like to thank our Chinese Molgen group: Dongdong, Liang, Yi, Jason,
Qian, Jingjing, Xue, Chenxi, Chunxu, Zhibo, Lu; and all the other Molgeners:
Manon, Jannet, Klazien, Anne, Siger, Harma, Angel, Lieke, Ruben, Tomas, Yoshi,
Takato, Arnau, Rieza, Jeroen, Ruud, Jhonatan, Renske, Jelle, Morten, Katrin,
Acknowledgment
193
Robin, Dimitra, Amanda, Jakob, David, Santiago, Baptiste, Alexandros, Arnoldas
and so on for working, eating, playing and sharing together during these years.
Furthermore, I would like to thank all my Chinese friends met in Groningen, Xinyu
Li, Huatang Cao, Zhenchen Tang, Xiaoming Miao, Xiaodong Cheng, Yanan
Wang, Si Chen, Fangfang Guo, Yingfen Wei, Min Wu, Boqun Liu, Yuanze Wang,
Bin Jiang, Lianghui Cheng, Wei Qin, Lei Lv, Xiangfeng Meng, Yuxiang Bai,
Huifang Yin, Gang Huang, Weichao Jing, Liying Tuo, Yuchen Du, Jing Chang,
Chen Li, Lu Han and Qing Zhang.
I am greatly indebted to the CSC for offering me the one year and a half support to
study in the Netherlands.
I also would like to thank professors, teachers and classmates at the Department of
Food Science, Tianjin University, who have instructed and helped me a lot in the
past ten years.
Special thanks should go to my roommates Yu Qi (Yuki), Ke Zheng (Coco) and
Anton Eskenazi, who have put considerable time with me in Groningen as family. I
was very happy traveling with them to many European cities, large and small.
To my beloved Nan, I cannot thank him enough for trusting and supporting me.
Even though we are far from each other, he always understands me.
Last but not the least, my gratitude also extends to my parents who have been
assisting, supporting and caring for me all my life. Mom and Dad, I am always
loving you. All my best wishes to you!
谢谢爸爸妈妈,我爱你们。
194
Publications
195
List of publications
1. Zhao X, Kuipers OP. Identification and classification of known and
putative antimicrobial compounds produced by a wide variety of Bacillales
species. BMC Genomics, 2016,17:882. (chapter 2)
2. Zhao X, de Jong A, Zhou Z, Kuipers OP. Complete genome sequence of
Bacillus amyloliquefaciens strain BH072, isolated from honey. Genome
announcements, 2015,3:e00098-15. (chapter 4)
3. Wang J, Li L, Zhao X, Zhou Z. Partial characteristics and antimicrobial
mode of pediocin produced by Pediococcus acidilactici PA003. Annals of
Microbiology, 2015,2:1-10.
4. Han Y, Fan J, Zhou Z, Tan X, Zhao X. Cloning and efficient expression of
Bacillus sp. BH072 tasA gene in Escherichia coli. Transactions of Tianjin
University, 2015,21:26-31.
5. Zhao X, Han Y, Tan X, Wang J, Zhou Z. Optimization of antifungal
lipopeptide production from Bacillus sp. BH072 by response surface
methodology. Journal of Microbiology, 2014,52:324-332.
6. Ren L, Han Y, Yang, Tan X, Wang J, Zhao X, Fan J, Dong T, Zhou Z.
Isolation, identification and primary application of bacteria from putrid
alkaline silica sol. Frontiers of Chemical Science and Engineering,
2014,8:330-339.
7. Fan J, Zhou Z, Zhao X, Tan X, Han Y. Isolation and identification of
yeasts in honey. Science and Technology of Food Industry, 2014,35:165-
168.
Publications
196
8. Zhao X, Zhou Z, Han Y, Wang Z, Fan J, Xiao H. Isolation and
identification of antifungal peptides from Bacillus BH072, a novel
bacterium isolated from honey. Microbiological Research, 2013,168:598-
606. (chapter 3)
9. Fan J, Zhou Z, Zhao X, Han Y. Research progress on production of sugar
alcohols by microbial fermentation. Sichuan Food and Fermentation,
2013,49:94-98.
10. Zhou Z, Zhao X, Han Y. A high-yielding strain of antimicrobial peptide
and its preparation methods (CN103773712 A). Patent application No.
201310662193.2.