IL-21 and IL-15 cytokine DNA augments HSV specific effector and memory CD8+ T cell response

transcript

KIIMCHD

gdlheCsc2TpaDa

Molecular Immunology 46 (2009) 1494–1504

Contents lists available at ScienceDirect

Molecular Immunology

journa l homepage: www.e lsev ier .com/ locate /mol imm

L-21 and IL-15 cytokine DNA augments HSV specific effector and memoryD8+ T cell response

uiz Rodriguesa,d, Subhadra Nandakumarb, Cristina Bonorinoa, Barry T. Rousec, Uday Kumaragurub,∗

Faculdade de Biociências e Instituto de Pesquisas Biomédicas, Pontifícia Universidade Católica do Rio Grande do Sul, Porto Alegre, RS 90619-900, BrazilDepartment of Microbiology, J.H. Quillen College of Medicine, ETSU, Johnson City, TN 37614, USADepartment of Pathobiology, College of Veterinary Medicine, University of Tennessee, Knoxville, TN 37996, USAFaculdade de Farmácia e Pós-graduacão em Nanociências, Centro Universitário Franciscano, Santa Maria, RS 97010-032, Brazil

r t i c l e i n f o

rticle history:eceived 6 November 2008ccepted 24 December 2008vailable online 23 February 2009

eywords:L-21L-15

emoryD8+ T cells

a b s t r a c t

The recurrence of lesions and transmission of Herpes simplex virus is dependent on the number andfunction of viral specific CD8+ T cells, especially the memory T cells. The generation, turnover and setpoint of this cell population is maintained by different factors like exposure to antigen, cytokines andco-stimulatory molecules. However, the contribution of these factors in the generation and maintenanceof the memory CD8+ T cell population is still controversial, since it is not clear if homeostatic prolifera-tion driven by cytokines can overcome T cell receptor (TCR) signaling. Since, interleukin 15 (IL-15) andinterleukin 21 (IL-21) are cytokines implicated in homeostatic control of CD8+ T cell pool, we constructedand used expression plasmids coding for IL-15 (pIL-15) and IL-21 (pIL-21) to expand HSV specific CD8+ Tcells in an animal model. Our results showed that the IL-21 increased the frequency of CD8+ T cells in the

erpes virusNA vaccination

absence of antigen, although the magnitude of this response was dependent on TCR signaling. Both pIL-15and pIL-21 boosted the numbers of antigen specific CD8+ IFN� producing cells in the primary response.In the memory phase, numbers of CD8+ CD44high as well as CD8+ T cells producing IFN-� and TNF-�were increased when pIL-15 and pIL-21 were used alone or in combination, compared to vector treat-ment only, and association of antigen further increased the proliferative response. Our data suggest thatgenetic treatment with pIL-15 and pIL-21 in the presence or absence of cognate antigen can contribute

t agai

. Introduction

One of the main goals of vaccine research is to maximize theeneration, maintenance and function of memory CD8+ T cells,eterminant for the immune responses against viruses and intracel-

ular pathogens (Brown et al., 2005). Memory CD8+ T cells expressigh levels of CD44 and can be divided in two populations based onxpression of homing molecules: central memory cells (CD44high

D62high), located in lymphoid organs such as lymph nodes andpleen; and effector memory cells (CD44high CD62low), that cir-ulate between lymphoid organs, tissues and blood (Cauley et al.,002; Wherry et al., 2004). These two populations of memory CD8+

cells are generated after the contraction phase of CD8+ T cells, this

∗ Corresponding author. Tel.: +1 423 439 6227.E-mail addresses: udaysnk@gmail.com, kumaragu@etsu.edu (U. Kumaraguru).

be expanded and perform effector functions faster and more effi-ciently than recently recruited effector CD8+ T cells (Sierro et al.,2005). In the case of Herpes simplex virus-1 (HSV-1), the set pointof memory CD8+ T cells is very low, and that can be a disadvantageto the host because HSV produces a latent infection, the control ofreactivation being fully dependent of memory CD8+ T cells (Khannaet al., 2003; Decman et al., 2005). This set point of memory CD8+

T cells is maintained by different factors such as low doses of anti-gen or cytokines (Hamilton et al., 2006; Lee and Surh, 2005; Prlicet al., 2007; Tan and Surh, 2006). However it is still unclear whichfactors are determinant in this mechanism, more so in the contextof a latent infection such as HSV-1.

Interleukin-15, a four-helix bundle cytokine, has a pivotal rolein the control of life and death of lymphocytes, especially mem-ory CD8+ T lymphocytes (Sandau et al., 2007; Waldmann, 2006;Williams et al., 2006). It is well documented that naïve CD8+ T

im2a�meci2eccpTsdtArpmweitep

tiicscIpeTvitacfTmirbo

wo1pvMbC

L. Rodrigues et al. / Molecular

There are also other cytokines that act like adjuvant, contribut-ng to the formation and maintenance of an effective CD8+ T cell

emory pool (Alves et al., 2007; Boyman et al., 2007; Carrio et al.,007; Liu and Wu, 2007). Interleukin-21 (IL-21) (a new member offamily of cytokines that uses receptors containing the common-chain) is one of the cytokine adjuvants that participate in theemory CD8+ T cell pool formation and maintenance (Kasaian

t al., 2002; Parrish-Novak et al., 2002; Zeng et al., 2005). Thisytokine is produced by activated CD4+ T cells and NKT cells,ndicating that it is involved in adaptive immunity (Collins et al.,003; Coquet et al., 2007; Strengell et al., 2002). The adjuvantffects of IL-21 on viral immunity were first observed by Cui andollaborators, who showed that immunization with a plasmidoding for the HSV-1 CD8 epitope (gB) together with IL-21 generotected mice from lethal HSV-1 challenge (Cui et al., 2005).he protective effects were related to the capacity of antigenpecific CD8+ T cell to produce IFN-�. IL-21 is involved in theifferentiation of naïve CD8+ T cells but require IL-2 to supporthe development of effector functions (Casey and Mescher, 2007).dditionally, in vitro and in vivo assays suggest that IL-21 has aole (1) in proliferation and maturation of natural killer (NK) cellopulations, (2) proliferation, survival and antibody production ofature B-cells, and (3) in the proliferation of T cells co-stimulatedith anti-CD3 (Mehta et al., 2003; Ozaki et al., 2002; Parrish-Novak

t al., 2002). When DCs are treated with IL-21, they maintain theirmmature phenotype after antigen uptake and LPS stimulation, andhe expression of MHC class II and CCR7 is also reduced (Brandtt al., 2003a,b). Taken together these results suggest that IL-21articipates in transition between innate to adaptive immunity.

In order to design a therapeutic approach using IL-21, it remainso be determined how IL-21 operates and what are the kinetics ofts function. The combination of IL-21 with IL-15, IL-7 or IL-18 canncrease the numbers and function of effector and memory CD8+ Tells (Strengell et al., 2003). There are several studies showing anynergism between IL-21 and IL-15 [22,32,47,56]. In this study, weonstructed a plasmid encoding murine IL-21 (pIL-21) and murineL-15 (pIL-15) to investigate the effects of these cytokines on theroliferation and function of CD8+ T cells in the absence or pres-nce of cognate antigen. We found that pIL-21 can increase CD8+

cell numbers in vitro in TCR non-activated and as well as acti-ated cells. In vivo, treatment with pIL-21 and pIL-15 contributes tomprove the generation of the CD8+ IFN-�+ cells in an HSV-1 infec-ion model. During memory phase, treatment with pIL-21 or pIL-15lone was sufficient to expand memory HSV-1 CD8+ TCR specificells. The combination of the two cytokines DNA or antigen DNAurther augmented proliferation and polyfunctionality (IFN-� andNF-� production; CD107 a and b expression by peptide specificemory CD8+ T cells). Although, there was a very high increase

n the CD8+ T cell response with the cytokine and the antigen, ouresults suggest that administration of IL-21 and IL-15 alone mayypass the need for antigen availability for the expansion of mem-ry CD8+ T cells in a viral latent infection.

. Materials and methods

.1. Mice

Female C57BL/6 mice were purchased from Charles River. Miceere maintained according to the Guide for the Care and Use

f laboratory Animals (National Academy Press, Washington, DC,996) and Institutional guidelines. Animals were kept in specific

y the American Association for Accreditation of Laboratory Animalare.

nology 46 (2009) 1494–1504 1495

2.2. Cell line and viruses

Vero African green monkey kidney cells (ATCC cat n CCL81)]and H293 (human kidney embryonic) cell lines were cultured inDullbecco’s minimal essential medium (DMEM; Gibco-BRL) sup-plemented with 10% fetal bovine serum (FBS). CTLL-2 cells (ATCC catn TIB 214) were grown and maintained in RPMI complete mediumcontaining 5% supernatant from Con-A-stimulated rat spleen cells(BD Biosciences) supplemented with IL-2, which is required forcell growth. HSV-1-KOS were cultured and titrated on a Vero cellmonolayer, and the supernatant stored in aliquots at −80 ◦C untiluse.

2.3. FACS and ELISA

Cy-chrome-conjugated anti-mouse CD8, PE-conjugated anti-mouse CD4, FITC-conjugated anti-mouse CD3, FITC-conjugatedanti-mouse IFN-�, APC-conjugated anti-mouse CD90.1, FITC-conjugated anti-mouse CD8, Cy-chrome-conjugated anti-mouseIFN-�, PE-conjugated anti-mouse TNF-�, PE-conjugates anti-mouse CD8, FITC-conjugated. Cy-chrome-conjugated anti-mouseCD44 were purchased from BD Biosciences. PE-MHC class I (H-2b)tetramers used to measure SSIEFARL specific T cell were providedby NIAID MHC Tetramer Core Facility (Atlanta, GA). Cytokines weremeasured by ELISA using polyclonal anti-IL-15, polyclonal anti-IL-21, biotin-conjugated IL-15, biotin-conjugated IL-21, recombinantprotein IL-15 and recombinant protein IL-21, all purchased fromR&D and used according to the manufacturer’s recommendation.For intracellular staining of IFN-�, spleen cells were isolated fromimmunized or non-immunized mice at appropriate times. Cells(1 × 106 per well) were plated in U-bottomed microwell plates inRPMI 10% FBS supplemented with 40 U IL-2 per well and stimu-lated with SSIEFARL peptide (1 �g/well) in presence of golgi plugtransport inhibitor. The splenocytes were incubated for 5 h at 37 ◦C,5% CO2 and stained for CD8 and intracellular IFN-� after permeabi-lizing the cells using permfix. Flow cytometry was performed in aBecton Dickson FACSscan, and the data were analyzed with FloJoand FCS express software.

2.4. Plasmids constructions

RNA for murine IL-15 (mIL-15) was isolated from macrophagesstimulated for 6 h with lipopolysaccharide (LPS) to induce genetranscription (Nishimura et al., 1998). mRNA was extracted usinga Qiagen RNeasy kit and cDNA was synthesized. The IL-15 for-ward primer (5′ cattgaattccttacc tgggcattaagtaatgaaaattt 3′) and thereverse primer (5′ aggctctagagcagtcaggacatgttgatgaaca tttg3)′ wereused to amplify the specific cDNA. Restriction sites for EcoRI andXba I were inserted on the forward and reverse primers, respec-tively. PCR conditions for all reactions were one cycle at 94 ◦C for2 min; 30 cycles at 94 ◦C for 1 min, 56◦ for 45 s, and 68◦ for 1 min,followed by a final extension step at 68◦ for 5 min. All reactionswere performed using high fidelity Pfx polymerase (Invitrogen).The final product was purified by agarose gel (1.5%) electrophore-sis. The murine interleukin-21 expression plasmid (pORF-mIL-21)was purchased from Invivogen and the gene excised using Nco I andNhe I. For plasmid DNA preparation DNA encoding IL-15 and IL-21was isolated from agarose gels using Gene clean kits (Q-Biogene).The DNA was digested with restriction enzymes (Fisher) and clonedinto the pVIVO-2 vector under control of ferritin promoter (Invivo-gen) or pCR3.1 vector under control of cytomegalovirus promoter

1 Immu

fiw2it

ttDmt25nImpb

cacntswbvb

pdwoCce0

496 L. Rodrigues et al. / Molecular

equences available in GeneBank were tested for in vitro expres-ion. All plasmid DNA constructions were purified using Plasmidndofree Mega prep (Qiagen). The isolated plasmids were precipi-ated in 3 M sodium acetate and absolute ethanol, and resuspendedn PBS.

.5. Immunization and infection

DNA was mixed in PBS containing 0.25% bupivacaine (Sigma) in anal volume of 100 �L. Intramuscular injections in the tibial muscleith 75 �g of pgB alone or in combination with pIL-15 and/or pIL-

1 were done. The empty vector was used as a control. Mice werenfected intraperitoneally with 5 × 106 PFU of HSV-KOS or in theibial muscle with 5 × 104 PFU.

.6. In vitro expression

Expression levels of the plasmid constructs were tested afterransient transfection of H293 cells. Cells were plated in six-wellissue culture plates at a density of 2 × 105 cells/well in completeMEM plus 10% FBS and allowed to adhere overnight. The next day,edium was replaced by serum free-DMEM and the cells were

ransfected with each plasmid construction using lipofectamine000 (Invitrogen). The plate was incubated for 6 h at 37 ◦C with% CO2 and the medium was replaced by DMEM. After 72 h, super-atants were harvested and analyzed for the presence of murine

L-15 by ELISA using capture and detection anti-mouse IL-15 or anti-ouse IL-21 monoclonal antibodies (R&D). Expression of the gB

lasmid was analyzed by immunoblotting with monoclonal anti-ody anti-gB (Virusys).

.7. In vivo expression

Mice were injected intramuscularly with each plasmid constructs previously described. Three days after injection, the tibial muscleas dissected, minced and the cells cultured in DMEM 1× 10% FBS

or three more days at 37 ◦C, 5% CO2. The supernatant was collectednd tested by ELISA using capture and detection anti-mouse IL-21r IL-15 antibodies.

.8. In vitro activity cytokines

Seventy-two hours after transfection, the supernatants of H293ells transfected with pIL-21, pIL-15 or control vector were removednd concentrated using centricon filters - 3 (Millipore). Proteinoncentration was determined by ELISA. These concentrated super-atants of IL-21, IL-15 or control vector-transfected cells were usedo supplement cell culture medium. Forty ng/�L of concentratedupernatant of IL-21 were added to RPMI (10% FBS) supplementedith antibiotics, 50 �M �-mercaptoethanol and 50 U/mL of recom-

inant human IL-2 [Hemagen]. The same volume of concentratedector-transfected cell supernatant was used. Media with recom-inant IL-21 (R&D) (40 ng/mL) or PBS were used as controls.

Single cell suspensions of spleen were prepared by gentlyressing the tissues through fine nylon screen. Erythrocytes wereepleted with Red Cell Lysis Buffer (Sigma). Cells were plated in 48ell plates at 1× 106 cells/well and cultured using control medium

r medium with IL-21. After 6 days of incubation at 37 ◦C with 5%O2, cells were harvested and the T cells were analyzed by flowytometry. To test the effect of IL-21 on activated splenocytes, thexperiment was repeated and cells co-incubated with anti-CD3

The IL-2 dependent murine T cell line CTLL-2 was used to assesshe biological activity of mIL-15 encoded by the plasmid constructn vitro. CTLL-2 cells obtained from American Type Culture Col-ection were grown and maintained in RPMI 1640 (Sigma) (10%

nology 46 (2009) 1494–1504

fetal bovine serum) and 50 U/mL of IL-2, which is required for cellgrowth. At the time of assay, cells were centrifuged and washedfour times with RPMI 1640 to remove residual IL-2. Cells wereplated at a concentration of 5 × 104 cells/well in 96 well, flat bot-tom polystyrene plates. Commercial murine IL-15 (eBioscience) aswell as the concentrated supernatants from transfected cells wasadded to each well. The cells were incubated at 37 ◦C with 5% CO2for 48 h. For analysis of proliferation, 3H-thymidine was added totriplicate wells and incubated for 8 h.

To determine, if the effects observed after treatment ofsplenocytes with IL-21 supernatants was specific, an antibody neu-tralization method was used. The media described above weretreated for 1 h with different concentrations of anti-murine IL-21antibody (15, 25 or 50 �g/mL) to neutralize the IL-21 protein andblock its binding to its receptor on cells surface. Six days after cul-ture CD3+CD8+ T cell numbers were analyzed by flow cytometry.

2.9. Adoptive transfer

Splenocytes from HSV-1 gB TCR specific transgenic C57BL/6,CD90.2 (Thy 1.2)+ (gBT cells) mice were isolated, reticulocytes lysedwith RBC buffer (Sigma) and 1 × 108 cells stained with 5 �M of CFSEin 4 mL of PBS, 37 ◦C, 5% CO2 for 7 min. The reaction was stoppedwith 4 mL of cold FBS and kept on ice for 2 min. Cells were washedthree times with 4 mL of PBS 2% FBS. CFSE stained splenocytes wereinjected intravenously (i.v.) by the tail vein in C57BL/6 CD90.1+ (Thy1.1)+ mice.

2.10. Data analysis

All the experiments were performed in at least three indepen-dent assays, unless specified. Data were tested for normality ofdistribution by a Kolmogorov–Smirnov test, and depending on theresult, differences were analyzed either by parametric tests (Stu-dent’s t-test and ANOVA, with Tukey post-tests) or non-parametrictests (Mann–Whitney and Kruskall–Wallis, with Dunn post-tests).A value of p < 0.05 was chosen as a level of significance. Analysiswas conducted using GraphPad Prism 4.0 Software.

3. Results

3.1. IL-21 and IL-15 can be efficiently expressed in mammaliancells under a ferritin promoter

We first set out to determine if our constructs were efficientlyexpressed in mammalian cells, both in vitro and in vivo. We ini-tially tested the efficiency of expression of IL-21 and IL-15 underthe control of two different mammalian expression promoters, thewell-studied cytomegalovirus (CMV) promoter cloned into pCR 3.1plasmid, and the less used ferritin promoter, cloned into the pVIVO-2 plasmid. To test in vitro expression, we transfected H293 cells witheither pIL-21 or pIL-15, or control vector only, as described in Sec-tion 2. After 72 h of culture, supernatant was collected and tested forcytokine expression by ELISA. The ferritin promoter used in theseconstructs led to higher yields of cytokine production compared towhat was obtained using the CMV promoter in vitro (Fig. 1A and B).To analyze in vivo expression, mice were immunized intramuscu-larly with pIL-21 or pIL-15 plus bupivacaine. After 3 days, musclewas dissected and cultured for another 3 days, to measure cytokineexpression in the supernatant (Sin et al., 2000). While we could

L. Rodrigues et al. / Molecular Immunology 46 (2009) 1494–1504 1497

Fig. 1. In vitro and in vivo expression of pIL-21 and pIL-15 plasmid constructs: for in vitro analysis expression levels of plasmid construct were assessed using transientlytransfected H293 cells as described in Section 2. Briefly, cells were plated in six-well tissue culture dishes at a density of 2 × 105 cells/well in complete DMEM plus 10% FBS andallowed to adhere overnight. The next day cells were transfected with either vector or plasmid constructs (1 �g/well) using lipofectamine 2000. After 48 h, cell supernatantswere harvest and analyzed for the presence of IL-21 protein by ELISA. For in vivo analysis mice were injected in tibial muscle with 75 �g of each cytokine plasmid or controlvector. Three days after DNA injection the muscle was excised, minced and cultured in RPMI with 10% FBS for three more days and the cytokine levels in the supernatantw ferritu IL-21 ip

ctoaftn3wsflt2t3ecaotptd5tt

as measured by ELISA. (A) Expression level of pIL-21 in pVIVO-2 under control ofnder control of ferritin promoter and CMV promoter and (C) expression level of per group) (*, p < 0.05; ** p < 0.005).

.2. Supernatants of pIL-21 and pIL-15 transfected cells have anffect on CD8+ T cell numbers in vitro

After we determined that the cytokines encoded by ouronstructs were efficiently expressed in vitro and in vivo, we inves-igated if the cytokines produced by the cells transfected withur constructs could influence CD8+ T cell numbers in vitro. Tonalyze the effect of IL-21, the supernatant of H293 cells trans-ected with pIL-21 (pIL-21H293 cells) was concentrated, and usedo supplement an IL-2 conditioned RPMI media. Splenocytes ofaïve C57Bl/6 mice were cultured in this media for 6 days at7 ◦C and 5% CO2. As positive controls, some cells were culturedith RPMI supplemented with IL-2 or commercial IL-21. On the

eventh day the cells were harvested, counted and analyzed byow cytometry. The results as shown in Fig. 2A–D indicate thathe number of CD3+CD8+ T cells increased in cultures with IL-1 (both commercial and produced by pIL-21H293 cells) withouthe engagement of TCR. In fact, when the cells were treated for0 min with anti-CD3 and cultured in the presence of IL-21, theffects on CD3+CD8+ T cell expansion were more intense, espe-ially when pIL-21H293 was used in the culture. Fig. 2E shows thebsolute numbers of the cultured cells, demonstrating an increasef CD3+CD8+ T cells in the IL-21 treated cells. To investigate, ifhe in vitro proliferation of CD8+ T cells cultured in media sup-lemented with pIL-21H293 is a phenomenon specifically related

in promoter and CMV promoter in vitro; (B) expression level of pIL-15 in pVIVO-2n pVIVO-2 (ferritin) in vivo (results of three independent experiments; three mice

decreased compared to wells without neutralizing treatment. TheCD3+CD8+ T cells numbers decreased proportionally to the amountof anti-IL-21 added. Taken together, these results indicate a directinvolvement of IL-21 cytokine in the expansion of CD3+CD8+ T cellsin vitro.

Using this same assay we observed that IL-15 did not have aneffect over the proliferation of naïve cells (results not shown), prob-ably because naïve cells do not express high levels of IL-15R� andits activity on this cells is mainly mediated by trans-presentation ofthis receptor subunit by macrophages or dendritic cells to IL-2/IL-15RB of CD8+ T cells (Dubois et al., 2002; Stoklasek et al., 2006).Consequently, we used a CTLL-2 cell proliferation assay, becausethese cells are highly dependent on IL-15 to proliferate. CTLL-2cells were cultured in RPMI supplemented with IL-2 until cellswere approximately 80% confluent, washed several times to thor-oughly remove residual IL-2 and cultured with RPMI supplementedwith supernatant from pIL-15H293 cells for 48 h and 3H-thymidinewas added for another 8 h. CTLL-2 proliferated when cultured inpresence of pIL15H293 supernatant proportionally to the concen-trations of IL-15 present in media (Fig. 3). This result showed thatthe IL-15 encoded by our construct can efficiently promote the pro-liferation a cytotoxic T cell that constitutive express IL-2/15R� andIL-15R�.

3.3. pIL-21 and pIL-15 can increase the numbers of antigen

Since the IL-21 and IL-15 encoded by the plasmid constructsrespectively increased the frequency and promoted proliferation

1498 L. Rodrigues et al. / Molecular Immunology 46 (2009) 1494–1504

Fig. 2. In vitro activity of IL-21. Supernatant from H293 cells transfected with pIL-21 or vector was used to supplement RPMI 1640 medium in addition to IL-2 and used toculture splenocytes from C57BL/6. Six days after culture the cells were counted stained with anti-CD3 FITC and anti-CD8 Cy-chrome and analyzed by flow cytometry. (A) Dotplot with percentage of CD3+CD8+cells recovered after treatment with hIL-2; (B) dot plot with percentage of CD3+CD8+cells recovered after treatment with hIL-2 (50 U/well)plus vector supernatant; (C) dot plot with percentage of CD3+CD8+cells recovered after treatment with pIL-21H293 supernatant (40 ng/mL) plus hIL-2 (50 U/well); (D) dot plotwith percentage of CD3+CD8+ cells recovered after treatment with recombinant IL-21 (R&D + +

with anti-CD3 (0.25 �g/mL) in the presence of mediums containing hIL-2 (50 U/well), veccontrol (40 ng/mL) for 3 days after culture; (F) pIL-21H293 supernatant was treated withprevious experiment (*, p < 0.05; ** p < 0.005).

Fig. 3. IL-15 bioactivity in supernatants of cells transfected with pIL-15 expressionplasmid. H293 cells were transfected with pIL-15 expression construct or vectorpVIVO-2, and the supernatant were collected 72 h after transfection, concentratedwith centricon-3 and the amount of IL-15 was determined by ELISA. The super-natants were diluted and tested by CTLL-2 bioassay to measure IL-15 bioactivity.Commercial IL-15 (2.5, 1.25 and 0.62 �g) was used as a positive control. The exper-iment was repeated multiple times with similar outcomes. The data representsresults from one such experiment. IL-15 supernatant (open circle), positive control(filled square), vector supernatant (asterisk).

) plus hIL-2 (50 U/well); (E) number of CD3 /CD8 cells recovered after stimulationtor supernatant, pIL-21H293 supernatant (40 ng/mL) or recombinant IL-21 positive

anti-IL-21 (15, 25 or 50 �g) for 1 h and used to culture the total splenocytes like

of CD8+ T cells in vitro, we decided to investigate their role in thepriming phase of adaptive immunity in vivo, using an HSV infec-tion model. Mice were infected intraperitoneally on day zero with5 × 104 PFU of HSV-KOS and 2 days after infection they receivedan intramuscular injection with pIL-21 or control vector. Each wastreated with 75 �g of pIL-21 or control vector diluted in PBS 0.25%bupivacaine on the right leg. Twelve days after infection, mice weresacrificed and spleens were harvested. The organs were minced,spleen RBC lysed and counted, and single cell suspensions werewashed with RPMI, counted and stimulated for 5 h with gB pep-tide. The cells were then stained for CD8 and IFN-�, as described inSection 2.

As seen in Fig. 4C, in spleens from mice infected and treatedwith pIL-21 the percentage of cells CD8+ IFN-�+ was almost twotimes higher than cells from mice infected and treated with vectoralone (Fig. 4B). Also, when the absolute numbers of CD8+ IFN-�+

cells were analyzed in total splenocytes from infected mice treated

L. Rodrigues et al. / Molecular Immunology 46 (2009) 1494–1504 1499

Fig. 4. In vivo activity of pIL-21 and pIL-15 constructs on CD8+ T cell expansion–effector phase. Female C57BL/6 was infected intraperitoneally with 5 × 104 PFU of HSV-KOS.Two days after the mice were treated by intramuscular injection with 75 �g of pIL-21, pIL-15 or vector. Twelve days after infection mice were sacrificed, splenocyte isolatedand RBC lysed. Cells were incubated in 37 ◦C/5% CO2 for 5 h with SSIEFARL peptide and golgi plug. After 5 h the cells were washed and stained with IFN-�-intracellular (PE) andCD8 (FITC). FACS plots show percentage of CD8+IFN-�+ cells. (A) Uninfected, (B) infected and vector treated, (C) infected and pIL-21 treated, (D) infected and pIL-15 treated,( 21 tret timese

adtsonbtta

gHapgm

E) absolute numbers of CD8+IFN-�+ cells of mice uninfected, vector treated or pIL-reated or pIL-15 treated (four mice per group). The experiment was repeated threexperiment (*, P < 0.05; **P < 0.001; ***P < 0.0001).

hat it can accelerate the generation of cytotoxic T cell effectors inhe beginning of immune response.

We repeated the same immunization experiments with pIL-15,nd as seen in Fig. 4D, the percentage of CD8+ IFN-�+ T cells onay 12 after immunization was higher in mice that received pIL-15reatment compared with mice that received vector only. Resultsimilar to pIL-21 treatment was observed when absolute numberf CD8+ IFN-�+ T cells was analyzed, mice treated with vector wasot different from uninfected mice, but a difference was observedetween pIL-15 versus uninfected (p < 0.05) (Fig. 4F). Taken togetherhese data suggest that DNA immunization with pIL-15 and pIL-21reatment during the beginning of primary immune response canccelerate the effector phase.

.4. Determination of the optimal number of SSIEFARL specificD8+ T cells to be used in an adoptive transfer system

To study the effects of pIL-21 and pIL-15 in memory CD8+ T celleneration and maintenance in vivo, we used CD8+ T cells from

ated, (F) absolute numbers number of CD8+IFN-�+ cells of mice uninfected, vectorand the pattern of results were the same. The figure represents data from one such

clonal abundance of initial precursors, since the proliferation ofthese cells is benefited from a low clonal abundance (Hataye etal., 2006). Hence, as a first step we sought to determine the opti-mal amounts of total splenocytes from CD90.2+ SSIEFRAL transgenicmice to be transferred, by analyzing proliferation rates after parkingthem into recipient mice. In order to do this, we labeled total spleno-cytes of CD90.2+ SSIEFRAL mice with CFSE, adoptively transferredintravenously different amounts of these cells into C57BL/6 CD90.1+

recipient mice and infected the recipient mice intraperitoneallywith 5 × 106 PFU of HSV-KOS. Before transfer, the numbers of SSIE-FARL CD8+ T cells present in total splenocytes were determinedby FACS using SSIEFARL tetramer PE and anti-CD8-FITC stain-ing. Groups of C57BL/6 CD90.1+ received 2 × 103, 2 × 104, 2 × 105

or 1 × 106 CFSE labeled splenocytes. Each dose of total spleno-cytes transferred represented 2.88 × 102, 2.88 × 103, 2.88 × 104 and1.44 × 105 SSIEFARL CD8+ T cells, respectively. The recipient micewere sacrificed 7 days after infection. Splenocytes were stainedwith APC labeled anti-CD90.2, PE-labeled SSIEFARL tetramer andCy-chrome labeled anti-CD8, for FACS analysis.

The data in Fig. 5 shows the fold increase in SSIEFARL specificdonor CD8+ T cell population recovered 7 days after transfer andviral infection. When we adoptively transferred 1.44 × 105 SSIE-FARL CD8+ T cells (1 × 106 total splenocytes), the fold expansion ofthese cells was around 7.9 times. Interestingly, transfer of very low

1500 L. Rodrigues et al. / Molecular Immu

Fig. 5. Expansion of SSIEFARL CD8+ T cells with pIL-21 and pIL-15. (A) Titration oftotal CD90.2+ splenocytes from SSIEFARL transgenic mice needed for adoptive trans-fer: two female C57BL/6 phenotype CD90.2+ SSIEFARL transgenics were sacrificedand splenocytes isolated and pooled. Splenocytes were stained with CFSE and trans-ferred into female C57BL/6 phenotype CD90.1+ through the tail vain. Each group ofconsisting of three mice received different amounts of total splenocytes that con-tains decreasing numbers of CD90.2+ SSIEFARL CD8+ cells (1.44 × 105; 2.88 × 104;2.88 × 103 or 2.88 × 102). Twenty-four hours after transfer the mice were infectedi 6

tmCrtwmeTwdCtotwgeaowa

ntraperitoneally with 5 × 10 PFU of HSV-KOS. The mice were killed 7 days afternfection, splenocytes were isolated, red cell lysed and the cells were stained withSIEFARL tetramer PE; CD90.2 APC and CD8+ Cy-chrome and analyzed by FACS (***,< 0.001).

umbers of SSIEFARL CD8+ T cells (2.88 × 102) yielded a 902-foldncrease in the donor transgenic population, a highly significantxpansion (R2 0.9469, p < 0.0001). Taken together these resultsndicate that a low transfer of SSIEFARL cells is more efficient foreneration of new antigen specific responder CD8+ T cell.

.5. pIL-21 and pIL-15 increases the memory CD8+ T cellopulation in vivo

Once we arrived at the number of splenocytes to be transferredo produce a new progeny of CD8+ T cells and the formation of stable

emory T cells, we adoptively transferred 2 × 104 donor SSIEFARLD90.2+ total splenocytes into C57BL/6 CD90.1+ recipient mice. Theecipient mice were infected with HSV-KOS and kept for 60 dayso reach memory phase. Upon memory phase each group of miceere injected into tibial muscle with 75 �g of each cytokine plas-id construct alone, combined or in association with pgB (plasmid

ncoding HSV-glycoprotein B); vector only was used as a control.en days after DNA treatment the mice were sacrificed, splenocytesere isolated and the cells analyzed by FACS. The experimentalesign is represented in Fig. 6A and B depicts the percentage ofD44+ population gated from CD90.2+ CD8+ SSIEFARL+ cells. Micereated with pIL-21 and pIL-15 presented higher expression of CD44n transgenic CD8+ T cells compared with groups treated with vec-or only. This result showed that CD8+ CD44high memory populationas more frequent in pIL-21 and as well as pIL-15 alone treated

roups; the combination did not improve the levels reached by thexogenous treatment with each cytokine. The association of thentigen to the immunization significantly improved the percentagef gB specific CD44+CD8+ T cells by ∼30%. The memory populationas highest in the group treated with both the cytokines and the

ntigen.Once it was established that the IL-15 and IL-21 plasmids

ncreased the quantity of the memory response in vivo, we pro-eeded to analyze the quality of the CD8+ T cell response. This waseasured based on the ability of the CD8+ T cells to produce mul-

iple cytokines and cytotoxic granules. The splenocytes from eachroup of mice were isolated, stimulated with specific peptide and

nology 46 (2009) 1494–1504

later stained with appropriate antibodies (as mentioned in Section2) and evaluated for the ability of the CD8+ T cells to produce IFN-�, TNF-� and CD107a/b. The analysis showed a marked increasein the frequency of gB specific CD8+ T cells producing TNF-� andIFN-� when the mice were vaccinated with either of the cytokines.The percentage of this cell population increased when the anti-gen was added to the vaccination cocktail. The quality of the CD8+

T cells was highest when the mice received the plasmids encod-ing both the cytokines along with the antigen (Fig. 6D and E). Thepolyfunctionality of the CD8+ T cells (CD8+IFN-�+TNF-�+) improvedvastly even upon vaccination with either p-IL-21 (29 ± 4.5) or pIL-15 (33.7 ± 5.1), it increased more than 13% when the vaccinationwas administered along with the antigen. But the maximum ben-efit was observed with the administration of plasmids encodingIL-21, IL-15 and the antigen (65 ± 12.6). Vaccination with the plas-mid encoding IL-21 and IL-15 also increased the cytotoxic ability ofthe HSV specific CD8+ T cells in terms of the CD 107 a and b expres-sion. Injection of the antigen encoding plasmid further improvedthe CD107 a/b expression by more than 5%. Taken together theseresults show that pIL-21 and pIL-15 injection, alone or in combina-tion during memory phase results in an additive effect on memoryCD8+ T cells numbers, even in absence of antigen. But the additionof the antigen further enhanced the CD8+ T cell memory responseto HSV in a highly significant level.

4. Discussion

In this study, an attempt was made to determine if murine IL-21alone or in combination with murine IL-15 could expand the HSV-1antigen specific memory CD8+ T cells by a homeostatic mechanism.To test this hypothesis, a genetic therapy with both cytokines undercontrol of ferritin promoter was used, this was established to bemore efficient than the CMV promoter in vitro. The cytokines alonewere able to expand the anti-HSV specific memory CD8+ T cells,but when combined with TCR stimulation by cognate antigen, theresponse was even stronger and long lasting.

With the main objective being to investigate the roles of pIL-21 and pIL-15 on CD8+ T cells, we tested if the cytokines presentin the supernatant of cells transfected with each plasmid couldexpand lymphocytes isolated from naïve mice. As shown in Fig. 2,the supernatant from cells transfected with pIL-21 increased thefrequency of CD3+CD8+ T cells twofold, compared with IL-2 alone.Indeed, IL-21 can efficiently expand CD8+ T cells, but this cytokineneeds help from other � chain-receptor using cytokines (IL-2, IL-7,IL-15 or IL-18) to promote this expansion in the absence of TCRstimulation (Zeng et al., 2005). In contrast, when we associatedanti-CD3, the increase in frequency of CD3+CD8+ cells was highlysignificant (Fig. 2E). These results agree with the first studies usingIL-21 reported by Parrish-Novak et al., which showed that the IL-21 receptor (IL-21R) is expressed by CD8+ T cells, and this cytokineacts in concert with IL-2 to promote T cell proliferation (Parrish-Novak et al., 2002). Recent studies have shown that the IL-21R isupregulated on T lymphocytes in response to either TCR stimula-tion or IL-21 (Jin et al., 2004; Wu et al., 2005). Also IL-21 augmentsthe frequency of antigen-specific CD8+ T cells following primary invitro stimulation around 20-fold, compared with no IL-21 addition(Li et al., 2005) in the ex vivo generation of potent Ag(melanoma)-specific CTLs for adoptive therapy. In our study, it is also possiblethat IL-21 acted in synergy with IL-2 produced by activated CD4+ Tcells, and that may have affected the CD8+ T cells expansion.

The supernatant of cells transfected with pIL-15 were also testedon splenocytes in vitro, however no improvement in CD3+CD8+ Tcell frequency was observed. This agreed with previous reportsshowing that naïve murine CD8+ T cells do not respond to human ormouse IL-15 stimulation in vitro, unless antigen is present (Carrio

eueobc

FCtcogi

t al., 2004). In contrast, human CD8+ T cells proliferate under stim-lation with IL-15 in vitro, without the need for antigen (Alves

ig. 6. pIL-21 and pIL-15 induces HSV-1 specific memory CD8+ T cell expansion. (A) C57BL/D90.2+ mice and infected intraperitoneally with 5 × 106 PFU of HSV-KOS. Sixty days after ior, alone or in combination. The immune response in spleen was analyzed 10 days after plasells recovered from each group of mice. Figure (C) and (D) represents the percentage of vif polyfunctional CD8+ T cells (CD8+tetramer+IFN-�+TNF-�+ cells) while the figure (F) depicating the population of cells that were CD90.2+, CD8+ and SSIEFARL+. Results are represetself was repeated with same outcome.

nology 46 (2009) 1494–1504 1501

The studies were extended to test if these findings would bereproducible in vivo, during the priming of an immune response

T cells during the expansion phase of viral specific CD8+ T cells.

6 CD90.1+ mice were adoptively transferred with 2 × 104 splenocytes from SSIEFARLnfection, groups of four mice were treated with 75 �g of pIL-21, pIL-15, pgB and vec-mid treatment. (B) Percentage of CD44 on gated CD90.2 + CD8 + SSIEAFARL + specific

rus specific CD8+ T cells producing IFN-� and TNF-�. Figure (E) shows the frequencyts the CD107a/b expression pattern in all the groups. Cell counts were obtained after

ntative of four mice per group (*P < 0.05; **P < 0.001; ***P < 0.0001). The experiment

1502 L. Rodrigues et al. / Molecular Immunology 46 (2009) 1494–1504

(Conti

T2hiaCt(ialaf2

i1TcaITBwapt

dfotdC

Fig. 6.

he improved antigen specific effector CD8+ T cell response to IL-1 treatment has been seen in other studies as well. Accordingly, itas been observed that IL-21R signaling activates PI3K pathway and

nduces Bcl2 expression, promoting CD8+ T cell survival (Ostiguy etl., 2007). Also, the benefits of IL-21 treatment on antigen-specificD8+ CTL frequencies during the effector phase were observed inumor models as well as in cytomegalovirus vaccination studiesSondergaard et al., 2007; van Leeuwen et al., 2002). Our results aren agreement with previous reports that showed that injection ofn IL-21 coding plasmid alone increases the percentage and abso-ute numbers of CD3+ and CD8+ cells (Wang et al., 2003), and IL-21dministration during the early phase of the immune response con-ers benefits to antigen specific CD8+ T cell response (Moroz et al.,004).

A similar pattern of results were observed when mice werenfected and treated with pIL-15. Although the main targets for IL-5 are memory CD8+ T cells, this cytokine can also regulate CD8+

cells during priming phase. IL-15 is an essential factor for res-ue of CD8+ T cell from apoptosis during the contraction phase,fter infection with an intracellular pathogen (Yajima et al., 2006).nterleukin-15 is also one of the factors involved in survival of CD8+

cells and its effects are mediated by induction of expression ofcl-2 anti-apoptotic members (Williams et al., 2006). Indeed, IL-15as already described as an adjuvant to CTL responses (Calarota et

l., 2003, 2008; Dubsky et al., 2007; Kutzler et al., 2005). There is aossibility that effectors CD8+ T cells were saved from apoptosis byhe IL-15 produced after plasmid administration.

The effect of genetic delivery of pIL-15 and pIL-21 was testeduring the memory phase of the response, using an adoptive trans-

nued ).

As seen in Fig. 5, when a high amount of SSIEFARL CD8+ T cellswere transferred (1.44 × 105), a 10-fold expansion was observed;contrastingly, when a low amount was transferred (2.88 × 102), a900-fold increase was observed. This result agreed with the findingthat a low cell frequency is important for the formation of a stableeffector memory CD8+ T cell pool (Marzo et al., 2005), and stressedthe importance of clonal competition among antigen specific pre-cursors for survival signals provided by TCR recognition, as reportedby Hataye et al. (2006). Hence, consecutive adoptive transfer exper-iments were performed with low numbers of SSIEFARL CD8+ T cells,because it favored the survival and activation of CD8+ T cells.

The administration of plasmids coding for IL-15 or IL-21 alone orin combination during memory phase of HSV-1 infection lead to anincrease of expression of CD44 on CD90.2+CD8+ cells. Also, whenpgB was associated with the cytokine DNA treatment a significantincrease in the magnitude of expression of CD44 was observed com-pared to the cytokine treatment alone. Numbers of CD8+ T cells thatexpressed T memory and HSV-specific markers (CD44 and SSIEFARLtetramer) in a monoclonal population were augmented by pIL-21or pIL-15 alone or in combination. However when pIL-15 and pgBwas used, some groups showed additional improvement in cytokineproducing ability of the CD8+ T cells as well as the cytotoxicity. SinceIL-15 is well studied as a memory proliferation factor, especially toCD8, it was expected that these cells do express the IL-15 recep-tor complex (Gasser et al., 2000; Sato et al., 2007). It has alreadybeen reported that IL-21 alone or in combination with IL-15 couldinfluence the frequency of memory CD8+ T cells. In some cases, theproliferation resulted from the cytokine combination can be usedto induce protection to virus infection or tumor using association

To develop viral vaccines or therapies for protection from viralinfection and replication, augmentation of CD8+ T cell function isconsidered important. In the case of HSV-1, CD8+ T cells play an

iK2mam(b1rnIcWCm(

cHdhtaowdT2cbttcItwma

rpmltlpttaiate

TitIacwwTep

mportant function on herpes recurrence (Decman et al., 2005;hanna et al., 2004; Prabhakaran et al., 2005; Sheridan et al.,007). Hence, the function of CD8+ T cells from each plasmid treat-ent was tested by determining IFN-� production by these cells

fter antigen stimuli. All plasmid treatments lead to an increase inagnitude of CD8+IFN-�+ cell, compared to vector injection alone

Fig. 6E). However, the compensation for CD8+IFN-�+ cell frequencyy plasmid cytokine treatment was most evident when pIL-21, pIL-5 and pgB were administered together. This observation is easilyevealed when cell numbers were analyzed. Interleukin-15 sig-aling is important for memory CD8+ T cell proliferation, but for

FN-� production and cytotoxity of this cells, others immune factorsan influence for better response (Schoenborn and Wilson, 2007;

ilson et al., 2008). Priming of CD8+ T cell required MHC-I:TCR andD28:B7 interaction and also CD4+ T cell help is needed. In case ofemory T cells it is not clear if these three signals are crucial events

Mescher et al., 2006) and necessary.Bolesta and colleagues showed that the combination of plasmids

oding for IL-21 and IL-15 can lead to an optimal augmentation ofIV specific T cell response when provided after Ag priming. Theyefend the notion that IL-21 exposure to an immune system thatas been primed with an antigen specific stimulation may lead tohe optimal augmentation of immune response and also that IL-21nd IL-15 combination can replace the CD4+ T cell help for mem-ry cells (Bolesta et al., 2006). Also, protective immune responsesere observed in tumor and viral models after IL-15 and IL-21 geneelivery, and this protection was related with substitution of CD4+

cell help by the cytokines (Kutzler et al., 2005; van Leeuwen et al.,002). Our results suggest that pIL-21 and pIL-15 plasmid treatmentan provide additional signals to memory CD8+ T cells to proliferatey homeostatic ways and the antigen provide a signal that poten-iates cytokine production. Studies with naïve T cells have shownhat IL-21 slightly increases IL-15-induced proliferation of CD8+ Tells, but IL-21 can prevent the CD28 down-regulation mediated byL-15. Interleukin-21 can preserve the capacity of naïve CD8+ T cellso be activated upon IL-15 stimulation(Alves et al., 2005). Perhapshen pIL-21, pIL-15 and pgB as antigen was associated, the maxi-al signals necessary for memory CD8 proliferation and function

re provided.An important point to be considered is that all of these studies

eported previously used cytokine treatment during the priminghase, together with antigen, and analyzed what happened in theemory phase. However, in our system, the antigen-specific popu-

ation was expanded during priming phase with viral infection andhe cytokine plasmids were administrated after the memory popu-ation was established. Our data suggested that during the memoryhase, IL-21 and/or IL-15 could support the homeostatic prolifera-ion of antigen specific CD8+ T cells. Indeed, the critical moment forhe generation of an efficient memory T cell pool to viral infectionppears to be during the initial antigen encounter, rather than dur-ng memory. Initial contact with antigen can impact the magnitudend quality of initial cytotoxic T lymphocytes responses as well ashe efficacy and longevity of the ensuing CD8+ memory pool (Prlict al., 2006, 2007).

Taken together, all results suggest that during the priming phase,CR signaling provided by anti-CD3 in vitro or virus infection in vivos crucial for the magnitude of CD8+ proliferation and function, andhat cytokines improve the response. In summary, we propose thatL-21 and IL-15 can be used as genetic adjuvants in cell therapynd vaccination to improve anti-viral immunity. These cytokinesan induce proliferation of naïve and memory CD8+ T cells with or

he optimized genetic system developed in this study is highly cost-ffective, and presents the same effects described before when theurified cytokines were employed. Finally, our data suggest that if

nology 46 (2009) 1494–1504 1503

the memory pool is expanded by IL-21 and IL-15, contacts withantigen such as infectious challenge will provide the signals forIFN-� and TNF-� production by antigen specific CD8+ T cells, thusenhancing the response.

Acknowledgements

Funding: Startup funds to UK, Department of Microbiology,Quillen College of Medicine, ETSU and NIH grant # AI 106336501 toBTR.

References

Althaus, C.L., Ganusov, V.V., De Boer, R.J., 2007. Dynamics of CD8+ T cell responses dur-ing acute and chronic lymphocytic choriomeningitis virus infection. J. Immunol.179, 2944–2951.

Alves, N.L., Arosa, F.A., van Lier, R.A., 2005. IL-21 sustains CD28 expression on IL-15-activated human naive CD8+ T cells. J. Immunol. 175, 755–762.

Alves, N.L., Arosa, F.A., van Lier, R.A., 2007. Common gamma chain cytokines: dissi-dence in the details. Immunol. Lett. 108, 113–120.

Alves, N.L., Hooibrink, B., Arosa, F.A., van Lier, R.A., 2003. IL-15 induces antigen-independent expansion and differentiation of human naive CD8+ T cells in vitro.Blood 102, 2541–2546.

Bolesta, E., Kowalczyk, A., Wierzbicki, A., Eppolito, C., Kaneko, Y., Takiguchi, M., Sta-matatos, L., Shrikant, P.A., Kozbor, D., 2006. Increased level and longevity ofprotective immune responses induced by DNA vaccine expressing the HIV-1 Envglycoprotein when combined with IL-21 and IL-15 gene delivery. J. Immunol. 177,177–191.

Boyman, O., Purton, J.F., Surh, C.D., Sprent, J., 2007. Cytokines and T-cell homeostasis.Curr. Opin. Immunol. 19, 320–326.

Brandt, K., Bulfone-Paus, S., Foster, D.C., Ruckert, R., 2003a. Interleukin-21 inhibitsdendritic cell activation and maturation. Blood 102, 4090–4098.

Brandt, K., Bulfone-Paus, S., Jenckel, A., Foster, D.C., Paus, R., Ruckert, R., 2003b.Interleukin-21 inhibits dendritic cell-mediated T cell activation and inductionof contact hypersensitivity in vivo. J. Invest. Dermatol. 121, 1379–1382.

Brown, S.A., Hurwitz, J.L., Zhan, X., Doherty, P.C., Slobod, K.S., 2005. CD8+ T-cells:are they sufficient to prevent, contain or eradicate HIV-1 infection? Curr. DrugTargets Infect. Disord. 5, 113–119.

Calarota, S.A., Dai, A., Trocio, J.N., Weiner, D.B., Lori, F., Lisziewicz, J., 2008. IL-15 asmemory T-cell adjuvant for topical HIV-1 DermaVir vaccine. Vaccine.

Calarota, S.A., Otero, M., Hermanstayne, K., Lewis, M., Rosati, M., Felber, B.K., Pavlakis,G.N., Boyer, J.D., Weiner, D.B., 2003. Use of interleukin 15 to enhance interferon-gamma production by antigen-specific stimulated lymphocytes from rhesusmacaques. J. Immunol. Methods 279, 55–67.

Carrio, R., Bathe, O.F., Malek, T.R., 2004. Initial antigen encounter programs CD8+ Tcells competent to develop into memory cells that are activated in an antigen-free IL-7- and IL-15-rich environment. J. Immunol. 172, 7315–7323.

Carrio, R., Rolle, C.E., Malek, T.R., 2007. Non-redundant role for IL-7R signaling forthe survival of CD8+ memory T cells. Eur. J. Immunol. 37, 3078–3088.

Casey, K.A., Mescher, M.F., 2007. IL-21 promotes differentiation of naive CD8 T cellsto a unique effector phenotype. J. Immunol. 178, 7640–7648.

Cauley, L.S., Hogan, R.J., Woodland, D.L., 2002. Memory T-cells in non-lymphoidtissues. Curr. Opin. Invest. Drugs 3, 33–36.

Collins, M., Whitters, M.J., Young, D.A., 2003. IL-21 and IL-21 receptor: a new cytokinepathway modulates innate and adaptive immunity. Immunol. Res. 28, 131–140.

Coquet, J.M., Kyparissoudis, K., Pellicci, D.G., Besra, G., Berzins, S.P., Smyth, M.J., God-frey, D.I., 2007. IL-21 is produced by NKT cells and modulates NKT cell activationand cytokine production. J. Immunol. 178, 2827–2834.

Cui, F.D., Asada, H., Jin, M.L., Kishida, T., Shin-Ya, M., Nakaya, T., Kita, M., Ishii, M., Iwai,M., Okanoue, T., Imanishi, J., Mazda, O., 2005. Cytokine genetic adjuvant facil-itates prophylactic intravascular DNA vaccine against acute and latent herpessimplex virus infection in mice. Gene Ther. 12, 160–168.

Decman, V., Freeman, M.L., Kinchington, P.R., Hendricks, R.L., 2005. Immune controlof HSV-1 latency. Viral Immunol. 18, 466–473.

Dubois, S., Mariner, J., Waldmann, T.A., Tagaya, Y., 2002. IL-15Ralpha recycles andpresents IL-15 In trans to neighboring cells. Immunity 17, 537–547.

Dubsky, P., Saito, H., Leogier, M., Dantin, C., Connolly, J.E., Banchereau, J., Palucka,A.K., 2007. IL-15-induced human DC efficiently prime melanoma-specific naiveCD8+ T cells to differentiate into CTL. Eur. J. Immunol. 37, 1678–1690.

Gasser, S., Corthesy, P., Beerman, F., MacDonald, H.R., Nabholz, M., 2000. Constitutiveexpression of a chimeric receptor that delivers IL-2/IL-15 signals allows antigen-independent proliferation of CD8+CD44high but not other T cells. J. Immunol. 164,5659–5667.

Hamilton, S.E., Wolkers, M.C., Schoenberger, S.P., Jameson, S.C., 2006. The generationof protective memory-like CD8+ T cells during homeostatic proliferation requires

Hataye, J., Moon, J.J., Khoruts, A., Reilly, C., Jenkins, M.K., 2006. Naive and memoryCD4+ T cell survival controlled by clonal abundance. Science 312, 114–116.

Jin, H., Carrio, R., Yu, A., Malek, T.R., 2004. Distinct activation signals determinewhether IL-21 induces B cell costimulation, growth arrest, or Bim-dependentapoptosis. J. Immunol. 173, 657–665.

1 Immu

H., Yoshikai, Y., 2006. IL-15 regulates CD8+ T cell contraction during primary

504 L. Rodrigues et al. / Molecular

asaian, M.T., Whitters, M.J., Carter, L.L., Lowe, L.D., Jussif, J.M., Deng, B., Johnson,K.A., Witek, J.S., Senices, M., Konz, R.F., Wurster, A.L., Donaldson, D.D., Collins,M., Young, D.A., Grusby, M.J., 2002. IL-21 limits NK cell responses and promotesantigen-specific T cell activation: a mediator of the transition from innate toadaptive immunity. Immunity 16, 559–569.

hanna, K.M., Bonneau, R.H., Kinchington, P.R., Hendricks, R.L., 2003. Herpes sim-plex virus-specific memory CD8+ T cells are selectively activated and retainedin latently infected sensory ganglia. Immunity 18, 593–603.

hanna, K.M., Lepisto, A.J., Decman, V., Hendricks, R.L., 2004. Immune control ofherpes simplex virus during latency. Curr. Opin. Immunol. 16, 463–469.

utzler, M.A., Robinson, T.M., Chattergoon, M.A., Choo, D.K., Choo, A.Y., Choe,P.Y., Ramanathan, M.P., Parkinson, R., Kudchodkar, S., Tamura, Y., Sidhu, M.,Roopchand, V., Kim, J.J., Pavlakis, G.N., Felber, B.K., Waldmann, T.A., Boyer, J.D.,Weiner, D.B., 2005. Coimmunization with an optimized IL-15 plasmid results inenhanced function and longevity of CD8 T cells that are partially independentof CD4 T cell help. J. Immunol. 175, 112–123.

ee, S.K., Surh, C.D., 2005. Role of interleukin-7 in bone and T-cell homeostasis.Immunol. Rev. 208, 169–180.

i, Y., Bleakley, M., Yee, C., 2005. IL-21 influences the frequency, phenotype, andaffinity of the antigen-specific CD8 T cell response. J. Immunol. 175, 2261–2269.

iu, J., Wu, C.Y., 2007. Subpopulations and cytokine expression of naive and memoryT cells in normal human PBMCs. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi 23, 2–5.

arzo, A.L., Klonowski, K.D., Le Bon, A., Borrow, P., Tough, D.F., Lefrancois, L., 2005.Initial T cell frequency dictates memory CD8+ T cell lineage commitment. Nat.Immunol. 6, 793–799.

ehta, D.S., Wurster, A.L., Whitters, M.J., Young, D.A., Collins, M., Grusby, M.J., 2003.IL-21 induces the apoptosis of resting and activated primary B cells. J. Immunol.170, 4111–4118.

escher, M.F., Curtsinger, J.M., Agarwal, P., Casey, K.A., Gerner, M., Hammerbeck,C.D., Popescu, F., Xiao, Z., 2006. Signals required for programming effector andmemory development by CD8+ T cells. Immunol. Rev. 211, 81–92.

oroz, A., Eppolito, C., Li, Q., Tao, J., Clegg, C.H., Shrikant, P.A., 2004. IL-21 enhancesand sustains CD8+ T cell responses to achieve durable tumor immunity: com-parative evaluation of IL-2, IL-15, and IL-21. J. Immunol. 173, 900–909.

ishimura, H., Washizu, J., Nakamura, N., Enomoto, A., Yoshikai, Y., 1998. Transla-tional efficiency is up-regulated by alternative exon in murine IL-15 mRNA. J.Immunol. 160, 936–942.

hteki, T., Tada, H., Ishida, K., Sato, T., Maki, C., Yamada, T., Hamuro, J., Koyasu, S., 2006.Essential roles of DC-derived IL-15 as a mediator of inflammatory responses invivo. J. Exp. Med. 203, 2329–2338.

stiguy, V., Allard, E.L., Marquis, M., Leignadier, J., Labrecque, N., 2007. IL-21 promotesT lymphocyte survival by activating the phosphatidylinositol-3 kinase signalingcascade. J. Leukocyte Biol. 82, 645–656.

zaki, K., Spolski, R., Feng, C.G., Qi, C.F., Cheng, J., Sher, A., Morse, H.C., 3rd, Liu,C., Schwartzberg, P.L., Leonard, W.J., 2002. A critical role for IL-21 in regulatingimmunoglobulin production. Science 298, 1630–1634.

arrish-Novak, J., Foster, D.C., Holly, R.D., Clegg, C.H., 2002. Interleukin-21 and theIL-21 receptor: novel effectors of NK and T cell responses. J. Leukocyte Biol. 72,856–863.

rabhakaran, K., Sheridan, B.S., Kinchington, P.R., Khanna, K.M., Decman, V., Lathrop,K., Hendricks, R.L., 2005. Sensory neurons regulate the effector functions of CD8+

T cells in controlling HSV-1 latency ex vivo. Immunity 23, 515–525.rlic, M., Hernandez-Hoyos, G., Bevan, M.J., 2006. Duration of the initial TCR stimulus

controls the magnitude but not functionality of the CD8+ T cell response. J. Exp.

rlic, M., Williams, M.A., Bevan, M.J., 2007. Requirements for CD8 T-cell priming,memory generation and maintenance. Curr. Opin. Immunol. 19, 315–319.

andau, M.M., Winstead, C.J., Jameson, S.C., 2007. IL-15 is required for sustainedlymphopenia-driven proliferation and accumulation of CD8 T cells. J. Immunol.179, 120–125.

nology 46 (2009) 1494–1504

Sato, N., Patel, H.J., Waldmann, T.A., Tagaya, Y., 2007. The IL-15/IL-15Ralpha on cellsurfaces enables sustained IL-15 activity and contributes to the long survival ofCD8 memory T cells. Proc. Natl. Acad. Sci. U.S.A. 104, 588–593.

Schoenborn, J.R., Wilson, C.B., 2007. Regulation of interferon-gamma during innateand adaptive immune responses. Adv. Immunol. 96, 41–101.

Sheridan, B.S., Knickelbein, J.E., Hendricks, R.L., 2007. CD8 T cells and latent herpessimplex virus type 1: keeping the peace in sensory ganglia. Exp. Opin. Biol. Ther.7, 1323–1331.

Sierro, S., Rothkopf, R., Klenerman, P., 2005. Evolution of diverse antiviral CD8+ Tcell populations after murine cytomegalovirus infection. Eur. J. Immunol. 35,1113–1123.

Sin, J.I., Kim, J., Pachuk, C., Weiner, D.B., 2000. Interleukin 7 can enhance antigen-specific cytotoxic-T-lymphocyte and/or Th2-type immune responses in vivo.Clin. Diagn. Lab. Immunol. 7, 751–758.

Sondergaard, H., Frederiksen, K.S., Thygesen, P., Galsgaard, E.D., Skak, K., Kristjansen,P.E., Odum, N., Kragh, M., 2007. Interleukin 21 therapy increases the density oftumor infiltrating CD8+ T cells and inhibits the growth of syngeneic tumors.Cancer Immunol. Immunother. 56, 1417–1428.

Stoklasek, T.A., Schluns, K.S., Lefrancois, L., 2006. Combined IL-15/IL-15Ralphaimmunotherapy maximizes IL-15 activity in vivo. J. Immunol. 177, 6072–6080.

Strengell, M., Matikainen, S., Siren, J., Lehtonen, A., Foster, D., Julkunen, I., Sareneva,T., 2003. IL-21 in synergy with IL-15 or IL-18 enhances IFN-gamma productionin human NK and T cells. J. Immunol. 170, 5464–5469.

Strengell, M., Sareneva, T., Foster, D., Julkunen, I., Matikainen, S., 2002. IL-21 up-regulates the expression of genes associated with innate immunity and Th1response. J. Immunol. 169, 3600–3605.

Tan, J.T., Surh, C.D., 2006. T cell memory. Curr. Top. Microbiol. Immunol. 311, 85–115.

van Leeuwen, E.M., Gamadia, L.E., Baars, P.A., Remmerswaal, E.B., ten Berge, I.J., vanLier, R.A., 2002. Proliferation requirements of cytomegalovirus-specific, effector-type human CD8+ T cells. J. Immunol. 169, 5838–5843.

Waldmann, T.A., 2006. The biology of interleukin-2 and interleukin-15: implicationsfor cancer therapy and vaccine design. Nat. Rev. Immunol. 6, 595–601.

Wallace, D.L., Berard, M., Soares, M.V., Oldham, J., Cook, J.E., Akbar, A.N., Tough, D.F.,Beverley, P.C., 2006. Prolonged exposure of naive CD8+ T cells to interleukin-7 or interleukin-15 stimulates proliferation without differentiation or loss oftelemeters length. Immunology 119, 243–253.

Wang, G., Tschoi, M., Spolski, R., Lou, Y., Ozaki, K., Feng, C., Kim, G., Leonard, W.J.,Hwu, P., 2003. In vivo antitumor activity of interleukin 21 mediated by naturalkiller cells. Cancer Res. 63, 9016–9022.

Wherry, E.J., Barber, D.L., Kaech, S.M., Blattman, J.N., Ahmed, R., 2004. Antigen-independent memory CD8 T cells do not develop during chronic viral infection.Proc. Natl. Acad. Sci. U.S.A. 101, 16004–16009.

Williams, M.A., Holmes, B.J., Sun, J.C., Bevan, M.J., 2006. Developing and maintainingprotective CD8+ memory T cells. Immunol. Rev. 211, 146–153.

Wilson, D.C., Matthews, S., Yap, G.S., 2008. IL-12 signaling drives CD8+ T cell IFN-gamma production and differentiation of KLRG1+ effector subpopulations duringToxoplasma gondii infection. J. Immunol. 180, 5935–5945.

Wu, Z., Kim, H.P., Xue, H.H., Liu, H., Zhao, K., Leonard, W.J., 2005. Interleukin-21receptor gene induction in human T cells is mediated by T-cell receptor-inducedSp1 activity. Mol. Cell Biol. 25, 9741–9752.

Yajima, T., Yoshihara, K., Nakazato, K., Kumabe, S., Koyasu, S., Sad, S., Shen, H., Kuwano,

infection. J. Immunol. 176, 507–515.Zeng, R., Spolski, R., Finkelstein, S.E., Oh, S., Kovanen, P.E., Hinrichs, C.S., Pise-Masison,

C.A., Radonovich, M.F., Brady, J.N., Restifo, N.P., Berzofsky, J.A., Leonard, W.J., 2005.Synergy of IL-21 and IL-15 in regulating CD8+ T cell expansion and function. J.Exp. Med 201, 139–148.

IL-21 and IL-15 cytokine DNA augments HSV specific effector and memory CD8+ T cell response

Documents