Post on 29-Aug-2021
transcript
Use of Hanseniaspora opuntiae in co-fermentation with
Saccharomyces cerevisiae to enhance the aromatic profile
of craft beer
Miguel Pinto Rocha
Thesis to obtain the Master of Science Degree in
Biotechnology
Supervisors: Dr. Margarida Isabel Rosa Bento Palma
Prof. Dr. Isabel Maria de Sá Correia Leite de Almeida
Examination Committee
Chairperson: Prof. Dr. Arsénio do Carmo Sales Mendes Fialho
Supervisor: Dr. Margarida Isabel Rosa Bento Palma
Members of the Committee: Dr. Cláudia Sofia Pires Godinho
November 2019
i
ii
Preface
The work presented in this thesis was performed at the Institute for Bioengineering and Biosciences of
Instituto Superior Técnico (Lisbon, Portugal), during the period February – October 2019, under the
supervision of Doctor Margarida Palma and Professor Isabel Sá-Correia.
Declaration
I declare that this document is an original work of my authorship and that it fulfils all the requirements
of the Code of Conduct and Good Practices of the Universidade de Lisboa.
iii
Acknowledgements
I would like to start by acknowledging my supervisors, Professor Isabel Sá-Correia and Dr. Margarida
Palma. I am thankful for their patience, knowledge and guidance that allowed the development of this
thesis. I would also like to thank Professor Isabel Sá-Correia, the leader of the Biological Sciences
Research Group (BSRG) of the Institute for Bioengineering and Biosciences (iBB), for the opportunity
to join her group.
I would like to acknowledge Professor Rosário Bronze and lab technician António Ferreira from Instituto
de Biologia Experimental e Tecnológica (iBET) for their collaboration in the GC-MS analysis.
I would also like to acknowledge the expert panel of tasters, composed by Hugo Elias, Bruno Aquino,
Fernando Gonçalves, João Loureiro and Pedro Lima. A special acknowledgment goes to Hugo Elias,
from D’Ourique Flavours, Cerveja Artesanal, for gathering the panel of beer tasters.
This work was performed in the Biological Sciences Research Group (BSRG) of the Institute for
Bioengineering and Biosciences (iBB), Instituto Superior Técnico, Universidade de Lisboa. The funding
received by iBB from the Portuguese Foundation for Science and Technology (FCT)
(UID/BIO/04565/2019) is acknowledged.
The following acknowledgements will be addressed in Portuguese:
Em primeiro lugar, gostaria de agradecer à Professora Isabel Sá-Correia pela orientação, por todo o
conhecimento transmitido e por todas as opiniões e conselhos que possibilitaram a realização desta
tese.
Um agradecimento especial à Dra. Margarida Palma pela disponibilidade e imensa paciência que teve
para comigo, por todo o conhecimento transmitido e aconselhamento diário. Sem a sua ajuda não teria
sido possível realizar esta tese, pelo que estarei para sempre grato.
Quero também agradecer ao grupo do laboratório 6.6.13, Luís, Cláudia, Nuno, Marta, Ricardo e Rui
pela forma como me receberam, por toda a ajuda prestada e por todos os momentos de boa disposição.
Um agradecimento especial ao Nuno, não só pela análise dos resultados do GC-MS, como também
pela disponibilidade e ajuda prestada. Aos meus colegas de mestrado, Catarina, Pedro, Rute e Paula,
um obrigado pela entreajuda no laboratório, mas principalmente por todos os momentos de
descontração e boa disposição, dentro e fora do laboratório.
Um obrigado ao meu padrinho Miguel, por todas as conversas e conselhos e por todo o apoio dado
durante o meu percurso académico.
Por fim, um enorme agradecimento à minha família, aos meus pais Isabel e Carlos, à minha irmã Joana
e à minha namorada Nina, por todo o apoio, compreensão e força que me dão e por me fazerem
acreditar em mim. Sem eles, não seria a pessoa que sou nem seria capaz de chegar a onde estou
hoje.
iv
Abstract
The increasing growth in popularity of craft beer led brewers to explore different Saccharomyces
cerevisiae starters, or mixed culture fermentations with this species and a non-Saccharomyces species
to produce beers of high sensorial complexity. In this work, several yeast species were isolated from
different environments. Four Hanseniaspora strains isolated from wine production environments were
screened for their potential in the enhancement of beer flavour and aroma. Hanseniaspora opuntiae
IST408 was selected to undergo mixed beer fermentations with the commercial strain S. cerevisiae US-
05, either inoculated simultaneously or sequentially. HPLC and GC-MS were used to characterize the
residual sugars and ethanol concentrations and the volatile profile of the produced beers, respectively.
H. opuntiae IST408 produced an overly sweet beer but has potential for the production of low-alcoholic
aromatic beverages. However, beers produced by mixed fermentations presented higher
concentrations of acetate esters and organic acids than single S. cerevisiae fermentations, in
agreement with the organoleptic evaluation of the beers, performed by an expert panel. Beers produced
by simultaneous inoculation of the two species were considered the most pleasant, with a citric, fruity
and acidic profile. Population dynamics studies were performed to investigate the evolution of each
species’ population in single and mixed culture fermentations. A S. cerevisiae mutant in which the three
main genes involved in acetate ester synthesis, ATF1, ATF2 and EAT1, are eliminated was also
constructed. This mutant will be used in future studies for the functional characterization of the
homologous genes from non-Saccharomyces that present high acetate ester production.
Keywords: Beer; Saccharomyces cerevisiae; Hanseniaspora opuntiae; Mixed culture fermentation;
Acetate ester production; Population dynamics
v
Resumo
O aumento da popularidade da cerveja artesanal tem levado os cervejeiros a explorar a realização de
fermentações de cultura mista envolvendo Saccharomyces cerevisiae e uma espécie não-
Saccharomyces, para produzir cervejas de elevada complexidade sensorial. Neste trabalho, a
capacidade de Hanseniaspora opuntiae IST408 em melhorar o perfil organolético da cerveja foi
testado. Para tal, foram realizadas fermentações mistas, com inoculação sequencial ou simultânea,
desta estirpe e da estirpe comercial S. cerevisiae US-05. HPLC e GC-MS foram utilizados para
caracterizar as concentrações de açúcares e etanol e o perfil de compostos voláteis das cervejas
produzidas. H. opuntiae IST408 produziu uma cerveja demasiado doce mas demonstrou potencial para
a produção de bebidas aromáticas pouco alcoólicas. No entanto, cervejas produzidas por fermentação
mista apresentaram concentrações superiores de ésteres de acetato e ácidos orgânicos do que por
fermentação apenas com S. cerevisiae, o que está de acordo com a avaliação organolética das
cervejas, efetuada por um painel de especialistas. Cervejas produzidas por inoculação simultânea
foram consideradas mais agradáveis, apresentando um perfil cítrico, frutado e acídico. Testes de
dinâmica populacional de fermentações com culturas simples e mistas foram efetuados de forma a
avaliar a evolução de cada uma das espécies. Paralelamente, foi construído um mutante de S.
cerevisiae em que os três principais genes envolvidos na produção de ésteres de acetato (ATF1, ATF2,
EAT1) foram parcialmente eliminados. Este mutante foi desenhado para ser utilizado em estudos
futuros que visam a caracterização funcional de genes homólogos de espécies não-Saccharomyces
que apresentam elevada produção de ésteres de acetato.
Palavras-chave: Cerveja; Saccharomyces cerevisiae, Hanseniaspora opuntiae; Fermentações de
cultura mista; Produção de ésteres de acetato; Dinâmica populacional
vi
Table of Contents
1. Motivation and thesis outline ..................................................................................................... 1
2. Introduction ..................................................................................................................................... 3
2.1. Production of different types of beer by Saccharomyces yeasts ............................. 3
2.2. Domestication of yeasts in beer production ................................................................... 3
2.3. Non-Saccharomyces yeasts in beer production ............................................................ 4
2.3.1. Pichia species .................................................................................................................. 4
2.3.2. Torulaspora species ....................................................................................................... 5
2.3.3. Brettanomyces species ................................................................................................. 6
2.3.4. Hanseniaspora species ................................................................................................. 8
2.3.5. Other yeast species ........................................................................................................ 9
2.4. Volatile compounds produced by yeasts ...................................................................... 10
2.4.1. Higher alcohols ............................................................................................................. 10
2.4.2. Volatile esters ................................................................................................................ 11
2.4.3. Carbonyl compounds .................................................................................................. 13
2.4.4. Organic acids ................................................................................................................. 14
2.4.5. Volatile sulphuric compounds .................................................................................. 15
2.4.6. Volatile phenols ............................................................................................................. 15
2.4.7. Monoterpene alcohols ................................................................................................. 17
3. Materials and Methods ............................................................................................................... 18
3.1. Yeast isolation and identification .................................................................................... 18
3.1.1. Samples collected ......................................................................................................... 18
3.1.2. Yeast isolation ............................................................................................................... 18
3.1.3. DNA extraction ............................................................................................................... 18
3.1.4. Polymerase Chain Reaction (PCR) and gel electrophoresis ............................. 19
3.1.5. DNA sequencing and yeast species identification .............................................. 19
3.1.6. Addition to the IST yeast collection ......................................................................... 19
3.2. Fermentative Trials .............................................................................................................. 20
3.2.1. Preparation of the beer wort ...................................................................................... 20
3.2.2. Strain selection for fermentation .............................................................................. 20
3.2.3. Inoculum preparation and fermentative conditions for the first screening .. 20
3.2.4. Organoleptic evaluation of the fermentation products from the first
screening .................................................................................................................................... 21
3.2.5. Inoculum preparation and fermentative conditions for the single and mixed
culture fermentations .............................................................................................................. 21
3.2.6. Fermentation monitoring ............................................................................................ 21
vii
3.2.7. Monitoring of sugar and ethanol concentrations ................................................. 21
3.2.8. Volatile compound analysis by GC-MS ................................................................... 22
3.3. Population Dynamics studies ........................................................................................... 22
3.3.1. Preparation of beer wort ............................................................................................. 22
3.3.2. Inoculum preparation and fermentative conditions for population dynamics
studies......................................................................................................................................... 22
3.3.3. Fermentation monitoring ............................................................................................ 23
3.3.4. Time point sample acquisition .................................................................................. 23
3.3.5. Monitoring of sugar and ethanol concentrations ................................................. 23
3.4. ATF1, ATF2 and EAT1 disruptions by CRISPR-Cas9 methodology ....................... 24
3.4.1. Oligonucleotides used ................................................................................................. 24
3.4.2. Plasmids used for the partial deletion of ATF1, ATF2 and EAT1 genes ........ 25
3.4.3. Saccharomyces cerevisiae CEN.PK113-7D transformation with p51-Cas9
vector........................................................................................................................................... 25
3.4.4. Primer duplexing ........................................................................................................... 25
3.4.5. Preparation of the plasmid with gRNA .................................................................... 26
3.4.6. E. coli transformation .................................................................................................. 26
3.4.7. Transformation with p59-gRNA and donorDNA ................................................... 26
3.4.8. Plasmid loss ................................................................................................................... 27
4. Results ............................................................................................................................................ 29
4.1. Isolation and identification of yeasts .............................................................................. 29
4.2. Selection of a Hanseniaspora strain with potential for increasing the
organoleptic profile of beer ....................................................................................................... 31
4.2.1. First screening fermentations ................................................................................... 31
4.2.2. Organoleptic characterisation of the fermentation products from the first
screening .................................................................................................................................... 33
4.3. Beer production by single and mixed cultures of Hanseniaspora opuntiae
IST408 and Saccharomyces cerevisiae US-05 ..................................................................... 33
4.3.1. Fermentation profile of single and mixed cultures of Hanseniaspora
opuntiae IST408 and Saccharomyces cerevisiae US-05 ............................................... 33
4.3.2. Volatile compound profile of single and mixed culture beer fermentations . 36
4.3.3. Organoleptic characterization of the beers produced by pure and mixed
culture fermentations .............................................................................................................. 43
4.4. Population dynamics during single and mixed culture fermentations of H.
opuntiae IST408 and S. cerevisiae US-05 .............................................................................. 44
4.5. Deletion of ATF1, ATF2 and EAT1 genes in Saccharomyces cerevisiae by
CRISPR-Cas9 methodology ...................................................................................................... 48
5. Discussion ..................................................................................................................................... 51
viii
6. Concluding remarks and future perspectives ..................................................................... 59
7. References..................................................................................................................................... 61
8. Annex .............................................................................................................................................. 75
ix
List of figures
Figure 1 – The three reactions that form the Ehrlich pathway and the genes that code for the enzymes
that catalyse each reaction. Taken from [78]. ....................................................................................... 11
Figure 2 – Biosynthesis of acetate esters (A) and of medium-chain fatty acid ethyl esters (B). The
genes that code for the enzyme responsible for the catalysis of each reaction are displayed above the
reaction arrows. Taken from [78]. ......................................................................................................... 13
Figure 3 – (A) Decarboxylation of phenylacrylic acids into vinyl phenols. S. cerevisiae and
Brettanomyces species can perform this reaction since they possess enzymes with phenylacrylic acids
reductase activity (B) Reduction of vinylphenols into ethylphenols. This reaction can be performed by
Brettanomyces species but not S. cerevisiae, since the former express the enzyme vinylphenol
reductase. Taken from [86]. .................................................................................................................. 16
Figure 4 – Overview of the biotransformation reactions of monoterpene alcohols and respective esters
catalysed by yeasts. The enzymes responsible for the catalysis of each reaction are indicated near the
reaction arrows. Enzymes in green have been experimentally verified in S. cerevisiae. Putative
enzymatic activities that have been implied from metabolite profiling in fermentations with S. cerevisiae
or bacteria are indicated in blue and orange, respectively. Taken from [16]. ....................................... 17
Figure 5 – Samples taken in each time point in the population dynamics studies............................... 23
Figure 6 – Progress of the first screening fermentations performed by different strains of H. uvarum
(IST412) and H. opuntiae (IST399, IST406 and IST408). .................................................................... 32
Figure 7 – (A) – Fermentation progress of single and mixed culture fermentations of H. opuntiae IST408
and S. cerevisiae US-05 fermentations performed for beer production. Orange dots correspond to H.
opuntiae IST408 single culture fermentation, blue dots correspond to S. cerevisiae US-05 single culture
fermentation, yellow dots correspond to sequential fermentation and grey dots correspond to
simultaneous fermentation. The growth curves shown are the result of three independent experiments
that gave rise to the same results. (B) – Fermentation progress of H. opuntiae IST408 single culture
fermentation, using a more appropriate scale. ...................................................................................... 34
Figure 8 – Sugars (maltose, maltotriose, fructose and glucose) and ethanol concentrations obtained
from single (H. opuntiae IST408 and S. cerevisiae US-05) and mixed (sequential and simultaneous)
culture fermentations. Samples were collected prior to fermentation and after primary and secondary
fermentations. An additional sample was collected at 48 hours in sequential fermentations, just before
the introduction of S. cerevisiae US-05. ................................................................................................ 36
x
Figure 9 – Total relative abundance of the four most ample chemical groups across all four
fermentations. Statistical significance was considered between mean values when *P-value<0.05; **P-
value<0.01; ***P-value<0.001; ****P-value<0.0001. T1 identifies samples taken after primary
fermentation and T2 identifies samples taken after secondary fermentation. ...................................... 37
Figure 10 – Relative abundance of the most abundant compounds of the acetate and ethyl esters
chemical groups. Statistical significance was considered between mean values when *P-value<0.05;
**P-value<0.01; ***P-value<0.001; ****P-value<0.0001. T1 identifies samples take after primary
fermentation and T2 identifies samples taken after secondary fermentation. ...................................... 41
Figure 11 – Relative abundance of the most abundant compounds of the higher alcohols and organic
acids chemical groups. Statistical significance was considered between mean values when *P-
value<0.05; **P-value<0.01; ***P-value<0.001; ****P-value<0.0001. T1 identifies samples taken after
primary fermentation and T2 identifies samples taken after secondary fermentation. ......................... 42
Figure 12 – (A) – Fermentation progress of single and mixed culture fermentations of H. opuntiae
IST408 and S. cerevisiae US-05 fermentations performed for population dynamics studies. Orange dots
correspond to H. opuntiae IST408 single culture fermentation, blue dots correspond to S. cerevisiae
US-05 single culture fermentation, yellow dots correspond to sequential fermentation and grey dots
correspond to simultaneous fermentation. The growth curves shown are the result of three independent
experiments that gave rise to the same results. (B) – Fermentation progress of H. opuntiae IST408
single culture fermentation, with a more appropriate scale. ................................................................. 44
Figure 13 – Sugars (maltose, maltotriose, fructose and glucose) and ethanol concentrations obtained
during the fermentation performed for the study of population dynamics in single (H. opuntiae IST408
and S. cerevisiae US-05) and mixed (sequential and simultaneous) culture fermentations. Samples
were periodically collected during 14 days. .......................................................................................... 45
Figure 16 – Alignments between a portion of the target gene sequences obtained by Sanger
sequencing and a portion of the non-mutated target gene sequences; A) Alignment between the non-
mutated ATF1 gene sequence and the mutated ATF1 gene sequence in CEN.PK113-7D atf1Δ; B)
Alignment between the non-mutated ATF2 gene sequence and the mutated ATF2 gene sequence in
CEN.PK113-7D atf2Δ; C) Alignment between the non-mutated EAT1 gene sequence and the mutated
EAT1 gene sequence in CEN.PK113-7D eat1Δ; D) Alignment between the non-mutated ATF2 gene
sequence and the mutated ATF2 gene sequence in CEN.PK113-7D atf1Δ atf2Δ; E) Alignment between
the non-mutated EAT1 gene sequence and the mutated EAT1 gene in CEN.PK113-7D atf1Δ atf2Δ
eat1Δ. .................................................................................................................................................... 49
xi
List of tables
Table 1 – Sequences of the oligos used in the disruption of ATF1, ATF2 and EAT1. ......................... 24
Table 2 – Plasmids created in this study. ............................................................................................. 25
Table 3 – Yeast strains from different species isolated from different samples. The IST Yeast Culture
Collection ID# and the identity (%) obtained in BLAST analysis performed in the NCBI database are
shown. ................................................................................................................................................... 31
Table 4 – pH values of the fermentation products obtained from the first screening fermentations. ... 32
Table 5 – Concentration of maltotriose, maltose, glucose, fructose and ethanol in the fermentation
products after 330 hours of fermentation. ............................................................................................. 33
Table 6 – pH value of the fermented products after the primary and secondary fermentations. ......... 35
Table 7 – Average relative abundance (RA) and standard deviation (SD) of all compounds identified in
single and mixed fermentations ............................................................................................................ 38
Table 8 – Sensory analysis notes of the expert panel for each beer produced in the beers fermented
by single cultures of H. opuntiae IST408 and S. cerevisiae US-05 and by simultaneous or sequential
mixed cultures of both species. ............................................................................................................. 43
xii
List of abbreviations
4-EG 4-ethylguaiacol
4-EP 4-ethylphenol
4-VC 4-vinylcatechol
4-VG 4-vinylguaiacol
4-VP 4-vinylphenol
4-VS 4-vinylsyringol
AATase Alcohol acetyl transferase
AEATase Acyl-CoA:ethanol O-acyltransferase
B. anomala Brettanomyces anomala
B. bruxellensis Brettanomyces bruxellensis
BCAA Branched-chain amino acid
BLAST Basic Local Alignment Search Tool
Car® Carboxen®
CFUs Colony Forming Units
CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
ddH2O Double-distilled water
DMSO Dimethyl sulfoxide
DNA Deoxyribonucleic acid
dNTPs Deoxy nucleotide
DTT Dithiothreitol
DVB Divinylbenzene
E. coli Escherichia coli
EDTA Ethylenediaminetetraacetic acid
EMBOSS European Molecular Biology Open Software Suite
FA Ferulic acid
GC-MS Gas chromatography - Mass spectrometry
gRNA Guide RNA
H. guilliermondii Hanseniaspora guilliermondii
H. opuntiae Hanseniaspora opuntiae
H. uvarum Hanseniaspora uvarum
H. vineae Hanseniaspora vineae
HF High fidelity
HPLC High Performance Liquid Chromatography
HS-SPME Headspace solid-phase microextraction
IST Instituto Superior Técnico
ITS Internal transcriber spacer
L. thermotolerans Lachancea thermotolerans
LB Lysogeny broth
xiii
LBA Lysogeny broth ampicillin
MCFA Medium-chain fatty acids
MS Mass spectrometry
MUSCLE Multiple Sequence Comparison by Log-Expectation
NCBI National Center for Biotechnology Information
OD Optical Density
P. anomala Pichia anomala
P. kluyveri Pichia kluyveri
P. kudriavzevii Pichia kudriavzevii
pCA p-coumaric acid
PCR Polymerase Chain Reaction
PDMS Polydimethylsiloxane
PEG Polyethylene glycol
PTFE Polytetrafluoroethylene
rDNA Ribosomal DNA
RNA Ribonucleic acid
rpm Rotation per minute
S. cerevisiae Saccharomyces cerevisiae
S. eubayanus Saccharomyces eubayanus
S. pastorianus Saccharomyces pastorianus
SA Sinapic acid
STE Sodium chloride-Tris-EDTA
T. delbrueckii Torulaspora delbrueckii
TCM Tris-calcium-magnesium
TPP Thiamine diphosphate
Tris Tris(hydroxymethyl)aminomethane
VDKs Vicinal diketones
W. anomalus Wickerhamomyces anomalus
WLN Wallerstein Laboratory Nutrient
YM Yeast malt
YNB Yeast Nutrient Base
YPD Yeast Extract-Peptone-Dextrose
xiv
1
1. Motivation and thesis outline
Fermented beverages have been produced by humans for thousands of years. Although bacteria can
be involved, yeasts are the most important microorganisms in the production of alcoholic fermented
beverages [1]. These eukaryotic organisms are responsible for metabolizing the sugars of the
fermentative medium into carbon dioxide and ethanol and producing a wide variety of aroma and flavour
active compounds that can influence the organoleptic profile of the beverage [1]. Although the first
fermentations were the result of spontaneous fermentations and some beverages are still produced
using traditional methods, modern production methods use yeast starter cultures as a way to guarantee
a rapid start of fermentation, in order to avoid the risk of contamination by unwanted microorganisms
and the development of undesirable off-favours [2,3]. The use of starter cultures has been also
important to ensure that the production of beverages is consistent across fermentation batches, which
is an important factor for the growth of alcoholic fermented beverages industry [4]. A wide array of
yeasts are used in the production of alcoholic fermented beverages, with Saccharomyces cerevisiae
being the most used [5]. This species presents certain characteristics that justify its dominance in the
production of fermented beverages, such as being highly tolerant to ethanol and capable of producing
high concentrations of this compound, and displaying the Crabtree effect (respiration repression by
glucose), which allows S. cerevisiae to perform fermentation in the presence of oxygen [4,6,7].
Beer is the most consumed alcoholic beverage in the world. Industrial production of this beverage has
narrowed down the type of raw materials and yeast strains used in beer production, leading to more
standardized products across the market [8,9]. However, in the last decade, the increased popularity of
craft beers that differentiate themselves from industrial beers in the complexity of the beers produced,
led to the emergence of new craft breweries [8–10]. Craft breweries are micro to small independent
breweries that produce more traditional styles of beer, while also innovating with new and experimental
styles [8,9]. For instance, craft brewers have experimented mixing malts and hops from different beer
styles, utilizing water with different mineral composition and also using unusual ingredients in beer
production, such as fruit, mushrooms and aromatic herbs [8,9]. One ingredient of beer production that
has received less attention for innovation is the yeast. However, in recent years, this has been changing,
with craft breweries producing beers by fermenting with uncommon yeasts, such as S. cerevisiae Kveik
yeasts, strains traditional to Norwegian farmhouse brewing [11], and with non-Saccharomyces yeasts
that were previously considered spoilage yeasts in beer [12,13]. Due to the increased interest in the
non-Saccharomyces species, the number of studies regarding the isolation, identification and
characterization of the potential of these non-conventional yeasts for beer production is also increasing
[14]. The majority of non-Saccharomyces species are not capable of fermenting all the sugars present
in beer wort, so a co-fermentation with a S. cerevisiae strain is necessary to obtain a complete
fermentation [15]. Nonetheless, some non-conventional yeasts show promise in beer production due to
producing higher quantities of aroma and flavour active compounds than S. cerevisiae, mainly volatile
esters [6,12].
2
The fact that some non-Saccharomyces are good producers of volatile esters, especially acetate esters,
can also be of interest to other industries [16,17]. For instance, ethyl acetate, in spite of being one of
the most important aroma compounds present in fermented beverages, is also a valuable bulk chemical
in other industries, such as resins and adhesives production [17,18]. Since this ester is produced
industrially from petrochemical resources, yeasts that produce high amounts of ethyl acetate can
become an important alternative to the production of this compound [18].
The objective of this thesis work was the isolation, identification and characterization of non-
Saccharomyces species for the improvement of the organoleptic profile of beer, in particular at the level
of volatile esters that confer fruity and floral aromas to beer. Three samples from wine production
environments, as well as two other samples from fermented products were collected. Species isolated
in this work and that were part of the IST Yeast Collection were screened for their capacity to enhance
the organoleptic profile of beer. Hanseniaspora opuntiae IST408 was deemed the most interesting and
was chosen to undergo further studies. Sequential and simultaneous inoculation of mixed culture
fermentations of H. opuntiae IST408 and S. cerevisiae US-05, a commercial strain with a neutral aroma
profile, were performed, as well as single culture fermentations that served as control. Primary
fermentations were carried out at 20 ⁰C, during 14 days. After this, beers were transferred into bottles
that contained glucose, in order to perform a secondary fermentation and carbonate the beer. Samples
were taken before the start of fermentation and after both primary and secondary fermentations to
analytically characterize the beers produced. These samples were analysed by HPLC to assess ethanol
and residual sugar concentrations and by GC-MS to characterize the volatile profile. Beers were also
organoleptically evaluated by an expert panel composed by experienced beer tasters and professional
craft brewers. Population dynamics studies of the single and mixed culture fermentations were also
performed to assess the species behaviour when alone in the fermentative medium and when both
species were together in the same medium.
A secondary objective of this thesis work was the creation of a mutant of S. cerevisiae where the main
genes involved in acetate esters biosynthesis, ATF1, ATF2 and EAT1, were deleted. CRISPR-Cas9
methodology was used to construct the desired mutant. Confirmation of the deletion of the genes was
done by performing a restriction reaction with the mutated gene sequence, since in the case of a
successful mutation, a restriction site for a specific restriction enzyme was added to the mutated gene.
In addition, we sequenced the mutated genes from yeast colonies that yielded positive results in the
restriction analysis.
3
2. Introduction
2.1. Production of different types of beer by Saccharomyces yeasts
Although there is a vast number of different beer styles worldwide, these can be divided into two big
groups: ales and lagers [19,20]. Ales beers are top-fermented beers, in which fermentation occurs in
relatively high temperatures, between 18⁰C – 25⁰C [19,20]. Traditionally, this type of beer is called top-
fermented since the yeast species responsible for its production, Saccharomyces cerevisiae, exhibits
flotation and traps CO2 bubbles to form a yeast “head” at the top of the fermentation vessel [5,19,20].
However, in the modern cylindroconical vessels, due to the high hydrostatic vessels, this does not tend
to happen, and the cells tend to deposit at the bottom of the vessel [19]. On the other hand, lager beers
are bottom-fermented beers, which are fermented at low temperatures, between 5⁰C – 15⁰C [19,20].
Contrary to ale beers, the yeasts responsible for the production of this type of beer usually clump
together, resulting in flocs that settle at the bottom of the fermentation vessel [19,20]. The yeast
responsible for lager fermentation is Saccharomyces pastorianus, which originates from the
interspecific hybridization between Saccharomyces cerevisiae and Saccharomyces eubayanus, a
closely related species that was isolated in Patagonia, Argentina, and is not typically associated with
industrial fermentations [5,21,22]. Interestingly, there is far more diversity among ale yeast strains than
among lager yeast strains. It is suggested that this difference in variety arises from the fact that ale
yeast strains can be isolated from multiple locations, whereas lager yeast strains are not readily found
in nature, being present in very limited locations [19].
Nonetheless, in a different classification approach that is based on the inoculation method, beers can
also be divided into two other groups: controlled fermentations or spontaneous fermentations.
Controlled fermentations encompass almost all beer styles where a yeast starter culture is used in order
to start fermentation, whereas spontaneous fermentations only include certain beer styles that are still
produced by traditional processes [23,24]. Common examples of this group are traditional beer styles,
such as Lambic, Gueuze and Berliner Weisse, or more recent ones, like American Sour [23,24]. The
particularity of these beers is that not only are they fermented by S. cerevisiae (meaning that they are
also ale beers), but they are also fermented by other microorganisms that are present in the production
environment, such as Brettanomyces species and acid-lactic and acetic-acid bacteria, which confers a
unique organoleptic profile to these beers [24].
2.2. Domestication of yeasts in beer production
Domestication is defined as human selection and breeding of wild species to obtain cultivated variants
with enhanced desirable features that thrive in man-made environments, but behave suboptimally in
natural environments [25]. From all the yeasts used in industrial production, S. cerevisiae is the most
4
well studied regarding its domestication [5]. This species is used in a vast number of industrial
fermentations but, interestingly, the strongest genetic and phenotypic traits of domestication are found
in S. cerevisiae strains used for beer production [5,25]. Several factors are thought to contribute to this
phenomenon, such as beer yeasts being harvested from previous fermentations and re-used in order
to start the next fermentative batch, resulting in a continuous selection imposed by the brewing
environment [5,19]. In addition, beer production occurs throughout the year, which leads to brewing
yeasts being almost completely isolated from wild yeasts. In contrast, wine making is a seasonal
production, so wine yeasts only grow in wine must in a limited time period, while spending most of the
year in the vineyards or in the guts of insects, where they can contact and share genetic material with
wild yeasts [5,25,26].
The most common trait of S. cerevisiae domestication and adaptation to brewing environments is its
ability to ferment maltotriose. This compound is one of the main sugars of beer wort, but is rarely found
in high concentrations in natural yeast environments. Efficient metabolism of maltotriose imposes a
selective advantage in brewing environments since it is an under-utilized energy source by other yeasts
[5,25]. Another well-documented domestication trait is the low production of undesirable compounds,
such as vinylguaiacol (4-VG). Various independent nonsense mutations in the genes involved in the
synthesis of these compounds have been identified in several strains used in beer production, but not
in S. cerevisiae strains used in other industrial activities [5,25,27]. Since S. cerevisiae strains
domesticated for beer production are adapted to favourable environments and are not usually exposed
to an unfavourable one, they present a lack of sexual cycle, which is a crucial trait to a rapid adaptation
to harsh environments but yields no benefits in favourable conditions [5,25].
The majority of studies involving S. pastorianus focus on the origins of this hybrid and not on its
domestication [5]. However, some studies indicate that this hybrid may have arisen from a
domestication phenomenon, since it shows a strong selective advantage over its parental species in
lager brewing conditions [5,21]. Some authors argue that the cold-tolerance displayed by this species
is conferred by the S. eubayanus genome, while the S. cerevisiae genome confers the other brewing
adaptations, mentioned above when discussing S. cerevisiae domestication [5,21].
2.3. Non-Saccharomyces yeasts in beer production
2.3.1. Pichia species
Yeasts from the genus Pichia are one of the most commonly found yeasts in grapes and wine must
[28]. The most studied species regarding their application in production of fermented beverages are
Pichia anomala, Pichia kluyveri and Pichia kudriavzevii [1,29,30]. All these three species are capable
of fermenting glucose [31], with P. anomala also being capable of fermenting sucrose [32,33]. Some
strains of P. anomala are also capable of fermenting galactose [31,33] and maltose [34].
5
Strains of this genus are able to grow in a wide temperature range (between 3⁰C and 37⁰C), under
extreme pH values (between 2.0 and 12.4) [6,35] and in high osmotic pressure, being efficient in their
mechanisms of adaptation to stress factors [6,33]. Although they show tolerance to these harsh
conditions, which can occur during fermentations, these yeasts are not particularly tolerant against
acetate and ethanol [6,36].
When using Pichia species in mixed culture fermentations with S. cerevisiae, it should be taken into
account the fact that some species, like P. anomala and P. kudriavzevii, can produce killer toxins with
antimicrobial activity, which might be effective against certain S. cerevisiae strains [37,38].
Regarding the production of sensory active compounds, P. anomala is an especially good producer of
ethyl acetate [6,35,36]. The production of this compound is a way to prevent toxic accumulation of acetic
acid inside the cells in limited oxygen conditions [35], since P. anomala synthesizes ethyl acetate from
acetate and ethanol by a reverse reaction of esterase [39,40]. Ethyl acetate directly affects both aroma
and flavour profile of beverages, giving an interesting fruity character, when in low concentrations, or
an unpleasant solvent-like aroma, when in higher concentrations [6,41].
Studies have shown the potential of P. kluyveri in the production of low-alcohol or alcohol-free beers,
due to its low fermentative power, with glucose being the only sugar present in beer wort that this yeast
is capable of fermenting [14,31,42]. It has also been shown that P. kluyveri can produce relatively high
amounts of volatile thiols such as 3-mercaptohexyl (passion fruit aroma) and 3-mercaptohexan-1-ol
(grapefruit aroma) in Sauvignon Blanc wines [14,43], and high amounts of isoamyl acetate (banana
aroma) and ethyl acetate (fruity aroma) in sequential beer fermentations with S. cerevisiae [44].
P. anomala has also been studied for the production of beer, with single culture fermentations of this
yeast producing clean, aromatic and fruity beers, with notes of pears, apple and apricot [45]. The use
of P. anomala in mixed culture fermentations with S. cerevisiae has also been studied, with beers
produced by this approach showing an increase in ethyl butanoate and ethyl acetate and a reduction in
acetaldehyde when compared to beers produced by single culture of P. anomala or S. cerevisiae, which
positively affected the aromatic profile of the beers produced [46].
P. kudriavzevii can have interesting applications in wine production, since this species can degrade
malic acid, thus contributing to the deacidification in the production of young wines [47]. Some P.
kudriavzevii strains have been reported as capable of producing extremely high amounts of ethyl
acetate but low amounts of isoamyl acetate in sequential beer fermentations with S. cerevisiae [44].
2.3.2. Torulaspora species
Torulaspora delbrueckii is considered the most important species of Torulaspora genus in the
production of fermented beverages [14]. This yeast can be isolated from grapes, fermenting wine must
or ageing wine [28]. T. delbrueckii is used in the production of red, rosé and sparkling wines [14,48,49]
6
and was one of the first commercial non-Saccharomyces species to be released as a starter [48–50].
Some authors indicate that this yeast is involved in the fermentation of traditional Bavarian wheat beers
[6,14,51].
T. delbrueckii can withstand high osmotic pressures [52,53], can grow well at low temperatures and
require oxygen to ferment, although not displaying the Custers effect (inhibition of fermentation in
anaerobic conditions and stimulation of fermentation in aerobic conditions) [52,54,55]. This yeast
species is capable of consuming sucrose, due to the fact that it presents invertase activity [6,56], with
some strains being described as capable of consuming maltose and maltotriose, which are the most
abundant sugars in beer wort [52,56]. Ethanol tolerance and fermentation efficiency are considered
strain-dependent features [6,14,51]. Studies show that certain strains can tolerate up to 5% (v/v) ethanol
in beer wort [56], while other strains are able to tolerate up to 11% (v/v) ethanol in wine must [51].
Studies that focused on the use of T. delbrueckii in beer fermentation indicated that this yeast presents
low production of phenolic off-flavours but a high acetaldehyde production [6,57], which is pleasant in
low concentrations, but in high concentrations gives an undesirable “grassy” aroma [14]. It has also
been shown that certain strains are capable of hop monoterpene alcohols into other derivatives
[14,44,58]. Beers produced by mixed culture fermentations of T. delbrueckii and S. cerevisiae presented
a fruity and citric flavour, with a very pleasant aroma, while beers produced with T. delbrueckii pure
cultures showed a similar but not as pronounced aroma profile and lower ethanol concentration
[51,56,57].
2.3.3. Brettanomyces species
In spite of being considered a spoilage yeast in wine and soft drinks [6,14,59,60], Brettanomyces
species are important yeasts in the production of certain beer styles, such as the traditional Lambic and
Gueuze beers of Belgium [3,23,59]. Yeasts from these genus display tolerance to osmotic pressure,
ethanol, limiting oxygen and pH, with the extent of these characteristics being species and strain specific
[6,59].
Brettanomyces anomala and Brettanomyces bruxellensis are the Brettanomyces species most studied
and the most utilized in beer fermentations, and are usually found in the surface of grapes and in
spontaneous fermentation beers, such as the styles mentioned above, particularly during the maturation
step [28,59,61]. Both species display the Crabtree effect (respiration repression by glucose), contrarily
to other Brettanomyces species, such as Brettanomyces naardenensis [59], and the Custers effect
[59,62,63]. These two species show different ethanol tolerance, with B. bruxellensis being resistant to
concentrations of up to 13.5 – 15% (v/v) of ethanol, whereas B. anomala is more susceptible, tolerating
concentrations of up to 8% (v/v) of ethanol [64]. The capacity of these species to tolerate relatively high
concentrations of ethanol is associated to a “make-accumulate-consume” strategy, where yeasts first
produce ethanol to prevent the growth of competing microorganisms and then respire the ethanol when
7
the fermentable sugars are depleted [65,66]. The production of acetic acid in aerobic conditions that B.
bruxellensis and B. anomala display, coupled with their ability to withstand low pH environments [67,68],
is another example of an additional “make-accumulate-consume” strategy that these yeasts present
[6,59,66]. In Lambic beers, the presence of acetic acid is considered positive, in concentrations between
0.4 – 1.2 g/L, although in other beers styles it might be considered negative [59].
B. bruxellensis and B. anomala are capable of fermenting most of the sugars present in beer wort, such
as glucose, fructose and maltose [59,69–71]. But, most importantly, B. anomala and B. bruxellensis are
able to degrade and ferment complex sugars, such as cellobiose and dextrins, which are not readily
utilized by Saccharomyces species [6,59]. Dextrins, such as maltotetraose and maltopentaose, are the
main components of the residual sugar content of beers fermented by Saccharomyces species [59].
Brettanomyces species produces an enzyme, α-glucosidase, which enables the hydrolysis of these
dextrins into fermentable glucose monomers, resulting in “superattenuated” beers with higher ethanol
levels and lower sugar concentrations (lower caloric contents) [59,72]. These yeasts also produce β-
glucosidase, an enzyme that allows the degradation of cellobiose, disaccharide found in wooden
barrels, commonly used to mature beers and wine [73,74]. This enzyme also allows the hydrolysis of
glycosides, which are water soluble, non-volatile and odourless compounds composed by one aroma
active (volatile) molecule bound to one β-D-glucose, with possible additional sugar units attached
[6,75,76]. These compounds are present in hops, one of the principal ingredients of beer, and in other
uncommon beer ingredients such as fruits, flowers and other plant parts [59,74,76,77]. The hydrolysis
of the glycosidic bond by the β-glucosidase releases the aroma active compound, which can positively
affect the aroma profile of the beverage [59,75,76].
Like other non-Saccharomyces species, B. bruxellensis and B. anomala have been described as
improving organoleptic profile of beer, by contributing to an overall fruity and floral aroma [6].
Interestingly, the ester profile produced by these Brettanomyces species is quite different than the
previously described non-Saccharomyces species, with B. bruxellensis and B. anomala producing high
amounts of ethyl acetate (fruity aroma [41,78]) ethyl hexanoate (apple, fruity, pineapple aroma [14,41])
and ethyl octanoate (apple, waxy, aniseed, musty aroma [14,41]) and low amounts of isoamyl acetate
and phenethyl acetate [6,14,23,24]. This imbalance between acetate and ethyl ester concentration is
caused by the degradation of acetate esters by the esterase enzyme present in Brettanomyces species,
which is much more efficient in hydrolysing acetate esters than non-acetate esters [59,79,80].
However, these Brettanomyces species produce some peculiar and characteristic volatile phenolic
compounds [81]. B. anomala and B. bruxellensis produce these compounds by metabolizing certain
acids present in beer wort, such as p-coumaric, ferulic and caffeic acids [14]. These acids are present
in the peel, pericarp and endosperm of cereal grains, associated to the arabinoxylans structural
carbohydrates, and are incorporated into beer wort during the mashing process [82–84]. The most
important volatile phenol compounds produced by these yeasts are 4-vynilphenol (4-VP), 4-
vynilguaiacol (4-VG), 4-ethylphenol (4-EP) and 4-ethylguaiacol (4-EG) [59]. The aroma that 4-VP and
4-EP give to the beverage is described as medicinal and horsy, with clove being used to describe the
aroma 4-VG and 4-EG impart to the beverages, and spicy also being used to describe 4-EG [85,86].
8
Although the presence of these compounds is considered an off-flavour in the majority of beer styles,
they are desirable in certain styles such as Lambic, Gueuze and Red Flanders [82].
2.3.4. Hanseniaspora species
Yeasts from the Hanseniaspora genus have not been significantly studied concerning beer
fermentation. However, some species are well-characterized, mainly Hanseniaspora uvarum and
Hanseniaspora guilliermondii, due to their important role in wine fermentation [87,88], in which they
confer a wide variety of aroma active compounds to the wine [89–91]. H. uvarum and H. guilliermondii
are the non-Saccharomyces yeasts most commonly found in grape berries and are also frequently
found at the start of wine must fermentation [48,92–94]. Although they are not commonly isolated from
spontaneously fermented beers, yeasts from this genus have been found in Lambic beers (a
spontaneous fermentation beer style) in a study that detected the presence of Hanseniaspora species
DNA in beer by utilizing Denaturing Gradient Gel Electrophoresis. However, in this study it was not
possible to isolate Hanseniaspora species from beer, indicating that they can be present in viable but
non-culturable state [3].
Hanseniaspora species show a low fermentative power, which could arise from the fact that they are
not capable of synthesizing certain vitamins like thiamine [91], whose concentration was linked to the
fermentation rate in S. cerevisiae, by determining the glycolytic flux [95,96]. However, these yeasts
produce a wide range of volatile compounds and in high quantities [28,48,97]. Acetate esters is a
chemical group that these species produce in high quantities, with ethyl acetate and phenethyl acetate
being the most prevalent, conferring fruity or flowery and rose aroma, respectively, to the final fermented
product [41,48,78]. These yeast have also been used in wine fermentations to reduce acidity or alcohol
levels [88,98,99]. In beer wort, these yeasts are not capable of fermenting maltose and maltotriose,
since they do not possess transporters for the uptake of these sugars [91].
Although being present in high numbers in the first stages of fermentation, the Hanseniaspora spp.
population diminishes as fermentation proceeds, like most other non-Saccharomyces yeasts [93,100–
102]. The increase in ethanol concentration has been hypothesised as the main cause for this decrease
in population, since usually non-Saccharomyces species found on grapes are not tolerant to ethanol
concentrations above 5-7% (v/v) [99,102,103]. However, recent studies indicate that ethanol tolerance
by Hanseniaspora spp. might be strain-specific, particularly in H. guilliermondii strains, presenting a
relatively high tolerance to ethanol [100,104,105].
Hanseniaspora uvarum is considered to be particularly suitable to be used in wine mixed fermentations
with S. cerevisiae, since the former is fructophilic and the latter is glucophilic, which leads to a faster
fermentation process [88]. Wines produced by mixed culture fermentations of H. guilliermondii and S.
cerevisiae presented higher concentrations of acetate and ethyl esters when compared to wines
produced by S. cerevisiae pure culture fermentations [106,107].
9
Hanseniaspora guilliermondii and Hanseniaspora vineae have been studied regarding their application
in beer production. In the case of H. guilliermondii, previous work performed in our laboratory
demonstrated that beers produced by mixed culture fermentation of this species and S. cerevisiae
showed an increase in ethyl acetate content when compared to beers produced by S. cerevisiae single
culture, leading to beers with a fruity aroma [108]. Regarding H. vineae, strains of this species have
been tested for the production of sour beers without use of lactic-acid bacteria. Beers produced by H.
vineae single cultures showed an organoleptic profile very similar to the ones produced by lactic-acid
bacteria, with a high concentration of lactic acid, although longer fermentation times (four weeks) were
necessary to obtain the final product [45]. H. vineae strains have also been tested for the production of
low-alcohol beers, with its fermentation product aroma profile being described as wort- and bread-like,
as well as black tea and caramel being used as descriptors [42].
Hanseniaspora opuntiae has not been intensively studied like H. guilliermondii or H. uvarum.
Nonetheless, studies have shown that wines produced by mixed culture fermentations of H. opuntiae
and S. cerevisiae presented higher levels of higher alcohols and phenylacetaldehyde, intensifying the
floral and sweet aroma of the wine [97,109], as well as an increase in anthocyanins-derived pigments
[110], which contributed to an enhanced colour stability [97,110,111].
However, not all Hanseniaspora strains can be used in mixed culture fermentations with S. cerevisiae
since some are capable of producing toxins that could lead to the death of S. cerevisiae cells, with the
reverse being also true [91,112].
2.3.5. Other yeast species
Saccharomycodes ludwigii is commonly used in the production of low-alcohol or alcohol-free beers,
since it is not capable of fermenting maltose and maltotriose [4,14]. This yeast species produced esters
that were able to mask the typical wort-like flavour that are usually described in alcohol-free or low
alcohol beers [4,14].
Beers produced by mixed culture fermentations of L. thermotolerans and S. cerevisiae showed
increased content of ethyl acetate [46], whereas pure culture fermentations of L. thermotolerans showed
high concentrations of lactic acid, similar to the amounts produced by acid-lactic bacteria in sour beer
fermentations [45].
The use of Zygotorulaspora florentina in mixed culture fermentations with S. cerevisiae for beer
production has also been studied, with the beers produced showing an increase in isoamyl acetate and
α-terpineol [46]
10
2.4. Volatile compounds produced by yeasts
2.4.1. Higher alcohols
Higher alcohols, also called fusel alcohols, are the most abundant organoleptic compounds present in
beer [78]. These compounds present an –OH group and more than two carbons and can significantly
contribute to the aroma and flavour profile of fermented beverages, contributing with floral, fruity or
herbal aromas depending on the synergistic effects displayed with other flavour-active compounds
present in the beverage [14]. Over 40 different higher alcohols have been identified in beer, with
isobutanol (solvent aroma), n-propanol (sweet aroma), isoamyl alcohol (banana aroma) and phenethyl
alcohol (roses, honey aroma) being considered the most important in beer [14,113].
Production of higher alcohols is a by-product of amino acid metabolism and catabolism of yeasts [14].
The majority of research regarding the biosynthesis of higher alcohols has been performed in S.
cerevisiae, and it is assumed that non-Saccharomyces species synthesize higher alcohols in similar
ways, although with differences in gene expression and pathway regulation [87,114].
In S. cerevisiae, the Ehrlich pathway is the principal and most studied pathway for higher alcohols
biosynthesis (Figure 1) [115]. This metabolic pathway is comprised of three steps, transamination,
decarboxylation and reduction, in which amino acids are degraded and metabolized into higher alcohols
[78,114].
The first step in the Ehrlich pathway is a transamination step, in which four transaminases are involved
[78,116]. These enzymes catalyse the transfer of amines between amino acids and their respective α-
keto acid, using glutamate and α-ketoglutarate as a donor and acceptor, respectively [115]. These
transaminases are encoded by the genes BAT1, BAT2, ARO8 and ARO9 [78,117]. Bat1 and Bat2 are
branched-chain amino acid (BCAA) aminotransferases involved in the BCAA transamination, whereas
Aro8 and Aro9 are aromatic amino acids aminotransferases I and II, respectively, involved in the
transamination of aromatic amino acids and also methionine and leucine [78,118,119]. These enzymes
are responsible for deamination amino acids, enabling the incorporation of the amino group into the
yeasts’ own structure [114].
The second step of the Ehrlich pathway, consists on an irreversible reaction where the remaining α-
keto acids are decarboxylated to form the respective fusel aldehyde [78,116]. There are four
decarboxylases involved in this step of the pathway, which are encoded by four different genes.
Specifically, PDC1, PDC5 and PDC6 code for pyruvate decarboxylases and ARO10 codes for
phenylpyruvate decarboxylase [120,121]. The activity of all four enzymes depend on the cofactor
thiamine diphosphate (TPP) [78]. Pdc5p and Aro10p were described as having a broader substrate
specificity than Pdc1p and Pdc6p [120,122]. In S. cerevisiae, there is another gene that encodes a
11
decarboxylase, THI3 [78]. However, studies suggest that the role of the enzyme encoded by this gene
is more regulatory than catalytic, being involved in the biosynthesis of thiamine [123].
Figure 1 – The three reactions that form the Ehrlich pathway and the genes that code for the enzymes that catalyse each reaction.
Taken from [78].
In the last step of the Ehrlich pathway, the fusel aldehydes are converted into their respective alcohols
by the action of alcohol dehydrogenases [78,116]. This conversion is the result of a reduction reaction
that can be performed, in S. cerevisiae, by any of the alcohol dehydrogenases encoded by ADH1,
ADH2, ADH3, ADH4 and ADH5 or the formaldehyde dehydrogenase encoded by SFA1 [116]. To note
that instead of being reduced into higher alcohols, fusel aldehydes can be oxidized into the respective
fusel acid, depending on the redox balance of the cell. In fermentative growth, with sufficient amounts
of glucose, the reduction reaction is favoured [115,116].
Although the Ehrlich pathway is the most studied, higher alcohols can also be produced during
upstream (anabolic pathway) biosynthesis of amino acids [14,124]. The most important of these
pathways are the de novo synthesis of BCAA through the isoleucine-leucine-valine pathway or through
carbohydrate metabolism [14,114,115].
2.4.2. Volatile esters
Volatile esters are only trace elements when compared with other metabolites produced by yeasts.
However, they are one of the most important aroma active compounds since they have low sensorial
threshold, influencing the organoleptic profile of beers even at low concentrations [20,41,125,126].
Nevertheless, their presence can be felt even at concentrations below their sensorial threshold, due to
12
the presence of different esters having synergistic effects on the individual flavours [41]. These
compounds can impart beer with a wide variety of fruity aroma but, if overproduced, they can negatively
affect the beverage with an undesirable bitter, over fruity taste [14].
The majority of esters are formed during the active phase of the primary fermentation by the enzymatic
condensation of organic acids with alcohols. Volatile esters present in beer can be divided into two
major groups, acetate esters and medium-chain fatty acids (MCFA) ethyl esters [78,114]. Acetate esters
are synthesized from acetic acid (acetate) with ethanol or a higher alcohol, whereas ethyl esters are
formed from a medium chain (6 to 12 carbon atoms) fatty acids and an ethanol radical [14,78,114].
Although a large number of different esters can be identified in beer, some are considered of major
importance in regards to beer aroma, particularly ethyl acetate (fruity, solvent-like aroma), isoamyl
acetate (banana aroma), isobutyl acetate (sweet aroma), phenethyl acetate (roses, honey aroma), ethyl
hexanoate (apple, fruity, pineapple aroma) and ethyl octanoate (apple, aniseed aroma) [41,78]. Acetate
esters are present in higher concentration in beer than ethyl esters, which can be correlated with their
capability of diffusing through the plasma membrane [78]. Esters are synthesized in the cytoplasm and
can readily leave the cell since these compounds are lipophilic. However, while small-chain acetate
esters can easily diffuse through the membrane, MCFA ethyl ester diffusion rates decrease as the
length of the aliphatic tail increases [78,127,128].
In order to be synthesized into esters, organic acids must be linked to a coenzyme A to form an acyl-
CoA molecule. This thioester linkage will provide the necessary energy to catalyse the enzymatic
reaction to synthesize the acetate or MCFA ethyl esters, which differs for both cases (Figure 2)
[78,114].
Acetate esters are synthesised by the enzymes alcohol acetyl transferases (AATase) I and II, which
are encoded by the genes ATF1 and ATF2, respectively [129,130]. Interestingly, it was found that
bottom fermenting lager yeasts possess an extra ATF1 homologous gene (Lg-ATF1), which encodes
an AATase very similar to AATase I [129]. The expression of this additional gene enhances acetate
ester production and can explain why lager beers normally present higher concentrations of acetate
esters than ale beers [78]. However, recent studies have also shown that other enzymes might be
involved in the synthesis of acetate esters, which is the case of the AATase family encoded by EAT1
and its homologues [17,131,132].
On the other hand, MCFA ethyl esters are synthesized by two acyl-CoA:ethanol O-acyltransferases
(AEATases), Eeb1 and Eht1, which are encoded by the genes EEB1 and EHT1, respectively [133,134].
Evidences obtained from deletion mutants show that Eeb1 is the main enzyme in the condensation
reaction to produce the ethyl ester, whereas Eht1 plays a minor role [133,134]. Also, double deletion of
these genes did not completely abolished the production of MCFA ethyl esters, which indicates that
other enzymes might be involved in ethyl ester synthesis [78,133,134]. Both Eeb1 and Eht1 also display
esterase activity, which explains why the overexpression of their encoding genes did not lead to an
increase in MCFA ester production [78,133].
13
Figure 2 – Biosynthesis of acetate esters (A) and of medium-chain fatty acid ethyl esters (B). The genes that code for the enzyme
responsible for the catalysis of each reaction are displayed above the reaction arrows. Taken from [78].
The final concentration of volatile esters is not only affected by their production rate, but also by the
activity of esterases [134–136]. As mentioned above, MCFA ethyl esters can be hydrolysed by the same
enzymes involved in their production [133,134]. In the case of acetate esters, a carboxylesterase
encoded by the gene IAH1 is involved in the hydrolysis of isoamyl acetate, ethyl acetate, phenethyl
acetate and hexyl acetate [135,136]. Also, volatile ester production is both species- and strain-
dependent, with a high number of non-Saccharomyces species presenting higher production of these
compounds than S. cerevisiae [6,41].
2.4.3. Carbonyl compounds
A large number of carbonyl compounds, over 200, have been reported as contributors to the aroma and
flavour of fermented beverages [114,137], although concentrations of these compounds is usually low
in beer [12,138]. As the name implies, these compounds present a carbonyl group (an oxygen atom
double bonded to a carbon atom), and two groups in particular, aldehydes and vicinal diketones, are of
interest in regards to the organoleptic profile of beer due to being considered undesirable in beer when
in excessive concentration, since they cause a stale flavour [12,137,139].
14
Acetaldehyde is the aldehyde present in higher concentration in beer. It is produced by yeast during the
growth phase, as a result of the decarboxylation of pyruvate [114]. It is an intermediate in the formation
of ethanol and acetate and when in concentrations above its sensorial threshold level (10 – 20 mg/L) it
gives an undesirable grassy or green apple-like aroma to the beer [12,14,114]. Similarly to higher
alcohols and esters, the extent of acetaldehyde accumulation depends on the yeast strain utilised and
the fermentative conditions [114].
Several vicinal diketones (VDKs) are present in beer but the most important when considering the
organoleptic profile of beer are 2,3-butanedione (diacetyl) and 2,3-pentanedione [140]. Diacetyl
presents a very low sensorial threshold (0.1 – 0.15 mg/L) and gives a very potent butter or butterscotch
aroma, with 2,3-pentanedione presenting a similar flavour to diacetyl, although often described as more
toffee-like, but with a higher sensorial threshold (0.9 mg/L) [14,20,139]. VDKs are more easily detected
in lighter beers, where their contribution to aroma and flavour is not masked by malt and hop flavour
and aroma [139]. Diacetyl and 2,3-pentanedione are formed as by-products of valine and isoleucine
synthesis, respectively [14,114,139]. They arise from spontaneous non-enzymatic oxidative
decarboxylation of α-acetohydroxy acids that are intermediates in the aforementioned pathways
[114,139]. Valine and isoleucine synthesis occurs in the mitochondria, whereas the described
spontaneous reactions occur in the wort, so the intermediates, α-acetolactate in the case of valine
pathway and α-acetohydroxybutyrate in the case of isoleucine pathway, need to be secreted out
through the cell membrane [12,139]. The reasons and mechanisms involved in this secretions are not
fully understood, but it is hypothesized that it might occur to protect the yeast from carbonyl stress [139].
At the end of fermentation and during maturation phase, diacetyl is taken up by yeast and reduced to
2,3-butanediol, a compound that does not affect beer flavour and aroma due to its relatively high
sensorial threshold [12,139]. Nevertheless, the presence of diacetyl in detectable concentrations is
acceptable in some beer styles, such as Bohemian Pilsner and some English ales [114,139].
2.4.4. Organic acids
Yeast cells can produce a wide variety of organic acids during fermentation, which can contribute to the
organoleptic profile of beer with sour or acidic notes [141]. Besides contributing to flavour and aroma,
organic acids can also influence the chemical stability and pH of beer [14]. Organic acids can be divided
into two groups, volatile and non-volatile organic acids [14]. The production of organic acids depends
on the yeast strain, with most of these compounds being by-products of glycolysis, the citric acid cycle
and amino acid and fatty acids metabolism [14,141–143].
The main volatile organic acids that can occur in beer are acetic, propionic, isobutyric, butyric, isovaleric,
hexanoic, octanoic, decanoic and dodecanoic acids. When present in high concentrations, these acids
can contribute with a sour and salty flavour, but can also contribute to off-flavours, which are usually
described as cheesy and sweaty [14,143]. Of the eight volatile organic acids previously mentioned, the
15
ones that impact flavour the most are acetic, octanoic, decanoic and dodecanoic acids. Acetic acid can
give a vinegary aroma and flavour but it presents a relatively high sensorial threshold (175 mg/L).
Octanoic acid presents a lower sensorial threshold (15 mg/L) and its aroma is described as goaty.
Decanoic acid is described as having a waxy aroma and presents a threshold of 10 mg/L. Finally,
dodecanoic acid presents the lowest sensorial threshold of the four (6.1 mg/L) and its aroma is
described as soapy [14].
To influence the aroma profile of beer, non-volatile organic acids need to be present in the beverage in
quite high concentrations, since they present a high sensorial threshold [14]. The main non-volatile
acids produced by yeast that can affect beer aroma and flavour are by-products of the citric acid cycle,
such as succinic, citric, fumaric and pyruvic acids [14,141,142]. Succinic acid presents the lowest
threshold of the highlighted compounds (220 mg/L) and an acidic aroma [14,142]. Pyruvic acid presents
a salty and straw-like, with a sensorial threshold of 300 mg/L [14,142]. Both citric and fumaric acids
present a sensorial threshold of 400 mg/L and sour aroma, with fumaric acid aroma also being
described as acidic [14,141,142]. Other commonly found non-volatile organic acid, mainly in Lambic
beers, is lactic acid, which also presents a sour and acidic aroma, with a sensorial threshold of 400
mg/L [14].
2.4.5. Volatile sulphuric compounds
The principal volatile sulphuric compounds that are produced by yeast and can influence the
organoleptic profile of beer are sulphur dioxide and hydrogen sulphide [14,114]. Both compounds arise
as by-products from the biosynthesis of the sulphur-containing amino acids cysteine and methionine
from sulphate. Biosynthesis of these amino acids only occurs when the wort is depleted of cysteine and
methionine [114]. Production of sulphur dioxide and hydrogen sulphide is both species- and strain-
dependent, and is determined as well from the wort composition [14,114]. Sulphur dioxide is important
in flavour stability, acting as an antioxidant in the finished beer, considerably increasing its shelf life
[14]. This compound presents a sulphurous sensorial threshold of 2.5 mg/L, which is considered a
positive trait in some bottom-fermented beers [14]. On the other hand, hydrogen sulphide is considered
an undesirable compound due to having a rotten egg aroma, coupled with a very low sensorial threshold
(0.005 mg/L), which gives this compound a high potential to mask other positive aromas and flavour
that might be present in beer [14,114].
2.4.6. Volatile phenols
Volatile phenols have been reported to contribute to the aroma of both alcoholic and non-alcoholic
beverages [84]. Although the majority of these compounds are considered off-flavours, their presence
is desirable in some beer styles, such as Lambic and Gueuze beers [82,84]. Among the flavour-active
16
volatile phenol, 4-vinylguaiacol (4-VG), 4-vinylphenol (4-VP), 4-ethylguaiacol (4-EG), 4-ethylphenol (4-
EP), 4-vinylsyringol (4-VS), 4-vinylcatechol (4-VC), styrene, eugenol and vanillin have been identified
in beer [14,84,86]. Between these volatile phenols, 4-VP and 4-VG are the most common in
fermentations carried out by S. cerevisiae and are undesirable in high concentrations in the majority of
beer styles due to their strong medicinal and clove-like aroma [59,84,85].
Volatile phenols’ biosynthesis is both species- and strain-dependent, as well as being dependent on
the concentration of precursors in the beer wort, the hydroxycinnamic acids (also known as
phenylacrylic acids) [14,44]. Some of these acids are more abundant in beer wort, such as the p-
coumaric and ferulic acids, which are present in cereal grains and are incorporated into beer wort during
the mashing process [82–84]. Some yeast are capable of performing a non-oxidative decarboxylation
of these hydroxycinnamic acids into volatile phenols (Figure 3) [85]. In the case of S. cerevisiae, this
reaction is catalysed by the enzymes phenylacrylic acid decarboxylase and ferulic acid decarboxylase,
which are encoded by the gene PAD1 and FDC1, respectively [86,144]. These enzymes are responsible
for the decarboxylation of p-coumaric and ferulic acids into 4-VP and 4-VG, respectively [86].
Brettanomyces yeasts also possess the enzyme phenylacrylic acid decarboxylase, encoded by the
gene DbPAD [59,145]. However, contrary to S. cerevisiae, Brettanomyces species are capable of
reducing vinylphenols into ethylphenols, in a reaction catalysed by the enzyme vinylphenol reductase
(Figure 3) [59]. Ethylphenol presents aromas similar to their precursors but their sensorial threshold is
lower. The reduction of 4-VP leads to 4-EP that presents a horsey and medicinal aroma, whereas the
reduction of 4-VG leads to 4-EG, which presents a spicy and clove-like aroma [59,85].
Figure 3 – (A) Decarboxylation of phenylacrylic acids into vinyl phenols. S. cerevisiae and Brettanomyces species can perform
this reaction since they possess enzymes with phenylacrylic acids reductase activity (B) Reduction of vinylphenols into
ethylphenols. This reaction can be performed by Brettanomyces species but not S. cerevisiae, since the former express the
enzyme vinylphenol reductase. Taken from [86].
17
2.4.7. Monoterpene alcohols
Aroma active terpenoids contribute with a highly floral, citrus and fruity aroma to beer, although being
present in much lower concentrations than other volatile compounds, due to their very low sensorial
threshold [16,58,146]. These compounds are found in beer due to being present in high concentrations
in hops, with each hop variety presenting a different terpenoid profile [58,146]. Even though other
terpenoids, such as sesquiterpenoids, can be found in hops, monoterpenes present the highest
concentration, in upwards of 75% of hops’ total terpenoid content [16]. Monoterpene alcohols can be
metabolized by some yeasts, through esterification, hydrolysis, isomerization and other types of
reaction, leading to a higher monoterpene diversity after fermentation (Figure 4) [14,16]. Also, these
compounds can also be found in beer wort in glycosidically bound forms, which are aroma inactive, and
yeasts that possess the enzyme glucoside hydrolase can cleave this chemical bound, releasing the
aroma active monoterpene [58]. The monoterpene alcohols most commonly found in beer are linalool
(lavender aroma, sensorial threshold of 5 µg/L), α-terpineol (lilac aroma, sensorial threshold of 2 mg/L),
β-citronellol (lemon and lime aroma, sensorial threshold of 8 µg/L), geraniol (rose aroma, sensorial
threshold of 6 µg/L) and nerol (rose, citrus aroma, sensorial threshold of 0.5 mg/L) [14,146]. To note
that the contribution of these monoterpene alcohols to the final beer aroma does not only depends on
their final concentration, but also on the ratio between each of the aforementioned compounds [16].
Figure 4 – Overview of the biotransformation reactions of monoterpene alcohols and respective esters catalysed by yeasts. The
enzymes responsible for the catalysis of each reaction are indicated near the reaction arrows. Enzymes in green have been
experimentally verified in S. cerevisiae. Putative enzymatic activities that have been implied from metabolite profiling in
fermentations with S. cerevisiae or bacteria are indicated in blue and orange, respectively. Taken from [16].
18
3. Materials and Methods
3.1. Yeast isolation and identification
3.1.1. Samples collected
A sample from a contaminated beer batch (labelled as CCIST), from the IST Brewer’s Club, was
collected from the top of the liquid, where biofilm was formed. Three wine samples were also collected:
a white wine sample from Sardoal (labelled as SarB), a town in the centre of Portugal and two red wine
must samples from Tomar, a town also located in the centre of Portugal. The latter were taken from the
same wine must, but were collected at different times during production. One was taken in the first day
of fermentation (labelled as Mst) and the other was collected after the wine must was stored in the
barrel (labelled as Bar).
3.1.2. Yeast isolation
The isolation of yeast strains was performed by spreading into YPD agar (Yeast extract (Difco) 1%,
Peptone (Difco) 2%, Glucose (Scharlau) 2%, Agar (NZYTech) 2%) plates, supplemented with 100
µg/mL of chloramphenicol (Sigma-Aldrich), serial dilutions (100 to 10-6) of each sample (CCIST, SarB,
Mst and Bar). All plates were incubated at 30⁰C for 24 hours before counting Colony Forming Units
(CFUs) and plating each morphologically different colony in new plates of the same medium to obtain
pure cultures. Serial dilutions of Mst and Bar were also spread on WLN agar (Yeast extract 4 g/L,
Tryptone (Difco) 5 g/L, Glucose 50 g/L, Potassium dihydrogen phosphate (Panreac) 0.55 g/L,
Potassium chloride (BIOCHEM Chemopharma) 0.425 g/L, Calcium chloride (Alpha Aesar) 0.125 g/L,
Magnesium sulphate (Riedel-de Haën) 0.125 g/L, Ferric chloride (Fisher Chemical) 0.0025 g/L,
Manganese sulphate (Sigma-Aldrich) 0.0025 g/L, Bromocresol green (Sigma-Aldrich) 0.022 g/L, Agar
15 g/L), and incubated at 30⁰C for 48 hours before counting CFUs and plating each morphologically
different colony in new YPD agar supplemented with 100 µg/mL of chloramphenicol to obtain pure
cultures. All pure culture plates were incubated at 30⁰C for 24 hours before performing DNA extraction
or being stored at 4⁰C.
3.1.3. DNA extraction
DNA extraction was performed using phenol-chloroform extraction protocol. Approximately one full loop
of yeast biomass was resuspended in a microcentrifuge tube containing glass beads (0.5 mm diameter)
and 200 µL of ddH2O, to which 300 µL of phenol:chloroform:isoamyl alcohol (25:24:1) (pH 6.7/8.0,
Amressco) was added. The tubes were vortexed for 5 minutes before centrifuging for 5 minutes (4⁰C,
14000 rpm). The supernatant was transferred to a new Eppendorf tube, to which 300 µL of
phenol:chloroform:isoamyl alcohol was added. The tubes were vortexed for 10 seconds before
centrifuging for 5 minutes (4⁰C, 14000 rpm). The supernatant was transferred to a new Eppendorf tube
19
to which 300 µL of ether (Sigma-Aldrich) was added. The tubes were vortexed for 20 seconds before
centrifuging for 5 minutes (4⁰C, 14000 rpm). The lower phase was transferred to a new Eppendorf tube,
to which 1 mL of absolute ethanol (CARLO ERBA Reagents) was added. The tubes were stored at -
20⁰C for 30 minutes before centrifuging for 15 minutes (4⁰C, 14000 rpm). The supernatant was
discarded and 500 µL of 70% ethanol was added before centrifuging for 5 minutes (4⁰C, 14000 rpm).
The supernatant was discarded and the pellet was vacuum dried in the SpeedVac, at 45⁰C, for 15
minutes. After this step, the pellet was resuspended in 100 µL of ddH2O and DNA concentration was
measured using the NanoDrop spectrophotometer before being stored at -20⁰C.
3.1.4. Polymerase Chain Reaction (PCR) and gel electrophoresis
Polymerase Chain Reaction (PCR) was used to amplify the D1/D2 region of the 26S ribosomal DNA
(rDNA) using the primers NL-1 (forward primer; 5’-GCATATCAATAAGCGGAGGAAAAG-3’) and NL-4
(reverse primer; 5’-GGTCCGTGTTTCAAGACGG-3’) or to amplify the ITS region of the rDNA using the
primers ITS-1 (forward primer; 5’-TCCGTAGGTGAACCTGCGG-3’) and ITS-4 (reverse primer; 5’-
TCCTCCGCTTATTGATATGC-3’). These primers were previously validated to use in yeast
identification [147][148]. The master mix prepared consisted of 1X Phusion HF Buffer, 2.5 mM MgCl2,
2 mM dNTPs (200 µM each), 0.5 µM of each primer, 3% DMSO and 0.02 U/µM of Phusion DNA
Polymerase (Thermo Fisher). The volume of reaction was 50 µL (49 µL of master mix and 1 µL of DNA)
and three reactions were prepared for each extracted DNA sample. The PCR protocol consisted in
denaturation at 98⁰C for 30 seconds, followed by 35 cycles of denaturation at 98⁰C for 10 seconds,
annealing at 52⁰C for 20 seconds and extension at 72⁰C for 30 seconds, finalizing with an extension at
72⁰C for 10 minutes. PCR products were separated by electrophoresis on a 0.8% agarose (NZYTech)
gel, with green safe (NZYTech) incorporated to stain DNA. After the run, the gel was placed in a
transilluminator to cut the sections that contained the DNA bands. To purify the DNA in the cut portions,
NZYGelpure® (NZYTech) kit was used, following the manufacturer’s instruction. The purified DNA was
quantified in the NanoDrop spectrophotometer and stored at -20⁰C.
3.1.5. DNA sequencing and yeast species identification
The amplified and purified rDNA samples were sent to STAB VIDA for sequencing by Sanger
sequencing. Using the Standard Nucleotide BLAST tool of NCBI, the DNA sequences obtained were
compared to those present in the NCBI database, in order to taxonomically identify the isolated yeast
species.
3.1.6. Addition to the IST yeast collection
DNA sequences of isolates from the same samples that were identified as belonging to the same
species were compared using EMBOSS Water pairwise sequence alignment and EMBOSS MUSCLE
alignment tools. If a comparison yielded that two or more isolates were the same strain, only one was
20
added to the IST yeast collection. Samples of isolates that were chosen to be added to the collection
were prepared by resuspending a full loop of biomass in liquid YPD with 15% glycerol (v/v) and
maintained at -80⁰C.
3.2. Fermentative Trials
3.2.1. Preparation of the beer wort
Beer wort was prepared by dissolving 100 g/L of malt extract (Light Dry Malt Extract, Muntons) in water
(commercial bottled water was used), and the pH was adjusted to 5.2 ± 0.1, when required. The medium
was boiled for 1 hour, followed by an addition of 1 g/L of Saaz hops and another hour of boiling. The
beer wort was left to cool overnight and, in the next day, was centrifuged at 10000 rpm for 10 minutes,
at room temperature, to precipitate solids present in the medium. The liquid was transferred to sterile
SCHOTT bottles and stored at room temperature for later use.
3.2.2. Strain selection for fermentation
Based on results from previous studies, it was decided that the yeast strains to be used in fermentative
trials would be from the Hanseniaspora genus. Two Hanseniaspora isolates that were identified in this
study were chosen, as well as two more Hanseniaspora isolates that are part of the IST yeast collection.
The commercial yeast strain S. cerevisiae SafAle™ US-05, was selected for the mixed fermentation
tests, because it is described as being a strain that produces a very clean beer, meaning that it should
give a neutral aroma to the beer, thus allowing the aromatic contribution of the non-Saccharomyces
strain to stand out in the beer.
3.2.3. Inoculum preparation and fermentative conditions for the first screening
The inoculum of each strain was prepared by growing the yeast cultures in liquid YM medium (malt
extract, 15 g/L, Difco). The cultures were incubated at 30⁰C, with an agitation of 250 rpm, for 48 hours.
After incubation, the Optical Density (OD) at 600 nm was measured for each culture, using the
spectrophotometer (U-2001, Hitachi). To determine the relation between OD and CFU/mL for each
culture, calibration curves obtained from previous OD vs. CFU studies were used. This allowed to
determine the necessary volume of each culture to inoculate in order to start the fermentation with a
concentration of 5x106 CFU/mL. The necessary volume of inoculum was vacuum filtered, using a
Whatman paper filter (0.2 µm pore size), and the filter was inserted into a 100 mL flask containing 70
mL of beer wort. The flasks were capped with a rubber cork perforated with a syringe needle and sealed
with parafilm. The cultures were incubated at 23⁰C, with no agitation, for 14 days. After incubation, 1
mL samples of each fermentation were collected for HPLC analysis.
21
3.2.4. Organoleptic evaluation of the fermentation products from the first screening
Members of the Biological Sciences Research Group performed the organoleptic evaluation of each
fermentation, immediately after uncapping the flasks. The evaluation focused on classifying the aroma
and flavour of each fermentation as interesting or not interesting, in order to select specific strains for
further studies.
3.2.5. Inoculum preparation and fermentative conditions for the single and mixed
culture fermentations
The inoculum of each strain was prepared by growing the yeast cultures in liquid YM medium (malt
extract, 15 g/L). The cultures were incubated at 30⁰C, with an agitation of 250 rpm, for 24 hours. After
incubation, the OD at 600 nm was measured for each culture and an appropriate volume of each culture
was transferred into new flasks containing fresh liquid YM medium, in order to obtain cultures with a
starting OD (600nm) of 0.1. These cultures were incubated at 30⁰C, with an agitation of 250 rpm, for 24
hours. After incubation, the OD at 600 nm was measured. Using calibration curves obtained in previous
CFU studies, the appropriate volume of inoculum necessary to start the fermentations with a
concentration of 5x106 CFU/mL was calculated. The necessary volume of each culture was centrifuged,
the supernatant discarded and the pellet was resuspended in beer wort and added to 1L Erlenmeyer
flasks containing 1L of beer wort. The flasks were capped with a rubber cork (with a hole filled with
cotton which allowed the release of CO2) and sealed with parafilm. The cultures were incubated at 20⁰C,
with no agitation, for 14 days. After this primary fermentation, the cultures were bottled (one 330 mL
bottle per fermentation) with the addition of a glucose solution (7 g/L of glucose added to the bottle) to
perform a secondary fermentation and carbonate the beer. The bottles were incubated at 20⁰C, with no
agitation, for 30 days. Samples were collected after primary fermentation (14 days in flasks) and
secondary fermentation (30 days in bottle) for HPLC (1 mL samples) and GC-MS (10 mL samples)
analysis.
3.2.6. Fermentation monitoring
Fermentations were monitored by weighting the flasks, without uncapping them. Measurements were
taken in regular intervals, two to three times a day (within the lab working hours) except during the first
two days (four to five measurements taken per day) and weekends (measurements were taken
whenever possible). The fermentations were interrupted after 14 days and the pH of the medium was
measured.
3.2.7. Monitoring of sugar and ethanol concentrations
A 1 mL sample of each fermentation product was collected for HPLC analysis at the end of primary and
secondary fermentations. Samples were centrifuged (10000 rpm, 3 minutes) before 100 µL of the
supernatant were transferred into an HPLC vial and diluting it 1:10 with 0.005 M H2SO4 (Sigma-Aldrich).
22
To determine the concentration of sugars (maltose, maltotriose, glucose and fructose) and ethanol, a
HPX87H column (Biorad) was used, with elution at 65⁰C with 0.005 M H2SO4 at a flow rate of 0.6 mL/min
(for the strain selection test samples) or 0.5 mL/min (for the mixed fermentation trials). Concentrations
were estimated based on appropriate calibration curves.
3.2.8. Volatile compound analysis by GC-MS
In order to analyse the volatile compounds present in each fermentation, 1 mL of the collected samples
was transferred to a 10 mL headspace vial (La-Pha-Pack®) that was capped with a
polytetrafluoroethylene (PTFE) silicone septum (Specanalitica). Volatile compounds were extracted
from the samples using headspace solid-phase microextraction (HS-SPME), with an extraction
temperature of 40⁰C for 15 minutes, stirring speed of 250 rpm, agitation during 10 seconds and a
desorption time of 3 minutes at 250⁰C. A divinylbenzene/Carboxen®/polydimethylsiloxane
(DVB/Car®/PDMS) fibre was used to extract the volatile compounds. Analysis was performed in a
GCMS-QP2010 (Shimadzu®), utilizing a capillary column Sapiens – Wax MS (Teknokroma), with a
length of 60 m, 0.25 mm (IS) and a film thickness of 0.25 µm. Injector and detector temperatures were
set at 250⁰C and injection was performed in a 1:5 split using high purity helium as the carrier gas, with
a flow of 4 mL/min. Column oven temperature was kept at 40⁰C for 5 minutes, after which was increased
to 170⁰C at a rate of 5⁰C per minute and then to 230⁰C at a rate of 30⁰C per minute, which was kept for
4 minutes. Both the MS interface and the ion source were kept at 250⁰C. Mass spectra were acquired
in Electron Ionization mode at 70 eV in a m/z range between 29 and 300 and a scan speed of 588
scans per second. 1-Butanol was added to all samples in a concentration of 5.05 µg/mL and used as
internal standard, in order to extrapolate the relative abundance of each of the identified compounds.
Volatile compounds were identified using the mass spectra libraries NIST 21, 27, 107, 147 and Wiley
229. Analysis of the chromatograms generated by GC-MS was done by the PhD student Nuno Melo.
3.3. Population Dynamics studies
3.3.1. Preparation of beer wort
Beer wort was prepared as described in section 3.2.1.
3.3.2. Inoculum preparation and fermentative conditions for population dynamics
studies
For population dynamics studies, the inocula of H. opuntiae IST408 and S. cerevisiae US-05 were
prepared as described in section 3.2.5, but fermentations were performed with different conditions.
Fermentations occurred in 25 mL glass vials containing 20 mL of beer wort, that were capped with a
plastic cork perforated with a syringe needle. The cultures were incubated at 20⁰C, with no agitation,
23
for 14 days. To monitor how yeast populations evolve during single and mixed fermentations, seven
vials were prepared for each fermentation and discarded after samples from a time point were taken.
3.3.3. Fermentation monitoring
Fermentations were monitored by weighting the vials, without uncapping them. Weight measurements
of the vials were taken before sample acquisition (all vials were measured).
3.3.4. Time point sample acquisition
At each time point, three different samples were acquired from each fermentation. From the top of the
liquid, a 1 mL sample was taken and stored at -20⁰C to be latter analysed by HPLC. A second 1 mL
sample was taken from approximately the central position (core) of the flask, to determine the number
of cells suspended in the liquid. After acquisition of this sample, the liquid was thoroughly mixed in order
to resuspend any biomass that may have been accumulated at the bottom of the vial. After mixing, a
third sample was collected, to determine the number of total cells. These two latter samples were
serially diluted and platted into WLN agar plates and YNB + galactose agar (yeast nitrogen base (Difco)
6.7 g/L, galactose (Sigma-Aldrich) 20 g/L, agar 20 g/L) plates (in the case of samples from mixed
fermentations). WLN agar plates were incubated at 30⁰C for 48 hours and YNB + galactose agar plates
were incubated at 30⁰C for 96 hours. After incubation, CFUs were counted.
Figure 5 – Samples taken in each time point in the population dynamics studies
3.3.5. Monitoring of sugar and ethanol concentrations
HPLC analysis was performed as described in section 3.2.7, but with a different flow rate, of 0.5 mL/min.
1. Sample for HPLC analysis
3. Sample to determine total CFUs
(after resuspending the biomass)
2. Sample for determine
CFUs in suspension
24
3.4. ATF1, ATF2 and EAT1 disruptions by CRISPR-Cas9 methodology
3.4.1. Oligonucleotides used
For the disruption of each gene, three pairs of oligos were designed: the gRNA oligos, the donor DNA
oligos and the primers to confirm the disruption of the genes. The oligos used in the disruption of ATF1,
ATF2 and EAT1 are listed below in Table 1. All donors were designed to contain 45 bp upstream and
45 bp downstream the sequence used for the design of gRNA oligos. The donor DNA for ATF1 partial
deletion introduces a phase-shift mutation (in red and bold) and eliminates an EcoRI restriction site that
is located in the gRNA oligo. The donor DNA for ATF2 partial deletion creates a restriction site for
BamHI by replacing a G for a C (in green and underlined) and introduced a STOP codon by replacing
a G for an A (in red and bold). The donor DNA for EAT1 partial deletion introduces a STOP codon by
replacing a G for a T (in red and bold) and introduces a SacI restriction site by replacing a G for a C (in
green and underlined). Restriction reactions with the corresponding enzymes were used to select
positive candidate mutants.
Table 1 – Sequences of the oligos used in the disruption of ATF1, ATF2 and EAT1.
Oligo Sequence Oligo Sequence Oligo Sequence
ATF1 gRNA forward
5’-GCAGTGAAAGATAAATGATGAAGAATTCAAAAATAGTAAGTTTTAGAG
CTAGAAATAG-3’
ATF2 gRNA forward
5’-GCAGTGAAAGATAAATGATGTTTATGTCACTAACCACTGGTTTTAGAGCTAGAAATAG-
3’
EAT1 gRNA forward
5’-GCAGTGAAAGATAAATGATGTGGCACTCTACTTTGCCAAGTTTTAGAGCTAGAAATA
G-3’
ATF1 gRNA reverse
5’-CTATTTCTAGCTCTAAAACTTACTATTTTTGAATTCTTCATCATTTATCT
TTCACTGC-3’
ATF2 gRNA reverse
5’-CTATTTCTAGCTCTAAAACCAGTGGTTAGTGACATAAACATCATTTATCTTTCACTGC-
3’
EAT1 gRNA reverse
5’-CTATTTCTAGCTCTAAAACTTGGCAAAGTAGAGTGCCACATCATTTATCTTTCACTGC-
3’
Donor ATF1 forward
5’-CTCAATGAAAACAACCTGAGTACAGTGCAGTAATGAAGCAAATATTATCCTATACTGCAAAAATTTTTAAACTTACTACCACTTTGACTATTCC-3’
Donor ATF2 forward
5’-TTACCAGGTAAGGATACTGATGGGTTTGAAACGTGAAAAAACTTCTCCGACGGTGTCAGTGGATCCAATTTTTTCAAAGATTTAGC
TCTA-3’
Donor EAT1 forward
5’-TTTTCAAAAGTTTGTAATGTAATAAGAGGAAATGTGGTGGAGCTCTTTTCTTTCTGTAAAATCCAATAATGTACACCAAGCACAGTTA
CAC-3’
Donor ATF1 reverse
5’-GGAATAGTCAAAGTGGTAGTAAGTTTAAAAATTTTTGCAGTATAGGATAATATTTGCTTCATTACTGCACTGTACTCAGGTTGTTTTCATTGAG-
3’
Donor ATF2 reverse
5’-TAGAGCTAAATCTTTGAAAAAATTGGATCCACTGACACCGTCGGAGAAGTTTTTTCACGTTTCAAACCCATCAGTATCCTTACCTGGT
AA-3’
Donor EAT1 reverse
5’-GTGTAACTGTGCTT
GGTGTACATTATTGGATTTTACAGAAAGAAAAGAGCTCCACCACATTTCCTCTTATTACATTACAAACTTTTGA
AAA-3’
ATF1 confirmation
forward
5’-ATGGATCTCTGGAAG
CGTC-3’
ATF2 confirmation
forward
5’-ACGTTTCTTCGAGG
TCTGTGAA-3’
EAT1 confirmation
forward
5’-ACTGAATACCACAG
CGCGTC-3’
ATF1 confirmation
reverse
5’-AAAGCCGAGGGAGTG
ACAAC-3’
ATF2 confirmation
reverse
5’-CTATACGAAGGCCC
GCTACG-3’
EAT1 confirmation
reverse
5’-GATTTGGGCCTGAC
ACGAGA-3’
25
3.4.2. Plasmids used for the partial deletion of ATF1, ATF2 and EAT1 genes
The plasmids used in the partial deletion of ATF1, ATF2 and EAT1 by CRISPR-Cas9 methodology were
provided by Professor Johan Thevelein from KU Leuven, Belgium. The plasmids used were p51 and
p59. The single copy plasmid p51 contains the gene coding for Cas9 [149] under the control of TEF
promoter and the antibiotic selection marker KanMX, which confers resistance to the antibiotics
kanamycin and geneticin. Plasmid p59 was selected to express the target-specific gRNA and has the
antibiotic selection marker NAT, which confers resistance to the nourseothricin. Plasmids created in
this study are presented in Table 2.
Table 2 – Plasmids created in this study.
Construct Characteristic
p59-ATF1 p59 expressing the ATF1 targeting gRNA
p59-ATF2 p59 expressing the ATF2 targeting gRNA
p59-EAT1 p59 expressing the EAT1 targeting gRNA
3.4.3. Saccharomyces cerevisiae CEN.PK113-7D transformation with p51-Cas9 vector
Saccharomyces cerevisiae CEN.PK113-7D cells were grown in YPD agar medium overnight, at 30⁰C.
Two full loops of biomass were resuspended in 1 mL of sterile ddH2O. Centrifugation was performed to
pellet the cells. The supernatant was discarded and the cells were resuspended in the remaining liquid
and ddH2O was added to desired volume (20 µL per transformation). In a new microcentrifuge tube, 20
µL of cell suspension were mixed with 1 µL of p51-Cas9 (concentration of 1700 ng/µL; 1 µL of ddH2O
for control reaction) and 100 µL of ONE-STEP buffer (0.2 M LiAc (Sigma-Aldrich); 40% PEG1000
(Merck); 100 mM DTT (Sigma-Aldrich)). This mix was vortexed for 5 seconds and incubated for 30
minutes at 42⁰C. After incubation, tubes were centrifuged to pellet the cells and the supernatant was
discarded. YPD liquid medium (1 mL) was added to the tubes and the cells were left to recover for 4
hours at 30⁰C. After recover, tubes were centrifuged to pellet the cells and the supernatant was
discarded. Cells were resuspended in 100 µL of sterile ddH2O and were plated in YPD agar plates
supplemented with 200 mg/L of geneticin (Sigma-Aldrich). Plates were incubated for 72 hours at 30⁰C.
3.4.4. Primer duplexing
Primers were dissolved in STE-buffer pH 8 (10 mM Tris (NZYTech), 1 mM EDTA (Sigma-Aldrich), 50
mM NaCl (Panreac)) to a concentration of 500 µM. Each primer pair (gRNA forward and reverse, donor
forward and reverse) were mixed in equal amounts (10 µL of each primer) and incubated in the heat
block at 94⁰C, for 3 minutes. After incubation, the heat block was unplugged and the primers were left
there to cool to 30⁰C during approximately 2 hours. After cooling, the mixes were diluted 500x with Milli-
Q water. Mixes (concentrated and diluted) were stored at -20⁰C.
26
3.4.5. Preparation of the plasmid with gRNA
The selected plasmid (p59) was opened using EcoRV and XhoI, following the enzyme manufacturers’
instructions. The assembly of gRNA with the restricted vector was performed using the Gibson
assembly technique [150]. For each gRNA primer pair, two Gibson reactions were performed, one with
the gRNA mix and other with water, for control. For a final reaction volume of 10 µL, 7.5 µL of 1.33x
Gibson Mix, 1 µL of 40 ng/µL solution of open plasmid, 0.75 µL of the prepared gRNA mix or water and
Milli-Q water to complete the volume were used. This mix was incubated at 50⁰C for 1 hour and used
fresh for E. coli transformation.
3.4.6. E. coli transformation
For each gRNA primer pair, three transformations were made: one using gRNA Gibson Mix, one using
the control Gibson Mix and one using water instead of Gibson Mix. For transformation, 150 µL of
competent E. coli (DH5α cells were used for transformations with plasmid containing ATF1 gRNA and
XL1-Blue cells were used for plasmids containing ATF2 gRNA and EAT1 gRNA) were mixed with 50
µL of TCM (10 mM Tris-HCl (Sigma-Aldrich), 10 mM CaCl2 (Alpha Aesar), 10 mM MgCl2 (Sigma-
Aldrich)) buffer. To this mix, 10 µL of fresh Gibson Mix was added and left in ice for 30 minutes. Heat
shock was performed by placing the tubes in the heat block at 42⁰C for 3 minutes and immediately
placing them in ice for 5 minutes. After heat shock, 1 mL of liquid LB (10 g/L Tryptone, 5 g/L Yeast
Extract, 10 g/L NaCl) medium was added and the tubes were incubated at 37⁰C, with an agitation of
250 rpm, for 1 hour. After incubation, the tubes were centrifuged for 2 minutes, in order to pellet the
cells. The supernatant was discarded, the cells were resuspended in 100 µL of sterile ddH2O, platted
in solid LBA medium and incubated at 37⁰C for 24 hours. Colonies of E. coli transformed with gRNA
Gibson Mix (candidates) were transferred into tubes containing 3 mL of liquid LBA medium (1 colony
per tube) and incubated overnight at 37⁰C, with an agitation of 250 rpm. To extract the plasmid from
each candidate, NZYMiniprep® kit (NZYTech) was used following the manufacturer’s instructions. The
extracted plasmids were sent to STAB Vida for sequencing, to identify if the plasmid contained gRNA.
3.4.7. Transformation with p59-gRNA and donorDNA
The inoculum of S. cerevisiae CEN.PK expressing p51-Cas9 was prepared by growing the strain in
liquid YPD, supplemented with 200 mg/L of geneticin. The culture was incubated overnight at 30⁰C,
with an agitation of 250 rpm. After incubation, the OD at 600 nm was measured using the
spectrophotometer. The necessary volume of inoculum to start a culture with an OD of 0.1 was
transferred into a new flask with liquid YPD medium, supplemented with 200 mg/L of geneticin, and
incubated for approximately 3 to 4 hours at 30⁰C, with an agitation of 250 rpm. Transformation of the
incubated cells was performed using the Alkali-Cation™ Yeast Transformation Kit from MP
Biomedicals, following the manufacturer’s instructions. A total of 250 ng of the plasmid expressing the
gRNA being utilized, as well as 2 µL of concentrated duplexed donor DNA (250 µM) were transformed
in S. cerevisiae. Transformed cells were plated into YPD agar plates supplemented with 200 mg/L of
27
geneticin and 100 mg/L of nourseothricin (Sigma-Aldrich) and incubated at 30⁰C for 48 hours. Colonies
of cells transformed with p59-gDNA and donorDNA (candidates) were spread in new plates of the same
medium and were incubated at 30⁰C for 48 hours. DNA extraction was performed using the same
protocol described in section 3.1.3. To determine if the desired mutants were obtained, PCR was
performed using the protocol described in section 3.1.4, but using the appropriate confirmation primers.
The PCR products of each candidate’s DNA were submitted to enzymatic restriction assays to asses if
the transformation was successful (each Donor oligo possessed a restriction site for a specific enzyme:
Donor ATF1 – EcoRI; Donor ATF2 – BamHI; Donor EAT1 – SacI). The products of the restriction
reaction were separated by electrophoresis on a 0.8% agarose gel, with green safe incorporated to
stain DNA. New PCR products of candidate’s DNA that yield positive results in the enzymatic restriction
assays were sent to STAB VIDA for sequencing by Sanger sequencing to confirm the disruption of the
gene.
3.4.8. Plasmid loss
After confirmation that the desired mutation was obtained (by comparing the sequence results with the
non-mutated sequence), the mutated strain was grown in liquid YPD, supplemented with 200 mg/L of
geneticin to lose the plasmid and allow subsequent transformation with other gRNA and deletions of
the other target genes. The culture was incubated at 30⁰C, with an agitation of 250 rpm, for 24 hours.
After incubation, a small volume of culture was transferred into fresh medium and incubated for another
24 hours, in the same conditions. This process was performed one more time (three incubations in
total). After the third incubation, serial dilutions were performed and the cultures were plated into YPD
agar plates, supplemented with 200 mg/L of geneticin and 100 mg/L of nourseothricin, and YPD agar
plates, supplemented with 200 mg/L of geneticin, in order to conclude if the cells had lost p59-ATF1,
p59-ATF2 or p59-EAT1.
28
29
4. Results
4.1. Isolation and identification of yeasts
In order to isolate and identify yeast strains with potential for improvement of the aromatic profile of craft
beer, a variety of samples from different origins was used. Wine and wine must samples were
considered interesting since non-Saccharomyces strains that are present in these types of samples are
described in the literature as being capable of producing a wide variety of flavour and aroma active
compounds [28,61,93]. Three different wine production samples were collected, one being a white wine
sample from Sardoal (labelled SarB), and the other two being red wine must samples from Tomar,
collected from the same wine production, but at different fermentation times. One was collected in the
first day of fermentation (labelled Mst) and the other was collected after the transferring the wine must
into the fermentation barrel (labelled Bar). Samples from a contaminated beer batch from the IST
Brewer’s Club (labelled CCIST), collected at the top of the liquid where a biofilm was formed, was also
used.
Serial dilutions (100 to 10-6) of the collected samples were spread on YPD agar medium, supplemented
with 100 µg/mL of chloramphenicol to prevent the growth of the bacteria present in the sample. Plates
were incubated at 30⁰C for 24 hours, after which each morphologically different colony was spread on
new YPD plates to obtain pure cultures. Serial dilutions of Mst and Bar samples were also spread on
WLN agar plates, which were incubated at 30⁰C for 48 hours before plating each morphologically
different colony in new YPD agar supplemented with 100 µg/mL of chloramphenicol to obtain pure
cultures. Due to the presence of bromocresol green in WLN agar, the colonies acquire a green
coloration, with variations in intensity, related to the microorganism’s metabolism, which provides
another morphological factor to differentiate colonies, allowing the distinction of strains of the same
species or variants of the same strain [151–153]. Accordingly, more morphologically different colonies
were detected in WLN plates than in YPD plates. In addition, pure colonies that were plated in YPD
agar plates were also plated in WLN agar plates (after being grown in YPD agar) to compare their
morphology and stability. Since Mst and Bar samples came from the same wine production, if colonies
with the same morphology were present in both samples, they will only be considered from one of the
samples. Also, since Mst and Bar samples were platted on two different media, samples platted in YPD
agar were labelled MstY and BarY, whereas samples platted in WLN agar were labelled MstW and
BarW.
For the identification of the strains, genomic DNA was extracted from the isolates and the very
conserved regions of ribosomal DNA, D1/D2 of the 26S subunit or Internal Transcribed Spacer (ITS),
were amplified and sequenced by Sanger sequencing outside the laboratory as a service. After
comparing the results obtained from Sanger sequencing (sequences presented in the Annex) with the
DNA sequences present in the NCBI database, it was possible to taxonomically identify the isolated
colonies.
30
Regarding CCIST samples, the colonies obtained were identified as Pichia kudriavzevii. Regarding
SarB, two types of morphologically different colonies were obtained and identified as Candida
intermedia and Clavispora lusitaniae. In MstY, six morphologically different colonies were isolated and
identified as belonging to five different species: Metschnikowia pulcherrima, Pichia kudriavzevii,
Saccharomyces cerevisiae (two colonies), Hanseniaspora uvarum and Starmerella bacillaris. As
mentioned above, regarding BarY, only colonies that were morphologically different from the ones
present in MstY were isolated, which led to the isolation of three different strains, that were identified
as Pichia kluyveri, Pichia kudriavzevii and Hanseniaspora uvarum. In the case of MstW, six
morphologically different colonies were isolated and identified as belonging to four different species: S.
cerevisiae (three colonies), Pichia kluyveri, Pichia terricola and Candida humilis. In BarW, a total of ten
morphologically different colonies were isolated and identified as belonging to five different species: S.
cerevisiae (two colonies), Metschinokowia ziziphicola, Starmerella bacillaris, Hanseniaspora opuntiae
and Hanseniaspora uvarum (four colonies). For one of the isolates it was not possible to conclude if it
was from H. opuntiae or H. uvarum because the BLAST analysis performed yielded H. uvarum as first
BLAST result, but similar identities (99% identity) were obtained for the two species. Nevertheless, this
strain is referred as H. uvarum from now on, since it was the first BLAST result yielded. Since Mst and
Bar were samples from the same wine production, pairwise sequence alignment analysis was
performed with D1/D2 sequences from the isolates from both samples that were identified as belonging
to the same species, in order to determine if they belonged to the same strain. In the case of a positive
result, only one of these isolates was added to the IST yeast collection.
In total, fifteen different isolates were obtained and added to the IST yeast collection, with fourteen
being from non-Saccharomyces species and one from S. cerevisiae. A list of all the isolated strains and
the corresponding isolation sample are summarized in Table 3.
31
Table 3 – Yeast strains from different species isolated from different samples. The IST Yeast Culture Collection ID# and the
identity (%) obtained in BLAST analysis performed in the NCBI database are shown.
Samples Isolated strain IST Yeast Culture Collection
ID # Identity
CCIST Pichia kudriavzevii IST376 100%
SarB Candida Intermedia IST385 100%
Clavispora lusitaniae IST413 99%
Mst
Candida humilis IST409 99%
Metschnikowia pulcherrima IST402 98%
Pichia kluyveri IST411 99%
Pichia terricola IST410 99%
Saccharomyces cerevisiae IST403 99%
Starmerella bacillaris IST401 99%
Bar
Hanseniaspora opuntiae IST399 99%
Hanseniaspora uvarum IST400 99%
Hanseniaspora uvarum IST412 99%
Metschnikowia ziziphicola IST404 99%
Pichia kluyveri IST397 99%
Pichia kudriavzevii IST398 99%
4.2. Selection of a Hanseniaspora strain with potential for increasing the organoleptic
profile of beer
Isolates from Hanseniaspora genus have been described in the literature as being capable of producing
a wide array of aromatic compounds [90,97,110]. For this reason, four Hanseniaspora strains were
chosen to undergo the first fermentative screening to find strains with potential for increasing the
organoleptic profile of beer. Hanseniaspora uvarum IST412 isolated in this work, as well as three H.
opuntiae strains, one isolated in this work (IST399), and two from the IST Yeast Culture Collection
(IST406 and IST408), were selected.
4.2.1. First screening fermentations
Since the flasks used for the fermentations were tightly capped and sealed, the entry of oxygen into the
flasks was very difficult, but the carbon dioxide produced as a by-product of alcoholic fermentation can
easily be expelled through the syringe needle that perforated the cork, due to pressure, leading to a
decrease in the weight of the fermentation flask. During sugar fermentation, carbon dioxide and ethanol
are produced at the same molar proportions (1:1 ratio) and, since carbon dioxide diffuses out of the
flask, it is possible to monitor the fermentations by weighting the flasks in set intervals of time and plot
the decrease in mass over time. Also to note that since carbon dioxide production is correlated to yeast
growth, these graphs can roughly be interpreted as fermentation growth curves. Plots generated with
32
this approach are shown in Figure 6. By analysing this figure, it is possible to observe that H. opuntiae
IST408 and H. uvarum IST412 show very similar weight loss patterns, as well as H. opuntiae strains
IST399 and IST406.
Figure 6 – Progress of the first screening fermentations performed by different strains of H. uvarum (IST412) and H. opuntiae
(IST399, IST406 and IST408).
Fermentations were performed at 23 ⁰C and were interrupted after 330 hours (approximately 14 days),
which is the typical fermentation time in beer production, and the pH of the broth was measured (Table
4). Although different species and strains were used, the pH in all fermentations decreased to similar
levels.
Table 4 – pH values of the fermentation products obtained from the first screening fermentations.
Samples pH
Beer wort (t0) 5.2
H. opuntiae IST399 4.56
H. opuntiae IST406 4.46
H. opuntiae IST408 4.43
H. uvarum IST412 4.43
After 330 hours of fermentation, each fermentation product was analysed by HPLC and its sugar and
ethanol concentrations were determined (Table 5).
0,00
0,10
0,20
0,30
0,40
0 50 100 150 200 250 300 350
Wei
ght
loss
(g)
Time (h)
IST399
0,00
0,10
0,20
0,30
0,40
0 50 100 150 200 250 300 350
Wei
ght
lost
(g)
Time (h)
IST406
0,00
0,10
0,20
0,30
0,40
0 50 100 150 200 250 300 350
Wei
ght
loss
(g)
Time (h)
IST408
0,00
0,10
0,20
0,30
0,40
0 50 100 150 200 250 300 350
Wei
ght
lost
(g)
Time (h)
IST412
33
Table 5 – Concentration of maltotriose, maltose, glucose, fructose and ethanol in the fermentation products after 330 hours of
fermentation.
Samples Maltotriose (g/L) Maltose (g/L) Glucose (g/L) Fructose (g/L) Ethanol (%v/v)
Beer wort (t0)
12.57 53.18 5.48 3.83 0.00
H. opuntiae IST399
11.85 49.81 0.00 0.00 0.37
H. opuntiae IST406
11.15 48.96 0.00 0.00 0.37
H. opuntiae IST408
11.16 47.48 0.00 0.00 0.40
H. uvarum IST412
11.40 49.14 0.00 0.00 0.41
As expected, glucose and fructose were completely consumed by all four strains, whereas maltose and
maltotriose were not fermented by any of the tested strains. Regarding ethanol production, all four
strains produced similar quantities of ethanol and in very small percentages (less than 0.5%).
4.2.2. Organoleptic characterisation of the fermentation products from the first
screening
After interruption of the fermentations, a preliminary organoleptic evaluation of the fermented product
was conducted by members of the Biological Sciences Research Group, to evaluate if the tested strains
produced interesting flavours and aromas. The fermentations products from H. opuntiae IST399 and H.
uvarum IST412 had an acidic taste (more pronounced in IST412) and did not present any interesting
aroma. The two remaining fermentations were the ones that yielded the more interesting results. The
fermentation carried out by H. opuntiae IST406 presented an oregano aroma but an insipid flavour,
whereas the fermentation carried out by H. opuntiae IST408 presented a caramel aroma and a sweet
taste. Due to its flavour and aroma profile, the fermentations with H. opuntiae IST408 was deemed the
most interesting, which led to the selection of this strain for further testing in mixed fermentations with
S. cerevisiae.
4.3. Beer production by single and mixed cultures of Hanseniaspora opuntiae IST408
and Saccharomyces cerevisiae US-05
4.3.1. Fermentation profile of single and mixed cultures of Hanseniaspora opuntiae
IST408 and Saccharomyces cerevisiae US-05
Since H. opuntiae does not ferment all the sugars present in beer wort, the utilization of this species for
beer production requires the presence of S. cerevisiae in the fermentative medium, due to its capability
34
to ferment all sugars present in beer wort. Regarding the choice of the Saccharomyces strain to be
used, SafAle™ US-05 (referred to as US-05 from now on) was selected. This is a commercial S.
cerevisiae strain from Fermentis that gives a neutral aroma to the beer (does not contribute significantly
to the aromatic profile of the beer). This trait would allow the aromatic contribution of the non-
Saccharomyces strain to stand out in the final product. In these trials, two types of mixed fermentations
were conducted, with differences in the method of inoculation. For one fermentation, sequential
inoculation of both species was done, with the non-Saccharomyces species being added to the medium
at the start of fermentation and the S. cerevisiae strain being added 48 hours after the first inoculation
(referred as sequential fermentation in this work). In this fermentation, the non-Saccharomyces species
H. opuntiae IST408 was added first, to allow the fermentation of glucose and fructose, without S.
cerevisiae competition for sugars and ethanol accumulation. For the other mixed fermentation,
simultaneous inoculation was performed with both species being added to the medium at the same time
(referred as simultaneous fermentation in this work). In both mixed fermentations, the two species were
added in the same ratio (1:1 ratio). As control, single culture fermentations of both species were
conducted. Also to note that a scale-up was done (total volume of 1 L) to better simulate commercial
beer production and to have sufficient volume to bottle beer in standard size bottles (330 mL). Three
experimental replicates were made for this trial.
The different fermentations performed were monitored by periodically weighting the flasks and plotting
the weight loss over time (Figure 7).
Figure 7 – (A) – Fermentation progress of single and mixed culture fermentations of H. opuntiae IST408 and S. cerevisiae US-
05 fermentations performed for beer production. Orange dots correspond to H. opuntiae IST408 single culture fermentation, blue
dots correspond to S. cerevisiae US-05 single culture fermentation, yellow dots correspond to sequential fermentation and grey
dots correspond to simultaneous fermentation. The growth curves shown are the result of three independent experiments that
gave rise to the same results. (B) – Fermentation progress of H. opuntiae IST408 single culture fermentation, using a more
appropriate scale.
By analysing this figure, it is possible to observe that when compared to the fermentation carried out by
S. cerevisiae US-05, the fermentation carried out by H. opuntiae IST408 shows a significantly lower
weight loss, which means that H. opuntiae IST408 has a much lower fermentative capacity. The mixed
fermentation where S. cerevisiae US-05 and H. opuntiae IST408 were simultaneously inoculated
0,0
5,0
10,0
15,0
20,0
25,0
30,0
0 100 200 300 400
Wei
ght
loss
(g)
Time (h)
All fermentations
0,0
0,5
1,0
1,5
2,0
2,5
3,0
0 100 200 300 400
Wei
ght
loss
(g)
Time (h)
IST408A B
35
shows a similar weight loss pattern to the S. cerevisiae US-05 single culture fermentation. This was
expected because, as seen in section 4.2.1 and considering that H. opuntiae IST408 possesses a low
fermentative capacity, the majority of the fermentative work is done by S. cerevisiae US-05. Regarding
the sequential inoculation mixed fermentation, the fermentation behaviour during the first 48 hours was
similar to H. opuntiae IST408 single culture fermentation, as expected because both were IST408 pure
culture fermentations. After the addition of S. cerevisiae US-05 to the sequential fermentation at 48
hours of fermentation, the subsequent weight loss pattern is similar to the patterns of both S. cerevisiae
US-05 single culture and simultaneous fermentations, but the maximum weight loss was lower than
those two other fermentations. This was also expected as S. cerevisiae US-05 will outcompete H.
opuntiae IST408 and takeover the fermentation.
Fermentations were interrupted after fourteen days of incubation and the pH of the liquid medium was
measured. The cultures were then bottled with the addition of a glucose solution (7 g/L of glucose added
to each bottle) to perform a secondary fermentation, in order to carbonate the beer. The bottles were
opened after 30 days to perform an organoleptic evaluation, and the pH of the beer was measured
(Table 6).
Table 6 – pH value of the fermented products after the primary and secondary fermentations.
Fermentation pH after primary fermentation pH after secondary fermentation
Beer wort (control) 5.38±0.022 5.26
H. opuntiae IST408 4.63±0.016 4.34
S. cerevisiae US-05 4.22±0.045 4.12
Sequential 4.13±0.026 4.08
Simultaneous 4.17±0.022 4.14
For the four fermentations, a decrease in final pH value was observed after the primary fermentation.
This decrease is more pronounced for the mixed fermentations than for the single culture fermentations.
The pH level decrease during H. opuntiae IST408 fermentation is not so significant when compared
with the other fermentations. The pH level of the S. cerevisiae US-05 single culture fermentation is
slightly higher than the values presented by the mixed fermentations. Regarding the pH values after the
secondary fermentation, the comparison with the pH values obtained after primary fermentation cannot
be easily done because they correspond to a single measurement, and beer wort presents a pH value
after the secondary fermentation that is below the value measured after primary fermentation.
Contamination of beer wort was not observed and this pH decrease may have been caused by the
deficient calibration of the pH meter.
Sugar and ethanol concentrations in samples collected at the end of primary and secondary
fermentations were analysed by HPLC (Figure 8). Glucose and fructose were almost totally consumed
after fermentation. In the case of fermentations where S. cerevisiae US-05 is present (single culture
and the two mixed fermentations), maltose and maltotriose were also used, whereas in H. opuntiae
IST408 single culture fermentation these sugars were not consumed.
36
The concentrations of ethanol in mixed culture fermentations are similar, around 4.4% (v/v), whereas
in S. cerevisiae US-05 single culture fermentation are around 3.9% (v/v). In the case of H. opuntiae
IST408 single culture fermentation, ethanol levels are much lower, reaching a concentration of around
0.5% (v/v). Sugar concentration remained constant during secondary fermentation, with the exception
of glucose, which was added at the beginning of the secondary fermentation and was completely
consumed. A slight increase in ethanol concentration after secondary fermentation can be observed in
all fermentations with the exception of the sequential fermentation.
0 10 20 30 40 50
0
20
40
60
0
1
2
3
4
5
H. opuntiae IST408
Time (days)
Su
ga
r (g
/L)
Eth
an
ol (%
v/v
)
0 10 20 30 40 50
0
20
40
60
0
1
2
3
4
5
S. cerevisiae US-05
Time (days)
Su
ga
r (g
/L)
Eth
an
ol (%
v/v
)
Maltotriose
Maltose
Glucose
Fructose
Ethanol
0 10 20 30 40 50
0
20
40
60
0
1
2
3
4
5
Sequential
Time (days)
Su
ga
r (g
/L)
Eth
an
ol (%
v/v
)
0 10 20 30 40 50
0
20
40
60
0
1
2
3
4
5
Simultaneous
Time (days)
Su
ga
r (g
/L)
Eth
an
ol (%
v/v
)
Figure 8 – Sugars (maltose, maltotriose, fructose and glucose) and ethanol concentrations obtained from single (H. opuntiae
IST408 and S. cerevisiae US-05) and mixed (sequential and simultaneous) culture fermentations. Samples were collected prior
to fermentation and after primary and secondary fermentations. An additional sample was collected at 48 hours in sequential
fermentations, just before the introduction of S. cerevisiae US-05.
4.3.2. Volatile compound profile of single and mixed culture beer fermentations
In order to identify the flavour-active volatile compounds present in each beer after primary and
secondary fermentations, samples were analysed by GC-MS (Table 7). Quantification of the identified
compounds was performed by calculating the area ratio between the areas of the compounds and
internal standard (1-butanol) peaks. Across all four fermentations, the same four chemical groups
37
(acetate esters, ethyl esters, higher alcohols and organic acids) presented higher relative abundance
when compared to other chemical groups. The relative abundance for these four chemical groups, in
each fermentation, is presented in Figure 9.
Statistical analysis was performed to assess if there were significant differences in relative abundance
of the highlighted chemical groups, between primary and secondary fermentation, to which the results
indicated that no significant differences existed (Figure 9).
IST40
8
US-0
5
Sequen
tial
Simulta
neous
0
5
10
15
20
Total acetate esters
Rela
tive a
bu
nd
an
ce
IST40
8
US-0
5
Sequen
tial
Simulta
neous
0
10
20
30
Total ethyl esters
Rela
tive a
bu
nd
an
ce
IST40
8
US-0
5
Sequen
tial
Simulta
neous
0
10
20
30
40
Total higher alcohols
Rela
tive a
bu
nd
an
ce
IST40
8
US-0
5
Sequen
tial
Simulta
neous
0
2
4
6
8
Total acids
Rela
tive a
bu
nd
an
ce
T1
T2
Figure 9 – Total relative abundance of the four most ample chemical groups across all four fermentations. Statistical significance
was considered between mean values when *P-value<0.05; **P-value<0.01; ***P-value<0.001; ****P-value<0.0001. T1 identifies
samples taken after primary fermentation and T2 identifies samples taken after secondary fermentation.
Although no significant difference was observed in the total relative abundance of each family of
compounds between T1 and T2, single flavour-active volatile compounds produced during each
fermentation show some differences. In Figures 10 and 11, the relative abundance of specific
compounds within each chemical group are presented.
38
Table 7 – Average relative abundance (RA) and standard deviation (SD) of all compounds identified in single and mixed fermentations
Fermentation
Compound RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio)
Ethyl acetate 2,4948 0,3768 5,7182 1,2436 2,9850 0,2550 3,2437 0,7498 5,7298 0,2669 5,7657 0,9865 4,6042 0,3352 5,0756 0,2858
Ethyl butanoate - - - - 0,4765 0,0676 0,4821 0,0156 0,2659 0,0114 0,3269 0,0108 0,4346 0,0053 0,5072 0,0514
Isobutanol 0,3836 0,0782 0,6939 0,1473 2,1236 0,5546 1,8809 0,0351 2,3760 0,4037 2,2601 0,2172 2,4215 0,3725 2,6892 0,2716
Isoamyl acetate 0,4179 0,1938 1,9416 1,1152 4,7007 0,2314 4,8761 0,4418 4,0895 0,4711 5,7528 0,5388 5,3090 0,0786 6,5635 0,3073
Isoamyl acetate (2) - - 0,0112 0,0112 0,0197 0,0197 0,0446 0,0283 0,0270 0,0186 0,0166 0,0166
2-Heptanone 0,0094 0,0004 0,0082 0,0082 0,0156 0,0156 0,0224 0,0085 0,0048 0,0048 0,0106 0,0028 0,0211 0,0211 0,0095 0,0095
Isoamyl propionate 0,0127 0,0061 0,0256 0,0001 0,0045 0,0045 0,0154 0,0066 0,0282 0,0020 0,0087 0,0007 0,0139 0,0030 0,0147 0,0014
Isoamyl propionate 0,0127 0,0061 0,0256 0,0001 0,0045 0,0045 0,0154 0,0066 0,0282 0,0020 0,0087 0,0007 0,0139 0,0030 0,0147 0,0014
Isoamyl alcohol 4,5116 0,7667 8,0419 2,8009 24,2455 1,8456 21,7426 2,8370 23,9274 0,3830 22,1516 2,0026 24,2145 1,0502 26,1339 0,2650
Ethyl hexanoate 0,0425 0,0167 0,2722 0,0423 2,5709 0,4998 2,5835 1,0140 1,1727 0,0051 1,5258 0,5683 1,8377 0,1551 2,3014 0,1790
Ethyl hexanoate (2) - - 0,0155 0,0020 0,0735 0,0056 0,0937 0,0002 0,0315 0,0004 0,0800 0,0095 0,0881 0,0188 0,0899 0,0430
Hexyl acetate - - 0,0170 0,0170 0,0235 0,0032 0,0233 0,0057 0,0151 0,0030 0,0309 0,0119 0,0111 0,0008 0,0264 0,0020
2-Octanone - - - - - - 0,0046 0,0046 - - - - - - - -
Acetoin 0,0426 0,0147 0,0291 0,0291 - - - - - - - - - - - -
Octanal - - - - 0,0216 0,0041 - - - - - - - - - -
Ethyl 3-hexenoate - - - - 0,0125 0,0008 0,0078 0,0078 0,0101 0,0003 0,0139 0,0038 0,0140 0,0005 0,0167 0,0035
Ethyl heptanoate 0,0234 0,0117 0,0279 0,0195 0,0585 0,0303 0,0514 0,0401 0,0625 0,0264 0,0472 0,0340 0,0525 0,0217 0,0549 0,0307
Ethyl lactate - - - - - - 0,0177 0,0031 - - 0,0135 0,0007 - - 0,0219 0,0019
1-Hexanol 0,0569 0,0075 0,0784 0,0137 0,0912 0,0053 0,0280 0,0280 0,1217 0,0141 0,1160 0,0195 0,1153 0,0069 0,0874 0,0141
Heptyl acetate - - 0,0041 0,0041 0,0093 0,0038 0,0069 0,0034 0,0071 0,0002 0,0100 0,0058 0,0018 0,0018 0,0090 0,0004
2-Nonanone - - - - 0,0112 0,0014 0,0095 0,0036 0,0020 0,0020 0,0035 0,0011 - - 0,0044 0,0044
Nonanal 0,0032 0,0015 0,0156 0,0026 0,0720 0,0101 0,0709 0,0354 0,0531 0,0190 0,0507 0,0060 0,0555 0,0164 0,0578 0,0116
Nonanal (2) - - - - 0,0172 0,0064 0,0150 0,0150 0,0092 0,0092 0,0127 0,0008 0,0139 0,0027 0,0130 0,0005
Ethyl octanoate 0,2778 0,1667 0,5101 0,3400 7,0261 3,2597 6,0098 3,8261 2,4035 0,4119 3,3558 2,1514 3,3940 0,0266 5,8165 2,1724
Acetic acid 0,6017 0,1842 1,3154 0,5457 0,8061 0,1558 0,8207 0,0991 1,8946 0,2149 1,9821 0,1806 2,1341 0,5079 1,9058 0,4660
Isoamyl hexanoate - - - - 0,0056 0,0056 0,0050 0,0050 - - - - - - - -
1-Heptanol 0,0365 0,0025 0,0391 0,0091 0,0762 0,0009 0,0707 0,0410 0,1114 0,0097 0,0974 0,0205 0,1247 0,0148 0,1387 0,0112
Octyl acetate - - - - 0,0088 0,0034 - - - - - - - - - -
2-Ethylhexanol 0,0115 0,0027 0,0381 0,0381 0,0368 0,0089 0,0943 0,0542 0,0405 0,0071 0,0835 0,0397 - - 0,1029 0,0538
2-Acetylfuran 0,0076 0,0021 0,0150 0,0051 0,0072 0,0069 0,0292 0,0182 0,0201 0,0085 0,0273 0,0157 0,0177 0,0042 0,0310 0,0133
Benzaldehyde - - - - - - - - 0,1997 0,0180 0,1854 0,0632 0,1965 0,0171 0,0963 0,0963
Furfuryl acetate 0,0196 0,0196 0,0638 0,0091 - - - - - - - - - - - -
Ethyl nonanoate 0,0697 0,0190 0,0667 0,0667 0,6731 0,0591 1,3741 0,8293 0,7006 0,1121 1,1896 0,7129 0,7738 0,1957 1,4330 0,5019
Linalool 0,0619 0,0215 0,0851 0,0335 0,1529 0,0759 0,1448 0,0949 0,1598 0,0870 0,1429 0,0909 0,1541 0,0739 0,1673 0,0783
Isobutanoic acid 0,0336 0,0065 0,0879 0,0164 - - - - - - - - - - - -
1-Octanol - - - - 0,5160 0,0760 0,4287 0,0399 0,2876 0,0059 0,2399 0,0152 0,5004 0,0052 0,5226 0,0330
1-(2,4-Dimethyl-furan-3-yl)-ethanone 0,0194 0,0065 0,0290 0,0094 0,0462 0,0086 0,0394 0,0037 0,0474 0,0050 0,0399 0,0013 0,0497 0,0024 0,0531 0,0086
Butanoic acid - - - - 0,0223 0,0223 0,0801 0,0344 0,0180 0,0180 0,0157 0,0157 0,0182 0,0182 0,0328 0,0328
2-Decanol 0,0286 0,0118 0,0378 0,0190 0,0690 0,0690 - - 0,0746 0,0746 0,0566 0,0566 0,0525 0,0525 0,0585 0,0585
Ethyl decanoate 0,5747 0,2580 1,4407 1,3155 0,7872 0,0916 1,2777 0,1745 0,4863 0,0127 1,5486 1,3749 0,3951 0,1265 1,3308 0,0778
Simultaneous T1 Simultaneous T2IST408 T1 IST408 T2 US-05 T1 US-05 T2 Sequential T1 Sequential T2
39
Table 7 (continuation) – Average relative abundance (RA) and standard deviation (SD) of all compounds identified in single and mixed fermentations
Fermentation
Compound RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio)
p-Tolualdehyde, o-Tolualdehyde 0,0021 0,0021 0,0663 0,0124 0,0341 0,0341 0,0742 0,0071 0,0204 0,0102 0,0589 0,0182 0,0829 0,0249 0,0814 0,0461
Furfuryl alcohol 0,0907 0,0019 0,1382 0,0211 0,1815 0,0321 0,1998 0,1153 0,1966 0,0251 0,1796 0,0704 0,1545 0,0187 0,1797 0,0230
Isoamyl octanoate - - - - - - - - - - - - 0,0121 0,0121 0,0316 0,0008
Isovaleric acid 0,0327 0,0003 0,0610 0,0190 0,2401 0,0074 0,2526 0,0813 0,1093 0,0112 0,0989 0,0050 0,2152 0,0022 0,2409 0,0373
2-Undecanol 0,0043 0,0043 0,0062 0,0062 - - - - 0,0073 0,0073 - - - - - -
Ethyl 9-decenoate 0,0410 0,0275 0,0585 0,0585 0,4560 0,2596 0,5889 0,3296 0,0339 0,0048 0,1879 0,1201 0,1115 0,0247 0,7660 0,2130
Alpha-terpineol 0,0060 0,0026 0,0062 0,0062 - - - - 0,0107 0,0107 0,0102 0,0102 - - - -
3-Hydroxypropyl methyl sulfide 0,0093 0,0022 0,0233 0,0056 - - 0,0117 0,0117 0,0347 0,0036 0,0281 0,0094 0,0418 0,0001 0,0415 0,0037
2-Dodecanol 0,0206 0,0068 0,0311 0,0223 - - - - 0,0345 0,0140 0,0161 0,0161 0,0160 0,0160 - -
Ethyl undecanoate - - 0,0028 0,0028 - - 0,0531 0,0455 0,0373 0,0164 0,0442 0,0351 0,0189 0,0148 0,0665 0,0448
10-Undecen-1-ol 0,0099 0,0060 0,0108 0,0108 0,0177 0,0177 0,0103 0,0103 0,0184 0,0184 0,0132 0,0132 0,0137 0,0137 0,0127 0,0127
Isoamyl nonoate, Isoamyl laurate - - - - - - - - 0,0089 0,0023 0,0135 0,0090 0,0079 0,0035 0,0149 0,0068
1-Decanol 0,0049 0,0005 0,0069 0,0013 0,2368 0,0572 0,1113 0,0033 0,1392 0,0001 0,0777 0,0128 0,1829 0,0200 0,1735 0,0054
Citronellol - - 0,0100 0,0100 0,0156 0,0156 0,0188 0,0051 0,0262 0,0010 0,0192 0,0054 0,0249 0,0004 0,0246 0,0090
Phenethyl acetate 0,1498 0,0533 0,3431 0,0696 0,5416 0,0485 0,5838 0,1074 0,4868 0,0540 0,6916 0,0884 0,5622 0,0166 0,7942 0,0368
Damascenone 0,0028 0,0004 0,0068 0,0003 0,0040 0,0040 0,0058 0,0058 0,0085 0,0004 0,0159 0,0022 0,0043 0,0043 0,0227 0,0017
Hexanoic acid 0,0182 0,0037 0,0525 0,0306 0,3179 0,0633 0,3259 0,1081 0,1419 0,0027 0,2019 0,0421 0,2330 0,0065 0,3170 0,0262
Ethyl dodecanoate 0,6232 0,1573 1,8290 1,7290 0,2963 0,0143 0,4813 0,2573 0,8027 0,2626 1,0236 0,9672 0,1031 0,0240 0,4442 0,1453
Geraniol 0,0070 0,0006 0,0055 0,0055 - - - - - - 0,0023 0,0023 0,0047 0,0047 - -
Furaneol - - - - 0,0995 0,0160 0,0719 0,0480 0,0809 0,0110 0,0490 0,0298 0,0795 0,0044 0,0931 0,0248
Geranyl acetone - - 0,0067 0,0026 - - - - - - 0,0044 0,0044 - - - -
Isoamyl decanoate 0,0079 0,0024 0,0073 0,0073 - - - - - - 0,0136 0,0136 - - 0,0115 0,0009
Phenethyl alcohol 0,1186 0,0265 0,4601 0,2434 3,8258 0,3382 3,6033 0,4506 3,6453 0,2276 3,5416 0,2214 4,0907 0,1718 4,7987 0,2137
2-Acetylpyrrole - - - - - - - - - - 0,0041 0,0041 0,0091 0,0091 0,0057 0,0057
1-Dodecanol 0,0149 0,0004 0,0220 0,0015 0,0525 0,0001 0,0510 0,0147 0,0509 0,0026 0,0493 0,0162 0,0354 0,0023 0,0692 0,0203
Amylbutyrolactone - - - - - - - - 0,0042 0,0042 0,0147 0,0017 0,0048 0,0048 0,0194 0,0002
Octanoic acid 0,0832 0,0046 0,2963 0,0628 1,6633 0,1610 1,4720 0,2202 1,0200 0,0434 1,2960 0,2648 1,3287 0,0867 1,8048 0,1782
1-Tetradecanol - - - - - - - - 0,0268 0,0015 0,0318 0,0098 0,0396 0,0222 0,0389 0,0054
Nonanoic acid 0,1280 0,0567 0,2274 0,0223 0,4448 0,1699 0,4286 0,1299 0,5173 0,2846 0,5117 0,2140 0,3216 0,0409 0,5600 0,1756
1-Pentadecanol - - - - - - - - 0,0226 0,0002 0,0155 0,0155 0,0102 0,0102 0,0189 0,0189
4-Vinylguaiacol 0,0145 0,0002 0,0175 0,0001 0,0411 0,0056 0,0315 0,0036 0,0454 0,0060 0,0297 0,0152 0,0535 0,0010 0,0418 0,0093
Butoxytriglycol 0,0061 0,0024 0,0099 0,0039 0,0068 0,0068 0,0195 0,0010 0,0116 0,0116 0,0141 0,0063 0,0056 0,0056 0,0121 0,0121
Ethyl hexadecanoate 0,0049 0,0049 - - 0,2024 0,0916 0,3300 0,1686 0,4315 0,0074 0,2885 0,1788 0,2584 0,0660 0,3476 0,0570
Decanoic acid 0,2048 0,0144 0,3498 0,0336 0,2204 0,0472 0,2348 0,0336 0,2028 0,0594 0,4398 0,3451 0,1674 0,0004 0,3999 0,0382
Ethyl 9-hexadecenoate 0,0684 0,0634 0,0771 0,0771 0,1681 0,1310 0,4248 0,4058 0,2216 0,1528 0,1020 0,1020 0,2254 0,1556 0,2817 0,2817
2,4-Di-tert-butylphenol 0,0819 0,0223 0,1291 0,0602 0,1838 0,0085 0,1946 0,0525 0,3387 0,0140 0,1358 0,0002 0,2878 0,1638 0,2437 0,0834
Dimethyl phthalate 0,0064 0,0028 0,0022 0,0022 0,0142 0,0024 0,0065 0,0065 0,0149 0,0020 0,0052 0,0052 - - 0,0065 0,0065
Undecylenic acid - - - - - - - - - - 0,0226 0,0226 - - 0,0662 0,0161
Diethyl phthalate 0,0759 0,0047 0,0686 0,0423 0,2195 0,0200 0,1666 0,1205 0,2045 0,0317 0,1581 0,1129 0,1183 0,0677 0,1937 0,1429
1-Hexadecanol 0,0115 0,0004 0,0418 0,0141 0,0272 0,0005 0,0431 0,0069 0,0250 0,0034 0,0402 0,0142 0,0330 0,0060 0,0445 0,0123
Simultaneous T1 Simultaneous T2IST408 T1 IST408 T2 US-05 T1 US-05 T2 Sequential T1 Sequential T2
40
Statistical analysis was performed to assess if there were significant differences between fermentations
regarding the highligthed compounds. Since beers are considered finished only after secondary
fermentation and no significant differences were detected between primary and secondary
fermentations, the focus of the analysis will be the volatile profile of each produced beer in T2.
For acetate esters, the compounds that exhibit the higher relative abundance are ethyl acetate, isoamyl
acetate and phenethyl acetate. After secondary fermentation, H. opuntiae IST408 single culture
fermentation presents a higher relative abundance of ethyl acetate when compared to S. cerevisiae
US-05 single culture fermentation. The relative abundance of this compound in the mixed fermentations
is similar to IST408 single culture fermentation. Regarding phenethyl acetate, H. opuntiae IST408
presents a lower production of this compound when compared to S. cerevisiae US-05. Both mixed
fermentations show a relative abundance of this acetate ester similar to US-05 single culture
fermentation. Finally, regarding isoamyl acetate, IST408 single culture fermentation presents a lower a
relative abundance of this compound when compared to US-05 single culture fermentation. In the case
of mixed fermentations, both show higher relative abundace than US-05 single culture fermentation,
with the simultaneous fermentation presenting higher levels than the sequential fermentation. Although
these differences can be observed in Figure 10, the only difference that was considered significantly
relevant by the statistical analysis was the difference beween H. opuntiae IST408 single culture
fermentation and the remaing fermentations regarding isoamyl acetate.
Regarding ethyl esters, the only differences that were deemed significantly relevant by the statistical
analysis were the differences in the relative abundance of ethyl octanoate beween H. opuntiae IST408
single culture fermentation and S. cerevisiae US-05 single culture and between H. opuntiae single
culture fermentation and simultaneous fermentation. The relative abundance of ethyl octanoate in H.
opuntiae IST408 and S. cerevisiae US-05 sequential fermentation is also higher than H. opuntiae single
culture fermentation, although not statiscally significant. The relative abundance of ethyl hexanoate was
also superior in fermentations where S. cerevisiae US-05 is present when compared to H. opuntiae
IST408 single culture. Ethyl butanoate, ethyl nonaoate and ethyl hexadecanoate were only identified in
fermentations where US-05 is present, presenting similar levels across the three fermentations,
although ethyl nonaoate presents a higher relative abundance than the other two compounds. Ethyl
dodecanoate presents higher relative abundance in H. opuntiae IST408 single culture fermentation
when compared with the remaining fermentations, whereas ethyl decanoate shows similar relative
abundance across all fermentations.
41
Figure 10 – Relative abundance of the most abundant compounds of the acetate and ethyl esters chemical groups. Statistical
significance was considered between mean values when *P-value<0.05; **P-value<0.01; ***P-value<0.001; ****P-value<0.0001.
T1 identifies samples take after primary fermentation and T2 identifies samples taken after secondary fermentation.
Regarding higher alcohols, the members of this group presenting higher relative abundances were
isobutanol, isoamyl alcohol and phenethyl alcohol. The relative abundance of each of these higher
alcohols was much higher in fermentations where S. cerevisiae US-05 was present than in H. opuntiae
IST408 single culture fermentations. Across all four fermentations, the compound that presented higher
relative abundance was isoamyl alcohol. Isobutanol and phenethyl alcohol presented similar relative
abundance levels in IST408 single culture fermentations, with the latter presenting a slighlty higher
relative abundance in the remaning fermentations. Although these differences can be observed in
Figure 10, only the difference between H. opuntiae IST408 single culture fermentations and the
Ethyl
ace
tate
Isoam
yl a
ceta
te
Phenet
hyl a
ceta
te
0
2
4
6
8
Acetate esters T1R
ela
tive a
bu
nd
an
ce
Ethyl
ace
tate
Isoam
yl a
ceta
te
Phenet
hyl a
ceta
te
0
2
4
6
8
Acetate esters T2
Rela
tive a
bu
nd
an
ce
IST408
US-05
Sequential
Simultaneous
Ethyl
buta
noate
Ethyl
hex
anoat
e
Ethyl
oct
anoat
e
Ethyl
nonao
ate
Ethyl
dec
anoat
e
Ethyl
dodec
anoat
e
Ethyl
hex
adec
anoat
e
0
5
10
15
Ethyl esters T1
Rela
tive a
bu
nd
an
ce
Ethyl
buta
noate
Ethyl
hex
anoat
e
Ethyl
oct
anoat
e
Ethyl
nonao
ate
Ethyl
dec
anoat
e
Ethyl
dodec
anoat
e
Ethyl
hex
adec
anoat
e
0
5
10
15
Ethyl esters T2R
ela
tive a
bu
nd
an
ce
**** *** **** **
*
**** ****
****
* **
** *
** ** ****
**** ** *
*
42
remaining fermentations regarding isoamyl acetate was deemed significantly relevant by the statistical
analysis.
Figure 11 – Relative abundance of the most abundant compounds of the higher alcohols and organic acids chemical groups.
Statistical significance was considered between mean values when *P-value<0.05; **P-value<0.01; ***P-value<0.001; ****P-
value<0.0001. T1 identifies samples taken after primary fermentation and T2 identifies samples taken after secondary
fermentation.
Finally, regarding the organic acids group, the six different acids that presented higher relative
abundances were acetic acid, isovaleric acid, hexanoic acid, octanoic acid, nonanoic acid and decanoic
acid. Although some differences can be observed in the relative abundance of these organic acids
across all fermentations (Figure 11), only the differences between S. cerevisiae US-05 single culture
fermentation and the mixed fermentations regarding acetic acid, and the differences between H.
opuntiae IST408 and the remaining fermentations regarding octanoic acid were deemed significantly
relevant by the statistical analysis. After secondary fermentation, the relative abundance of acetic acid
in mixed fermentations was higher compared to the two single culture fermentations. Moreover, the
beer produced by H. opuntiae IST408 single culture presented slightly higher relative abundance of
Isobuta
nol
Isoam
yl a
lcohol
Phenet
hyl a
lcohol
0
10
20
30
Higher alcohols T1
Rela
tive a
bu
nd
an
ce
Isobuta
nol
Isoam
yl a
lcohol
Phenet
hyl a
lcohol
0
10
20
30
Higher alcohols T2
Rela
tive a
bu
nd
an
ce
IST408
US-05
Sequential
Simultaneous
Ace
tic a
cid
Isova
leric
acid
Hex
anoic
aci
d
Oct
anoic
aci
d
Nonan
oic a
cid
Dec
anoic
aci
d
0
1
2
3
Acids T1
Rela
tive a
bu
nd
an
ce
Ace
tic a
cid
Isova
leric
acid
Hex
anoic
aci
d
Oct
anoic
aci
d
Nonan
oic a
cid
Dec
anoic
aci
d
0
1
2
3
Acids T2
Rela
tive a
bu
nd
an
ce
**** **** ****
* * **
**** ****
****
*** ****
**** ****
*** ** * ***
**** **** *
** **
43
acetic acid when compared with the beer produced by S. cerevisiae US-05 single culture. A similar
profile can be observed for decanoic acid, but the relative abundace of this acid is much lower across
all four fermentations. In the fermentations where S. cerevisiae US-05 is present the relative abundance
of octanoic acid was significantly higher than in the fermentation carried out by H. opuntiae single
culture. A similar profile was obtained for hexanoic and nonanoic acids, although the statistical analysis
did not consider statistically significant the differences between H. opuntiae fermentation and the
fermentations where S. cerevisiae is present. Regarding isovaleric acid, H. opuntiae IST408 single
culture fermentation presented the highest relative abundance of this acid across all fermentations.
Interrestingly, the lowest relative abundance of this acid is presented by the sequential fermentation,
with S. cerevisiae US-05 single culture and simultaneous fermentation showing similar intermediate
relative abundance levels.
4.3.3. Organoleptic characterization of the beers produced by pure and mixed culture
fermentations
After secondary fermentation, the beers produced in the single and mixed culture fermentations were
evaluated by a panel of experienced beer tasters and professional craft brewers. The sensory analysis
notes attributed to each beer are presented in Table 8.
Table 8 – Sensory analysis notes of the expert panel for each beer produced in the beers fermented by single cultures of H.
opuntiae IST408 and S. cerevisiae US-05 and by simultaneous or sequential mixed cultures of both species.
Fermentation Tasting Notes
H. opuntiae IST408
Aroma Very sweet, with notes of butter, popcorn and honey; Slightly fruity
and notes of lactic acid (yogurt)
Flavour Malt flavour, without attenuation; Very sweet, with notes of fruits
and honey
Overall Impression
Very sweet, with no attenuation and hard to drink
S. cerevisiae US-05
Aroma Neutral aroma, with the presence of some esters, giving a slight
caramel aroma
Flavour Dry beer, slightly fruity and acidic
Overall Impression
Fresh and light beer, with a clean profile and easy to drink
H. opuntiae IST408 + S. cerevisiae US-05
(Sequential)
Aroma Attenuated malt, slightly citric aroma
Flavour Equilibrated flavour, light and fresh, with citric and slightly acidic
notes
Overall Impression
Pleasant beer
H. opuntiae IST408 + S. cerevisiae US-05
(Simultaneous)
Aroma Fruity, citric and slightly acid and vegetable aroma; Fresh
Flavour Well-attenuated beer, fruity and acidic; Dry
Overall Impression
Pleasant beer with good attenuation, well-equilibrated
44
The comparison between the sensory analysis notes and the volatile profile of the beers is done in the
discussion section.
4.4. Population dynamics during single and mixed culture fermentations of H. opuntiae
IST408 and S. cerevisiae US-05
The study of population dynamics was conducted in order to know how cell populations of the two yeast
species behave and interact in mixed culture fermentations. Since these studies were performed in
small-scale conditions, different from those described before for beer production, single and mixed
culture fermentations of H. opuntiae IST408 and S. cerevisiae US-05 were also monitored by
periodically weighting the vials and plotting the decrease of mass over time, and measuring sugar and
ethanol concentrations, as described previously.
Each fermentation comprised seven vials (one for each time point) and each of these vials was weighted
before acquiring samples for CFUs counting and determination of sugars and ethanol concentrations.
Since the vials were discarded after sample acquisition, the plots presented in Figure 12 were generated
with the weight measurements of vials corresponding to the last time point.
Figure 12 – (A) – Fermentation progress of single and mixed culture fermentations of H. opuntiae IST408 and S. cerevisiae US-
05 fermentations performed for population dynamics studies. Orange dots correspond to H. opuntiae IST408 single culture
fermentation, blue dots correspond to S. cerevisiae US-05 single culture fermentation, yellow dots correspond to sequential
fermentation and grey dots correspond to simultaneous fermentation. The growth curves shown are the result of three
independent experiments that gave rise to the same results. (B) – Fermentation progress of H. opuntiae IST408 single culture
fermentation, with a more appropriate scale.
As expected, the weight loss patterns for each fermentation observed in Figure 12 are similar to those
described in section 4.3.1 (Figure 7), as well as the profiles for sugar consumption and ethanol
production across the four fermentations (Figure 8). This means that these small-scale fermentations
mimic the beer fermentations described before, but this analysis has the advantage of being more
detailed since more time points were taken during primary fermentation, allowing the observation of the
evolution of sugar consumption and ethanol production.
0,0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
0 50 100 150 200 250 300 350
Wei
ght
loss
(g)
Time (h)
All fermentationsA
0,00
0,02
0,04
0,06
0,08
0,10
0 50 100 150 200 250 300 350
Wei
ght
loss
(g)
Time (h)
IST408B
45
Regarding ethanol production (Figure 13), it is possible to observe that H. opuntiae IST408 fermentation
reaches 0.44% (v/v) after 24 hours and this value remains constant during the rest of fermentation,
whereas ethanol concentration is higher in the fermentations where S. cerevisiae US-05 is present. The
ethanol production profile is very similar in the case of S. cerevisiae US-05 single culture and
simultaneous fermentations, reaching a final concentration of 3.70% (v/v) and 3.45% (v/v), respectively.
In the case of the sequential fermentation, during the first 48 hours, when H. opuntiae is the only species
present, the ethanol production is similar to H. opuntiae IST408 single culture fermentation. After the
addition of S. cerevisiae US-05 to the sequential fermentation, an increase in ethanol production similar
to US-05 single culture fermentation is observed, reaching a final concentration of 3.40% (v/v), similar
to the simultaneous fermentation.
Regarding sugar consumption (Figure 13), H. opuntiae IST408 did not ferment maltose and maltotriose
but consumed glucose and fructose almost completely, whereas S. cerevisiae US-05 consumed all four
sugars almost entirely. The sugars consumption pattern for the simultaneous fermentation is similar to
the one observed for S. cerevisiae US-05 single culture fermentation. Finally, regarding the sequential
fermentation, during the first 48 hours, only glucose and fructose were fermented, with maltose and
maltotriose being consumed after the addition of S. cerevisiae US-05, but at a slower rate. The final
concentration for all sugars in each fermentation is similar to the one presented in section 4.3.1.
0 100 200 300 400
0
20
40
60
0
1
2
3
4
H. opuntiae IST408
Time (h)
Su
ga
r (g
/L)
Eth
an
ol (%
v/v
)
0 100 200 300 400
0
20
40
60
0
1
2
3
4
S. cerevisiae US-05
Time (h)
Su
ga
r (g
/L)
Eth
an
ol (%
v/v
)
Maltotriose
Maltose
Glucose
Fructose
Ethanol
0 100 200 300 400
0
20
40
60
0
1
2
3
4
Sequential
Time (h)
Su
ga
r (g
/L)
Eth
an
ol (%
v/v
)
0 100 200 300 400
0
20
40
60
0
1
2
3
4
Simultaneous
Time (h)
Su
ga
r (g
/L)
Eth
an
ol (%
v/v
)
Figure 13 – Sugars (maltose, maltotriose, fructose and glucose) and ethanol concentrations obtained during the fermentation
performed for the study of population dynamics in single (H. opuntiae IST408 and S. cerevisiae US-05) and mixed (sequential
and simultaneous) culture fermentations. Samples were periodically collected during 14 days.
46
The study of population dynamics was conducted by taking two samples from each fermentation vial:
one to assess CFUs in suspension and another to assess total CFUs. It is possible to distinguish
colonies of H. opuntiae IST408 and S. cerevisiae US-05 in WLN agar plates since the first forms big,
green colonies, whereas the second forms small, white colonies. In addition, to assess S. cerevisiae
CFUs in suspension samples from mixed fermentations were also plated in YNB + galactose agar
plates, since only S. cerevisiae can grow in this medium because H. opuntiae IST408 is not able to
consume this sugar. For each fermentation, CFUs over time were plotted, for either CFUs in suspension
and total CFUs, presented in Figures 14 and 15, respectively.
0 100 200 300 400
1×101
1×102
1×103
1×104
1×105
1×106
1×107
1×108
H. opuntiae IST408
Time (h)
CF
U/m
L
0 100 200 300 400
1×101
1×102
1×103
1×104
1×105
1×106
1×107
1×108
S. cerevisiae US-05
Time (h)
CF
U/m
L
0 100 200 300 400
1×101
1×102
1×103
1×104
1×105
1×106
1×107
1×108
Sequential
Time (h)
CF
U/m
L
0 100 200 300 400
1×101
1×102
1×103
1×104
1×105
1×106
1×107
1×108
Simultaneous
Time (h)
CF
U/m
L
Figure 14 – CFUs in suspension in single (H. opuntiae IST408 and S. cerevisiae US-05) and mixed (sequential and simultaneous)
culture fermentations. Full circles represent CFUs of H. opuntiae IST408 and full triangles represent CFUs of S. cerevisiae US-
05.
Regarding the CFUs/mL in suspension (Figure 14), it is possible to observe an increase in CFU/mL
during the first hours of H. opuntiae IST408 single culture (first two time points; increase of around 10-
fold), followed by a decrease to similar but slightly lower values of CFU/mL than the initial value. In the
case S. cerevisiae US-05 single culture fermentation, a very different behaviour can be observed, with
a rapid decrease to levels of around 103 CFU/mL in the first 100 hours, remaining stable during the rest
of fermentation. Regarding mixed culture fermentations, in the case of the sequential fermentation, the
behaviour shown by H. opuntiae IST408 during the first 48 hours (first three time points) is similar to
the one shown by IST408 single culture fermentation. After addition of S. cerevisiae US-05, a steady
decrease in H. opuntiae IST408 CFU/mL in suspension can be observed until the last time point,
although in the last time point the values of CFU/mL in suspension from H. opuntiae are still around ten
47
times higher than the values of CFU/mL for S. cerevisiae. The behaviour of S. cerevisiae US-05 in
suspension in the sequential fermentation is similar to its behaviour in single culture fermentation. In
the case of simultaneous fermentation, S. cerevisiae US-05 also shows a similar behaviour to the one
shown in its single culture fermentation, with the exception of two time points (the third and seventh).
In this fermentation, H. opuntiae IST408 shows a similar behaviour to the one shown in the sequential
fermentation, with the exception of the last time point.
0 100 200 300 400
1×105
1×106
1×107
1×108
H. opuntiae IST408
Time (h)
CF
U/m
L
0 100 200 300 400
1×105
1×106
1×107
1×108
S. cerevisiae US-05
Time (h)
CF
U/m
L
0 100 200 300 400
1×105
1×106
1×107
1×108
Sequential
Time (h)
CF
U/m
L
0 100 200 300 400
1×105
1×106
1×107
1×108
Simultaneous
Time (h)
CF
U/m
L
Figure 15 – Total CFUs in single (H. opuntiae IST408 and S. cerevisiae US-05) and mixed (sequential and simultaneous) culture
fermentations. Full circles represent CFUs of H. opuntiae IST408 and full triangles represent CFUs of S. cerevisiae US-05.
Regarding total CFU/mL (Figure 15) in H. opuntiae IST408 fermentation, we can observe that the
number of CFU/mL increases during the first 48 hours, but starts to decrease after this period and until
200 hours of fermentation. After 200 hours and until the end of fermentation, the number of CFU/mL
remains constant. In the case of S. cerevisiae US-05 fermentation, the number of CFU/mL also
increases in the first 48 hours of fermentation, although reaching lower levels than H. opuntiae IST408
in its single culture fermentation. After 48 hours of fermentation, the levels of S. cerevisiae CFU/mL
remain constant during the rest of the fermentation. Regarding the sequential fermentation, as it was
observed with the CFUs in suspension, during the first 48 hours, the increase of H. opuntiae IST408
total CFUs is similar to the one presented by this strain in its single culture fermentation. After addition
of S. cerevisiae US-05 to the fermentation broth, at 48 hours, a decrease in total CFUs of H. opuntiae
IST408 can be observed until the end of fermentation, reaching a level of total CFUs/mL lower than
total CFUs/mL of S. cerevisiae US-05. This strain, after being added to the fermentation, exhibits an
increase in total CFUs/mL, but not as pronounced as the increased observed in its single culture
48
fermentation and not as fast. After reaching the highest number of CFU/mL, S. cerevisiae US-05 viable
cells remain constant during the rest of the fermentation, overtaking H. opuntiae IST408 as the dominant
strain in terms of total CFU/mL in the last hours of fermentation. In the case of the simultaneous
fermentation, H. opuntiae IST408 exhibits a similar behaviour with the one presented in the sequential
fermentation, with the difference that it does not reach the same high values for total CFU/mL and it
reaches lower total CFU/mL in the end of fermentation. S. cerevisiae US-05 exhibits a similar behaviour
with the one it presented in its single culture fermentation and, similarly to H. opuntiae IST408, it does
not reach the same high levels for total CFU/mL in this fermentation. Remarkably, when comparing the
two mixed fermentations, it can be observed is that in the simultaneous fermentation, S. cerevisiae US-
05 becomes the dominant strain at around 200 hours, whereas in sequential fermentation is dominant
only after 300 hours of fermentation.
4.5. Deletion of ATF1, ATF2 and EAT1 genes in Saccharomyces cerevisiae by CRISPR-
Cas9 methodology
The objective of this molecular biology work was to delete three of the most important genes involved
in the production of acetate esters in S. cerevisiae, ATF1, ATF2 and EAT1, in order to obtain a mutant
strain to be used in future studies for the expression and functional characterization of homologous
genes from non-Saccharomyces strains capable of producing higher yields of acetate esters. All three
genes, ATF1, ATF2 and EAT1, code for alcohol acetyl transferases [129,131].
CRISPR-Cas9 methodology was used to produce the desired mutants. In order to obtain the desired
triple deletion mutant CEN.PK113-7D atf1Δ atf2Δ eat1Δ, single and double deletion mutants
(CEN.PK113-7D atf1Δ and CEN.PK113-7D atf1Δ atf2Δ, respectively) were sequentially obtained.
Single deletion of ATF2 and EAT1 was also performed to obtain CEN.PK113-7D atf2Δ and CEN.PK113-
7D eat1Δ. To confirm if the partial deletions were successfully done, the donor DNA utilized was
designed in a way to introduce (or remove, in the case of ATF1 partial deletion) a restriction site for a
specific restriction enzyme. With this approach, if mutation of the target DNA region occurred, a
restriction reaction performed with the appropriate enzyme would be positive (or negative in the case
of ATF1 partial deletion). The DNA sequence of each gene from positive candidates was sent to be
sequenced by Sanger sequencing and the sequence obtained was compared to the non-mutated DNA
sequence to confirm the partial deletion of the gene. The comparison between the non-mutated DNA
and the sequences obtained from Sanger sequencing are presented in Figure 16. The alignment of the
two DNA sequences shows that a partial deletion of the target gene occurred, which indicates that the
five mutants were successfully obtained. Considering that single, double and triple deletion mutants
were sequentially obtained, the alignments shown in Figure 16D and 16E correspond to the partial
deletion of ATF2 in atf1Δ background strain and EAT1 in atf1Δatf2Δ, respectively.
49
Figure 16 – Alignments between a portion of the target gene sequences obtained by Sanger sequencing and a portion of the
non-mutated target gene sequences; A) Alignment between the non-mutated ATF1 gene sequence and the mutated ATF1 gene
sequence in CEN.PK113-7D atf1Δ; B) Alignment between the non-mutated ATF2 gene sequence and the mutated ATF2 gene
sequence in CEN.PK113-7D atf2Δ; C) Alignment between the non-mutated EAT1 gene sequence and the mutated EAT1 gene
sequence in CEN.PK113-7D eat1Δ; D) Alignment between the non-mutated ATF2 gene sequence and the mutated ATF2 gene
sequence in CEN.PK113-7D atf1Δ atf2Δ; E) Alignment between the non-mutated EAT1 gene sequence and the mutated EAT1
gene in CEN.PK113-7D atf1Δ atf2Δ eat1Δ.
A
B
E
D
C
50
51
5. Discussion
The main goal of this thesis work was the isolation and identification of non-Saccharomyces species
and the evaluation of their potential for the enhancement of the aromatic profile of beer when used in
co-fermentation with a Saccharomyces cerevisiae strain. This study started with the isolation and
identification of microorganisms from a variety of samples of different origins. A total of three different
wine production samples were collected, with two being wine must samples from the same production,
collected at different stages (Mst and Bar), and one being a wine sample (SarB), as well as a
contaminated beer batch sample (CCIST). From the non-vinous sample (CCIST), only one species was
isolated, being identified as Pichia kudriavzevii. This species is considered a spoilage yeast in beer
fermentation and causes biofilms in low pH products [60], which is consistent with the origin of the
CCIST sample. From SarB, only two species were isolated, Clavispora lusitaniae and Candida
intermedia. Since this wine sample was taken quite some time after the wine was produced, a low
biodiversity is expected since only a few species can tolerate the final ethanol concentrations in wine
[28,102,105]. The presence of these species in wine is not common, although they have been isolated
from other fermented beverages [154,155]. Regarding the remaining samples, Mst and Bar, S.
cerevisiae was isolated, as expected, since it is the major contributor in wine fermentation [28]. Yeasts
from the Metschnikowia, Pichia and Hanseniaspora genera were also isolated. The presence of species
from these genera is very common in wine fermentation, mainly in the first stages of fermentations
[28,48,93]. Particularly, Hanseniaspora uvarum and Pichia kluyveri are some of the predominant
species present in the surface of grape berries, which contributes to their presence in high numbers in
the earlier stages of wine fermentation [28]. Candida humilis and Starmerella bacillaris were also
isolated from these samples and these species are also commonly found in wine fermentations
[156,157].
Since some of the non-Saccharomyces species that produce a wide variety of flavour and aroma active
compounds are Hanseniaspora species [89,90,97], strains from this genus (isolated in this work or that
were present in the IST Yeast Culture Collection) were selected to undergo a screening to assess which
ones produced an interesting flavour and aromatic profile in beer. From the four tested strains, H.
opuntiae IST408 was considered the most interesting as its fermentation product was characterized as
having a caramel aroma and sweet taste. Our results demonstrated that H. opuntiae IST408 does not
ferment the two most abundant sugars in beer wort, maltose and maltotriose, which results in low
alcohol concentrations and a very sweet beverage. In order to use this strain in beer production, a mixed
fermentation with inoculation of a S. cerevisiae strain was the strategy planned to be tested. This
approach allowed the fermentation of maltose and maltotriose, leading to a complete fermentation.
SafAle™ US-05 was selected as the S. cerevisiae strain to be used due to its capability of producing a
dry beer, with a neutral aroma, which allows the aroma active compounds produced by H. opuntiae
IST408 to stand out in the final product. This commercial yeast strain has been utilised in other studies
where mixed fermentation of a non-Saccharomyces strains with a S. cerevisiae strain was performed,
as it is the case of the work of Canonico et al. (2019), where three non-Saccharomyces species
52
(Lachancea thermotolerans, Wickerhamomyces anomalus and Zygotorulaspora florentina) where
tested in mixed fermentations with US-05.
Single and mixed culture fermentations of S. cerevisiae US-05 and H. opuntiae IST408 were monitored
by plotting the weight loss of the fermentation flasks over time. This approach is based on the fact that,
since ethanol and carbon dioxide are produced in the same molar proportions during fermentation, and
the latter diffuses out of the flask, it is possible to monitor ethanol production by weighting the flasks.
This assumption was adequate since the fermentations that presented higher weight loss were also
found to exhibit higher sugar consumption and ethanol production. H. opuntiae IST408 single culture
fermentations presented the lowest production of ethanol, which arises from the fact that this strain
does not consume maltose and maltotriose. In fact, this study demonstrates that in single culture
fermentations, H. opuntiae IST408 consume almost all glucose and fructose in the first 48 hours, which
led to an increase of around 10-fold in total CFUs of H. opuntiae IST408 during this time. After this
period, a decrease in the concentration of H. opuntiae IST408 viable cells was observed, which could
be linked to nutrient limitation, since only maltose and maltotriose are available in the fermentation
medium. When comparing the sugar consumption after primary fermentation, the simultaneous
fermentations presented a slightly higher concentration of residual sugars, mainly maltose and
maltotriose, than S. cerevisiae US-05 single culture fermentation. As observed in the population
dynamics studies, S. cerevisiae US-05 was present in higher concentrations during fermentation in its
single culture fermentation than in the simultaneous fermentation, which may explain the difference in
residual sugars observed. Although US-05 single culture fermentation presents a slightly higher total
weight loss value, ethanol production is higher in the simultaneous fermentation. The weight loss pattern
presented by the sequential fermentation is a mix between the patterns presented by both H. opuntiae
and S. cerevisiae single culture fermentations. However, the final weight loss of the sequential
fermentation is lower than the other two fermentations where S. cerevisiae US-05 is present. This can
be correlated to the fact that the concentration of residual sugars, mainly maltose and maltotriose, was
higher in the sequential fermentation, although the ethanol concentration after primary fermentation
was similar to the simultaneous fermentation. As it can be observed in the population dynamics studies,
when S. cerevisiae US-05 was added to the sequential fermentation, glucose and fructose had already
been consumed by H. opuntiae and maltose and maltotriose were the only sugars available. This
contrasts with S. cerevisiae single culture and simultaneous fermentation where S. cerevisiae can
readily use glucose and fructose. This evidence might explain why S. cerevisiae US-05 concentration
in the sequential fermentation is much lower than in US-05 single culture fermentation (around 10 times
lower), which in turn can explain this difference in residual sugar concentration. Both H. opuntiae IST408
and S. cerevisiae US-05 present different fermentative capabilities, mainly in beer wort, since members
of the Hanseniaspora genus do not ferment maltose and maltotriose due to the fact that they not
possess transporters for these sugars [91]. On the other hand, S. cerevisiae strains are particularly
adapted to beer fermentation since they possess membrane transporters for the principal sugars
present in beer wort (maltose, maltotriose, glucose and fructose) and are capable of fermenting them
[5].
53
While S. cerevisiae US-05 presents a similar behaviour after consuming all fermentable sugars in all
fermentations where it is present, a much different behaviour can be observed for H. opuntiae IST408,
where a decrease to lower levels than the initial concentration occur in mixed fermentations, which may
be related with ethanol production by S. cerevisiae US-05. In H. opuntiae IST408 single culture
fermentations, ethanol concentration reached 0.44% (v/v), whereas in the mixed fermentations it
reached a concentration of around 3.40% (v/v). Comparing the CFUs and the ethanol concentration
over time, it can be observed that this much steeper decrease of H. opuntiae IST408 begins when
ethanol concentration reaches a range between 2-3% (v/v). A similar situation can be observed in wine
fermentation where, in the first stages, Hanseniaspora species are the dominant yeasts, but their
presence diminishes throughout fermentation, with S. cerevisiae becoming the dominant species [104].
Although ethanol might have an important role regarding the decrease in H. opuntiae it has been
demonstrated that in S. cerevisiae and H. guilliermondii mixed culture wine fermentations, the former
species accumulates antimicrobial peptides on its cell surface that cause death of the H. guilliermondii
cells upon cell-cell contacts [91,158].
When comparing the values of total CFUs and CFUs in suspension in single culture fermentations, 42%
of the total cells were deposited in the bottom of the vial in H. opuntiae IST408 single culture
fermentation, whereas in S. cerevisiae US-05 single culture fermentation 99.95% of the total cells were
deposited in the bottom of the vial. According to the manufacturer’s commercial sheet, S. cerevisiae
US-05 has a moderate sedimentation but in our experimental conditions, sedimentation of cells was
high. In mixed fermentations, H. opuntiae IST408 presents a deposition of 99.2% of total cells in the
sequential fermentation and a deposition of 96.8% if total cells in the simultaneous fermentation. This
increase in sedimentation might occur due to H. opuntiae IST408 cells becoming trapped in the middle
of S. cerevisiae US-05 aggregates and being pushed down by these aggregates. In the case of US-05,
it presents in mixed fermentations a sedimentation level similar to its single culture fermentation and,
therefore, its sedimentation is not affected by the presence of H. opuntiae cells. Our results demonstrate
that in the mixed fermentations the majority of the cells that will be transferred to the bottle are H.
opuntiae IST408 cells. Nevertheless, only a small part of H. opuntiae and S. cerevisiae total cells will
be transferred to the bottles, since mixed fermentations have high sedimentation levels.
After primary and secondary fermentation, the pH level was measured and a decrease was observed
across all four fermentations. The decrease in pH is associated with the fermentative capacity of each
strains, which is associated with the production of certain metabolites, in particular organic acids [13].
The decrease in pH after primary fermentation was higher for fermentations where S. cerevisiae US-05
is present, with the mixed fermentations exhibiting a lower final pH value than the single culture
fermentation. These values are in accordance with GC-MS results obtained, where the relative
abundance of total organic acids after primary fermentation is much higher in fermentations in which S.
cerevisiae US-05 is involved. After secondary fermentation, an additional decrease in pH was observed,
with H. opuntiae IST408 single culture fermentation still presenting the highest pH value. However, in
this situation, the decrease in pH is higher for this fermentation, minimizing its pH difference to the other
three fermentations. This variation is also in agreement with the GC-MS results, since the relative
54
abundance of total organic acids in the fermentations where US-05 was present is similar between
primary and secondary fermentations, whereas an increase in relative abundance of total organic acids
regarding H. opuntiae IST408 single culture fermentation was observed. Although an increase occurs,
the relative abundance of total organic acids is still lower in IST408 fermentation than in the remaining
fermentations.
Volatile compound analysis of single and mixed culture fermentations was performed by GC-MS.
Across all four fermentations, four chemical groups (acetate esters, ethyl esters, higher alcohols and
organic acids) exhibited the highest relative abundance when compared to other chemical groups.
Higher alcohols are the most abundant organoleptic compounds present in beer, with esters being
present in trace amounts when compared with other yeast metabolites [78]. However, volatile esters
are the most important aroma elements produced by yeast, due to their very low odour threshold in
beer, which confers them an important role in defining the aroma profile [12,20,78]. In the results
obtained for the volatile analysis, higher alcohols was the chemical group with the higher relative
abundance, followed by the acetate and ethyl esters chemical groups. However, these chemical groups
were not present in trace amounts, as mentioned above, and if we group both acetate esters and ethyl
esters in one more general group, esters, their relative abundance is almost similar to the relative
abundance of higher alcohols. When comparing the production of volatile compounds by H. opuntiae
IST408 and S. cerevisiae US-05, we found that similar quantities of total acetate esters and organic
acids were produced, but strain US-05 presented a higher production of total ethyl esters and higher
alcohols. Accordingly, a higher relative abundance regarding total acetate esters and organic acids was
observed when comparing mixed fermentations with US-05 single culture fermentation, which suggests
a synergistic effect between H. opuntiae IST408 and S. cerevisiae US-05. Synergistic effects between
H. guilliermondii, which is genetically closely related to H. opuntiae [91,159,160], and S. cerevisiae
strains were previously described [91,101]. Moreover, differences detected in the aroma profiles of the
wines obtained by mixed culture fermentations were correlated with the changes observed in the
transcript profiles of S. cerevisiae genes involved in the production of the aroma compounds identified
in mixed culture fermentations and attributable to the presence of H. guilliermondii [91,101].
Regarding the organoleptic evaluation of the produced beers, although isoamyl acetate (banana aroma
[41,78]) was present in all four fermentations, the expert panel did not describe any of the beers as
having banana aroma, which may indicate that this compound might be present in a concentration
below its sensorial threshold (1.2-2 mg/L) [78]. Absolute quantification of the identified compounds by
GC-MS was not performed, so conclusions regarding their presence in values above or below their
sensorial threshold may only be drawn from the sensory analysis notes, which constitutes a limitation
of this study. The expert panel described beers produced by fermentations where H. opuntiae IST408
was present as having a fruity aroma, characteristic of ethyl acetate [41,78], that indeed, has higher
relative abundance in these fermentations than in US-05 single culture fermentation. This may indicate
that in beers produced by fermentations where H. opuntiae IST408 was present, ethyl acetate could be
present in higher concentrations than its sensorial threshold (25-30 mg/L) [41,78]. Phenethyl acetate
(floral, rose, honey, sweet aroma [41,78]) appears to influence more the aroma profile of the single
55
culture fermentations, in which their aroma was characterized using descriptors that can be associated
to this ester, as it is the case of honey (identified in H. opuntiae IST408) and sweet (identified in S.
cerevisiae US-05). Although phenethyl acetate exhibits the lowest relative abundance among the three
highlighted acetate esters, this ester has a sensorial threshold of 0.2-3.8 mg/L [41,78], which might
explain why it could influence the aromatic profile of the beers.
Regarding the ethyl esters, ethyl octanoate (apple, aniseed) [41,78,161] exhibits the higher relative
abundance in fermentations where S. cerevisiae US-05 was present and a much lower relative
abundance in H. opuntiae IST408 single culture fermentation. This ethyl ester presents a sensorial
threshold of 0.9-1.0 mg/L [41,78] and, apparently, did not influence the aroma profile of the beers. The
ethyl esters that had higher relative abundance in IST408 single culture fermentations were ethyl
decanoate (sweet, fruity, grapefruit, apple aroma [161]) and ethyl dodecanoate (sweet, soapy and waxy
aroma [161]), which presented similar and lower relative abundance, respectively, in fermentations
where US-05 is involved. Both ethyl esters might have influenced the aroma profile of the beers
produced by IST408 single culture fermentation, since both can confer a sweet aroma to the beer.
Regarding fermentations where S. cerevisiae US-05 is present, ethyl decanoate might have a more
important role than ethyl dodecanoate, since the aroma profile of these beers was characterized using
some of the aroma descriptors associated to this ethyl ester, like sweet (in the case of US-05 single
culture fermentation) or fruity (in the case of the simultaneous fermentation). Other ethyl ester that
presented a high relative abundance, mainly in fermentations where S. cerevisiae US-05 is present, is
ethyl hexanoate (apple, fruity and pineapple aroma [41,78,161]), which might have influenced over the
aroma profile of the beers produced by the simultaneous fermentations, since aromatic descriptors like
fruity were used to characterize these beers.
The abundance of ethyl esters in beer is highly influenced by their precursors availability, which are
medium chain fatty acids [127]. Other factor that can influence the abundance of ethyl esters in beer is
their diffusion across the membrane, since these compounds are liposoluble. The transfer of ethyl
esters to the fermenting medium decreases drastically with the increase of chain length, from 100% for
ethyl hexanoate, to 54%-68% for ethyl octanoate and 8%-17% for ethyl decanoate [127,128]. Octanoic
acid, the precursor of ethyl octanoate (the most abundant ethyl ester), was the fatty acid that presented
the highest relative abundance in all fermentations. Regarding hexanoic, nonanoic and decanoic acids,
which are precursors of ethyl hexanoate, ethyl nonaoate and ethyl decanoate, respectively, differences
in their relative abundance across all fermentations were in accordance to what was observed regarding
the ethyl ester of which they are a precursor. The only exception is nonanoic acid, which was present
in H. opuntiae IST408 single culture fermentation, but not ethyl nonanoate. The aroma descriptors
associated with these fatty acids are cheesy and rancid [161] and since none of the beers were
described as having this aroma, we can suggest that they were present in concentrations below their
sensorial threshold.
Besides medium chain fatty acids, the other detected organic acid was acetic acid, which is the
precursor of ethyl acetate [162,163]. Relative abundance of acetic acid in H. opuntiae IST408 single
culture fermentations was higher than in S. cerevisiae US-05 single culture fermentations, similarly to
56
the relative abundance of acetate ester in these two fermentations. The relative abundance of acetic
acid was similar in both mixed fermentations, which is in agreement with the relative abundance of ethyl
acetate in these fermentations, but was higher than the relative abundance in IST408 single culture
fermentation, which was not observed in the case of ethyl acetate. The presence of acetic acid in all
four beers might contribute to the acidic flavour that the beers presented, with the exception of the beers
produced by H. opuntiae IST408 single culture fermentation. Since IST408 is unable to ferment maltose
and maltotriose, the beers produced by H. opuntiae IST408 present higher concentration of residual
sugars (observed in the HPLC analysis) and, consequently, their sweet flavour can mask their acidity.
The higher alcohols present with the highest relative abundance were isobutanol, isoamyl alcohol and
phenethyl alcohol. Isobutanol (solvent aroma [78,161]) has a relatively high sensorial threshold (100
mg/L) [78], which might explain why it did not contribute to the aroma profile of the beers. Phenethyl
alcohol (roses, honey aroma [78,161]) and isoamyl alcohol (banana aroma [78,161]), the precursors of
phenethyl acetate and isoamyl acetate, respectively, presented a similar relative abundance in the
fermentations where S. cerevisiae US-05 is involved, with a much lower relative abundance in H.
opuntiae IST408 single culture fermentation. These observations are in accordance with the relative
abundances observed for the acetate ester of which these alcohols are a precursor. Although isoamyl
alcohol and phenethyl alcohol have the same aroma descriptors as their acetate ester counterparts, the
sensorial thresholds for these higher alcohols are much higher (50-65 mg/L for isoamyl alcohol and 40
mg/L for phenethyl alcohol [78]). Like it was observed for isoamyl acetate, since none of the beers
presented a banana aroma, isoamyl alcohol concentration appears to be lower than its sensorial
threshold. In the case of phenethyl alcohol, it may also contribute for the aroma profile of beers where
phenethyl acetate appears to have a significant role. One reason that may explain why H. opuntiae
IST408 single culture fermentations present a much lower relative abundance of higher alcohols is the
fact that this yeast does not possess aryl-alcohol dehydrogenases, which are enzymes responsible for
the synthesis of higher alcohols from aldehydes [91].
A chemical group that might have influenced the aroma profile of the beers but was not present with
one of the highest relative abundances is the terpenes. From this group, β-citronellol and linalool were
identified and the aroma descriptors associated with these compounds are citric and floral aroma
[16,146], with the former being used by the expert panel to describe the aroma of the beers produced
by mixed fermentation. The precursor of these compounds, geraniol, is present in the essential oils of
hops, and can be metabolized into β-citronellol and linalool, in a metabolic cascade [16,146]. Although
these compounds present a very low olfactory threshold (8 µg/L for β-citronellol and 5 µg/L for linalool),
citric aroma was only described for the mixed fermentations, even though they are present in similar
relative abundances in beers produced by S. cerevisiae US-05 fermentation. This can indicate that the
citric aroma may arise due to a conjugation of different volatile compounds in the mixed fermentations
[57], or as a result of the presence of a volatile compound that was not identified in the GC-MS spectra,
possibly due to its retention time being similar to other more abundant compounds, which could have
masked the peak of this unidentified compound.
57
It is important to point out that only two replicates were analysed by GC-MS, which resulted in the
relative quantification of some compounds having a relatively high standard deviation, which affected
the statistical analysis to determine if differences between fermentations were significantly relevant.
This is particularly important in the case of ethyl esters, because these compounds are very volatile,
presumably leading to a big difference between replicates.
Taking into consideration the evaluation of the expert panel and the volatile profile of the beers
produced, we can say that performing mixed fermentation of S. cerevisiae US-05 with H. opuntiae
IST408 leads to the improvement of the organoleptic profile of the final product. Higher relative
abundance of acetate esters and organic acids was obtained, which contributed to a more complex
aroma and flavour profile. Regarding both mixed fermentations, the expert panel preferred the beers
produced by the simultaneous fermentation to those that were produced by sequential fermentation,
because it was considered to present a more complex aroma and more prominent fruity and acidic
flavour notes.
As mentioned before, acetate esters are one of the most important chemical groups in regards to the
aroma profile of beer, conferring fruity and floral aromas to this beverage [16,44,132]. Among the
acetate esters, ethyl acetate is one of the most important aroma compound in fermented foods, but its
chemical relevance goes beyond being a flavour-active compound. Ethyl acetate is also a valuable
bulk chemical, industrially produced from petrochemical resources, that can be used as a chemical
solvent and applied in the synthesis of biodiesels paints, adhesives, herbicides and resins [17,131].
Although S. cerevisiae is capable of producing compounds from this group, some non-Saccharomyces
species produce acetate esters in higher concentrations [16,44]. In S. cerevisiae, ATF1, ATF2 and
EAT1 genes are responsible for the majority of the biosynthesis of acetate esters, mainly ethyl acetate
[131,164,165]. When this thesis work started, S. cerevisiae EAT1 deletion mutant and S. cerevisiae
ATF1 ATF2 double deletion mutant were described in the literature [17,129], but the triple deletion
mutant was not. Ethyl acetate production was reduced by 50% in both mutants [17,129,132], with
isoamyl acetate and phenethyl acetate production being reduced by 80% in the S. cerevisiae ATF1
ATF2 double deletion mutant [129,164]. In this thesis work, we aimed at the construction of the S.
cerevisiae triple deletion mutant, by partially eliminating the aforementioned genes in the genome of S.
cerevisiae CEN.PK 113-7D using CRISPR-Cas9 methodology. The desired triple deletion mutant,
CEN.PK113-7D atf1Δ atf2Δ eat1Δ, was successfully obtained, which was confirmed by the positive
results of the restriction assays and the DNA sequences obtained by Sanger sequencing. However,
during this thesis work, the triple deletion mutant was constructed and described by a different
laboratory [132]. In their work, Kruis et al. obtained a total of 14 CEN.PK2-1D disruption mutants,
including six single knockouts (atf1Δ, atf2Δ, eat1Δ, eht1Δ, eeb1Δ, imo32Δ) and 8 multiple disruption
mutants [132]. Their results showed that, contrary to what was expected, the triple mutant atf1Δ atf2Δ
eat1Δ still produced ethyl acetate and isoamyl acetate. The authors concluded that there are other
mechanisms producing ethyl acetate and isoamyl acetate in S. cerevisiae, which are not yet fully
elucidated. Besides constructing the aforementioned mutants in their work, Kruis et al. (2018) also
performed heterologous expression in CEN.PK2-1D of EAT1 homologous genes from different non-
58
Saccharomyces species, with some overexpression strains showing increased production of acetate
esters. Nevertheless, there are other non-Saccharomyces species capable of producing ethyl acetate
that have not been tested that could be interesting, such as Hanseniaspora guilliermondii [91]. It should
be also noted that there is a high variability regarding acetate esters production within each species,
with certain strains producing higher quantities of acetate esters than others [13]. The work developed
in this thesis is a starting point for the exploration of ethyl acetate production in yeasts. In specific, the
triple deletion mutant, CEN.PK113-7D atf1Δ atf2Δ eat1Δ, will be very useful in future studies for the
functional characterization of ATF1, ATF2 and EAT1 homologous genes from non-Saccharomyces
species that present a high yield of acetate esters production.
59
6. Concluding remarks and future perspectives
The recent increase in craft beer popularity and the emergence of new craft breweries has led to more
experimentation in the craft beer industry, in a way to produce beers with complex organoleptic profiles
[8,9]. One of the approaches taken is the use of non-Saccharomyces species as starters, which are not
commonly used in beer production, to obtain a final product with distinct aroma and flavour profiles
[6,8,13]. In this work, the potential of Hanseniaspora opuntiae IST408 to enhance the organoleptic
profile of beer was assessed. Fermentation of beer wort with this strain yielded a final product with low
ethanol concentration and high sugar concentration, because this species only ferments glucose and
fructose, leaving maltose and maltotriose in the medium, which resulted in a beer that is very sweet and
hard to drink. Nevertheless, H. opuntiae IST408 shows promise in the production of fermented
beverages with low alcohol content, although special attention should be taken to the sugar composition
of the fermentative medium, in order to avoid the production of an overly sweet beverage. In regards to
its potential for beer production, mixed culture fermentations with Saccharomyces cerevisiae US-05
were performed. The beers produced by co-fermentation presented an improved organoleptic profile
when compared with beers produced by S. cerevisiae US-05 single culture fermentation, in particular
the beers produced by simultaneous inoculation of both H. opuntiae IST408 and S. cerevisiae US-05
that were considered the most pleasant.
Although positive results were obtained, it should be interesting to perform these fermentations with a
different set of conditions, such as varying the inoculation ratio between both species or changing the
temperature, which is one of the parameters that can affect the production of volatile compounds
[20,130]. In addition, since volatiles’ production is both species- and strain-specific [14,41,90], mixed
culture fermentations of S. cerevisiae US-05 with other strains of H. opuntiae or other non-
Saccharomyces species should also be investigated. For this, the isolation and identification of new
yeasts from different environments should be done, followed by the characterization of the volatile
esters produced by each isolate prior to beer fermentation.
The quantification of the volatile compounds by GC-MS is one aspect that can be improved in future
studies. Although the relative quantification was done in this thesis work, absolute quantification is
preferable and desired, since it allows to directly compare the concentration of the compound with its
sensorial threshold and understand if it influences the aroma profile of the beer.
In parallel with the co-fermentation studies, molecular biology work was performed in order to construct
a S. cerevisiae mutant in which the three main genes involved in the acetate ester biosynthesis are
eliminated. Acetate esters are important compounds regarding the aroma profile of beer [12,41]. Ethyl
acetate, in particular, is one of the most important aroma compounds in fermented beverages, while
also being a valuable bulk chemical in other industries [17]. Since this ester is produced industrially
from petrochemical resources, yeasts that produce high amounts of ethyl acetate can become an
important sustainable alternative to the production of this compound [18,165]. The desired triple deletion
mutant, CEN.PK113-7D atf1Δ atf2Δ eat1Δ, was successfully obtained, but the confirmation of the
60
acetate esters’ deficient production phenotype should be further investigated. If positive, the mutant
strain constructed in this thesis work will be useful in future studies for the functional characterization
of ATF1, ATF2 and EAT1 homologous genes from non-Saccharomyces species that present high
acetate ester production. To perform these studies, several different non-Saccharomyces species
should be screened for their acetate ester production in different media, in order to assess which
species could be of interest regarding the desired application.
61
7. References
[1] Arevalo-Villena M, Briones-Perez A, Corbo MR, Sinigaglia M, Bevilacqua A. Biotechnological
application of yeasts in food science: Starter cultures, probiotics and enzyme production. J Appl
Microbiol 2017;123:1360–72. https://doi.org/10.1111/jam.13548.
[2] Berbegal C, Spano G, Fragasso M, Grieco F, Russo P, Capozzi V. Starter cultures as biocontrol
strategy to prevent Brettanomyces bruxellensis proliferation in wine. Appl Microbiol Biotechnol
2018;102:569–76. https://doi.org/10.1007/s00253-017-8666-x.
[3] Spitaels F, Wieme AD, Janssens M, Aerts M, Daniel H, Van Landschoot A, et al. The Microbial
Diversity of Traditional Spontaneously Fermented Lambic Beer. PLoS One 2014;9:e95384.
https://doi.org/10.1371/journal.pone.0095384.
[4] Steensels J, Verstrepen KJ. Taming Wild Yeast : Potential of Conventional and Nonconventional
Yeasts in Industrial Fermentations. Annu Rev Microbiol 2014;68:61–80.
https://doi.org/10.1146/annurev-micro-091213-113025.
[5] Gallone B, Mertens S, Gordon JL, Maere S, Verstrepen KJ, Steensels J. Origins, evolution,
domestication and diversity of Saccharomyces beer yeasts. Curr Opin Biotechnol 2018;49:148–
55. https://doi.org/10.1016/j.copbio.2017.08.005.
[6] Basso RF, Alcarde AR. Could non-Saccharomyces yeasts contribute on innovative brewing
fermentations? Food Res Int 2016;86:112–20. https://doi.org/10.1016/j.foodres.2016.06.002.
[7] Marsit S, Dequin S. Diversity and adaptive evolution of Saccharomyces wine yeast : a review.
FEMS Yeast Res 2015;15:1–12. https://doi.org/10.1093/femsyr/fov067.
[8] Aquilani B, Laureti T, Poponi S, Secondi L. Beer choice and consumption determinants when
craft beers are tasted: An exploratory study of consumer preferences. Food Qual Prefer
2015;41:214–24. https://doi.org/10.1016/j.foodqual.2014.12.005.
[9] Elzinga KG, Tremblay CH, Tremblay VJ. Craft Beer in the United States: History, Numbers, and
Geography. J Wine Econ 2015;10:242–74. https://doi.org/10.1017/jwe.2015.22.
[10] Murray DW, O’Neill MA. Craft beer: Penetrating a niche market. Br Food J 2012;114:899–909.
https://doi.org/10.1108/00070701211241518.
[11] Bråtå HO. Local traditions as a means for commercial production of historical beers: The case
of Vossaøl, Norway. Nor Geogr Tidsskr 2017;71:301–12.
https://doi.org/10.1080/00291951.2017.1395909.
[12] Olaniran AO, Hiralal L, Mokoena MP, Pillay B. Flavour-active volatile compounds in beer:
production, regulation and control. J Inst Brew 2017;123:13–23. https://doi.org/10.1002/jib.389.
[13] Padilla B, Gil J V., Manzanares P. Past and Future of Non- Saccharomyces Yeasts : From
62
Spoilage Microorganisms to Biotechnological Tools for Improving Wine Aroma Complexity.
Front Microbiol 2016;7:411–31. https://doi.org/10.3389/fmicb.2016.00411.
[14] Michel M, Meier-Dörnberg T, Jacob F, Methner FJ, Wagner RS, Hutzler M. Review: Pure non-
Saccharomyces starter cultures for beer fermentation with a focus on secondary metabolites
and practical applications. J Inst Brew 2016;122:569–87. https://doi.org/10.1002/jib.381.
[15] Rijswijck IMH, Wolkers – Rooijackers JCM, Abee T, Smid EJ. Performance of non‐conventional
yeasts in co‐culture with brewers’ yeast for steering ethanol and aroma production. Microb
Biotechnol 2017;10:1591–602. https://doi.org/10.1111/1751-7915.12717.
[16] Holt S, Miks MH, de Carvalho BT, Foulquié-Moreno MR, Thevelein JM. The molecular biology
of fruity and floral aromas in beer and other alcoholic beverages. FEMS Microbiol Rev
2019;43:193–222. https://doi.org/10.1093/femsre/fuy041.
[17] Kruis AJ, Levisson M, Mars AE, van der Ploeg M, Garcés Daza F, Ellena V, et al. Ethyl acetate
production by the elusive alcohol acetyltransferase from yeast. Metab Eng 2017;41:92–101.
https://doi.org/10.1016/j.ymben.2017.03.004.
[18] Löser C, Urit T, Bley T. Perspectives for the biotechnological production of ethyl acetate by
yeasts. Appl Microbiol Biotechnol 2014;98:5397–415. https://doi.org/10.1007/s00253-014-5765-
9.
[19] Bokulich NA, Bamforth CW. The Microbiology of Malting and Brewing. Microbiol Mol Biol Rev
2013;77:157–72. https://doi.org/10.1128/mmbr.00060-12.
[20] Hiralal L, Olaniran AO, Pillay B. Aroma-active ester profile of ale beer produced under different
fermentation and nutritional conditions. J Biosci Bioeng 2014;117:57–64.
https://doi.org/10.1016/j.jbiosc.2013.06.002.
[21] Baker EC, Wang B, Bellora N, Peris D, Hulfachor AB, Koshalek JA, et al. The genome sequence
of Saccharomyces eubayanus and the domestication of lager-brewing yeasts. Mol Biol Evol
2015;32:2818–31. https://doi.org/10.1093/molbev/msv168.
[22] Libkind D, Hittinger CT, Valeŕio E, Gonca̧lves C, Dover J, Johnston M, et al. Microbe
domestication and the identification of the wild genetic stock of lager-brewing yeast. Proc Natl
Acad Sci U S A 2011;108:14539–44. https://doi.org/10.1073/pnas.1105430108.
[23] Van Oevelen D, Spaepen M, Timmermans P, Verachtert H. Microbiological Aspects of
Spontaneous Wort Fermentation in the Production of Lambic and Gueuze. J Inst Brew
1977;83:356–60. https://doi.org/10.1002/j.2050-0416.1977.tb03825.x.
[24] Crauwels S, Steensels J, Aerts G, Willems KA, Verstrepen KJ, Lievens B. Brettanomyces
bruxellensis, essential contributor in spontaneous beer fermentations providing novel
opportunities for the brewing industry. BrewingScience 2015;68:110–21.
[25] Gallone B, Steensels J, Prahl T, Soriaga L, Saels V, Herrera-Malaver B, et al. Domestication
63
and Divergence of Saccharomyces cerevisiae Beer Yeasts. Cell 2016;166:1397-1410.e16.
https://doi.org/10.1016/j.cell.2016.08.020.
[26] Stefanini I, Dapporto L, Berń L, Polsinelli M, Turillazzi S, Cavalieri D. Social wasps are a
Saccharomyces mating nest. Proc Natl Acad Sci U S A 2016;113:2247–51.
https://doi.org/10.1073/pnas.1516453113.
[27] Gonçalves M, Pontes A, Almeida P, Barbosa R, Serra M, Libkind D, et al. Distinct Domestication
Trajectories in Top-Fermenting Beer Yeasts and Wine Yeasts. Curr Biol 2016;26:2750–61.
https://doi.org/10.1016/j.cub.2016.08.040.
[28] Capozzi V, Garofalo C, Assunta M, Grieco F, Spano G. Microbial terroir and food innovation :
The case of yeast biodiversity in wine. Microbiol Res 2015;181:75–83.
https://doi.org/10.1016/j.micres.2015.10.005.
[29] Marsh AJ, Hill C, Ross RP, Cotter PD. Fermented beverages with potential : Past and future
perspectives. Trends Food Sci Technol 2014;38:113–24.
https://doi.org/10.1016/j.tifs.2014.05.002.
[30] Baschali A, Tsakalidou E, Kyriacou A, Karavasiloglou N, Matalas AL. Traditional low-alcoholic
and non-alcoholic fermented beverages consumed in European countries: A neglected food
group. Nutr Res Rev 2017;30:1–24. https://doi.org/10.1017/S0954422416000202.
[31] Kurtzman CP, Fell JW, Boekhout T. Summry of Species Characteristics. Yeasts a Taxon. Study,
Elsevier B.V.; 2011, p. 223–77. https://doi.org/10.1016/b978-0-444-52149-1.00165-8.
[32] Rodriguez J, Perez JA, Ruiz T, Rodriguez L. Characterization of the invertase from Pichia
anomala. Biochem J 1995;306:235–9. https://doi.org/10.1042/bj3060235.
[33] Walker GM. Pichia anomala: Cell physiology and biotechnology relative to other yeasts. Antonie
van Leeuwenhoek, Int J Gen Mol Microbiol 2011;99:25–34. https://doi.org/10.1007/s10482-010-
9491-8.
[34] Lee YJ, Choi YR, Lee SY, Park JT, Shim JH, Park KH, et al. Screening wild yeast strains for
alcohol fermentation from various fruits. Mycobiology 2011;39:33–9.
https://doi.org/10.4489/MYCO.2011.39.1.033.
[35] Fredlund E, Druvefors UÄ, Olstorpe MN, Passoth V, Schnürer J. Influence of ethyl acetate
production and ploidy on the anti-mould activity of Pichia anomala. FEMS Microbiol Lett
2004;238:133–7. https://doi.org/10.1016/j.femsle.2004.07.027.
[36] Passoth V, Fredlund E, Druvefors UÄ, Schnürer J. Biotechnology, physiology and genetics of
the yeast Pichia anomala. FEMS Yeast Res 2006;6:3–13. https://doi.org/10.1111/j.1567-
1364.2005.00004.x.
[37] Bajaj BK, Raina S, Singh S. Killer toxin from a novel killer yeast Pichia kudriavzevii RY55 with
idiosyncratic antibacterial activity. J Basic Microbiol 2012;52:1–11.
64
https://doi.org/10.1002/jobm.201200187.
[38] Belda I, Ruiz J, Alonso A, Marquina D, Santos A. The biology of pichia membranifaciens killer
toxins. Toxins (Basel) 2017;9. https://doi.org/10.3390/toxins9040112.
[39] Rojas V, Gil J V., Manzanares P, Gavara R, Piñaga F, Flors A. Measurement of alcohol
acetyltransferase and ester hydrolase activities in yeast extracts. Enzyme Microb Technol
2002;30:224–30. https://doi.org/10.1016/S0141-0229(01)00483-5.
[40] Yoshioka K, Hashimoto N. Ester Formation by Alcohol Acetyltransferase from Brewers’’
Yeast</i>. Agric Biol Chem 1981;45:2183–90. https://doi.org/10.1271/bbb1961.45.2183.
[41] Verstrepen KJ, Derdelinckx GUY, Dufour J, Winderickx J, Thevelein JM, Pretorius IS, et al.
Flavor active esters: Adding fruitiness to beer. J Biosci Bioeng 2003;96:1–9.
https://doi.org/10.1016/S1389-1723(03)90112-5.
[42] Bellut K, Michel M, Zarnkow M, Hutzler M, Jacob F, De Schutter DP, et al. Application of non-
Saccharomyces yeasts isolated from kombucha in the production of alcohol-free beer.
Fermentation 2018;4. https://doi.org/10.3390/fermentation4030066.
[43] Anfang N, Brajkovich M, Goddard MR. Co-fermentation with Pichia kluyveri increases varietal
thiol concentrations in Sauvignon Blanc. Aust J Grape Wine Res 2004;15:1–8.
https://doi.org/10.1111/j.1755-0238.2008.00031.x.
[44] Holt S, Mukherjee V, Lievens B, Verstrepen KJ, Thevelein JM. Bioflavoring by non-conventional
yeasts in sequential beer fermentations. Food Microbiol 2018;72:55–66.
https://doi.org/10.1016/j.fm.2017.11.008.
[45] Osburn K, Amaral J, Metcalf SR, Nickens DM, Rogers CM, Sausen C, et al. Primary souring: A
novel bacteria-free method for sour beer production. Food Microbiol 2018;70:76–84.
https://doi.org/10.1016/j.fm.2017.09.007.
[46] Canonico L, Galli E, Ciani E, Comitini F, Ciani M. Exploitation of Three Non-Conventional Yeast
Species in the Brewing Process. Microorganisms 2019;7:11.
https://doi.org/10.3390/microorganisms7010011.
[47] Barda NB, Rubio NC, Caballero AC. Selection and characterization of a Patagonian Pichia
kudriavzevii for wine deacidification. J Appl Microbiol 2014;117:451–64.
https://doi.org/10.1111/jam.12547.
[48] Jolly NP, Varela C, Pretorius IS. Not your ordinary yeast: non-Saccharomyces yeasts in wine
production uncovered. FEMS Yeast Res 2014;14:215–37. https://doi.org/10.1111/1567-
1364.12111.
[49] van Breda V, Jolly N, van Wyk J. Characterisation of commercial and natural Torulaspora
delbrueckii wine yeast strains. Int J Food Microbiol 2013;163:80–8.
https://doi.org/10.1016/j.ijfoodmicro.2013.02.011.
65
[50] Ciani M, Beco L, Comitini F. Fermentation behaviour and metabolic interactions of multistarter
wine yeast fermentations. Int J Food Microbiol 2006;108:239–45.
https://doi.org/10.1016/j.ijfoodmicro.2005.11.012.
[51] Tataridis P, Kanelis A, Logotetis S, Nerancis E. Use of non-saccharomyces Torulaspora
delbrueckii yeast strains in winemaking and brewing. Zb Matice Srp Za Prir Nauk 2013:415–26.
https://doi.org/10.2298/ZMSPN1324415T.
[52] Alves-Araujo C, Pacheco A, Almeida MJ, Spencer-Martins I, Leao C, Sousa MJ. Sugar utilization
patterns and respiro-fermentative metabolism in the baker’s yeast Torulaspora delbrueckii.
Microbiology 2007;153:898–904. https://doi.org/10.1099/mic.0.2006/003475-0.
[53] Bely M, Stoeckle P, Masneuf-Pomarède I, Dubourdieu D. Impact of mixed Torulaspora
delbrueckii–Saccharomyces cerevisiae culture on high-sugar fermentation. Int J Food Microbiol
2008;122:312–20. https://doi.org/10.1016/j.ijfoodmicro.2007.12.023.
[54] Hanl L, Sommer P, Arneborg N. The effect of decreasing oxygen feed rates on growth and
metabolism of Torulaspora delbrueckii. Appl Microbiol Biotechnol 2005;67:113–8.
https://doi.org/10.1007/s00253-004-1695-2.
[55] Salvadó Z, Arroyo-López FN, Guillamón JM, Salazar G, Querol A, Barrio E. Temperature
adaptation Markedly Determines evolution within the genus Saccharomyces. Appl Environ
Microbiol 2011;77:2292–302. https://doi.org/10.1128/AEM.01861-10.
[56] Michel M, Kopecká J, Meier-Dörnberg T, Zarnkow M, Jacob F, Hutzler M. Screening for new
brewing yeasts in the non- Saccharomyces sector with Torulaspora delbrueckii as model. Yeast
2016;33:129–44. https://doi.org/10.1002/yea.3146.
[57] Canonico L, Agarbati A, Comitini F, Ciani M. Torulaspora delbrueckii in the brewing process: A
new approach to enhance bioflavour and to reduce ethanol content. Food Microbiol 2016;56:45–
51. https://doi.org/10.1016/j.fm.2015.12.005.
[58] King A, Richard Dickinson J. Biotransformation of monoterpene alcohols by Saccharomyces
cerevisiae, Torulaspora delbrueckii and Kluyveromyces lactis. Yeast 2000;16:499–506.
https://doi.org/10.1002/(SICI)1097-0061(200004)16:6<499::AID-YEA548>3.0.CO;2-E.
[59] Steensels J, Daenen L, Malcorps P, Derdelinckx G, Verachtert H, Verstrepen KJ. Brettanomyces
yeasts - From spoilage organisms to valuable contributors to industrial fermentations. Int J Food
Microbiol 2015;206:24–38. https://doi.org/10.1016/j.ijfoodmicro.2015.04.005.
[60] Fleet GH. Yeast Spoilage of Foods and Beverages. Yeasts, A Taxon. Study, Elsevier B.V.; 2006,
p. 53–63. https://doi.org/10.1016/B978-0-444-52149-1.00005-7.
[61] Varela C, Borneman AR. Yeasts found in vineyards and wineries. Yeast 2017;34:111–28.
https://doi.org/10.1002/yea.3219.
[62] Schifferdecker AJ, Dashko S, Ishchuk OP, Piškur J. The wine and beer yeast Dekkera
66
bruxellensis. Yeast 2014;31:323–32. https://doi.org/10.1002/yea.3023.
[63] Barnett JA, Entian KD. A history of research on yeasts 9: Regulation of sugar metabolism. Yeast
2005;22:835–94. https://doi.org/10.1002/yea.1249.
[64] Barata A, Caldeira J, Botelheiro R, Pagliara D, Malfeito-Ferreira M, Loureiro V. Survival patterns
of Dekkera bruxellensis in wines and inhibitory effect of sulphur dioxide. Int J Food Microbiol
2008;121:201–7. https://doi.org/10.1016/j.ijfoodmicro.2007.11.020.
[65] De Deken RH. The Crabtree effect: a regulatory system in yeast. J Gen Microbiol 1966;44:149–
56. https://doi.org/10.1099/00221287-44-2-149.
[66] Rozpedowska E, Hellborg L, Ishchuk OP, Orhan F, Galafassi S, Merico A, et al. Parallel
evolution of the make-accumulate-consume strategy in Saccharomyces and Dekkera yeasts.
Nat Commun 2011;2. https://doi.org/10.1038/ncomms1305.
[67] Freer SN. Acetic acid production by Dekkera/Brettanomyces yeasts. World J Microbiol
Biotechnol 2002;18:271–5. https://doi.org/10.1023/A:1014927129259.
[68] Freer SN, Dien B, Matsuda S. Production of acetic acid by Dekkera/Brettanomyces yeasts under
conditions of constant pH. World J Microbiol Biotechnol 2003;19:101–5.
https://doi.org/10.1023/A:1022592810405.
[69] Blomqvist J, Eberhard T, Schnürer J, Passoth V. Fermentation characteristics of Dekkera
bruxellensis strains. Appl Microbiol Biotechnol 2010;87:1487–97.
https://doi.org/10.1007/s00253-010-2619-y.
[70] De Barros Pita W, Silva DC, Simões DA, Passoth V, De Morais MA. Physiology and gene
expression profiles of Dekkera bruxellensis in response to carbon and nitrogen availability.
Antonie van Leeuwenhoek, Int J Gen Mol Microbiol 2013;104:855–68.
https://doi.org/10.1007/s10482-013-9998-x.
[71] Blomqvist J, Passoth V. Dekkera bruxellensis-spoilage yeast with biotechnological potential, and
a model for yeast evolution, physiology and competitiveness. FEMS Yeast Res 2015;15:1–9.
https://doi.org/10.1093/femsyr/fov021.
[72] Kumara HMCS, De Cort S, Verachtert H. Localization and characterization of α-glucosidase
activity in Brettanomyces lambicus. Appl Environ Microbiol 1993;59:2352–8.
[73] Vanderhaegen B, Neven H, Coghe S, Verstrepen KJ, Derdelinckx G, Verachtert H. Bioflavoring
and beer refermentation. Appl Microbiol Biotechnol 2003;62:140–50.
https://doi.org/10.1007/s00253-003-1340-5.
[74] Daenen L, Saison D, Sterckx F, Delvaux FR, Verachtert H, Derdelinckx G. Screening and
evaluation of the glucoside hydrolase activity in Saccharomyces and Brettanomyces brewing
yeasts. J Appl Microbiol 2008;104:478–88. https://doi.org/10.1111/j.1365-2672.2007.03566.x.
67
[75] Winterhalter P, Skouroumounis GK. Glycoconjugated aroma compounds: Occurrence, role and
biotechnological transformation. In: Berger RG, Babel W, Blanch HW, Cooney CL, Enfors S-O,
Eriksson K-EL, et al., editors. Biotechnol. Aroma Compd., Berlin, Heidelberg: Springer Berlin
Heidelberg; 1997, p. 73–105. https://doi.org/10.1007/BFb0102063.
[76] Daenen L, Sterckx F, Delvaux FR, Verachtert H, Derdelinckx G. Evaluation of the glycoside
hydrolase activity of a Brettanomyces strain on glycosides from sour cherry (Prunus cerasus L.)
used in the production of special fruit beers. FEMS Yeast Res 2008;8:1103–14.
https://doi.org/10.1111/j.1567-1364.2008.00421.x.
[77] Fia G, Giovani G, Rosi I. Study of β-glucosidase production by wine-related yeasts during
alcoholic fermentation. A new rapid fluorimetric method to determine enzymatic activity. J Appl
Microbiol 2005;99:509–17. https://doi.org/10.1111/j.1365-2672.2005.02657.x.
[78] Pires EJ, Teixeira JA, Brányik T, Vicente AA. Yeast: The soul of beer’s aroma - A review of
flavour-active esters and higher alcohols produced by the brewing yeast. Appl Microbiol
Biotechnol 2014;98:1937–49. https://doi.org/10.1007/s00253-013-5470-0.
[79] Spaepen M, Verachtert H. Esterase activity in the genus Brettanomyces. J Inst Brew
1982;88:11–7. https://doi.org/10.1002/j.2050-0416.1982.tb04061.x.
[80] Spaepen M, Van Oevelen D, Verachtert H. Fatty acids and esters produced during the
spontaneous fermentation of lambic and gueuze. J Inst Brew 1978;84:278–82.
https://doi.org/10.1002/j.2050-0416.1978.tb03888.x.
[81] Oelofse A, Pretorius IS, du Toit M. Significance of Brettanomyces and Dekkera during
Winemaking: A Synoptic Review. South African J Enol Vitic 2016;29:128–44.
https://doi.org/10.21548/29-2-1445.
[82] Lentz M, Harris C. Analysis of Growth Inhibition and Metabolism of Hydroxycinnamic Acids by
Brewing and Spoilage Strains of Brettanomyces Yeast. Foods 2015;4:581–93.
https://doi.org/10.3390/foods4040581.
[83] Yu J, Vasanthan T, Temelli F. Analysis of phenolic acids in barley by high-performance liquid
chromatography. J Agric Food Chem 2001;49:4352–8. https://doi.org/10.1021/jf0013407.
[84] Vanbeneden N, Van Roey T, Willems F, Delvaux F, Delvaux FR. Release of phenolic flavour
precursors during wort production: Influence of process parameters and grist composition on
ferulic acid release during brewing. Food Chem 2008;111:83–91.
https://doi.org/10.1016/j.foodchem.2008.03.029.
[85] Vanbeneden N, Delvaux F, Delvaux FR. Determination of hydroxycinnamic acids and volatile
phenols in wort and beer by isocratic high-performance liquid chromatography using
electrochemical detection. J Chromatogr A 2006;1136:237–42.
https://doi.org/10.1016/j.chroma.2006.11.001.
68
[86] Vanbeneden N, Gils F, Delvaux F, Delvaux FR. Formation of 4-vinyl and 4-ethyl derivatives from
hydroxycinnamic acids: Occurrence of volatile phenolic flavour compounds in beer and
distribution of Pad1-activity among brewing yeasts. Food Chem 2008;107:221–30.
https://doi.org/10.1016/j.foodchem.2007.08.008.
[87] Gamero A, Quintilla R, Groenewald M, Alkema W, Boekhout T, Hazelwood L. High-throughput
screening of a large collection of non-conventional yeasts reveals their potential for aroma
formation in food fermentation. Food Microbiol 2016;60:147–59.
https://doi.org/10.1016/j.fm.2016.07.006.
[88] Tristezza M, Tufariello M, Capozzi V, Spano G, Mita G, Grieco F. The Oenological Potential of
Hanseniaspora uvarum in Simultaneous and Sequential Co-fermentation with Saccharomyces
cerevisiae for Industrial Wine Production. Front Microbiol 2016;7:1–14.
https://doi.org/10.3389/fmicb.2016.00670.
[89] Moreira N, Mendes F, Pinho PG De, Hogg T, Vasconcelos I. Heavy sulphur compounds , higher
alcohols and esters production profile of Hanseniaspora uvarum and Hanseniaspora
guilliermondii grown as pure and mixed cultures in grape must. Int J Food Microbiol
2008;124:231–8. https://doi.org/10.1016/j.ijfoodmicro.2008.03.025.
[90] Moreira N, Pina C, Mendes F, Couto JA, Hogg T, Vasconcelos I. Volatile compounds
contribution of Hanseniaspora guilliermondii and Hanseniaspora uvarum during red wine
vinifications. Food Control 2011;22:662–7. https://doi.org/10.1016/j.foodcont.2010.07.025.
[91] Seixas I, Barbosa C, Mendes-Faia A, Güldener U, Tenreiro R, Mendes-Ferreira A, et al. Genome
sequence of the non-conventional wine yeast Hanseniaspora guilliermondii UTAD222 unveils
relevant traits of this species and of the Hanseniaspora genus in the context of wine
fermentation. DNA Res 2019;26:67–83. https://doi.org/10.1093/dnares/dsy039.
[92] Wang C, García-Fernández D, Mas A, Esteve-Zarzoso B. Fungal diversity in grape must and
wine fermentation assessed by massive sequencing, quantitative PCR and DGGE. Front
Microbiol 2015;6:1–8. https://doi.org/10.3389/fmicb.2015.01156.
[93] Grangeteau C, Gerhards D, Rousseaux S, von Wallbrunn C, Alexandre H, Guilloux-Benatier M.
Diversity of yeast strains of the genus Hanseniaspora in the winery environment: What is their
involvement in grape must fermentation? Food Microbiol 2015;50:70–7.
https://doi.org/10.1016/j.fm.2015.03.009.
[94] Clavijo A, Calderón IL, Paneque P. Diversity of Saccharomyces and non-Saccharomyces yeasts
in three red grape varieties cultured in the Serranía de Ronda (Spain) vine-growing region. Int J
Food Microbiol 2010;143:241–5. https://doi.org/10.1016/j.ijfoodmicro.2010.08.010.
[95] Bataillon M, Rico A, Sablayrolles JM, Salmon JM, Barre P. Early thiamin assimilation by yeasts
under enological conditions: Impact on alcoholic fermentation kinetics. J Ferment Bioeng
1996;82:145–50. https://doi.org/10.1016/0922-338X(96)85037-9.
69
[96] Brion C, Ambroset C, Delobel P, Sanchez I, Blondin B. Deciphering regulatory variation of THI
genes in alcoholic fermentation indicate an impact of Thi3p on PDC1 expression. BMC
Genomics 2014;15:1–11. https://doi.org/10.1186/1471-2164-15-1085.
[97] Martin V, Valera M, Medina K, Boido E, Carrau F. Oenological Impact of the
Hanseniaspora/Kloeckera Yeast Genus on Wines—A Review. Fermentation 2018;4:76.
https://doi.org/10.3390/fermentation4030076.
[98] Contreras A, Hidalgo C, Henschke PA, Chambers PJ, Curtin C, Varela C. Evaluation of non-
Saccharomyces yeasts for the reduction of alcohol content in wine. Appl Environ Microbiol
2014;80:1670–8. https://doi.org/10.1128/AEM.03780-13.
[99] Ciani M, Morales P, Comitini F, Tronchoni J, Canonico L, Curiel JA, et al. Non-conventional
yeast species for lowering ethanol content of wines. Front Microbiol 2016;7:1–13.
https://doi.org/10.3389/fmicb.2016.00642.
[100] Pérez-Nevado F, Albergaria H, Hogg T, Girio F. Cellular death of two non-Saccharomyces wine-
related yeasts during mixed fermentations with Saccharomyces cerevisiae. Int J Food Microbiol
2006;108:336–45. https://doi.org/10.1016/j.ijfoodmicro.2005.12.012.
[101] Barbosa C, Mendes-Faia A, Lage P, Mira NP, Mendes-Ferreira A. Genomic expression program
of Saccharomyces cerevisiae along a mixed-culture wine fermentation with Hanseniaspora
guilliermondii. Microb Cell Fact 2015;14:1–17. https://doi.org/10.1186/s12934-015-0318-1.
[102] Branco P, Monteiro M, Moura P, Albergaria H. Survival rate of wine-related yeasts during
alcoholic fermentation assessed by direct live/dead staining combined with fluorescence in situ
hybridization. Int J Food Microbiol 2012;158:49–57.
https://doi.org/10.1016/j.ijfoodmicro.2012.06.020.
[103] Ciani M, Comitini F. Yeast interactions in multi-starter wine fermentation. Curr Opin Food Sci
2015;1:1–6. https://doi.org/10.1016/j.cofs.2014.07.001.
[104] Albergaria H, Arneborg N. Dominance of Saccharomyces cerevisiae in alcoholic fermentation
processes: role of physiological fitness and microbial interactions. Appl Microbiol Biotechnol
2016;100:2035–46. https://doi.org/10.1007/s00253-015-7255-0.
[105] Pina C, Santos C, Couto JA, Hogg T. Ethanol tolerance of five non-Saccharomyces wine yeasts
in comparison with a strain of Saccharomyces cerevisiae - Influence of different culture
conditions. Food Microbiol 2004;21:439–47. https://doi.org/10.1016/j.fm.2003.10.009.
[106] Hu K, Jin GJ, Mei WC, Li T, Tao YS. Increase of medium-chain fatty acid ethyl ester content in
mixed H. uvarum/S. cerevisiae fermentation leads to wine fruity aroma enhancement. Food
Chem 2018;239:495–501. https://doi.org/10.1016/j.foodchem.2017.06.151.
[107] Curiel JA, Morales P, Gonzalez R, Tronchoni J. Different non-Saccharomyces yeast species
stimulate nutrient consumption in S. cerevisiae mixed cultures. Front Microbiol 2017;8:1–9.
70
https://doi.org/10.3389/fmicb.2017.02121.
[108] Bourbon e Carvalho Melo N. <i>Isolation, identification and assessment of the potential of
Saccharomyces and non-Saccharomyces strains for craft beer production<i/>. 2018.
[109] Luan Y, Zhang BQ, Duan CQ, Yan GL. Effects of different pre-fermentation cold maceration time
on aroma compounds of Saccharomyces cerevisiae co-fermentation with Hanseniaspora
opuntiae or Pichia kudriavzevii. LWT - Food Sci Technol 2018;92:177–86.
https://doi.org/10.1016/j.lwt.2018.02.004.
[110] Lleixà J, Martín V, Portillo M del C, Carrau F, Beltran G, Mas A. Comparison of fermentation and
wines produced by inoculation of Hanseniaspora vineae and Saccharomyces cerevisiae. Front
Microbiol 2016;7:1–12. https://doi.org/10.3389/fmicb.2016.00338.
[111] Medina K, Boido E, Dellacassa E, Carrau F. Yeast interactions with anthocyanins during red
wine fermentation. Am J Enol Vitic 2005;56:104–9.
[112] Becker B, Schmitt MJ. Yeast killer toxin k28: Biology and unique strategy of host cell intoxication
and killing. Toxins (Basel) 2017;9:1–15. https://doi.org/10.3390/toxins9100333.
[113] Oka K, Hayashi T, Matsumoto N, Yanase H. Decrease in hydrogen sulfide content during the
final stage of beer fermentation due to involvement of yeast and not carbon dioxide gas purging.
J Biosci Bioeng 2008;106:253–7. https://doi.org/10.1263/jbb.106.253.
[114] Stewart G. The Production of Secondary Metabolites with Flavour Potential during Brewing and
Distilling Wort Fermentations. Fermentation 2017;3:63.
https://doi.org/10.3390/fermentation3040063.
[115] Hazelwood LA, Daran JM, Van Maris AJA, Pronk JT, Dickinson JR. The Ehrlich pathway for
fusel alcohol production: A century of research on Saccharomyces cerevisiae metabolism. Appl
Environ Microbiol 2008;74:2259–66. https://doi.org/10.1128/AEM.02625-07.
[116] Dickinson JR, Salgado LEJ, Hewlins MJE. The catabolism of amino acids to long chain and
complex alcohols in Saccharomyces cerevisiae. J Biol Chem 2003;278:8028–34.
https://doi.org/10.1074/jbc.M211914200.
[117] Picotti P, Clément-Ziza M, Lam H, Campbell DS, Schmidt A, Deutsch EW, et al. A complete
mass-spectrometric map of the yeast proteome applied to quantitative trait analysis. Nature
2013;494:266–70. https://doi.org/10.1038/nature11835.
[118] Iraqui I, Vissers S, André B, Urrestarazu A. Transcriptional Induction by Aromatic Amino Acids
in Saccharomyces cerevisiae. Mol Cell Biol 1999;19:3360–71.
https://doi.org/10.1128/mcb.19.5.3360.
[119] Eden A, Van Nedervelde L, Drukker M, Benvenisty N, Debourg A. Involvement of branched-
chain amino acid aminotransferases in the production of fusel alcohols during fermentation in
yeast. Appl Microbiol Biotechnol 2001;55:296–300. https://doi.org/10.1007/s002530000506.
71
[120] Romagnoli G, Luttik MAH, Kötter P, Pronk JT, Daran JM. Substrate specificity of thiamine
pyrophosphate-dependent 2-oxo-acid decarboxylases in Saccharomyces cerevisiae. Appl
Environ Microbiol 2012;78:7538–48. https://doi.org/10.1128/AEM.01675-12.
[121] Bolat I, Romagnoli G, Zhu F, Pronk JT, Daran JM. Functional analysis and transcriptional
regulation of two orthologs of ARO10, encoding broad-substrate-specificity 2-oxo-acid
decarboxylases, in the brewing yeast Saccharomyces pastorianus CBS1483. FEMS Yeast Res
2013;13:505–17. https://doi.org/10.1111/1567-1364.12051.
[122] Vuralhan Z, Morais MA, Tai SL, Piper MDW, Pronk JT. Identification and characterization of
phenylpyruvate decarboxylase genes in Saccharomyces cerevisiae. Appl Environ Microbiol
2003;69:4534–41. https://doi.org/10.1128/AEM.69.8.4534-4541.2003.
[123] Mojzita D, Hohmann S. Pdc2 coordinates expression of the THI regulon in the yeast
Saccharomyces cerevisiae. Mol Genet Genomics 2006;276:147–61.
https://doi.org/10.1007/s00438-006-0130-z.
[124] Chen Y, Siewers V, Nielsen J. Profiling of cytosolic and peroxisomal acetyl-CoA metabolism in
Saccharomyces cerevisiae. PLoS One 2012;7. https://doi.org/10.1371/journal.pone.0042475.
[125] Saison D, De Schutter DP, Uyttenhove B, Delvaux F, Delvaux FR. Contribution of staling
compounds to the aged flavour of lager beer by studying their flavour thresholds. Food Chem
2009;114:1206–15. https://doi.org/10.1016/j.foodchem.2008.10.078.
[126] Saerens SMG, Verbelen PJ, Vanbeneden N, Thevelein JM, Delvaux FR. Monitoring the
influence of high-gravity brewing and fermentation temperature on flavour formation by analysis
of gene expression levels in brewing yeast. Appl Microbiol Biotechnol 2008;80:1039–51.
https://doi.org/10.1007/s00253-008-1645-5.
[127] Saerens SMG, Delvaux FR, Verstrepen KJ, Thevelein JM. Production and biological function of
volatile esters in Saccharomyces cerevisiae. Microb Biotechnol 2010;3:165–77.
https://doi.org/10.1111/j.1751-7915.2009.00106.x.
[128] Nykänen L, Nykänen I. Production of Esters By Different Yeast Strains in Sugar Fermentations.
J Inst Brew 1977;83:30–1. https://doi.org/10.1002/j.2050-0416.1975.tb03787.x.
[129] Verstrepen KJ, Laere SDM Van, Vanderhaegen BMP, Derdelinckx G, Dufour J, Pretorius IS, et
al. Expression Levels of the Yeast Alcohol Acetyltransferase Genes ATF1 , Lg-ATF1 , and ATF2
Control the Formation of a Broad Range of Volatile Esters. Appl Environ Microbiol
2003;69:5228–37. https://doi.org/10.1128/AEM.69.9.5228.
[130] Molina AM, Swiegers JH, Varela C, Pretorius IS, Agosin E. Influence of wine fermentation
temperature on the synthesis of yeast-derived volatile aroma compounds. Appl Microbiol
Biotechnol 2007;77:675–87. https://doi.org/10.1007/s00253-007-1194-3.
[131] Kruis AJ, Mars AE, Kengen SWM, Borst JW, van der Oost J, Weusthuis RA. Alcohol
72
Acetyltransferase Eat1 Is Located in Yeast Mitochondria. Appl Environ Microbiol 2018;84:1–11.
https://doi.org/10.1128/AEM.01640-18.
[132] Kruis AJ, Gallone B, Jonker T, Mars AE, van Rijswijck IMH, Wolkers–Rooijackers JCM, et al.
Contribution of Eat1 and Other Alcohol Acyltransferases to Ester Production in Saccharomyces
cerevisiae. Front Microbiol 2018;9:1–11. https://doi.org/10.3389/fmicb.2018.03202.
[133] Saerens SMG, Verstrepen KJ, Van Laere SDM, Voet ARD, Van Dijck P, Delvaux FR, et al. The
Saccharomyces cerevisiae EHT1 and EEB1 genes encode novel enzymes with medium-chain
fatty acid ethyl ester synthesis and hydrolysis capacity. J Biol Chem 2006;281:4446–56.
https://doi.org/10.1074/jbc.M512028200.
[134] Saerens SMG, Delvaux F, Verstrepen KJ, Van Dijck P, Thevelein JM, Delvaux FR. Parameters
affecting ethyl ester production by Saccharomyces cerevisiae during fermentation. Appl Environ
Microbiol 2008;74:454–61. https://doi.org/10.1128/AEM.01616-07.
[135] Fukuda K, Yamamoto N, Kiyokawa Y, Yanagiuchi T, Wakai Y, Kitamoto K, et al. Balance of
activities of alcohol acetyltransferase and esterase in Saccharomyces cerevisiae is important
for production of isoamyl acetate. Appl Environ Microbiol 1998;64:4076–8.
[136] Lilly M, Bauer FF, Lambrechts MG, Swiegers JH, Cozzolino D, Pretorius IS. The effect of
increased yeast alcohol acetyltransferase and esterase activity on the flavour profiles of wine
and distillates. Yeast 2006;23:641–59. https://doi.org/10.1002/yea.1382.
[137] Bamforth CW. The non-Biological Instability of Beer. J Inst Brew 2011;117:488–97.
https://doi.org/10.1002/j.2050-0416.2011.tb00496.x.
[138] Kobayashi M, Shimizu H, Shioya S. Beer Volatile Compounds and Their Application to Low-Malt
Beer Fermentation. J Biosci Bioeng 2008;106:317–23. https://doi.org/10.1263/jbb.106.317.
[139] Krogerus K, Gibson BR. 125th anniversary review: Diacetyl and its control during brewery
fermentation. J Inst Brew 2013;119:86–97. https://doi.org/10.1002/jib.84.
[140] Lodolo EJ, Kock JLF, Axcell BC, Brooks M. The yeast Saccharomyces cerevisiae - The main
character in beer brewing. FEMS Yeast Res 2008;8:1018–36. https://doi.org/10.1111/j.1567-
1364.2008.00433.x.
[141] Whiting GC. Organic acid metabolism of yeasts during fermentation of alcoholic beverages - A
review. J Inst Brew 1976;82:84–92. https://doi.org/10.1002/j.2050-0416.1976.tb03731.x.
[142] Li H, Liu F. The chemistry of sour taste and the strategy to reduce the sour taste of beer. Food
Chem 2015;185:200–4. https://doi.org/10.1016/j.foodchem.2015.03.135.
[143] Li H, Liu F. Changes in organic acids during beer fermentation. J Am Soc Brew Chem
2015;73:275–9. https://doi.org/10.1094/ASBCJ-2015-0509-01.
[144] Mukai N, Masaki K, Fujii T, Kawamukai M, Iefuji H. PAD1 and FDC1 are essential for the
73
decarboxylation of phenylacrylic acids in Saccharomyces cerevisiae. J Biosci Bioeng
2010;109:564–9. https://doi.org/10.1016/j.jbiosc.2009.11.011.
[145] Godoy L, García V, Peña R, Martínez C, Ganga MA. Identification of the Dekkera bruxellensis
phenolic acid decarboxylase (PAD) gene responsible for wine spoilage. Food Control
2014;45:81–6. https://doi.org/10.1016/j.foodcont.2014.03.041.
[146] Takoi K, Itoga Y, Koie K, Kosugi T, Shimase M, Katayama Y, et al. The contribution of geraniol
metabolism to the citrus flavour of beer: Synergy of geraniol and β-citronellol under coexistence
with excess linalool. J Inst Brew 2010;116:251–60. https://doi.org/10.1002/j.2050-
0416.2010.tb00428.x.
[147] Kurtzman CP, Robnett CJ. Phylogenetic relationships among yeasts of the ‘ Saccharomyces
complex ’ determined from multigene sequence analyses. FEMS Yeast Res 2003;3:417–32.
https://doi.org/10.1016/S1567-1356(03)00012-6.
[148] White TJ, Bruns T, Lee S, Taylor J. Amplification and Direct Sequencing of Fungal Ribosomal
Rna Genes for Phylogenetics. PCR Protoc 1990:315–22. https://doi.org/10.1016/b978-0-12-
372180-8.50042-1.
[149] Dicarlo JE, Norville JE, Mali P, Rios X, Aach J, Church GM. Genome engineering in
Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res 2013;41:4336–43.
https://doi.org/10.1093/nar/gkt135.
[150] Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. Ezymatic assembly of
DNA molecules up to several hundred kilobases. Nat Methods 2009;6:343–5.
https://doi.org/10.1038/nmeth.1318.
[151] Hall JF. Detection of wild yeasts in the brewery. J Inst Brew 1971;77:513–6.
[152] Jespersen L, Jakobsen M. Specific spoilage organisms in breweries and laboratory media for
their detection. Int J Food Microbiol 1996;33:139–55. https://doi.org/10.1016/0168-
1605(96)01154-3.
[153] Preiss R, Tyrawa C, Krogerus K, Garshol LM, van der Merwe G. Traditional Norwegian Kveik
Are a Genetically Distinct Group of Domesticated Saccharomyces cerevisiae Brewing Yeasts.
Front Microbiol 2018;9. https://doi.org/10.3389/fmicb.2018.02137.
[154] Pérez-Brito D, Magaña-Alvarez A, Lappe-Oliveras P, Cortes-Velazquez A, Torres-Calzada C,
Herrera-Suarez T, et al. Genetic diversity of Clavispora lusitaniae isolated from Agave
fourcroydes Lem, as revealed by DNA fingerprinting. J Microbiol 2015;53:14–20.
https://doi.org/10.1007/s12275-015-4373-4.
[155] Santiago-Urbina JA, Arias-García JA, Ruiz-Terán F. Yeast species associated with spontaneous
fermentation of taberna, a traditional palm wine from the southeast of Mexico. Ann Microbiol
2015;65:287–96. https://doi.org/10.1007/s13213-014-0861-8.
74
[156] Gutiérrez A, Boekhout T, Gojkovic Z, Katz M. Evaluation of non-Saccharomyces yeasts in the
fermentation of wine, beer and cider for the development of new beverages. J Inst Brew
2018;124:389–402. https://doi.org/10.1002/jib.512.
[157] Englezos V, Giacosa S, Rantsiou K, Luca R, Luca R. Starmerella bacillaris in winemaking:
opportunities and risks. Curr Opin Food Sci 2017;17:30–5.
https://doi.org/10.1016/j.cofs.2017.08.007.
[158] Branco P, Kemsawasd V, Santos L, Diniz M, Caldeira J, Almeida MG, et al. Saccharomyces
cerevisiae accumulates GAPDH-derived peptides on its cell surface that induce death of non-
Saccharomyces yeasts by cell-to-cell contact. FEMS Microbiol Ecol 2017;93:1–10.
https://doi.org/10.1093/femsec/fix055.
[159] Cadez N, Poot GA, Raspor P, Smith MT. Hanseniaspora meyeri sp. nov. Hanseniaspora
clermontiae sp. nov., Hanseniaspora lachancei sp. nov. and Hanseniaspora opuntiae sp. nov.,
novel apiculate yeast species. Int J Syst Evol Microbiol 2003;53:1671–80.
https://doi.org/10.1099/ijs.0.02618-0.
[160] Nisiotou AA, Nychas GJE. Yeast populations residing on healthy or Botrytis-infected grapes
from a vineyard in Attica, Greece. Appl Environ Microbiol 2007;73:2765–8.
https://doi.org/10.1128/AEM.01864-06.
[161] Liu SQ, Quek AYH. Evaluation of beer fermentation with a novel yeast Williopsis saturnus. Food
Technol Biotechnol 2016;54:403–12. https://doi.org/10.17113/ft b.54.04.16.4440.
[162] Plata C, Millán C, Mauricio JC, Ortega JM. Formation of ethyl acetate and isoamyl acetate by
various species of wine yeasts. Food Microbiol 2003;20:217–24. https://doi.org/10.1016/S0740-
0020(02)00101-6.
[163] Fan G, Sun B, Xu D, Teng C, Fu Z, Du Y, et al. Isolation and Identification of High-Yield Ethyl
Acetate-Producing Yeast from Gujinggong Daqu and Its Fermentation Characteristics. J Am Soc
Brew Chem 2018;76:117–24. https://doi.org/10.1080/03610470.2017.1396849.
[164] De Carvalho BT, Holt S, Souffriau B, Brandão RL, Foulquié-Moreno MR, Theveleina JM.
Identification of novel alleles conferring superior production of rose flavor phenylethyl acetate
using polygenic analysis in yeast. MBio 2017;8:1–21. https://doi.org/10.1128/mBio.01173-17.
[165] Holt S, Trindade de Carvalho B, Foulquié-Moreno MR, Thevelein JM. Polygenic Analysis in
Absence of Major Effector ATF1 Unveils Novel Components in Yeast Flavor Ester Biosynthesis.
MBio 2018;9. https://doi.org/10.1128/mBio.01279-18.
75
8. Annex
Partial sequence of the D1/D2 region of the 26S rDNA:
Candida humilis IST409
agcacgttcctcaaaagcggctggccgtattcctgcaggctgtaacacttcccgaagcaagctacgttcctgcagttttgtccggccgccaaaa
ctgatgctggcccagtgagctgcgagagtcccccacccacaaggagcggggggcgcaaaacaccatgtctgatcaaatgcccttccctttca
acaatttcacgtactttttcactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtctctcgccaatatttagctttagatggaatt
taccacccacttagagctgcattcccaaacaactcgactcttcgagagcgctttacacggaaccgcactcctcgccacacgggattctcaccct
ctatgacgtcctgttccaaggaacatagacaaggagccgccccaaagtcgccctctacaaattacaactcgggcaccgaaggtaccagattt
caaatttgagcttttgccgcttcactcgccgttactgaggcaatcccggttggtttcttttcctccgcttattgatatgcaaat
Clavispora lusitaniae IST413
cctaaaatctgcaggcctcgaaaagggatggaggcgtcaacacgagctataacacgcgcgcccgaaggtgcgcgccacattctcgagttct
tgttcctccccccttttcgacgctggcccggtaaaaccgtgtctgcttgcaagcccttccctttcaacaatttcacgtgctgtttcactctcttttcaaagt
gcttttcatctttccatcactgtacttgttcgctatcggtctctcgccaatatttagctttagatggaatttaccacccacttagagctgcattcccaaaca
actcgactcgtcggagccgcggtgtacaaagagtcggcgtgcgccatacggggctctcaccctcccaggcgccatgttccaatggacttggg
cgcggccgactcagaccacgaaaccttcaaattacaattcccgcaggatttcaaatttgagcttttgccgcttcactcgccgttactggggcaatc
cctgttggtttcttttcctccgcttatttggatatgcaaac
Hanseniaspora opuntiae IST399
cgtttttgaccgaagcgcagtcctcaatcccagctagcagtattccaataagctataacactaccgaggtagctacattcttaatgatttatcctact
gccagaattgatgttggcccagtgaaatttttgagaggcccaagcccacgagaggcgagtgcatgcaaaaaacaccatgtctgatcaaatgc
ccttccctttcaacaatttcacgtactttttcactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtctctcgccaatatttagctt
tagatggaatttaccacccactttgagctgcattcccaaacaactcgactcttcgaaaaagtcttacagagaaaaggtatcctcgccaaacggg
attctcaccctctatgacgtcctgttccaaggaacatagacaaggacctaatcaaagacaaattctacaaattacaactcgggcactgaaagta
ccagatttcaaatttgagcttttaccgcttcactcgccgttactaaggtaatcccagttggtttcttttcctccgcttattgatatgcaat
Hanseniaspora uvarum IST400
gttttatgaccgaagcacagtcctcaatcgcggctaacagtattccaaaaagctataacactaccgaagtagctacattcttaatgatttatcctgc
tgccagaattgatgttggcccagtgaaatttttgagaggcccaagcccacgagaggcgagtgcatgcaaaaaacaccatgtctgatcaaatg
cccttccctttcaacaatttcacgtactttttcactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtctctcgccaatatttagc
tttagatggaatttaccacccactttgagctgcattcccaaacaactcgactcttcgaaaaagtcttacagagaaaaggtatcctcgccaaacgg
gattctcaccctctatgacgtcctgttccaaggaacatagacaaggacctaatcaaagacaaattctacaaattacaactcgggcactgaaagt
accagatttcaaatttgagcttttaccgcttcactcgccgttactaaggtaatcccagttggtttcttttcctccgcttattgatatgcaata
76
Hanseniaspora uvarum IST412
ggggcccggttctcaaacggggctgggtgtattccggtaagctataacactaccgaggtagctacattcttaatgatttatcctgctgccagaatt
gatgttggcccagtgaaatttttgagaggcccaagcccacgagaggcgagtgcatgcaaaaaacaccatgtctgatcaaatgcccttccctttc
aacaatttcacgtactttttcactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtctctcgccaatatttagctttagatggaa
tttaccacccactttgagctgcattcccaaacaactcgactcttcgaaaaagtcttacagagaaaaggtatcctcgccaaacgggattctcaccc
tctatgacgtcctgttccaaggaacatagacaaggacctaatcaaagacaaattctacaaattacaactcgggcactgaaagtaccagatttc
aaatttgagcttttaccgcttcactcgccgttactaaggtaatcccagttggtttcttttcctccgcttatttgatatgcact
Metschnikowia pulcherrima IST402
aaggcccgcctctagaaggtgagggattaagacaggggcttaataatcccgagagaggtacattccccggtggttttgctccccgccgcccc
gatgctggcccagttaagtgtctgcttgcaagcccttccctttcaacaatttcacgtactttttcactctcttttcaaagtgcttttcatctttccatcactgt
acttgttcgctatcggtctctcgccggtatttagctttagatggaatttaccacccacttagagctgcattcccaaacaactcgactcttggagatctg
ggatgagggcgttgaaggggttcacggggctgtcaccctctgtggcgccactttccagtggacttaacccccgccggccggacccaaatctctt
caaattacaattcccgggggatttcaaatttgagcttttgccgcttcactcgccgttactgaggcaatccctgttggtttcttttcctccgacttattgata
tgcaac
Metschnikowia ziziphicola IST404
Gggctagggaaaattgagaccaggggttataatcctcgaaaggtacattccccggtggttttgtttcccgccgccccgatgctggcccagttaa
gtgtctgcttgcaagcccttccctttcaacaatttcacgtactttttcactctcttttcaaagtgcttttcatctttccatcactgtacttgttcgctatcggtct
ctcgccggtatttagctttagatggaatttaccacccacttagagctgcattcccaaacaactcgactcttggagatctgggatgaaggcgttgag
ggggttcacggggctgtcaccctctgtggcgccactttccagtggacttaacccccgccggccggacccaaatctcttcaaattacaattcccgg
gggatttcaaatttgagcttttgccgcttcactcgccgttactgaggcaatccctgttggtttcttttcctccgcttattgatatgca
Pichia kluyveri IST411
gaagccaagttccgccacagccctcggtccccatacgcagcatctacaaaaggctataacactccgaggagccacattccaattgtccttatc
ctgcaacgaaaaccgatgctggcccaggaaaaacccagagcgccgcccacgagaggcaacgatgcgtaaatcccatgtcgagcccaat
acccttccctttcaacaatttcacgtgctgtttcactctcttttcaaagtgcttttcatctttccttcacagtacttgttcgctatcggtctctcgccaatattta
gccttagatggaatttaccacccacttagagctgcattcccaaacaactcgactcgtcagaagggcctcacaggtgtcgacatgcacgatacg
gggctctcaccctcagtggcaccctgttccaagggacttgcacacacgtctaacccgagactccaacctgcaatttacaactcgcacactaggt
gagatttcaaatctgagctcttgccgcttcactcgccgctactgaggcaatccctgttggtttcttttcctccgctttttgatatgcact
Pichia kluyveri IST397
agcaagtttctacacagccctacaagtccccatacgcagcatctacaaaaggctataacactccgaggagccacattccaattgtccttatcct
gcaacgaaaaccgatgctggcccaggaaaaacccagagcgccgcccacgagaggcaacgatgcgtaaatcccatgtcgagcccaatac
77
ccttccctttcaacaatttcacgtgctgtttcactctcttttcagagtgcttttcatctttccttcacagtacttgttcgctatcggtctctcgccaatatttagc
cttagatggaatttaccacccacttagagctgcattcccaaacaactcgactcgtcagaagggcctcacaggtgtcgacatgcacgatacggg
gctctcaccctcagtggcaccctgttccaagggacttgcacacacgtctaacccgagactccaacctgcaatttacaactcgcacactaggtga
gatttcaaatctgagctcttgccgcttcactcgccgctactgaggcaatccctgttggtttcttttcctccgcttattgatatgc
Pichia kudriavzevii IST398
ggttcaagaaagggcgacgccgcacgaagcatctggccctggctataacactccgaagagccacgttccagaaccccttctcctgcagcaa
gaaccgatgctggcccagggaaagcccagagcgccgcccacgagaggcagcggtgcgcaatccccatgtcgggcgcaatacccttccct
ttcaacaatttcacgtgctgtttcactctcttttcaaagtgcttttcatctttccttcacagtacttgttcgctatcggtctctcgccagtatttagccttagat
ggaatttaccacccgcttggagctgcattcccaaacaactcgactcgtcagaagggcctcactgcttccgccggcatcccacggggctctcac
cctcctgggcgccctgttccaagggacttggacaccgccttccacacagactccaacctgcaatctacaactcgtgccgcaaagcacgatttc
aaatctgagctcttgccgcttcactcgccgctactgaggcaatccctgttggtttcttttcctccgcttattgatatgcacg
Pichia terricola IST410
gcattacctaaggccccgctcgcggcatctgagagaggctataacactccgaagagccacgttcctccccccattctcccgcggcaaaaact
gatgctggcccagaaaccgcacagagcgccgcctacaagaagcaacggtgcgcagtccccatgtcgagcccaatacccttccctttcaaca
atttcacgtgctgtttcactctcttttcaaagtgcttttcatctttccttcacagtacttgttcgctatcggtctctcgccagtatttagccttagatggaattta
ccacccacttagagctgcattcccaaacaactcgactcgtcagaagggtcttaaagcttagacgcgtgccgcacggggctctcaccctcaatg
gcgccctgttccaagggacttagacacacgccgccacaaagactccaacctgcaatttacaactcgccgaggcgatttcaaatctgagctctt
gccgcttcactcgccgctactgaggcaatccctgttggtttcttttcctccgcttatttgatatgcacat
Saccharomyces cerevisiae IST403
ccgtcgcattcctacagtcccagctggcagtattcccacaggctataatacttaccgaggcaagctacattcctatggatttatcctgccaccaaa
actgatgctggcccagtgaaatgcgagattcccctacccacaaggagcagagggcacaaaacaccatgtctgatcaaatgcccttccctttca
acaatttcacgtactttttcactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtctctcgccaatatttagctttagatggaatt
taccacccacttagagctgcattcccaaacaactcgactcttcgaaggcactttacaaagaaccgcactcctcgccacacgggattctcaccct
ctatgacgtcctgttccaaggaacatagacaaggaacggccccaaagttgccctctccaaattacaactcgggcaccgaaggtaccagattt
caaatttgagcttttgccgcttcactcgccgttactaaggcaatcccggttggtttcttttcctccgcttattgatatgcaat
Starmerella bacillaris IST401
gtcgcaactctcgtgaggaatatgaccagcatctataatactccgaggagctacattctacagcatttatcttccccccaaacacggctctacatg
gttagcggcctacccttccatttcaacaatttcacgtactttttcactctcttttcaaagttcttttcatctttccctcacagtacttgtttactatcggtctctc
gcagatatttagctttagatggagcataccacccatttgagctgcattcccaaacaactcgactccatgttaagatcctatatgaggtcaatgcta
gacggggctatcaccctccatggcgctcctttccagaagacttaagcatcgtttctcaggaccctaacttcagaatacaacggcacaaaagtgc
ctttcaaatctgagctcttgcctgttcactcgccgttactagggcaatccctgttggtttcttttcctccgcttattgatatgcact
78
Partial sequence of the Internal Transcriber Spacer region rDNA:
Candida intermedia IST385
gatttggagggcgaagaataaagttgaagtaacgtattgcaacaactgtgatatttcggaaggcaacaccaaacccgggggtttgaaggga
gccgacgctcaaacaggcatgccttgaggaatacctcaaggcgcaatgtgcgttcaaagattgatgattcacgtctgcaagtcatgatacgtat
cgcaattcgctgcgttcttcatcgatgcgagaaccaagagatccgttgttgaaagttttgatttttctaagttattgaatattaatggttattagtgtttgct
tcaaaaacaatgtaataaattaattttaatgatccttccgcaggttcacctacggaagg
Pichia kudriavzevii IST376
cgaaggtcgagctttttgttgtctcgcaacactcgctctcggccgccaagcgtccctgaaaaaaagtctagttcgctcggccagcttcgctcccttt
caggcgagtcgcagctccgacgctctttacacgtcgtccgctccgctcccccaactctgcgcacgcgcaagatggaaacgacgctcaaaca
ggcatgccccccggaatgccgaggggcgcaatgtgcgttcaagaactcgatgattcacgatggctgcaattcacactaggtatcgcatttcgct
gcgctcttcatcgatgcgagaaccaagagatccgttgttgaaagttttgtttgtttttcgtagatttctcttgtcgactatatgctatattccacattttaggt
gttgttgttttcgttccgctcacgcagtgtagtactaaatcacagtaatgatccttccgcaggttcaccctacagaaaaggtg