DNADeoxyribonucleic Acid

DNA

• A type of Nucleic Acid• Genetic material in chromosomes.• Monomer made of:– Phosphate– Sugar (Deoxyribose)– Nitrogen Base

• Monomer= Nucleotide

DNA: Nitrogen Bases

• Nitrogen Bases are the “steps” of the DNA “Ladder”

• Adenine == Thymine (A-T)• Cytosine == Guanine (C-G)• Held together by Hydrogen Bonds

DNA: You Try

DNA: History

• 1950’s Rosalind Franklin & Maurice Wilkens– Xray photography– Spiral structure

DNA: History

• 1950’s Watson & Crick– DNA consists of a

double helix.– Two strands that are

complements of each other.

– Heredity is based on this chemical molecule!

Warm upWhat are the two sets of complimentary base pairs?

What does complimentary mean?

The Functions of DNA

• Replication– Occurs during

interphase.– Split your model

and make two replicated strands!

DNA Replication

Watson and Crick thought that one side of the DNA served as a template for the other side to be built.

The DNA separates. This is caused by an enzyme called the DNA Helicases.

The DNA untwists by breaking the Hydrogen bonds that hold the two strand together.

DNA Replication

DNA polymerase moves along each strand of DNA and adds the missing nucteotides.

The place where the DNA separate is called the replication fork . Two new

DNA strands are formed.

DNA Replication

Once all of the nucleotides are in place, the DNA polymerases are told to stop and detach.

The two pieces of DNA are EXACT.

The DNA polymerase can proofread the DNA to make sure that it matched the nucleotides correctly. It can go back and fix its mistakes. Mistakes happen about every 1 billion nucleotides.

The Language of DNA

• Sets of 3 nitrogen bases is a “word” called a codon.• Each segment of DNA that makes a protein

is called a gene.

ATCCGTACTAACGTACATTGC C0D0N

GENE

The Functions of DNA

• Protein Synthesis • One gene codes for one protein

DNA --> mRNA --> Protein

Transcription Translation

How Proteins are Made

• DNA can not leave the nucleus.• Messenger is needed to carry the

information to the ribosome where the proteins are made.

Ribonucleic Acid

• A nucleic acid.• Single strand• Sugar = Ribose• Nitrogen bases:

Cytosine == GuanineAdenine == Uracil

• Types –mRNA, tRNA, rRNA

Transcription

• The synthesis of mRNA using DNA as the template.

• DNA = T T C A T C

• mRNA= A A G U A G

Let’s Practice: DNA to RNA

DNA RNA1. GGC2. GTA3. TAT4. CCA5. AAA

DO NOW:

1.What is the first step of protein synthesis?

2.Where does the first step occur in a cell?

3.Transcribe the DNA into RNA below.DNA– TAC GTA CGT

RNA -

How to Read a Codon Sheet

Start Codon

Stop

Codon

Stop

Translation: Let’s Try!

• The process of building a protein at a ribosome where the mRNA determines the sequence of amino acids in the protein.

• mRNA= A A G U A G

• Amino Acids/Codons= Lysine, Stop Codon

Translation

• The ribosome reads the mRNA sequence and translates it into the amino acid sequence of the protein.

• The ribosome starts at the sequence AUG, then reads three nucleotides at a time.

• Each 3 nucleotide codon specifies a particular amino acid.

• The stop codons (UAA, UAG, UGA) tell the ribosome that the protein is complete.

Mutations

Mutation: Any change in the nucleotide sequence of DNA.

Warm Up

Transcribe and Translate this DNA Sequence – Healthy Person

TAC-CAA-GTA-GAC-CTC-CTT-CTC-GTG-CAT-CCT-GTG-ATC

Transcribe and Translate this DNA Sequence – Afflicted PersonTAC-CAA-GTA-GAC-CAC-CTT-CTC-GTG-CAT-CCT-GTG-ATC

Mutation Types

Point Mutation (Base Substitution) Replacement of one nitrogen base for another.

Mutation Types Silent Mutation: The change in the nitrogen base makes no difference in the coded amino acid.

Mutation Example• Sickle Cell Anemia

Sickle cell anemia is the most common inherited blood disorder in the United States.

• SCA is genetic disease caused by a point mutation in the hemoglobin beta gene.