Proteomic analysis of low‐to high‐grade astrocytomas reveals an alteration of the expression...

transcript

RESEARCH ARTICLE

Proteomic analysis of low- to high-grade astrocytomas

reveals an alteration of the expression level of raf kinase

inhibitor protein and nucleophosmin

Marcela Gimenez1,2, Vanessa Cristina de Oliveira Souza1,2, Clarice Izumi1,Manuela R. Barbieri1,2, Roger Chammas2,3, Sueli Mieko Oba-Shinjo4,Miyuki Uno4, Suely Kazue Nagahashi Marie4 and Jose Cesar Rosa1,2

1 Protein Chemistry Center and Department of Molecular and Cell Biology, School of Medicine of Ribeirao Preto,University of Sao Paulo, Sao Paulo, Brazil

2 CEPID-CTC Center for Cell Therapy, Fundac- ao Hemocentro de Ribeirao Preto, Ribeirao Preto, Brazil3 Department of Radiology, Laboratory of Experimental Oncology LIM-24, Sao Paulo, Brazil4 Laboratory of Molecular and Cellular Biology, Department of Neurology, School of Medicine of Sao Paulo,

University of Sao Paulo, Sao Paulo, Brazil

Received: October 27, 2009

Revised: March 29, 2010

Accepted: May 15, 2010

Proteomic approaches have been useful for the identification of aberrantly expressed proteins

in complex diseases such as cancer. These proteins are not only potential disease biomarkers,

but also targets for therapy. The aim of this study was to identify differentially expressed

proteins in diffuse astrocytoma grade II, anaplastic astrocytoma grade III and glioblastoma

multiforme grade IV in human tumor samples and in non-neoplastic brain tissue as control

using 2-DE and MS. Tumor and control brain tissue dissection was guided by histological

hematoxylin/eosin tissue sections to provide more than 90% of tumor cells and astrocytes. Six

proteins were detected as up-regulated in higher grade astrocytomas and the most important

finding was nucleophosmin (NPM) (po0.05), whereas four proteins were down-regulated,

among them raf kinase inhibitor protein (RKIP) (po0.05). We report here for the first time

the alteration of NPM and RKIP expression in brain cancer. Our focus on these proteins was

due to the fact that they are involved in the PI3K/AKT/mTOR and RAS/RAF/MAPK path-

ways, known for their contribution to the development and progression of gliomas. The

proteomic data for NPM and RKIP were confirmed by Western blot, quantitative real-time

PCR and immunohistochemistry. Due to the participation of NPM and RKIP in uncontrolled

proliferation and evasion of apoptosis, these proteins are likely targets for drug development.

Keywords:

2-DE / Astrocytomas / Biomedicine / Gliomas / Nucleophosmin / Raf kinase

inhibitor protein

1 Introduction

Astrocytomas comprise a wide range of neoplasms whose

differences reflect genetic alterations acquired during

malignant transformation and the histological grading

is a means to predict their biological behavior [1]. The

Abbreviations: AA, anaplastic astrocytoma; AST, diffuse astro-

cytoma; CRMP2/DPYL2, collapsin-related membrane protein 2;

ESI-3Q-MS, electrospray triple quadrupole mass spectrometry;

GBM, glioblastoma multiforme; KCRB, creatine kinase chain B;

NN, non-neoplastic brain tissue; NPM, nucleophosmin; QT-PCR,

quantitative real-time RT-PCR; RKIP, raf kinase inhibitor protein;

% vol, normalized volume of spots; WHO, World Health

Organization

Correspondence: Professor Jose Cesar Rosa, Protein Chemistry

Center and Department of Molecular and Cell Biology, School of

Medicine of Ribeirao Preto, University of Sao Paulo, Av.

Bandeirantes, 3900, 14049-900 Ribeirao Preto, SP/Brazil

E-mail: jcrosa@fmrp.usp.br

Fax: 155-16-2101-9366

& 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com

2812 Proteomics 2010, 10, 2812–2821DOI 10.1002/pmic.200900722

classification of a tumor as astrocytic depends on the

recognition of tumor cell areas that have histological

features of astrocytes and/or express gene products char-

acteristically found in this cell type [2]. The World Health

Organization (WHO) classifies diffusely infiltrating astro-

cytic tumors as grade II (diffuse astrocytoma-AST), grade III

(anaplastic astrocytoma (AA)) and grade IV (glioblastoma

multiforme (GBM)) [1]. Low-grade astrocytomas (grade II)

develop slowly and can display an intrinsic tendency to

progress to more malignant phenotypes, that is, AAs (WHO

grade III) and eventually glioblastomas, the most aggressive

subtype (WHO grade IV) [3].

Deletions or inactivation of tumor suppressor gene p53

represents the most frequent genetic alterations in ASTs

and the most significant ones for malignant transformation.

Mutations in other regulatory factors such as amplifications

of gene Rb and also of genes such as CDK4 and MDM2 have

been described [3–5]. Changes in tyrosine-kinase receptors

such as EGFR, PDGFR and VEGFR are also observed in

astrocytomas, and the most important pathways involved in

the downstream oncogenesis of these growth factor recep-

tors are PI3K/Akt and Ras/MAPK [6, 7].

Although techniques for the analysis of gene expression,

such as ‘‘microarray’’, have led to the mapping of genes that

are up- or down-regulated in tissues or cells involved in

brain cancer, only a fraction of these changes in the

expression of mRNA has been confirmed by the expression

of proteins through proteomic analysis [8, 9]. We performed

a proteomic study based on 2-DE and MS (MALDI-TOF and

ESI-MS/MS) using astrocytomas surgically removed from

patients to identify differentially expressed proteins in these

tumors according to increasing levels of malignancy (grades

II, III and IV), compared with samples obtained from non-

neoplastic (NN) brain tissue. This comprehensive approach

allowed the identification of a small number of proteins

frequently accumulated or lost in the samples studied. We

then mapped the potential functions of these proteins and

focused our attention on nucleophosmin (NPM) and raf

kinase inhibitor protein (RKIP), validating their differential

expression in an independent set of human samples.

Overexpression of NPM and decreased expression of RKIP

seem to be common features of glioblastomas, suggesting

that these proteins may be useful biomarkers for diagnosis

and prognosis and may represent interesting targets for

therapeutic strategies and drug development [10, 11].

2 Materials and methods

2.1 Reagents and antibodies

All reagents and solvents were purchased from Sigma

(St. Louis, MO) and Pierce (Rockford, IL). Electrophoresis

buffer and gel reagents/solvents were purchased from GE

Healthcare (Uppsala, Sweden). Modified trypsin was

purchased from Promega (Madison, WI). Antibodies were

purchased from different sources: anti-NPM (Zymed, clone

FC61991, Invitrogen, Carlsbad, CA, and clone NA24,

Thermo Scientific, NeoMarks, Fremont, CA), anti-b-actin

(clone ACTBD11B7, Santa Cruz Biotechnology, Santa Cruz,

CA) and anti-RKIP (Zymed, clone:4D11E8, Invitrogen). A

protease inhibitor cocktail was purchased from Sigma-

Aldrich product number P8340 (Sigma-Aldrich, St. Louis,

2.2 Tissue specimens

During surgery, tissue samples from tumors were collected,

snap frozen in liquid nitrogen and stored at �801C in

appropriate vials. Guided by the microscopic examination of

cryosections, tissue samples were micro-dissected in order

to remove areas of necrosis, cellular debris and any NN

tissue. A diagnostic confirmation was performed during this

procedure. The tumor areas of interest were collected into

microvials, kept on dry ice during handling and stored at

�801C. All tumor specimens were examined micro-

scopically and graded according to the latest WHO classifi-

cation of CNS tumors by two independent pathologists with

full diagnostic agreement. The tumors were graded as ASTs

(grade II) (n 5 5; mean age at diagnosis: 31.278.2; three

males and two females), AAS (grade III) (n 5 5; mean age at

diagnosis: 32.878.2; two males and three females) and

glioblastomas (GBM – grade IV) (n 5 5; mean age at diag-

nosis: 46.4713.8; three males and two females).

NN brain tissue obtained from individuals submitted to

temporal lobe resection for epilepsy surgery was used as

control and examined by a pathologist who confirmed the

abundance of astrocytic cells in the resected tissue (n 5 5;

mean age: 37.474.5; three males and two females). For the

gene expression procedure, 19 NN brain tissues and 138

astrocytic tumor samples, consisting of 26 AST, 18 AA and

84 GBM, were analyzed. The use of human material in this

study was approved by the National Bioethics Commission

of Brazil and by the Ethics Committee of the Medical School

of Ribeirao Preto, University of Sao Paulo. Written consent

was obtained from patients authorizing the use of their

tissues in the present investigation.

2.3 Tissue processing

Individual samples were mechanically homogenized in lysis

buffer containing 30 mM Tris-HCl pH 7.5, 150 mM NaCl,

1% Triton X-100, 10% glycerol and a protease inhibitor

cocktail. The cell lysates were centrifuged at 20 000� g for

30 min, the supernatants were precipitated with 20%

trichloroacetic acid and washed three times with cold acet-

one. Electrophoresis buffer (200 mL) containing 10 mM

Tris base, pH 9.0, 7 M urea, 2 M thiourea, 65 mM DTT and

4% CHAPS was added to each pellet, and the pellets

were then submitted to three cycles of 5 min each in an

Proteomics 2010, 10, 2812–2821 2813

ultrasound bath (UltraSonic Clear 750, UNIQUE) for

complete re-dissolution. Samples were stored at �801C.

Protein concentration was determined by the method of

Bradford [12].

2.4 2-DE and image analysis

In the first dimension, electrofocusing was carried out on

Immobiline Dry IPG strips (7 cm, pH 3-10 non-linear; GE

Healthcare) and after 12 h of IPG gel re-hydration, the

sample was applied to a cup-loading strip-holder (125 mL).

The separation for the first dimension was performed in an

isoelectric focusing system (Ettan IPGphor I, GE Health-

care) at 201C with a constant current of 50 mA per IPG strip

until an accumulation of 40 000 Vh was reached. After

isoelectric focusing, the IPG gel strips were reduced with

DTT and alkylated with iodoacetamide, followed by SDS-

PAGE as the second dimension. Homogeneous 12.5% gel

(10 cm� 10 cm� 1 mm) was used and gels were stained

with CBB for protein spot detection. The gel images were

acquired with a transmissive scanner (ImageScanner,

Pharmacia-Biotech, GE Healthcare) using the MagicScan

software (GE Healthcare) and analyzed with the Image-

Master 2D Platinum v.5.0 software (GE Healthcare). The

spot volume was measure and reported as percent volume of

the spot (normalized volume of spots, % vol) in relation to

the sum of all detected spot and this provided normalized

spot volumes. Differential protein abundance was detected

on the basis of relative % vol. Reproducibility was deter-

mined by the number of matched spots in relation to the

reference group (NN brain tissue, control). Differential

protein abundance was identified when the spot ratio

compared with another sample was Z2-fold in terms of %

vol (pr0.05).

2.5 Tryptic digestion, MS and protein identification

Selected spots were excised from gels and combined. SDS

and CBB were removed by washing the gels three times

with 50% ACN in 0.1 M ammonium bicarbonate, pH 7.8,

followed by dehydration in neat ACN and the gels were

dried in a Speed Vac instrument (Savant, New York, NY).

The dried gel spots were swollen in 20mL of 0.5 mg trypsin

(Promega) in 0.1 M ammonium bicarbonate, pH 7.8,

followed by the addition of 50mL of 0.1 M ammonium

bicarbonate to cover the entire gel piece. Trypsin hydrolysis

was carried out at 371C for 24 h and the reaction was stop-

ped by the addition of 5mL of neat formic acid. Peptides

were extracted from gel pieces and desalted in microtips

filled with POROS R2 (PerSeptive Biosystems, Foster City,

CA) previously equilibrated in 0.2% formic acid. After

loading, the sample was desalted with two washes of 150mL

0.2% formic acid. Peptides were eluted from the microtips

with 30mL of 60% methanol/5% formic acid. One-third of

the sample was used for MALDI-TOF-MS analysis for PMF

and the remaining sample was analyzed by electrospray

triple quadrupole MS (CID-MS/MS). The MALDI-TOF-MS

instrument (MALDI micro MX Waters, Manchester, UK)

was calibrated with a mixture of angiotensin II, renin and

ACTH (mass accuracy o50 ppm). One-third of the sample

was dried and re-dissolved in 5 mL of 10 mg/mL CHCA and

2 mL were applied to the MALDI target using the dried-

droplet method. PMF identification was complemented with

amino acid sequencing of peptide ions using an electrospray

triple-quadrupole mass spectrometer Quattro II (ESI-CID-

MS/MS) (Micromass, Manchester, UK). ESI-CID-MS/MS

samples were analyzed by direct infusion (0.3mL/min)

under the following conditions: capillary voltage maintained

at 3.5 kV, cone voltage at 40 V and cone temperature set to

1001C. In the mode of product ion scanning, the collision

energy ranged from 25 to 40 eV, and argon was used as

collision gas with a partial pressure of 3.0� 10�3 mTorr.

Each spectrum was collected as an average of 20–50

scans (2–5 s/scan) for electrospray triple quadrupole mass

Figure 1. Representative 2-DE gels. Protein extracts (200 mg) were

submitted to 2-DE using IPG pH 3–10NL (7 cm) for isoelectric

focusing and 12.5% SDS-PAGE mini-gel as the second dimen-

sion. Protein spots were selected on the basis of spot volume for

differential expression and submitted to in situ trypsin digestion.

(A) 2-DE, (B) zoom of the CRMP2 protein spot region, (C) zoom of

the NPM protein spot region and (D) zoom of the RKIP protein

spot region. NN, non-neoplastic brain tissue; AST, diffuse

astrocytoma; AA, anaplastic astrocytoma; GBM, glioblastoma.

2814 M. Gimenez et al. Proteomics 2010, 10, 2812–2821

spectrometry (ESI-3Q-MS) and of ten scans for MALDI-

TOF-MS. All spectra from MALDI-TOF-MS and ESI-3Q-MS

were processed using MassLynx software v.3.3 for centroid

peaks using default parameters. PMF spectra were trans-

formed to centroid peaks by MaxEnt3 after combining ten

scans and the query ions were selected from the mass list of

each spectrum using Microsoft Excel to filter ion intensities

above 20% of base peak intensity. The mass list was

submitted to a database search using MASCOT. Product ion

spectra of tryptic peptides were exported to SEQUEST

file.dta and converted to MASCOT Generic Data format.

PMF and CID spectra were submitted to protein identifi-

cation by searching the Swiss-Prot database version 51.7

selected for taxonomy filter of Homo sapiens (total sequences

of 462 764 and sequences for H. sapiens containing 20 405

sequences) using in-house MASCOT version 2.2.04. The

database search parameters accept one missing trypsin

cleavage, carbamidomethylation and methionine oxidation.

Mass tolerance was 1.2 Da for precursor ions and 0.8 Da for

product ions. Protein was considered to be identified by

PMF when seven or more peptides were identified and/or

when the sequence was supported by the MS/MS analysis of

individual ions (ESI-3Q-CID-MS/MS). The MASCOT score

435 for proteins corresponded to a level of significance of

po0.05. The amino acid sequence of each ion peptide was

also inspected manually for mass spectral fragment analysis

using Biolynx (MassLynx v. 3.3; Micromass) and repre-

sentative spectra are shown in Supporting Information

2.6 Western blot

The WesternBreezes Chromogenic Western Blot Immuno-

detection Kit (Invitrogen) was used for Western blot analysis.

Samples of each tumor grade (II, III and IV) and

of NN tissue were selected and 20mg of protein extract of

each was separated on 12.5% homogeneous SDS-PAGE

gel and electro-blotted to a PVDF membrane (Hybond-P,

GE Healthcare). The PVDF membrane was blocked with BSA

and primary antibodies were sequentially incubated with

monoclonal anti-NPM, anti-RKIP and anti-b-actin antibodies

at 1:500 dilution for 1 h. A secondary antibody conjugated

with alkaline phosphatase was incubated for 30 min and the

membrane was incubated in 5 mL of chromogenic substrate

until purple bands developed on it. The Western blot images

were acquired using an Image Scanner in the reflective mode

(Pharmacia-Biotech, Upsala, Sweden).

2.7 Immunohistochemistry

For immunohistochemical detection of NPM and RKIP,

tissue sections were routinely processed and subjected to

antigen retrieval. Briefly, slides were immersed in 10 mM

citrate buffer, pH 6.0, and incubated at 1221C for 3 min

using an electric pressure cooker (BioCare Medical, Walnut

Creek, CA). Specimens were then blocked and further

incubated with a mouse monoclonal antibody raised against

human NPM (Thermo Scientific, NeoMarks, clone: NA24,)

at a final concentration of 2.5 mg/mL, and with a mouse

monoclonal anti-RKIP antibody (clone 4E11D8) at a final

dilution of 1:3200 at 16–201C for 16 h. The reaction was

developed using a commercial kit (Novolink, Novocastra,

Newcastle-upon-Tyne, UK) at room temperature using

diaminobenzidine, and Harris hematoxylin for nuclear

staining. All slides were analyzed independently by two

pathologists, and the positive reaction for NPM was scored

as 0 when no positivity was detected, as 1 when up to 25%

of positive structures were present, as 11 for 26–50% of

positive structures, as 111 for 51–75% of positive struc-

tures and as 1111 for 476% of positive structures. For

RKIP, nuclear and cytoplasm reactivity was scored inde-

pendently as 0 when no positivity was detected, as 1 when

up to 25% of positive structures were present, as 11 for

26–50% of positive structures, as 111 for 51–75% of

positive structures, and as 1111 for476% of positive

structures. Additionally, the intensity of the positive reaction

Figure 2. Proteins differentially expressed in

astrocytomas. The expression levels of 12

differentially expressed protein spots were

quantified on the basis of the normalized

volume of 2-DE spots (% vol) for each group.

These data were analyzed by ANOVA and the

Duncan test, po0.05. Data are reported as

mean7SD. Higher NPM expression was

observed with increasing malignancy grade

of astrocytomas, whereas the levels of RKIP

and CRMP2 expression decreased with

tumor progression. NN, non-neoplastic brain

tissue; AST, diffuse astrocytoma; AA,

anaplastic astrocytoma; GBM, glioblastoma.

Proteomics 2010, 10, 2812–2821 2815

was also scored as 1 when slight, 2 when moderate and 3

when intense. The total score for each case was calculated as

a quantitative versus intensity score for nuclear and cyto-

plasm. The median score for each astrocytoma grade and for

NN tissue was used to plot the histogram shown in Fig. 6.

Digital photomicrographs of representative fields were

retrieved and mounted using PICASA 3.

2.8 Total RNA extraction and cDNA synthesis

Total RNA was extracted from tissues using the RNeasy

Mini Kit (Qiagen, Hilden, Germany). RNA quantification

and purification was determined by measuring absorbance

at 260 and 280 nm. A260/A280 ratios in the 1.8–2.0

range were considered to indicate a satisfactory level of

Table 1. Protein identification by MALDI-TOF-MS and ESI-MS/MS of tryptic peptides obtained from 2-DE spots of brain tissue samples

SpotID

Accessionnumber(MW/pI)

Protein name PMF CID-MS/MS

Matched/searched

Prot.score

%Seq.cov.

Prot.score

%Seq.cov.

Uniquepeptides

Pep.seq.

1/4 KCRB_HUMAN Creatine kinase 7/13 49 23.9 436 27.0 1031.8 359LLIEMEQR366

(42644/5.3) B-type 1232.8 87DLFDPIIEDR96

1304.0 33VLTPELYAELR43

1558.0 253FCTGLTQIETLFK265

1587.0 157LAVEALSSLDGDLAGR172

1658.0 367LEQGQAIDDLMPAQK381

1658.2 224TFLVWVNEEDHLR236

1849.4 342LGFSEVELVQMVVDGVK358

2/3 DPYL2_HUMAN Collapsin response 7/11 34 11.4 132 9.1 1084.8 441GSPLVVISQGK451

(62294/5.9) mediator protein 2 1140.8 472KPFPDFVYK480

1683.0 452IVLEDGTLHVTEGSGR467

1795.0 346DNFTLIPEGTNGTEER361

5 MDHC_HUMAN Malate 4/4 40 12.9 24 9.0 1026.0 150ENFSCLTR157

(36426/6.9) dehydrogenase 1165.0 221GEFVTTVQQR230

cytoplasmic 1394.0 299FVEGLPINDFSR310

6 PEBP1_HUMAN RKIP 7/18 49 48.7 143 18.2 1560.8 63LYTLVLTDPDAPSR76

(23976/7.6) 1950.8 94GNDISSGTVLSDYVGSGPPK113

7 ANXA1_HUMAN(38715/6.6)

Annexin A1 7/15 45 28.0 – – – –

8 ANXA5_HUMAN Annexin A5 10/10 111 33.1 404 31.6 954.6 194FITIFGTR201

(35937/4.9) 1002.0 109VLTEIIASR117

1014.8 90LYDAYELK97

1106.8 277SEIDLFNIR285

1156.8 261GAGTDDHTLIR271

1340.8 7GTVTDFPGFDER18

1447.0 64DLLDDLKSELTGK76

1614.2 228ETSGNLEQLLLAVVK242

1705.2 30GLGTDEESILTLLTSR45

9 CRYAB_HUMAN a-Crystallin B chain 7/13 55 37.1 187 30.9 986.8 83HFSPEELK90

(20159/7.5) 1140.8 164EEKPAVTAAPK174

1165.8 93VLGDVIEVHGK103

1375.0 12RPFFPFHSPSR22

1497.0 57APSWFDTGLSEMR69

10 TPIS_HUMAN Triose-phosphate – – – 64 16.5 1326.6 207IIYGGSVTGATCK219

(26653/6.4) isomerase 1459.0 101HVFGESDELIGQK113

1602.6 161VVLAYEPVWAIGTGK175

11 PPIA_HUMAN Peptidyl-prolyl cis- 6/15 39 33.9 62 17.6 1055.8 20VSFELFADK28

(18012/7.5) trans isomerase A 1154.8 83FEDENFILK91

1247.8 155KITIADCGQLE165

12 NPM_HUMAN NPM 6/11 53 22.8 153 11.9 1819.6 278MTDQEAIQDLWQWR291

(32575/4.6) 2228.2 81MSVQPTVSLGGFEITPPVVLR101

homegeneity. Denaturing agarose gel electrophoresis was

used to assess the quality of the samples. cDNA synthesis

was performed by reverse transcription of 1 mg total RNA

previously treated with one unit of DNase I (FPLC-pure, GE

Healthcare) using random and oligo(dT) primers, an RNase

inhibitor and SuperScript III (Invitrogen), following the

manufacturer’s recommendations.

2.9 Quantitative real-time RT-PCR

The expression levels of the NPM1 gene (NPM1) and RKIP

gene (RKIP) were determined by quantitative real-time RT-

PCR (QT-PCR). Quantitative data were normalized relative to

the internal housekeeping control genes hypoxanthine

phosphoribosyltransferase 1 (HPRT), ATP-binding cassette,

subfamily G, member 2 (BCRP) and glucuronidase, beta

(GUSB). The geometric mean of the three genes was used for

relative expression analysis. Primer sequences were as

follows (50–30): NPM1 F: TGTTGAAGCAGAGGCAATGAAT,

NPM1 R: AAGGGAAACCGTTGGCTGTA, RKIP F: CAGGA-

AGGATCCCAAATACAGAGA, RKIP R: ATAATCGGA-

GAGGACTGTGCCA, HPRT F: TGAGGATTTGGAAAGGG-

TGT, HPRT R: GAGCACACAGAGGGCTACAA, BCRP F:

CCTTCGACGTCAATAACAAGGAT, BCRP R: CCTGCGAT-

GGCGTTCAC, GUSB F: GAAAATACGTGGTTGGAGAGC-

TCATT, and GUSB R: CCGAGTGAAGATCCCCTTTTTA,

synthesized by IDT (Integrated DNA Technologies, Coral-

ville, IA). The relative expression levels of NPM1 and RKIPwere analyzed in NN brain tissues and in astrocytomas of

different malignancy grades. Sybr Green I amplification

mixtures (12mL) contained 3mL cDNA, 6mL 2� Power Sybr

Green I Master Mix (Applied Biosystems, Foster City, CA),

and forward and reverse primers at final concentrations of

200–400 nM. Reactions were run on an ABI 7500 Real-Time

PCR System (Applied Biosystems). The cycle conditions were

incubation at 501C for 2 min to activate UNG, initial dena-

turation at 951C for 10 min, and 40 cycles of 15 s each at 951C,

and 601C for 1 min. DNA melting curve analysis showed a

single peak for all genes. The 2�DDCT equation was applied to

calculate the relative expression of tumor samples versus the

median of NN tissues [13].

2.10 Statistical analysis

The statistical analysis of NPM1 and RKIP expression by

QT-PCR in astrocytomas of different grades and in NN

tissues was performed by the Kruskal–Wallis test. The Dunn

multiple comparison post-test was applied to compare the

differences between the NN tissue group and each astro-

cytoma group. Differences were considered to be statistically

significant at po0.05. Proteomic data were obtained from

the % vol parameter of the 2-D gel images and analyzed for

grades II, III and IV astrocytomas compared with NN brain

tissue using the ANOVA Duncan test, with the level of

significance set at po0.05.

3 Results

3.1 Separation of proteins by 2-DE

A proteomic study of 2-DE was performed on five samples

each of three different malignant grades of diffusely infil-

trating astrocytomas (grades II, III and IV) and on five

samples of NN brain tissue for control. Figure 1A shows a

representative 2-DE. The optimization and reproducibility

of 2-DE were obtained by analysis of triplicate gels

using a T98G cell lineage protein extract which was

loaded onto the gel in 100, 200 and 400mg of total protein.

Figure 3. Expression of NPM in astrocytomas of different grades

of malignancy. (A) Distribution of percentage of volume for each

tissue sample examined (five patients/each grade) obtained by

2-D gel image analysis. (B) Western blot using an anti-NPM

monoclonal antibody. (C) Real-time PCR for NPM1 using

normalization of BCRP, HPRT and GUSB as housekeeping genes.��Dunn test, po0.0001. The horizontal lines represent the

median of each group. NN, non-neoplastic brain tissue; AST,

diffuse astrocytoma; AA, anaplastic astrocytoma; GBM, glio-

blastoma.

Proteomics 2010, 10, 2812–2821 2817

The reproducibility of 2-DE runs for 200mg loaded protein

was 91% and an average of 450 protein spots were detected

by CBB. Tumor patient samples were loaded with 200 mg of

protein extracts for 2-DE. 2-DE image analysis was used to

detect protein spots from duplicate gels of five samples of

each grade. The number of average protein spots was,

380741 (grade II), 457746 (grade III), 463765 (grade IV)

and 435727 (NN brain tissue, control). The overall repro-

ducibility of 2-DE patient samples was 78–87%.

3.2 Identification of proteins differentially expressed

in astrocytomas

Twelve protein spots were differentially abundant in patient

samples compared with control. Figure 1A shows a repre-

sentative 2-DE gel IPG pH 3–10NL and zoom region of

three protein spots are indicated in the control and

tumor samples (Figs. 1B, C and D). These 12 differentially

abundant protein spots are shown in Fig. 2, considering

the volume of the spot to be equivalent to expression

level (n 5 5, mean7SD), accounted for ten proteins and

two additional protein isoforms. Ten proteins were differ-

entially expressed in tumor samples when compared

with NN brain samples. Six of them were more abundant in

tumor samples than in control tissue, and four were less

abundant in tumor samples than in control tissue. The

differentially expressed protein spots were identified by MS.

The proteins up-regulated in GBM were NPM, annexin A1,

annexin A5, triosephosphate isomerase, peptidyl prolyl-cis-trans isomerase (PPIase 1 or cyclophilin A), and a-crystallin

chain B. The down-regulated proteins in GBM were creatine

kinase chain B (KCRB), RKIP or phosphatidylethanolamine-

binding protein 1, collapsin-related membrane protein 2 or

dihydropyraminidase-like 2 variant (CRMP2) and malate

dehydrogenase. Additionally, two KCRB and CRMP2

isoforms were also identified, respectively. Table 1

summarizes the proteins identified by MS and the respective

parameters of database searching. Spot volume from 2-DE

was used as an indication of the expression level, which

showed significant variation of those protein spots correlated

from low- to high-grade astrocytomas using ANOVA

(po0.05, Supporting Information Tables SI and SII).

3.3 NPM expression correlates with high-grade

astrocytomas

NPM showed increased expression levels in grade III and IV

astrocytomas, whereas grade II astrocytomas presented NPM

levels similar to control (Fig. 3A), indicating a correlation of

NPM with malignant astrocytoma progression. This finding

was confirmed by Western blot analysis using an anti-NPM

monoclonal antibody (Fig. 3B), and also by QT-PCR in an

expanded series of 138 astrocytomas compared with 19 NN

brain tissues (Fig. 3C). NPM was also detected in two cell

Figure 4. Immunohistochemistry of NPM. (A) NN brain tissue showing negative staining, (B) low-grade astrocytoma (WHO grade II, AST)

showing nuclear staining of focal cells, (C) AA (WHO grade III) with 25% cells showing positive nuclear staining and (D) glioblastoma

(WHO grade IV, GBM) with 75% of tumor cells showing positive nuclear and nucleolar staining. (E) Graph of NPM immunochemistry in

NN, AST, AA and GBM. No NN brain tissue presented positivity to NPM. One case of AST presented focal positivity to NPM, two out of

five cases of AA presented 25% (11) of positive stained tumor cells, and four out of five GBM presented 75% (111) NPM-positive cells.

Magnification, 200� .

lines derived from GBM: fourfold more abundant in T98G

and twofold more abundant in U87MG compared with

control by 2-DE and selected reaction monitoring MS (data

not shown). MS data were not sufficient to discriminate

between NPM1 isoform 1 and isoform 2, because they differ

in the 195–223 residues which were deleted in isoform 2, a

region rich in basic amino acids (lysine/arginine), leading to

fragmentation of small tryptic peptides that were probably

lost during the preparation for MS analysis. However,

Western blot analysis using a monoclonal antibody raised

against the N-terminal and the C-terminal epitopes of NPM1

strongly suggests that the NPM detected by 2-DE in astro-

cytomas is NPM1 isoform 1. QT-PCR analysis for NMP1expression further corroborates this assumption, and

confirmed proteomic analysis, with higher NPM1 expression

levels in astrocytomas when compared with NN brain tissue

controls (p 5 0.0001, Kruskal–Wallis test).

In addition, five samples each of NN brain tissue, AST, AA

and GBM were analyzed by immunohistochemistry for NPM

expression. The positive cells were barely detected in NN

brain tissues (Fig. 4A). Only focal staining of the nucleus was

observed in very few cells of AST cases (Fig. 4B). Nuclear and

nucleolar staining were detected in 25% of the cells analyzed

in two of five cases of AA (Fig. 4C), and in more than 75% of

the cells analyzed in four of the five cases of GBM (Fig. 4D).

The graph in Fig. 4E shows the interpretation of NPM

immunohistochemistry in astrocytomas.

Annexin A1, annexin A5, PPIase A, TIPS and a-crystallin

B-chain were more abundant in GBM (grade IV) compared

with control, but levels were low and not different from

control in astrocytoma grades II and III, and no correlations

with tumor progression were detected.

3.4 RKIP expression is down-regulated in high-

grade astrocytomas

Four proteins selected from proteomic data were less

abundant in GBM compared with control, showing a

statistically significant down-regulation in tumors of lower

to higher grade. RKIP (Fig. 5A) and CRMP2 were found to

be down-regulated in astrocytomas of higher malignant

grades (AA and GBM). The level of CRMP2 mRNA

expression did not differ significantly between GBM and NN

tissue (data not shown). The protein expression level was

not evaluated since no commercial antibody is currently

available. On the other hand, the differential expression of

RKIP was confirmed by Western blot (Fig. 5B), QT-PCR

(Fig. 5C) and also by immunohistochemistry (Fig. 6). The

relative levels of RKIP expression did not differ significantly

between NN brain samples and astrocytoma samples.

Nevertheless, the median gene expression level was lower in

the GBM group than in the control group. Heterogeneity is

a well-known characteristic of GBM, and 69 of 84 (82%)

GBM cases presented a low RKIP expression level. When

the 15 GBM outliers with the higher RKIP expression levels

were excluded from the Dunn test, the difference between

control and GBM was statistically significant (p 5 0.001),

corroborating the proteomic result. The immunohisto-

chemical analyses of RKIP also demonstrated lower posi-

tivity in both the cytoplasm and the nuclei of GBM cases

than in NN brain tissue. Of note, RKIP protein reactivity

decreased in parallel to the increase of malignancy, in a

similar profile of gene expression level obtained by QT-PCR.

(Figs. 5 and 6).

Figure 5. Expression of RKIP in astrocytomas of different

malignancy grades. (A) Distribution of percentage of volume for

each tissue sample examined (five patients/grade) obtained by

proteomic analysis. (B) Western blot using an anti-RKIP mono-

clonal antibody. (C) Real-time PCR for RKIP using normalization

of BCRP, HPRT and GUSB as housekeeping genes. The hori-

zontal lines represent the median of each group. NN, non-

neoplastic brain tissue; AST, diffuse astrocytoma; AA, anaplastic

astrocytoma; GBM, glioblastoma.

Proteomics 2010, 10, 2812–2821 2819

4 Discussion

A proteomic approach comparing different grades of diffu-

sely infiltrative astrocytomas permitted the identification of

six up-regulated proteins in GBM. Among them, NMP up-

regulation was confirmed in malignant astrocytomas,

specifically in GBM, by immunohistochemistry and

Western blot at the protein level, and also at the gene

expression level by quantitative real-time PCR in an expan-

ded series of astrocytomas. NPM, a nucleolar phosphopro-

tein, is related to growth, cell proliferation, inhibition of cell

differentiation and apoptosis [14, 15]. Particularly, it is

implicated in resistance to apoptosis, either by impeding

p53 localization in mitochondria or by binding to activated

Bax [16–19]. Furthermore, NPM is a classic mitogen-

induced protein, and has been linked to the H-Ras onco-

gene. NPM accumulation has also been reported to be

completely prevented by rapamycin, a pharmacological

inhibitor of mTOR, or by TCS1, a native inhibitor of mTOR

[20, 21]. Also, it is well known that hyper-activation of

mTOR is a common feature among GBM [22].

Therefore, NPM becomes an attractive target for cancer

therapy because of its involvement in proliferation and in

the apoptosis process. Moreover, this target might also be

considered for other types of solid tumors since NPM

overexpression and mutations have already been described

in colon, stomach, ovary and prostate carcinomas [14].

In contrast, RKIP proved to be down-regulated in GBM.

RKIP is involved in angiogenesis, cell cycle regulation, apop-

tosis and genome integrity. Unphosphorylated RKIP nega-

tively regulates the Raf/MEK/ERK pathway by inhibiting Raf-1.

In a phosphorylated state, it inhibits GRK-2, a negative regu-

lator of G-protein coupling receptors. RKIP also regulates

Aurora B kinase, and the spindle check-point [23–26]. A recent

report has shown the influence of loss of RKIP expression on

colorectal cancer aneuploidy, and its association with genomic

instability [27]. Loss of RKIP expression has also been impli-

cated in the malignant phenotype of prostate cancer and also

in the poor prognosis for breast and melanoma tumors [28].

RKIP�/� mice display an olfaction deficit which increases in

severity with aging, besides a general learning deficit asso-

ciated with the loss of RKIP function in knockout mice [29].

NPM and RKIP are involved in two signal transduction

cascades known to contribute to the formation of glio-

blastomas, i.e. RAS/RAF/MAPK and PI3K/AKT/mTOR,

especially RAS and Akt [30].

In summary, the proteomic approach permitted us to

identify two proteins related to two signal transduction

cascades known to contribute to GBM formation. If NPM

activates RAS, the down-regulation of RKIP may contribute

to the activation of RAF, leading to uncontrolled cell

proliferation, showing that both proteins are eligible as

potential targets for the development of new drugs for the

treatment of GBM.

Figure 6. Immunohistochemistry of RKIP. (A) NN brain tissue demonstrates positive expression in the cytoplasm and nuclei (NN), (B) low-

grade astrocytoma (WHO grade II, AST), (C) AA (WHO grade III) and (D) glioblastoma (WHO grade IV, GBM) show decreasing positivity in

tumor cell nucleus and cytoplasm from grade II to grade IV, where only a few more aneuploid nuclei present positivity. (E) Graph of RKIP

immunohistochemistry total score in NN, AST, AA and GBM representing the decrease of RKIP positivity toward the more malignant

astrocytoma. Magnification, 200� .

M. G. received fellowships from FAPESP/Brazil (2005/53039-5 and 2008/51360-9). The authors thank the neuro-surgeons Paulo Henrique de Aguiar, Flavio Miura and EdsonNakagawa for sample collection, as part of the FAPESP-Genoma-Clinico program. This work was supported by FAPESP(04/12133-6 and 98/14247), the Ludwig Institute for CancerResearch, FAEPA, and FINEP.

The authors have declared no conflict of interest.

5 References

[1] Louis, D. N., Ohgaki, H., Wiestler, O. D., Cavenee, W. K.

et al., The 2007 WHO classication of tumours of the central

nervous system. Acta Neuropathol. 2007, 114, 97–109.

[2] Ichimura, K., Ohgaki, H., Kleihues, P., Collins, V. P., Mole-

cular pathogenesis of astrocytic tumours. J. Neurooncol.

2004, 70, 137–160.

[3] Watanabe, T., Katayama, Y., Yoshino, A., Yachi, K. et al.,

Aberrant hypermethylation of p14ARF and O6-methylgua-

nine-DNA methyltransferase genes in astrocytoma

progression. Brain Pathol. 2007, 17, 5–10.

[4] Chumbalkar, V. C., Subhashini, C., Dhople, V. M., Sundaram,

C. S. et al., Differential protein expression in human gliomas

and molecular insights. Proteomics 2005, 5, 1167–1177.

[5] Ohgaki, H., Kleihues, P., Genetic pathways to primary and

secondary glioblastoma. Am. J. Pathol. 2007, 5, 1445–1453.

[6] Merlo, A., Genes and pathways driving glioblastomas in

humans and murine disease models. Neurosurg. Rev. 2003,

26, 145–158.

[7] Soni, D., King, J. A., Kaye, A. H., Hovens, C. M., Genetics of

glioblastoma multiforme: mitogenic signaling and cell cycle

pathways converge. J. Clin. Neurosci. 2005, 12, 1–5.

[8] Futcher, B., Latter, G. I., Monardo, P., McLaughlin, C. S.,

Garrels, J. I., Sampling of the yeast proteome. Mol. Cell.

Biol. 1999, 19, 7357–7368.

[9] Khalil, A. A., James, P., Biomarker discovery: a proteomic

approach for brain cancer profiling. Cancer Sci. 2007, 98,

201–213.

[10] Chumbalkar, V., Sawaya, R., Bogler, O., Proteomics: the

new frontier also for brain tumor research. Curr. Probl.

Cancer 2008, 32, 143–154.

[11] Liota, L. A., Kohn, E. C., Petricoin, E. F., Clinical proteomics:

personalized molecular medicine. JAMA 2001, 286,

2211–2214.

[12] Bradford, M. M., A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing the

principle of protein-dye binding. Anal. Chem. 1976, 7,

248–254.

[13] Livak, K. J., Schmittgen, T. D., Analysis of relative gene

expression data using real-time quantitative PCR and the

2(-Delta Delta C(T)). Methods 2001, 25, 402–408.

[14] Grisendi, S., Mecucci, C., Falini, B., Pandolfi, P. P.,

Nucleophosmin and cancer. Nat. Rev. Cancer 2006, 6,

493–505.

[15] Lim, M. J., Wang, X. W., Nucleophosmin and human

cancer. Cancer Detect. Prev. 2006, 30, 481–490.

[16] Dhar, S. K., St Clair, D. K., Nucleophosmin blocks mito-

chondrial localization of p53 and apoptosis. J. Biol. Chem.

2009, 284, 16409–16418.

[17] Kerr, L. E., Birse-Archbold, J. L., Short, D. M., McGregor, A. L.

et al., Nucleophosmin is a novel Bax chaperone that regu-

lates apoptotic cell death. Oncogene 2007, 26, 2256–2554.

[18] Thompson, J., Finlayson, K., Salvo-Chirnside, E., MacDo-

nald, D. et al., Characterisation of the Bax-nucleophosmin

interaction: the importance of the Bax C-terminus. Apop-

tosis 2008, 13, 394–403.

[19] Geng, Y., Walls, K. C., Ghosh, A. P., Akhtar, R. S. et al.,

Cytoplasmic p53 and activated Bax regulate p53-dependent,

transcription-independent neural precursor cell apoptosis.

J. Histochem. Cytochem. 2010, 58, 265–275.

[20] Sandsmark, D. K., Zhang, H., Hegedus, B., Pelletier, C. L.

et al., Nucleophosmin mediates mammalian target of

rapamycin-dependent actin cytoskeleton dynamics and

proliferation in neurofibromin-deficient astrocytes. Cancer

Res. 2007, 67, 4790–4799.

[21] Pelletier, C. L., Maggi, L. B., Jr., Brady, S. N., Scheidenhelm,

D. K. et al., TSC1 sets the rate of ribosome export and

protein synthesis through nucleophosmin translation.

Cancer Res. 2007, 67, 1609–1617.

[22] Sandsmark, D. K., Pelletier, C., Weber, J. D., Gutmann, D. H.,

Mammalian target of rapamycin: master regulator of cell

growth in the nervous system. Histol. Histophatol. 2007, 22,

895–903.

[23] Granovsky, A. E., Rosner, M. R., Raf kinase inhibitory

protein: a signal transduction modulator and metastasis

suppressor. Cell. Res. 2008, 18, 452–457.

[24] Klysik, J., Theroux, S. J., Sedivy, J. M., Moffit, J. S.,

Boekelheide, K., Signaling crossroads: the function of Raf

kinase inhibitory protein in cancer, the central nervous

system and reproduction. Cell. Signal. 2008, 20, 1–9.

[25] Eves, E. M., Shapiro, P., Naik, K., Klein, U. R. et al., Raf

kinase inhibitory protein regulates aurora B kinase and the

spindle checkpoint. Mol. Cell. 2006, 23, 561–574.

[26] Rosner, M. R., MAP kinase meets mitosis: a role for Raf

kinase inhibitory protein in spindle checkpoint regulation.

Cell. Div. 2007, 2, 1–4.

[27] Al-Mulla, F., Hagan, S., Al-Ali, W., Jacob, S. P. et al., Raf

kinase inhibitor protein: mechanism of loss of expression

and association with genomic instability. J. Clin. Pathol.

2008, 61, 524–529.

[28] Keller, E. T., Fu, Z., Brennan, M., The biology of a prostate

cancer metastasis suppressor protein: Raf kinase inhibitor

protein. J. Cell. Biochem. 2005, 94, 273–278.

[29] Theroux, S., Pereira, M., Casten, K. S., Burwell, R. D. et al., Raf

kinase inhibitory protein knockout mice: expression in the

brain and olfaction deficit. Brain Res. Bull. 2007, 71, 559–567.

[30] Holland, E. C., Celestino, J., Dai, C., Schaefer, L. et al.,

Combined activation of Ras and Akt in neural progenitors

induces glioblastoma formation in mice. Nat. Genet. 2000,

25, 55–57.

Proteomics 2010, 10, 2812–2821 2821

Proteomic analysis of low‐to high‐grade astrocytomas reveals an alteration of the expression...

Documents