Post on 23-Jul-2020
transcript
Wesley Leftwich
Abstract
The purpose of this experiment is to extract certain genes encoded to convert B-Carotene
to astaxanthin in Haematococcus pluvialis and insert these genes into a hairy root. The genes
required to do so include Beta carotene ketolase, or BKT, and Beta carotene hydroxylase, or
BCH. Haematococcus pluvialis produces the carotenoid astaxanthin naturally under high stress
or direct sunlight to protect itself from damage, and this quality also proves to benefit humans.
Astaxanthin is a commercially valuable ketocarotenoid. Like all ketocarotenoids, astaxanthin
contains a keto group and hydroxyl group, which make them good antioxidants. It also helps in
eye and skin health, and has other positive attributes for humans including anti-inflammatory
properties, anticancer activity, enhances immune responses, and restrains oxidation of low-
density lipoproteins.
Introduction
The ketocarotenoid astaxanthin (3, 3-dihydroxy-4,4-diketo-carotene) has been used as a
pigmentation source for fish aquaculture and egg yolks, and also serves as a potent antioxidant
(Kobayashi 1992). Although the actual role of astaxanthin is unknown, it is known that it plays a
role in photoprotection and protection from oxidative stress. The green alga, Haematococcus
pluvialis, produces the highest astaxanthin accumulation, reaching up to 4% by dry weight, and
is relatively easy to maintain, which makes it an appropriate source for astaxanthin production
(Steinbrenner and Linden 2001). H. pluvialis produces astaxanthin in response to environmental
stress such, as high light intensity, salt stress, nitrogen limitation, and iron stress (Steinbrenner
and Linden 2001). This purpose of this work was to clone the genes, Beta carotene ketolase and
Beta carotene hydroxylase, that H. pluvialis utilizes to convert Beta-carotene to astaxanthin and
insert those genes into a hairy root. The enzymes encoded by these genes belong to a family of
enzymes that take part in the biochemistry of carotenogenesis (Hirschberg 2001). The sequences
of the genes in this family are extremely conserved across crop plants, making it possible to
insert genes from different plants into others that participate in some form of carotenogenesis, to
make carotenoids that would not normally be made in those crops (Fraser 1997). The BKT and
BCH genes are novel genes that are the best known sequences that which convert B-carotene to
astaxanthin, thus acquiring those genes is important in order to engineer them into other
organisms (Fraser 1997), such as feed for farm-raised salmon and chickens, giving the salmon
and egg yolk’s their yellow, red, or orange pigment color. Astaxanthin was needed as a
supplement for farm-raised salmon because farm-raised fish do not have access to the algae and
other feed available in the open sea, which is how wild salmon receive astaxanthin. Additionally,
egg yolk needed to be pigmented for consumer preference. These supplements began as a
pigmentation additive, but turned out to be also beneficial for proper growth and as a powerful
antioxidant.
The carotenoid biosynthetic pathway. Arrow with a square in the middle means β-carotenoid ketolase is needed, and an arrow with a circle in the middle means β-carotenoid hydroxylase is needed.
Materials and Methods
In order to clone the BKT and BCH genes from H. pluvialis the algae need to be induced
to produce astaxanthin followed by the mRNAs of the genes being made into cDNA. The
cDNAs will then be put into a vector for plant transformation, which in this experiment was the
agrobacterium, p201crtB-2, containing the kanamycin resistance gene. The promoter and
terminator used for the cDNA cassettes will be from pGmubi-sgfp-nos, since the soybean,
tobacco, lima bean, and carrot hairy roots all recognize the Gmubi promoter and terminator, and
will perform direct expression of the gene such a promoter and terminator contains. In between
the Gmubi promoter and terminator sites is a gfp gene. This gene serves as space in which the
BKT/BCH gene will be inserted. The Gmubi-sgfp-nos section will be cut out of the pGmubi-
sgfp-nos vector and then inserted into each of the three shuttles. Shuttles will be needed to insert
both the cassettes containing the BKT and BCH genes into the p201 crtB-2 vector in order to
make a binary vector, since the production of astaxanthin from Beta-carotene in H. pluvialis
requires both the Beta-carotene hydoxylase gene and Beta-carotene ketolase gene. Then, the gfp
gene will be removed and replaced with either of the BKT and BCH genes. At this point the
vector present contains the BKT/BCH gene with the Gmubi promoter and terminator, and shuttle
containing the Ppo, Sce, or both restriction sites. It is these restriction sites, present in all the
shuttles and p201 crtB-2 vector, that make the insertion of two cassettes possible.
Accordingly, H. pluvialis will be grown on media described by Kobayashi et. al. (1992) and
then manipulated to over-produce astaxanthin by induction with sodium chloride. Past
experiments have used sodium acetate, FeSO4, sodium chloride, continuous high light, and
nitrogen deficiency in varying combinations and degrees to induce production of astaxanthin, but
sufficient results were obtained in the past by using sodium chloride alone. This will make it
easier to locate the RNAs of the BKT and BCH genes and clone them from H. pluvialis
(Kobayashi 1992; Huang 2005; Zhu 2009).
The first goal was to determine the best treatment with which to induce astaxanthin
production. Accordingly, experiments were performed to compare NaCl (100 mM total
concentration), sodium acetate (45mM), ferrous sulfate (450 µM), sodium acetate (45 mM) with
ferrous sulfate (450 µM), and continuous high light (>100 μE/m2/s, 24oC – 32oC)(Kobayashi
1992; Huang 2005). Results were calculated by looking for the red pigment that which
astaxanthin produces in the green algae. The best results were observed under continuous high
light conditions without supplements, because only under this condition did the algae assume the
red pigmentation. (see new Results section at bottom)
After 24 hours in high light the H. pluvialis initially started to express the BKT and BCH
genes to synthesize astaxanthin. After 48 hours of high light, H. pluvialis turned a visible red
color, and astaxanthin production was noticeable. Samples between 90-110 mg of the algae in
all three stages (green: under no stress conditions, brown: after 24 hours of high light, and red:
after 48 hours of high light) were taken and ground up with a mortar and pestle in liquid nitrogen
in order to isolate the RNA content in the tissue. Also to note: It became aware that the algae
was contaminated in the tubes they were delivered in, so therefore when grown in flasks,
contaminants were present. This did not affect the algae’s ability to produce astaxanthin though,
and no alterations were made considering BKT and BCH mRNAs were extracted successfully.
The picture to the left displays Haematococcus pluvialis without any high light stress and no obvious astaxanthin production. The picture to the right displays H. pluvialis after 48 hours of high light stress with obvious astaxanthin production.
The tube to the left is a picture of the astaxanthin production of H. pluvialis after 24 hours of high light. This was the tissue used to extract the RNA from the cells, since astaxanthin was in the process of being produced at this stage. The middle tube is a picture of H. pluvialis without any exposure to high light. The right tube is a picture of the astaxanthin production after 48 hours of high light.
The RNA for BKT and BCH was extracted with the materials and guide provided by
Spectrum Plant Total RNA kit, user guide catalog numbers STRN10, STRN50, and STRN250.
Then cDNA was synthesized and PCR followed using Invitrogen SuperScript III Reverse
Transcriptase catalog number 18080-093. PCR reactions to amplify the specific regions of DNA
were as follows.
P primers:
BKT2
Forward: 5’-CCTGCCTAAGTCGAAGAATG-3’
Reverse: 5’-TCACCAGCGGAGGGAC-3’
BKT1
Forward: 5’-GTTTGTGCGCCTCGAC-3’
Reverse: 5’-CCAGCTAGGCAGGAACCA-3’
BCH
Forward: 5’-TTTCACAAGCCCGTGAGC-3’
Reverse: 5’-CTGGTTCCGCACCCTAC-3’
Oligo dT primer (which makes cDNA with any RNA starting with a poly A):
TTTTTTTTTTTTTTTTTT
NCBI Nucleotide Database was used to find sequences of the BKT and BCH DNA. The
accession numbers for the genes are: AF162276 (for BCH), X86782 (for BKT1), and D45881.1
(for BKT2). Next Redasoft Visual Cloning was used to make a map of the genes, and finally
Gene Runner to make primers.
Map of genes using RedaSoft Visual Cloning
Following, the Blunt-End cloning protocol from Fermentas Life Sciences CloneJet PCR
cloning kit #K1231, #K1232 was used to ligate the PCR products with pJET1.2 blunt cloning
vector, and the Sigma GenElute Plasmid Miniprep Kit was used to isolate the pJET1.2 and PCR
product plasmid DNA.
The CloneJet and PCR gene from the ligation were used for a bacterial transformation
using New England BioLabs High Efficiency Transformation Protocol (C2987H) and selected
for ampicillin resistant colonies. The genes in the E. coli transformation could then be sent to be
sequenced. (BKT1 was sequenced and from here forward, BKT1 was used for the β-ketolase
gene).
Next, the genes were cloned into a pGmubi-sgfp-nos vector, using shuttles pM05Ppo/Sce,
pM05Sce, and pM05Ppo which facilitate the cloning of both the hydroxylase and ketolase genes
genes via mega nuclease cloning sites. Primers were ordered that were specific for a phusion
PCR for Infusion cloning. This means that every primer began with fifteen bases of the
sequence that preceded the sequence of interest, which were both the Transit Peptide and either
of the H. pluvialis genes.
--(15)-- --(15)-- Gmubi promoter TP H.p. gene Nos-terminator
←--(15)- ←--(15)-
Primers included:
1)TP:BKT1 F, GGAAGAGTAAAGTGCATGCAGCTAGCAGCGACAG
2)BKT1:TP R, CGCTGCTAGCTGCATGCACTTTACTCTTCCACCATTG
3)TP:BCH F, GGAAGAGTAAAGTGCATGCTGTCGAAGCTGCAGTC
4)BCH:TP R, CAGCTTCGACAGCATGCACTTTACTCTTCCACCATTG
5)GmU_P:TP F, TCGACAGGATCCCTTCTATGATATCCTCTTCC 6)Nos_T:BKT1 R, AATGTTTGAACGATCTGCAGCTAGGCAGGAACCAGACCTC 7)Nos_T:BCH R, AATGTTTGAACGATCTGCAGCTACCGCTTGGACCAGTCC
Clontech Phusion PCR for Infusion Cloning: H2O 6μl 2X Phusion HF MasterMix 10μl Primer 1 10μM 1μl Primer 2 10μM 1μl Template 1ng/μl 2μl Final 20μl 1) 98° 1 min 2) 98° 10 sec 3) 55° 10 sec 4) 72° 15 sec 5) 72° 5 min Steps 2-4 were repeated 25x’s Reactions with the GmU_P:TP and H.P_gene:TP primers had a p201 TPB template, and reactions with TP:H.P_gene and Nos_T:H.P_gene had their respective pJet H.P. gene as a template.
Phusion PCR for Infusion Cloning 1: Gmubi p:TP and BCH:TP 2:Gmubi p:TP and BKT1:TP 3: TP:BCH and nos_T:BCH 4: TP:BKT1 and nos_T:BKT1 The shuttles were then cut with EcoRV, and the pGmubi-sgfp-nos was cut with EcoRI
and ApaI. The cut Gmubi-sgfp-nos was treated with T4 DNA polymerase and 2mMdNTP,
incubated for 15 minutes at 12 C, and then treated with EDTA and incubated at 75 C for twenty
minutes in order to blunt the EcoRI overhang. The cut shuttles were treated with TSAP, so that
they would remain cut, and incubated at 37 C for 15 minutes, then heat inactivated by incubating
at 74 C for fifteen minutes.
The Gmubi-sgfp-nos cut and treated with T4 was run on a gel containing Cyt and gel-
purified using Zymoclean Gel Recovery Kit Catalog Nos. D4001 and D4002. The cut Gmubi-
sgfp-nos with each shuttle were ligated using Fermentas Life Sciences Rapid DNA Ligation Kit
#K1421, #K1422, #K1423. The control was the Ppo/Sce shuttle by itself without the Gmubi-
sgfp-nos. This control was to test to see whether the TSAP worked. The three reactions with
each shuttle and Gmubi-sgfp-nos along with the control (only Ppo/Sce) were then transformed
using New England BioLabs High Efficiency Transformation Protocol (C2987H) and ampicillin
plates. Unfortunately, the control for the experiment had as much or more colonies as the other
three experiment.
To rectify this, a gel was run for the shuttles and Zymoclean Gel Recovery Kit Catalog
Nos. D4001 and D4002 was used to recover only the Ppo/Sce shuttles that remained cut. And, as
before the Gmubi-sgfp-nos was recovered from a gel as well. This was followed by the same
ligation and bacterial transformation steps.
pGmU-gfp-nos cut with ApaI and EcoRIHF, which was treated with T4 polymerase. The circled DNA was the DNA recovered from the gel.
Ppo, Sce, and Ppo/Sce cut with EcoRV. The DNA circled was the DNA recovered from the gel using a blade for precision
This change amended the problem and the control culture (the Ppo/Sce without Gmubi-
sgfp-nos) had fewer colonies than did the Ppo/Sce-Gmubi-sgfp-nos. Colony screening isolated
individual colonies for growth by using a bacterial hood to add 2.5 ml of LB Broth, 2.5 μl AMP
100 mg/ml to equal 100 μg/ml and one single colony from the ampicillin plates to each tube.
Three tubes for each of the three plates were made. After the cultures grew over night a Sigma
GenElute Plasmid Miniprep Kit was used for the colonies to isolate the plasmid DNA from E.
coli cultures. A restriction enzyme cut followed, which cut out the gfp section of the Ppo/Sce-
Gmubi-sgfp-nos with the restriction enzymes PstI and NcoI.
A gel was run in order to make sure the gfp portion of the plasmid was removed, and a
gel recovery using Zymoclean Gel Recovery Kit Catalog Nos. D4001 and D4002 purified only
the cut Ppo/Sce-Gmubip-nos without the gfp region. This was then stored in case complications
arose that meant some uncut Ppo/Sce-Gmubip-sgfp-nos remained in the reaction.
Results of cutting the Ppo/Sce-Gmubi-sgfp-nos, which cut out the gfp portion. The circled DNA
was the DNA purified from gel recovery. The bottom left lanes were the gfp regions and the two
right lanes were uncut Ppo/Sce-Gmubi-sgfp-nos for comparison sake.
After the gfp region was cut out the Ppo/Sce-Gmubi-nos was recombined with the
InFusion PCR products of the transit peptide (Gmubi:TP/BCH:TP) and pJet H.P. gene (i.e.
TP:BCH/nos_T:BCH) using Clontech In-Fusion Advantage PCR Cloning Kit Protocol-at-a-
Glance (PT4065-2). And then transformation into E. coli followed using New England BioLabs
High Efficiency Transformation Protocol (C2987H) and ampicillin plates.
Next, what will happen is that a colony screening for the recombined Ppo/Sce-Gmubip-
TP-BCH-nos_T will pick out specific colonies for amplification and sequencing. The colony
screening entails using the phusion primers to make a PCR reaction that will amplify the specific
Ppo/Sce-Gmubip-TP-BCH-nos_T region of DNA to be sequenced. But also, a new ampicillin
resistant plate will be used to plate the same colony that was used for the PCR reaction so that
the colony is saved. Following, TP-BCH will be cut with I-SceI and I-PpoI to release TP-BCH in
order to insert it into the p201 crtB-2 (which is an agrobacterium). The Ppo/Sce shuttle will go
first into the p201crtB-2 vector, followed by the Ppo and Sce shuttles. This order is necessary so
that more than one cassette can be inserted into the p201crtB-2 vector. Also, it is necessary to
use the p201crtB-2 vector with Ppo/Sce, Ppo, Sce as shuttles because it is a binary vector, which
will give the agrobacterium more flexibility in terms of the hairy root that will accept it.
Results
Accumulation of astaxanthin in H. pluvialis: In cultures with NaCl, sodium acetate,
ferrous sulfate, or sodium acetate and ferrous sulfate supplements H. pluvialis remained its usual
green coloration, but in the high light experimental, red pigment was apparent. The best results
were observed under continuous high light conditions without supplements, because only under
this condition did the algae assume the red pigmentation.
References
Huang, Jun-Chao, Feng Chen, Gerhard Sandmann. “Stress-related differential expression of
multiple β-carotene ketolase genes in the unicellular green alga Haematococcus
pluvialis.” Journal of Biotechnology. 122. (2006): 176-185
Kobayashi, Makio, Toshihide Kakizono, and Shiro Nagai. “Enhanced Carotenoid Biosynthesis
by Oxidative Stress in Acetate-Induced Cyst Cells of a Green Unicellular Alga,
Haematococcus pluvialis.” Applied and environmental Microbiology. 59.3 (1993): 867-
73
Steinbrenner, Jens and Hartmut Linden. “Regulation of Two Carotenoid Biosynthesis Genes
Coding for Phytoene Synthase and Carotenoid Hydroxylase during Stress-Induced
Astaxanthin Formation in the Green Alga Haematococcus pluvialis.” Plant Physiology.
125.
(2001): 810-17.
Zhu, Changfu, Shaista Naqvi, Teresa Capell, and Paul Christou. "Metabolic
engineering of ketocarotenoid biosynthesis in higher plants." Archives of
Biochemistry and Biophysics . 483. (2009): 182-90.