Tetramerization-defects of p53 result in aberrant ubiquitylation and transcriptional activity

transcript

M O L E C U L A R O N C O L O G Y XXX ( 2 0 1 4 ) 1e1 7

ava i lab le a t www.sc ienced i rec t . com

ScienceDirect

www.elsevier .com/locate/molonc

Tetramerization-defects of p53 result in aberrant

ubiquitylation and transcriptional activity

Val�erie Langa, Chiara Pallarab, Amaia Zabalac, Sofia Lobato-Gila,Fernando Lopitz-Otsoac, Rosa Farr�asd, Roland Hjerpec,1,Monica Torres-Ramosc,2, Lorea Zabaletaa, Christine Blattnere,Ronald T. Hayf, Rosa Barrioc, Arkaitz Carracedoc,g,h,Juan Fernandez-Reciob, Manuel S. Rodr�ıgueza,*,Fabienne Ailleta

aUbiquitylation and Cancer Molecular Biology Laboratory, Inbiomed, Mikeletegi 81, San Sebasti�an-Donostia 20009,

Gipuzkoa, SpainbJoint BSC-IRB Research Program in Computational Biology, Life Sciences Department, Barcelona Supercomputing

Center, Carrer Jordi Girona 29, 08034 Barcelona, SpaincCIC bioGUNE, Ed 801A Parque Tecnol�ogico de Bizkaia, 48160 Derio, Bizkaia, SpaindCentro de Investigaci�on Pr�ıncipe Felipe, Eduardo Primo Y�ufera 3, 46012 Valencia, SpaineKarlsruher Institute of Technology, Institute of Toxicology and Genetics, Fritz-Erler-Straße 23, 76133 Karlsruhe,

GermanyfCenter for Interdisciplinary Research, School of Life Sciences, University of Dundee, Dow Street, DD15EH Scotland,

United KingdomgIkerbasque, Basque Foundation for Science, 48011 Bilbao, SpainhBiochemistry and Molecular Biology Department, University of the Basque Country (UPV/EHU), P.O. Box 644,

E-48080 Bilbao, Spain

A R T I C L E I N F O

Article history:

Received 30 October 2013

Received in revised form

19 March 2014

Abbreviations: OD, Oligomerization DomaModulator of Apoptosis; Noxa, Noxious stressuperfamily, member 6); p21, Chromosome 6Mouse double minute 2 homolog ubiquitin lidrogenase; 14.3.3s, 14-3-3 sigma protein eluttrophoresis; MD, Molecular dynamics; FTDO* Corresponding author. Tel.: þ34 943 309 06E-mail addresses: vlang@inbiomed.org (V

med.org (S. Lobato-Gil), flopitz@cicbiogune.eca.atorres@gmail.com (M. Torres-Ramos),dundee.ac.uk (R.T. Hay), rbarrio@cicbiogunemsrodriguez@inbiomed.org (M.S. Rodr�ıguez)

1 Present address: The MRC Protein Phosphversity of Dundee, Dow Street, Dundee DD1

2 Present address: Instituto Nacional de Ne1574-7891/$ e see front matter ª 2014 Federhttp://dx.doi.org/10.1016/j.molonc.2014.04.00

Please cite this article in press as: Lantranscriptional activity, Molecular Oncol

A B S T R A C T

The tumor suppressor p53 regulates the expression of genes involved in cell cycle progres-

sion, senescence and apoptosis. Here, we investigated the effect of single point mutations

in the oligomerization domain (OD) on tetramerization, transcription, ubiquitylation and

stability of p53. As predicted by docking and molecular dynamics simulations, p53 OD mu-

tants show functional defects on transcription, Mdm2-dependent ubiquitylation and 26S

in; Bax, Bcl2-associated X protein; Bcl-XL, B-cell lymphoma-extralarge; PUMA, p5pregulateds induced protein; Bid, BH3 interacting domain death agonist; FAS/CD95, Fas (TNF receptorp21.2 located Cyclin-dependent kinase inhibitor 1A; E2F1, E2F transcription factor 1; Mdm2,gase; PCNA, Proliferating Cell Nuclear Antigen; GAPDH, Glyceraldehyde-3-phosphate dehy-ed in the 14th fraction of bovine brain homogenate and migrating on position 3.3 after elec-CK, FFT-based docking program; ADR, Adriamycin; RMSD, Root mean square deviation.4; fax: þ34 943 308 222.. Lang), chiara.pallara@bsc.es (C. Pallara), azabala@cicbiogune.e (A. Zabala), slobato@inbio-s (F. Lopitz-Otsoa), rfarras@cipf.es (R. Farr�as), n.r.e.hjerpe@dundee.ac.uk (R. Hjerpe), moni-lzabaleta@inbiomed.org (L. Zabaleta), christine.blattner@kit.edu (C. Blattner), r.t.hay@.es (R. Barrio), acarracedo@cicbiogune.es (A. Carracedo), juanf@bsc.es (J. Fernandez-Recio),, faillet@inbiomed.org (F. Aillet).orylation and Ubiquitylation Unit, The Sir James Black Centre, College of Life Sciences, Uni-5EH, Scotland.urolog�ıa y Neurocirug�ıa “Manuel Velasco Su�arez”, M�exico D.F., Mexico.ation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.2

g, V., et al., Tetramerization-defects of p53 result in aberrant ubiquitylation andogy (2014), http://dx.doi.org/10.1016/j.molonc.2014.04.002

Accepted 2 April 2014

Available online -

Keywords:

Ubiquitylation

Oligomerization

Transcription

Proteasome

Please cite this article in press as: Lantranscriptional activity, Molecular Oncolo

proteasome-mediated degradation. However, mutants unable to form tetramers are well

degraded by the 20S proteasome. Unexpectedly, despite the lower structural stability

compared to WT p53, p53 OD mutants form heterotetramers with WT p53 when expressed

transiently or stably in cells wild type or null for p53. In consequence, p53 OD mutants

interfere with the capacity of WT p53 tetramers to be properly ubiquitylated and result

in changes of p53-dependent protein expression patterns, including the pro-apoptotic pro-

teins Bax and PUMA under basal and adriamycin-induced conditions. Importantly, the pa-

tient derived p53 OD mutant L330R (OD1) showed the more severe changes in p53-

dependent gene expression. Thus, in addition to the well-known effects on p53 stability,

ubiquitylation defects promote changes in p53-dependent gene expression with implica-

tions on some of its functions.

ª 2014 Federation of European Biochemical Societies.

1. Introduction accumulation of mutant p53 in tumor cells suggests an alter-

The tumor suppressor p53 is amajor gatekeeper of the genome

that tightly controls critical processes in the cell, acting as a

central player within a large network of proteins involved in

DNA-repair, apoptosis or cell cycle (Levine, 1997; Vogelstein

et al., 2000; Zilfou and Lowe, 2009). P53 is a transcription factor

that binds its DNA consensus sequence as a tetramer to acti-

vate transcription. The C-terminus of p53 contains the oligo-

merization domain (OD) that is required for the formation of

the transcriptionally active tetramer. The C-terminus also con-

tains sub-cellular localization signals and amino acids targeted

by a wide variety of posttranslational modifications, including

phosphorylation, acetylation, methylation, SUMOylation

(Alarcon-Vargas and Ronai, 2002; Chuikov et al., 2004;

Rodriguez et al., 1999) and ubiquitylation that control its degra-

dation by the 26S proteasome (Maki, 1999; Rodriguez et al.,

2000) and its function (Funk et al., 1992; Maki and Howley,

1997; Maltzman and Czyzyk, 1984). Data from in vivo experi-

ments in mouse models have suggested that ubiquitylation

of lysines located in C-terminal may play a role in the regula-

tion of transcriptional activity in a manner of “fine-tuning”

the expression of specific p53-dependent genes (Krummel

et al., 2005) (Feng et al., 2005). Among the most important

p53-dependent genes, the ubiquitin protein-ligase Mdm2, has

been shown to be crucial for regulation of p53 function (Fang

et al., 2000) and its proteasomal degradation (Chowdary et al.,

1994; Maki, 1999; Maki et al., 1996). Other well-known p53-

target-genes are Bax, PUMA, Noxa, Bid, Fas/CD95, which are

involved in apoptosis, while p21 and E2F1 control cell cycle ar-

rest and proliferation (Riley et al., 2008).

P53 is found mutated in about half of human cancers

(Hollstein et al., 1991; Soussi and Beroud, 2001) with most of

the mutations being missense and mainly located in the

core DNA-Binding domain. To date, the database of TP53

maintained at IARC, has registered more than 30,000 muta-

tions in humans (www-p53.free.fr/www-p53.iarc.fr) (Olivier

et al., 2002). Few mutations have been registered in its OD

(Milner and Medcalf, 1991; Sturzbecher et al., 1992). After

epidemiologic studies, 17% of germline mutations in patients

with Li-Fraumeni syndrome occurred in the p53 OD (Petitjean

et al., 2007). Transcriptionally silent p53 mutants generate

transdominant negative effects over a WT allele through

mechanisms that are not well understood. The aberrant

g, V., et al., Tetramerizgy (2014), http://dx.doi.

ation in its degradation pathway. Intrigued by these aspects,

we have introduced single point mutations in the b-strand of

the p53 OD,mimicking the alterations in L330 observed in can-

cer, which is one of the crucial amino acids for correct tetra-

merization (Chene and Bechter, 1999). NMR and X-Ray

crystallography analysis revealed that OD (residues 323e356)

contains one b-strand (326e333) and one a-helix (335e354)

with a V-shaped structure (Chene, 1997; Clore et al., 1995;

Jeffrey et al., 1995; Lee et al., 1994; Miller et al., 1996; Mittl

et al., 1998). The hydrophobic amino-acid L330 together with

seven other residues (F328, I332, R337, F338, F341, N345 and

D352) form a critical hydrophobic pocket, allowing association

of two dimers, necessary for the formation of a transcription-

ally active tetramer and for preservation of p53 stability (Clore

et al., 1995; Friedman et al., 1993; Jeffrey et al., 1995; Kato et al.,

2003; Kawaguchi et al., 2005; Mateu and Fersht, 1998).

2. Materials and methods

2.1. Modeling of the p53 dimer structure by dockingsimulation

We used the monomeric structure of the p53tet PDB 1AIE;

1.5 �A in its active tetrameric form as starting structure for

theWT dimer model and as scaffold to build all the structures

of the mutants described herein, using SCWRL3.0 program

(Canutescu et al., 2003). The rigid-body docking simulations

were performed using the FFT-based docking program

FTDOCK with grid resolution of 0.7 �A and electrostatics

(Gabb et al., 1997), which generated a set of 10,000 docking

poses that were evaluated by the energy-based pyDock

scoring scheme (Cheng et al., 2007). For each docking run,

we selected the lowest-energy solution. RMSD was calculated

for amonomer respect to its equivalent in the p53 dimer struc-

ture (as found in the p53 biological assembly) after super-

position of the interacting partner monomer.

2.2. Molecular dynamics simulation of WT and mutantp53 dimer structures

The WT p53 dimer structure for the Molecular dynamics (MD)

simulation was extracted from PDB code 1AIE. The mutants

ation-defects of p53 result in aberrant ubiquitylation andorg/10.1016/j.molonc.2014.04.002

M O L E C U L A R O N C O L O G Y XXX ( 2 0 1 4 ) 1e1 7 3

were built in silico from the WT structure, using the AMBER

module LEAP. Each system was then minimized solvated

and equilibrated in a five-step at the same conditions as pre-

viously described for the MoDEL database (Meyer et al.,

2010). The AMBER parm99SB force field parameters in AMBER

10 package were used (Case et al., 2005). Root mean square de-

viation (RMSD) and residueeresidue minimal interatomic dis-

tances were calculated with ICM-browser program

(www.molsoft.com) on a total of 4000 snapshots generated

every 100ps along the MD trajectories.

2.3. Pairwise residueeresidue decomposition of bindingenergy

The MMPBSA.py script in AMBER12 (Steinbrecher et al., 2012)

was used to estimate the binding free energy of each dimer

by calculating the interaction energy and solvation free energy

for the complex, receptor and ligand (MM-GBSA method). All

energy components (van der Waals contribution from MM,

electrostatic energy as calculated by the MM force field, the

electrostatic contribution to the solvation free energy calcu-

lated by GB, nonpolar contribution to the solvation free energy

calculated by an empirical model) were calculated using 200

snapshots extracted from the last 20ns of each MD trajectory

and then averaged. Finally, in order to identify the key L330

contacts responsible for binding, we computed the energetic

contribution to the total binding free-energy of all the contacts

between the L330 residue (or equivalent mutated residue) of

one monomer and the other residues from the other mono-

mer, using the MM-GBSA free energy decomposition process

in AMBER12 (the average for the two values obtained for the

L330 residue in each monomer is given in Table 2, in which

we have highlighted those pairwise contacts with more than

1 kcal/mol change in the mutant with respect to WT).

2.4. Reagents, plasmids and DNA manipulations

The following reagents were used at the indicated concentra-

tions: MG132 (Sigma, 5 mM, overnight), Z-VAD (Calbiochem,

50 mM, 24 h), Chloroquine (Sigma, 200 mM, 24 h), Cycloheximide

(Sigma, 50 mM), Adriamycin (ADR) (Sigma, 1 mM). Plasmid

encoding Mdm2 has been previously described (Blattner

et al., 1994). WT p53 and p53 OD mutant fragments were

cloned into the vector pcDNA3-SV5 using the restriction sites

KpnI and EcoRI. For the amplification of p53 molecules, the

following sense primer: 50-cc ggt acc atg gag gag ccg cag tca

g-30 and anti sense primer were used: 50-cg gaa ttc gtc tga gtc

agg ccc ttc tg-30.

2.5. Site directed mutagenesis

For mutagenesis, the QuickChange� Site-Directed Mutagen-

esis Kit from Stratagene was used with the following sense

and anti-sense primers: OD1 (L330R), sense primer: 50-ctg gat

gga gaa tat ttc acc CGT cag atc cgt ggg-30 and anti sense primer

50-ccc acg gat ctg acg ggt gaa ata ttc tcc atc cag-30. OD2

(F328V þ L330R) sense primer: 50-ca ctg gat gga gaa tat GTC

acc CGT cag atc cgt ggg cg-30. OD3 (L330E) sense primer: 50-ctg gat gga gaa tat ttc acc GAA cag atc cgt ggg-30 and anti sense

primer 50-ccc acg gat ctg acg ggt gaa ata ttc tcc atc cag-30. OD4

Please cite this article in press as: Lang, V., et al., Tetrameriztranscriptional activity, Molecular Oncology (2014), http://dx.doi.

(L330M), sense primer, 50-ctg gat gga gaa tat ttc acc ATG cag atc

cgt ggg-30 and anti sense primer 50-ccc acg gat ctg acg ggt gaa

ata ttc tcc atc cag-30. OD5 (L330P), sense primer 50-ctg gat gga

gaa tat ttc acc CCT cag atc cgt ggg-30 and anti sense primer

50-ccc acg gat ctg acg ggt gaa ata ttc tcc atc cag-30.

2.6. Cell culture and transfection

P53 null H1299 human lung cancer cells andWT p53 U2OS hu-

man osteosarcoma cell line were grown in DMEM with 10%

FBS and antibiotics. Population U2OS stable cells were estab-

lished by transfecting pcDNA3/WT p53 or pcDNA3/OD mu-

tants to obtain equal levels of expression and maintained

under genetic selection during all experiments. Cells were

transiently transfected with indicated plasmids using lipo-

fectamine (Invitrogen). For most degradation experiments, a

plasmid ratio 1:5 p53: Mdm2 was used, with the exception of

the Figure 3Awhere it was used a ratio 1:10. After transfection,

cells were grown in six-well plates for 24 h, and harvested for

Western blotting analysis or immunofluorescence. For mea-

surement of transcriptional activity, H1299 cells were tran-

siently co-transfected with plasmids expressing WT p53 or

OD mutants with reporter plasmid luciferase gene under the

control of promoter p21 or Bax and control b-galactosidase.

Luciferase and b-galactosidase activities were measured as

previously described (Rodriguez et al., 1996). P53 WT and OD

mutant half-life quantifications in H1299 were performed as

described (Blattner et al., 1994).

2.7. Tetramerization assay

In order to analyze the oligomerization status of p53, tetrame-

rization assays using glutaraldehyde cross-linking were per-

formed as reported (Hjerpe et al., 2010). Assays were

performed using cells transiently (H1299) or stably (U2OS)

expressing WT p53 and/or OD mutants. For transient experi-

ments constant levels of WTp53-SV5 (100 ng) and increasing

amounts (100 or 250 ng) of untagged OD mutants were used.

When required, constant levels (100 ng) of untagged WT p53

and increasing amounts (100 or 250 ng) of SV5 tagged OD mu-

tants were also expressed. Briefly, cells were grown 24 h

before being treated or not 1 h with 1 mM ADR (stable cells),

and lysed in a buffer containing 100 mM NaCl, 100 mM Tris

pH 8, 0.5%NP40 (Igepal). Samples were split in two and treated

or not with 0.1% of the crosslinking agent glutaraldehyde. The

reactionwas quenched after 10minwith 100mMPBS-Glycine.

Laemmli sample buffer was added to each sample and boiled

for 5 min before SDS-PAGE. Western-blot analysis with the

indicated antibodies is shown.

2.8. Chemotherapy simulation assay

This assay was adapted from a previous procedure aiming to

mimic a sequential treatment of chemotherapy using ADR

(Kopp et al., 2012). MCF-7 cells were plated and exposed or

not (CTR) to 1 mM of ADR during 1 h and maintained in fresh

DMEMmedium for 24 h. Cells were collected at day 2 or main-

tained in culture. When indicated, cells were treated or not at

day 6 and collected at day 7. Finally cells were also treated or

not at day 10 and collected at day 11. Thus D2 was exposed or

not to a single ADR treatment, whereas D7 and D11 cells were

treated or not for two or three times with ADR, respectively

(Figure 7A). Duplicate samples were prepared for Western-

blot analysis and tetramerization assays.

2.9. RNA extraction and real time quantitative PCR

RNA was isolated by using NucleoSpin RNA kit (Macher-

eyeNagel, following manufacturer’s instructions). cDNA was

subsequently obtained using the qScript cDNA Synthesis Kit

(Quanta) with random hexanucleotides. Real time quantita-

tive PCR was performed in a VIIA7 (life technologies) using

the 384 standard PCR program, and data was normalized by

the housekeeping gene and relativized to untreated WT p53

expressing cells. VIC fluorescent PCR probes for the house-

keeping gene (GAPDH)were purchased from Life Technologies

(Hs02758991_g1) and PCR probes for the target genes were

generated using the Universal Probe Library (Roche) of for-

ward and reverse primers as follows: 14-3-3s gacacagagtccggc

attg & atggctctggggacacac (probe 27); p21 tcactgtcttgtaccct

tgtgc & ggcgtttggagtggtagaaa (probe 32); MDM2 gactccaagcgcg

aaaac & cagacatgttggtattgcacatt (probe 68); E2F1 tccaagaaccac

atccagtg & ctgggtcaacccctcaag (probe 5); BAX agcaaactggtgctc

aagg & tcttggatccagcccaac (probe 69).

2.10. Preparation of cell extracts and western blotanalysis

Harvested cells were lysed in Laemmli buffer and proteins

were then analyzed by Western blot. Immunodetection was

performed using the following primary antibodies: anti-p53

(clone DO1, kindly given by RTH); anti-SV5 (MCA1360, Serotec,

Germany); anti-Mdm2 (Calbiochem, EMD Chemicals, USA).

PCNA and E2F-1 antibodies (Santa Cruz Technology, USA).

P21, PUMA and Bax antibodies from Cell Signalling Technol-

ogy (MA, USA), GAPDH antibody used as a control of charge

from Sigma, 14.3.3s (Abcam, UK), Bax and Bcl-XL from Life

Technologies (USA), anti-ubiquitin lys-K48 specific fromMilli-

pore, (MA, USA) and anti-ubiquitin lys-K63 specific from Enzo

Life Sciences (NY, USA).

2.11. Pull-downs of polyubiquitylated proteins usingTUBES followed by immunoprecipitation

Cells were plated the day before and stimulated according to

the experiment. Then cellswere lysed using TUBEs lysis Buffer

as previously described (Hjerpe et al., 2009; Aillet et al., 2012).

Captured polyubiquitylated proteins were submitted to an

immunoprecipitation assay using Protein A dynabeads

cross-linked with 4 mg specific antibody. After 2 h of binding

at 4 �C, beads were washed three times with lysis buffer and

resuspended in Laemmli buffer X3. Proteins were then sub-

mitted to Western blot analysis.

2.12. In vitro degradation of OD mutants by 20S and 26Sproteasomes

In vitro transcribed/translated p53 WT and OD were incubated

in a degradation mixture containing ATP regenerating system

[25 mM Tris pH 7.6, 5 mM MgCl2, 2 mM ATP, 10 mM creatine

phosphate (Sigma), 5 mM NaCl2, 3.5 U/ml of creatine kinase

(Sigma) and 0.6 U/ml of inorganic pyrophosphatase (Sigma)],

10 mg Ubiquitin (Sigma), 10 ng human E1 Ubiquitin activating

enzyme (Biomol), 500 ng E2 Ubiquitin conjugating enzyme

UbcH5b (Biomol), as previously described (Hjerpe et al., 2010)

with 1 mg of purified 26S or 20S proteasome (Boston Biochem).

For 26S proteasome reactions, in vitro transcribed/translated

MDM2 was supplemented in the degradation mixture. The

degradationmixture was incubated at 30 �C for 2 h and the re-

action was stopped by addition of SDS sample buffer contain-

ing b�mercaptoethanol. Reaction products were fractionated

by SDS-PAGE (10%) and analyzed by Western-blotting.

3. Results

3.1. Effect of point mutations in the dimerization-foldingnucleus

Tobetterunderstand thestructural determinantsofhowmuta-

tions in the p53 OD affect tetramerization, and consequently

transcriptional activity, ubiquitylation and stability, we per-

formed docking and molecular dynamics (MD) studies. The

following mutants were analyzed: L330R (OD1), L330R þ F328V

(OD2), L330E (OD3), L330M (OD4) and L330P (OD5) (Figure 1A).

We performed one docking simulation between two WT p53

monomers (PDB1AIE; 1.5�A),andfiveothersimulationsbetween

mutant monomers (in which the same mutations were intro-

duced in both monomers). The docking simulation well pre-

dicted the WT p53 dimer orientation (Table 1, Figure 1B). The

mutants OD1 and OD2 showed significantly worse binding en-

ergies (Table 1) and structurally worse predictions (Figure 1B),

while the OD3, OD4 and OD5 mutants were predicted to be

structurally correct, with only slightly worse binding energies.

In order to evaluate the effect of the mutations on the confor-

mational stability of the p53 dimeric structure, we performed

MD on the WT and mutant variants. The mutants OD1 and

OD5showed thehighestgeneraldeviation frominitial structure

along theMD (Figure 1C, Table 1). Overall,MD shows low stabil-

ity inOD1 andOD5mutants, while docking showspoor binding

energy in OD1, and OD2mutants. Only OD3 and especially OD4

show binding energy and stability values similar toWT.

To understand the structural rearrangements that are

responsible for the loss of stability or changes in the relative

dimer orientation in the mutants, we used the MD data to

compute the free energy of all possible contacts between

each 330 residue and the other monomer (Table 2). Interest-

ingly, in L330M mutant, all the studied contacts are similar

to WT, which indicates that no major energetic effect is seen

along the dynamics. In the other mutants, there are always

contacts whose energy changes in the mutant. In the L330P

mutant, there is a loss of binding energy in several of the con-

tacts. In the case of L330Emutant, in spite of not showing ma-

jor differences in docking energy or dynamics stability, it is

clear that themutation introduces new highly favorable inter-

actions like E330-R342 or E330-N345, which can affect dimer-

ization. In mutants L330R and L330R þ F328V there are also

several new favorable interactions as well. Interestingly, the

new residue R330 forms a favorable interaction with E346 in

L330R mutant, but not in L330R þ F328V and, on the contrary,

Figure 1 e Effect of oligomerization domain point mutations on the stability of p53 dimers. A) Single point mutations were introduced in the OD

of p53 as indicated. B) Lowest-energy docking solutions obtained for WT (dark gray) and the different mutants (OD1 in blue; OD2 in red; OD3 in

magenta; OD4 in yellow; OD5 in green), as compared to the X-ray structure of the p53 dimer (in grey). C) RMSD for Ca atoms of WT and

different mutants (same color code as above). D) Minimal pairwise residue distance between L330 (or equivalent residue if mutated) and E346 from

different monomers in WT and mutants OD1 (L330R), and OD2 (L330R D F328V) (same color code as above). E) Minimal pairwise residue

distance between L330 (or equivalent residue if mutated) and E349 from different monomers in WT and mutants L330R, and L330R D F328V

(same color code as above).

the same new residue R330 forms a favorable interaction with

E349 in L330R þ F328V but not in the single L330R mutant

(Table 2; Figure 1D, E). All mutants except L330M significantly

affect the network of contacts formed by the core residues

involved in dimerization.

3.2. The hydrophobicity of the OD conditions p53tetramerization and transcription

To evaluate the characteristics of the L330 mutants, transient

transfections of p53 null H1299 cells were performed.

Table 1 e Docking simulation of homodimers and heterodimers ofp53 OD mutants and WT p53. Predicted dimer binding energy andligand RMSD values of the lowest-energy solution from the p53dimer complex structure.

p53 ODform

Lowest-energy dockingsolution

MD AvgTot-RMSD

Energy RMSD (�A) (10e40 ns)

WT �61.2 3.5 2.0

OD1 �38.4 6.1 4.9

OD2 �26.4 14.0 3.5

OD3 �50.5 2.8 2.6

OD4 �53.2 3.1 2.8

OD5 �55.7 1.1 5.1

Table 2 e Free energy of dimer residueeresidue contacts (Kcal/mol).

ResB-ResA WT OD1 OD2 OD3 OD4 OD5

L330-T329 �2.39 �2.25 �2.37 �2.89 �2.47 �2.53

L330-L330 �4.22 �3.55 �3.64 L3.03 �4.58 L0.65

L330-I332 �1.16 �0.77 �0.86 �0.94 �1.22 �1.39

L330-F338 �1.67 L3.22 L3.75 �1.06 �1.67 �0.86

L330-F341 �1.26 L3.40 �0.75 �1.31 �1.49 �2.21

L330-R342 �1.43 �1.56 �0.89 L11.52 �1.12 L0.08

L330-N345 �0.46 0.22 0.00 L5.90 �0.47 �0.02

L330-E346 �0.06 L4. 04 �0.26 0.29 �0.05 �0.02

L330-E349 �0.04 �0.10 L4.92 0.01 �0.03 �0.01

Pairwisecontactswithmore than1kcal/mol change indicated inbold.

Tetramer formation was analyzed using glutaraldehyde (GA)

crosslinking (Hjerpe et al., 2010) and assessed by two criteria,

detection of high molecular weight forms of around 175 kDa

and disappearance of p53 monomeric forms. The patient

derived mutation L330R (OD1) exhibited severe defects in

tetramer formation (Figure 2A and Duddy et al., 2000; Hjerpe

et al., 2010; Kawaguchi et al., 2005) and transcriptional activity

(Figure 2B and Hjerpe et al., 2010; Kato et al., 2003; Kawaguchi

et al., 2005). Introduction of a second patient-derived muta-

tion, F328V, did not have any additional effect on tetrameriza-

tion of the resulting L330R/F328V double mutant (Kato et al.,

2003). Changing L330 to the negatively charged amino acid E

(OD3) or to the less hydrophobic amino acid P (OD5) equally

impaired the formation of tetramers and transcription of

p21 and Bax genes measured using luciferase reporter assays

(Figure 2A and B). However, mutation of L330 to the bulky hy-

drophobic amino acid M (OD4) allows tetramer formation and

transcription of p53-dependent genes (Figure 2A and B). The

observed defects were not due to a mislocalization of the

p53 mutants compared to WT p53 (Figure 2C). Thus, the hy-

drophobic nature of the p53 oligomerization domain condi-

tions the formation of transcriptionally active p53

homotetramers without affecting the nuclear localization of

p53 monomers (OD1, OD2, OD3 and OD5 mutants).

3.3. Alternative proteolytical pathways contribute todegrade WT p53 and OD mutants

As ubiquitylation is known to play an important role in regu-

lating the stability of WT p53, we investigated if the

degradation of the OD mutants was affected. In order to eval-

uate potential differences in degradability, low levels of Mdm2

expression were used in p53 null H1299 cells. Tetramerizable

p53 molecules (WT and mutant OD4) were more efficiently

degraded than monomeric mutants OD1, OD2, OD3 and OD5,

showing various levels of degradation (Figure 3A). The

observed degradation was ubiquitin-proteasome-dependent

and could be fully or partially inhibited when using a catalyt-

ically inactive Mdm2 mutant (C464) or the proteasome inhibi-

tor MG132 (Figure 3A).

The possible contribution of alternative proteolytical path-

ways in the degradation of non-tetramerizable mutants was

explored in H1299 cells (Figure 3B) and U2OS (Supplementary

Figure 1). To better evaluate the effects of distinct protease in-

hibitors, degradation driven by Mdm2 was improved by

increasing its expression in cells co-transfected with WT p53

or OD mutants. After verification that Mdm2 was equally

expressed (data not shown), cells were treated during 24 h

with different combinations of protease inhibitors: 1) chloro-

quine (CQ) that inhibits autophagy and lysosomal protein

degradation (Mehrpour et al., 2010) 2) pan-caspase Z-VAD-

fmk (Z) an inhibitor that irreversibly binds to the catalytic

site of caspase proteases (Slee et al., 1996) and 3) MG132

(MG). MG efficiently protects WTp53 and p53 OD mutants

from proteasomal degradation without reaching 100% inhibi-

tion (Figure 3B). In contrast Z modestly (but consistently) pro-

tected WTp53 and p53 OD mutants. However, the

combination of Z with MG increased its protective effect on

all analyzed p53 molecules. Chloroquine showed no protec-

tive effect when used alone but enhanced the protective effect

of MG/Z, allowing the recovery of almost 100% of all p53 mol-

ecules. With small variations, similar results were obtained

with U2OS cells transiently transfected with different mu-

tants or WT p53 (Supplementary Figure 1). From these exper-

iments we conclude that proteasomal degradation is a major

pathway for the Mdm2-mediated degradation of WTp53 and

p53 OD mutants. Additionally, caspases and lysosomal path-

ways might also be implicated in the Mdm2-mediated turn-

over of these p53 molecules.

3.4. Oligomerization determines ubiquitin-dependent orubiquitin-independent proteasomal degradation of p53

Given that p53 OD mutants are degraded through the protea-

some, we further investigated their turnover by the ubiquitin-

proteasome system (UPS). First we analyzed the ubiquityla-

tion pattern of WT p53 or p53 OD mutants using ubiquitin

traps known as TUBEs (Hjerpe et al., 2009) in H1299 cells

(Figure 4A). We found that p53 molecules that cannot tetra-

merize (OD1, OD2, OD3 and OD5) have defects in ubiquityla-

tion compared to wild type p53 and OD4 mutant (Figures 2A

and 4A). Using in vitro degradation assays, we confirmed that

tetramerizable p53 molecules were more efficiently degraded

by the 26S proteasome in a reaction containing ubiquitin and

Mdm2while non-tetramerizable p53 ODmutants were prefer-

entially degraded by the 20S proteasome in the absence of

Mdm2 (Figure 4B) (Hjerpe et al., 2010). To investigate if the de-

fects in ubiquitylation and the degradation by 26S and 20S

proteasome had any impact on the half-life of p53 OD mu-

tants, we performed cycloheximide experiments in H1299

Figure 2 e Oligomerization domain controls p53 tetramerization and transcription. A) P53 OD mutants present severe tetramerization defects

after glutaraldehyde (GA) crosslinking. H1299 cells were transfected with WT p53 or OD mutants. B) Tetramerization defective p53 OD mutants

do not activate transcription of target genes. H1299 cells were co-transfected with the indicated luciferase reporters and WTp53 or OD mutants.

C) Localization of WT p53 and OD mutants by immunofluorescence in H1299 cells. Anti-p53 (clone DO1) antibody was used for detection.

cells (Figure 4C). We observed that ODmutants weremore un-

stable than WT p53 at early times after cycloheximide treat-

ment. OD1, OD2, OD3, and OD5 mutants show a similar

degradation profile in the in vitro assay executed in presence

of the 20S proteasome (Figure 4B). Unexpectedly, OD4 mutant

was more unstable than WT p53 despite the fact that those

molecules share most biochemical properties. Differences in

stability between WT p53 and OD mutants remain at late

stages of cycloheximide treatment even if these were signifi-

cantly reduced.

3.5. Oligomerization defective p53 mutants formheterotetramers with WT p53

Next, we wanted to investigate if p53 OD mutants could exert

an effect on the wild type molecule, to analyze what could

Figure 3 e Proteolytical pathways driving WT p53 and OD mutants

to degradation. A) Role of ubiquitylation on the degradation of OD

mutants. Mdm2 was expressed to high levels together with WT p53 or

OD mutants in H1299 cells. Mdm2 mutant (C464) was used as

indicated. GAPDH was used as charge control. Western blot

detection with the indicated antibodies. B) Alternative proteolytical

pathways driving WTp53 and OD mutants to degradation. H1299

cells were co-transfected with plasmids expressing WT p53 or OD

mutants together with plasmid expressing Mdm2. The indicated

treatments were used during 24 h: Chloroquine (CQ), Z-VAD (Z)

and MG-132 (MG). GAPDH was used as charge control. Analysis by

Western blots with the indicated antibodies.

occur in a model of autosomal dominant inheritance

(Petitjean et al., 2007). For this purpose, we first evaluated

the capacity of the untagged OD mutants to form tetramers

in H1299 cells co-expressing constant low level of SV5 tagged

WT p53 (Figure 5A). Using GA crosslinking, we found that OD1,

OD2, OD3 andOD5mutants promote a dose dependent forma-

tion of WT p53 tetramers suggesting that these mutants were

integrated into heterotetramers. To confirmour interpretation

a similar experiment was performed using SV5 tagged ODmu-

tants and constant levels of untagged WT p53 (Figure 5B). We

observed that all mutants were integrated but in different pro-

portions following the order OD4 > WT > OD5 > OD1 >

OD2 > OD3. Difficulties to integrate heterotetramers of OD1,

OD2, OD3, and OD5 mutants were also observed after ADR

stimulation of U2OS cells (Figure 7B and Supplementary

Figure 2). Altogether our tetramerization assays indicate that

all OD mutants integrate heterotetramers in different propor-

tions and have an impact on the stability of the WT p53

tetramer. To further support these observations, p53-

dependent reporter assays were performed by co-expressing

similar levels of WT p53 together with p53 OD mutants

(Figure 5B). Interestingly, WT p53 and p53 OD4 mutant acti-

vate transcription of Bax-Luc or p21-Luc reporters. In contrast,

p53 OD1, OD2, OD3 and OD5 heterotetramers repress the gene

expression driven by WT p53, thus acting as dominant nega-

tive mutants (Figure 5B).

3.6. WT p53 and OD mutants are modified by distinctpolyubiquitin chains

The effect of p53 OD mutants on the ubiquitylation pattern of

endogenous WT p53 was investigated using U2OS cells. Cells

were transiently transfected with plasmids expressing SV5

tagged versions of WT p53 or OD mutants in the presence or

absence of Mdm2 (Figure 6A). In the absence of Mdm2, few

polyubiquitin chains were observed in the TUBEs-captured

fraction with WT p53 and OD4 mutant. In presence of

Mdm2, an accumulation of ubiquitylated forms of WT p53

and OD4 mutant were captured while a mild accumulation

was observed for OD1, OD2, OD3 and OD5 (Figure 6A). When

WT p53 or OD4 mutant were transfected, endogenous WT

p53 was efficiently captured by TUBEs suggesting that these

molecules can be well integrated into the ubiquitylated p53

complexes. Furthermore, TUBEs can also capture endogenous

p53 into complexes with OD1, OD2, OD3 and OD5mutants but

to a lesser extend (Figure 6A lower panels), thus supporting

our previous conclusion. To characterize these chains, a

similar experiment was done in presence of Mdm2, now

with the aim to perform immunoprecipitations from TUBE-

captured material using p53, ubiquitin K48 or ubiquitin K63

specific antibodies (Figure 6B). In the presence of WT p53

and OD4, we can observe an accumulation of K48 polyubiqui-

tin chains. The presence of OD2 and OD3mutants show an in-

termediate level of K48 ubiquitin chains compared to the low

level found with OD1 and OD5 mutants. Surprisingly, only

WTp53 allows an accumulation of the K63 polyubiquitin

chains. The amount of K63 ubiquitin chains is severely

affected in all mutants including OD4 that sharedmostmolec-

ular characteristics with WT p53 (Figure 6B). Thus, distinct

patterns of ubiquitin chains can be formed on p53 in the

Figure 4 e Oligomerization determines ubiquitin-dependent or -independent proteasomal degradation of p53. A) Ubiquitylation pattern of WT

p53 and OD mutants. H1299 cells were transfected with the indicated p53 molecules and Mdm2. TUBEs-captured material was analyzed by

Western blot with the indicated antibodies. B) In vitro degradation assays of p53 OD mutants using either 26S or 20S proteasomes in the presence

or absence of Mdm2. Western blot detections with the indicated antibodies. Quantifications from 4 different experiments were performed and

plotted to the right. Standard deviations are indicated. C) Half-life of p53 OD mutants in H1299 cells. Cells were treated with cycloheximide

during the indicated times to analyze OD mutants half-life. Western blot analysis with anti-p53 DO1. GAPDH was used as charge control.

Quantification were plotted in the graph (right panel).

presence of ODmutants, and onlyWT p53 shows efficient K48

and K63 polyubiquitylation.

3.7. OD defective mutants differentially affectexpression of p53-dependent genes

To better evaluate the repressive effects of OD mutants on

endogenousWT p53, the response to ADR was analyzed using

U2OS cells stably expressing the different p53 mutants. ADR

stimulations during short periods of time and up to 24 h did

not provide important differences in the expression of p53-

dependent genes (Supplementary Figure 3). For this reason,

we have implemented a protocol to mimic chemotherapy

treatments used for patients were established by adapting a

previously reported procedure (Kopp et al., 2012). Cells were

exposed for 1 h of ADR (1 mM) then incubated for 24 h and har-

vested at three different times: day 2, day 7 and day 11 (see

schematic of the procedure in Figure 7A). Cell number count-

ing, tetramerization assays and extracts for Western blot

analysis were prepared for each time point. The level of

expression of both endogenous and exogenous p53 molecules

was monitored by Western blot (Figure 7A) as well as their ca-

pacity to form heterodimers and heterotetramers (Figure 7B).

The expression of several p53-dependent genes including

those involved in apoptosis and regulation of cell cycle was

also analyzed using the same samples (Figure 7C). Under com-

parable GAPDH loading conditions, the expression of p21,

14.3.3s, Bax, PUMA and Bcl-XL was increased after each pulse

of ADR until day 11, with only minor differences in some mu-

tants (Figure 7C). While the expression of p21 was similar for

most p53 OD mutants compared to WT p53, the expression

of Bax was affected and showed different levels of expression.

Interestingly, OD3 did not favor the expression of Bax on the

third pulse of ADR (D11) and OD5 delayed the expression of

Bax until D11. It is important to underline that U2OS cells do

not express the anti-apoptotic Bcl-2 protein that usually het-

erodimerizes with Bax during apoptosis (data not shown).

While the expression of 14.3.3s was severely reduced at D11

Figure 5 eOligomerization defective p53 mutants out compete WT p53 transcription. A) Capacity of p53 OD mutants to integrate tetramers with

WT p53. H1299 cells were transiently transfected with constant WT p53-SV5 together with increasing concentrations of untagged OD mutants.

Tetramerization assays were performed and detection was done by Western blot with anti-SV5 antibodies. B) UntaggedWT p53 was co-transfected

with increasing concentrations of OD-SV5 mutants into H1299 cells. Tetramerization assays were performed and detection was done by Western

blot with anti-SV5 antibodies. C) Effect of p53 OD mutants on transcription mediated by WTp53. Luciferase reporter assays were performed in

H1299 cells using the Bax and p21 promoters. n [ 4.

Please cite this article in press as: Lang, V., et al., Tetramerization-defects of p53 result in aberrant ubiquitylation andtranscriptional activity, Molecular Oncology (2014), http://dx.doi.org/10.1016/j.molonc.2014.04.002

Figure 6 e Ubiquitylation pattern of p53 OD mutants in presence of WT p53. A) U2OS cells were transfected with WT p53 or OD mutants in the

presence or absence of Mdm2. Twenty-four hours after transfection, ubiquitylated forms were captured using TUBEs and revealed by Western blot

using anti-p53 antibody. B) Ubiquitin chain types formed in the presence of p53 OD mutants. TUBEs capture was followed by an

immunoprecipitation using an anti-p53, anti-K48 or anti-K63 antibodies revealed by Western blot using anti-p53 antibody DO1.

in the presence of OD1, OD2 and OD3mutants (Figure 7C), Bcl-

XL showed low expression levels at D2 in presence of OD2,

OD3, OD4 and OD5. PUMA showed high basal levels of expres-

sion with OD1 and OD2 mutants while PCNA and Mdm2 pro-

teins levels showed minor changes in presence of all

mutants. E2F was expressed to basal levels in WT and most

ODmutants but at D7 and D11, after ADR stimulation, expres-

sion was decreased except for OD5. To confirm that these ef-

fects on transcription are also reflected at mRNA expression

level, we performed qPCR analysis using the same U2OS cells

stably expressing OD mutants or WT p53 (Supplementary

Figure 4). We could observe that although the pattern of

mRNA expression of p21, MDM2, E2F1, BAX and 14.3.3s is

not exactly the same than the pattern of protein expression

before and after stimulation with ADR at days 2 and 7 accord-

ing to our protocol (Figure 7C), all OD mutants promote a

different pattern of gene expression compared to WT p53.

This was especially evident for E2F1 and 14.3.3s. Altogether,

our results indicate that p53 OD mutants alter WT p53-

dependent gene expression.

Thus, thenegativeeffectsonbasal transcriptionofallODmu-

tantsweredifferent fromtheir capacity to inhibit theexpression

of p53-dependent genes after genotoxic insult with ADR. Unlike

the overexpression, the equivalent level of WT p53 and ODmu-

tantsdoesnotexertadominantnegativeeffect but ratheraffects

the pattern of expression of p53-dependent genes that appears

to be unique for each OD mutant. Remarkably, the p53 OD1

mutant, found in patients appears to be the one with the more

severechanges ingeneexpression.Altogether these results indi-

cate thatmutations in the OD domain of p53 affect the capacity

to oligomerize, altering ubiquitylation, stability and transcrip-

tion mediated by this tumor suppressor (Figure 8).

Figure 7 e OD defective mutants modify the expression of p53-dependent genes. U2OS stably expressing the different p53 mutants were

stimulated with ADR during 1 h and kept in culture for the indicated periods of time (day 2, day 7 and day 11). A) Schema of the chemotherapy-

like treatment used in this experiment. Monitoring of protein levels of both endogenous and exogenous p53 molecules was performed by Western

blot. B) Formation of tetramers in stable cell lines expressing ODmutants. Basal and ADR induced formation of p53 oligomers at days 2, 7 and 11.

C) The expression of p53-dependent genes involved in apoptosis and cell cycle regulation. Western blot analysis using the indicated antibodies.

4. Discussion

Early studies underlined the importance of the oligomeriza-

tion domain of p53 in the regulation of transcription and tu-

mor suppressor potential of this crucial cellular factor

(Chene and Bechter, 1999; Chene et al., 1997). The connection

between ubiquitylation and several p53 properties, including

tetramerization and susceptibility to the 26S proteasome

degradation has been studied by several groups (Hjerpe

et al., 2010; Maki, 1999; Maki and Howley, 1997). More recently,

ubiquitylation on the C-terminal region of p53 has been pro-

posed to regulate gene expression rather than stability (Feng

et al., 2005). To shed some light on different conclusions, we

focused our efforts on studying p53 mutants that affect the

dimerization-“folding nucleus” (Figure 1). Our first approach

used docking and molecular dynamic simulations to predict

binding energy and stability of these mutants. We found

that only OD3 (L330E) and especially OD4 (L330M) show

Figure 7 e (continued)

binding energy and stability values similar to WT. We also

observed poor binding energy for L330R (OD1), and

L330R þ F328V (OD2) mutants and low stability for OD1 and

OD5 (L330P) mutants. The loss of stability or changes in the

relative dimer orientation studies revealed that all mutants

except L330M introduced significant energy changes in the

network of contacts formed by the core residues that can

affect dimerization. Our results show that the good integra-

tion of OD1 and OD2 into heterotetramers (Figure 5A) could

be related to their capacity to form homodimers when

expressed alone (Figure 2A). On the other hand, OD3 and

OD5 are not in favor of forming either homodimers or homo-

tetramers (Figure 2A). Therefore, one can speculate that there

is a predisposition to form heterotetramers containing only

one molecule of OD3 or OD5, while two mutant molecules

might exist within the heterotetramer formed by OD1 or

OD2 (Figures 2A and 5A). Coherently with our interpretation,

we found that, with the exception of the hydrophobic OD4

mutant, the inability for p53 OD mutants to form homote-

tramers was dramatically affecting their ubiquitylation and

transcriptional activity capacity (Figures 2 and 4). Also, OD1,

OD2, OD3 and OD5 p53 mutants were mainly degraded by

Figure 8 e Integrated view of the effect of p53 OD mutants on tetramerization, ubiquitylation and p53 mediated transcription. According to the

nature of the amino acid change, mutants can be grouped in hydrophobic, acid, neutral or basic and resulting in a different expression of p53

dependent genes. Due to the double mutation of OD2, the pattern of expression of this mutant shows a mixed phenotype OD1/OD3/OD4.

Defects of ubiquitylation and tetramerization are indicated as follows: 0, no defect; D poor defects; DD medium defects; DDD severe defects.

Changes in genes expression are indicated as follows: (L) reduction; (LL) significant reduction; L/D alterations; increase (D); significant

increase (DD).

the ubiquitin-independent degradation mediated by the 20S

proteasome (Figure 4C) while WT and OD4 mutant were

good substrates for the 26S proteasome. These results suggest

the intervention of the so-called “default pathway” proposed

by Shaul and collaborators where the 20S proteasome

contribute to the degradation of unstructured monomers

(Asher et al., 2006). Indeed, the lack of integration of p53 OD

mutants into a more stable tetrameric structure could facili-

tate the action of the 20S proteasome in vitro and bypass the

requirement of ubiquitylation (Figure 4C, D). Furthermore,

we found that other proteolytical pathways including cas-

pases or the lysosome might contribute to p53 degradation

when Mdm2 is overexpressed (Figure 3B and Supplementary

Figure 1).

Interestingly, we observed that p53 OD mutants unable to

form homotetramers could form heterotetramers with WT

p53 thus affecting p53-dependent transcription in overexpres-

sion conditions (Figure 5). Those defects were also reflected in

the ubiquitylation pattern of endogenous p53 detected in

U2OS cells (Figure 6). While we cannot exclude that some of

the efficient ubiquitylation observed might come from exoge-

nousWT p53 or OD4, one can clearly observe that endogenous

WT p53 was efficiently captured by TUBEs (Figure 6A low

panels). In the same experiment we confirmed that other OD

mutants can also integrate endogenous p53 but to a lesser

extend. These results indicate that endogenous WT p53

molecules can be well integrated into the ubiquitylated exog-

enous p53 complexes. Furthermore the pattern of ubiquitin

chains is not the same when immunoprecipitated with anti-

bodies against K48 or K63 chains, arguing in favor of an OD

mutant-dependent formation of heterologous ubiquitin

chains.

Despite the similar pattern of K48 ubiquitin chains found

when overexpressing WT p53 or OD4 mutant, the pattern of

K63 ubiquitin chainswas significantly reduced forOD4mutant.

This absence of ubiquitin K63 chains, here appears to change

the expression of some apoptotic and cell cycle arrest genes

induced by WT p53 at least the ones that we analyzed. More

dramatically, we found that defects in the formation of K48 or

K63ubiquitinchains inall otherODmutantsaffectgeneexpres-

sion indifferentproportions.All together, these results indicate

that changinga singleaminoacid inODcanaffect thepatternof

ubiquitylation and gene expression.

Most features and properties of WT p53 and OD4 mutant

are shared due to the hydrophobic nature of both forms

including its capacity to form homotetramers and activate

transcription of luciferase reporters. However some differ-

ences between WT p53 and OD4 mutant can be observed at

the level of protein stability (Figure 4C) and ubiquitin chain

pattern (Figures 4A and 6). The preference of OD4 to form

K48 chains in the presence of WT p53 is compatible with the

fact that OD4 is more instable than WT p53 (Figures 4C and

5A). Interestingly, in the presence of OD4, the protein levels of

E2F1, PUMA and 14.3.3s were often higher that those found

when WT p53 was expressed. These observations support

the possibility that K48 chains on OD4 mutant are implicated

in the formation of transcriptionally active complexes

coherent with the transcriptional activation by destruction

mechanism of regulation recently discussed by McShane

and Selbach (2014) and deeply studied by Caltic and collabora-

tors (Catic et al., 2013). Such mechanism might be masking a

more important role for this post-translational modification

in the formation of active p53 transcriptional complexes. In

that sense, our evidence are not the first ones that associate

K48 chain formation to activation of transcription (Le Cam

et al., 2006).

We have shown that overexpression of p53 OD mutants

exert a dominant negative effect on WT counterpart. This is

coherent with the notion that in cancer cells where p53 is

mutated, this form is overexpressed as a consequence of the

elimination of the wt allele. Therefore overexpression condi-

tions most likely reflect what happens in those tumoral cells.

However, to better evaluate the impact of ODmutants on het-

erotetramerization and transcriptional activity, we generate

U2OS cells stably expressing equivalent or lower levels of OD

mutants than endogenous WT p53. We found that formation

of heterotetramers interferes with the capacity of endogenous

WT p53 to activate transcription of p53-dependent genes after

ADR stimulation. While the induction of p21 is comparable in

all cases, Bax and PUMA expression drops in some cases, with

the patient-derived OD1 (L330R) mutant having the most se-

vere reduction of protein levels (Figure 8). In apparent contra-

diction with observations obtained using luciferase reporters

and overexpression systems (Figure 5B), the stable expression

of ODmutants at levels similar to endogenousWT p53 still al-

lows the expression of p53-dependent genes (Figure 7C). As it

occurs in many cancer types, the overexpression of p53 mu-

tants show more drastic repressive effects on p53-

dependent genes due to several molecular events including

saturation of signaling pathways, promoter occupancy or

basal transcription factors quenching. We have also observed

important differences on the formation of heterotetramers

between transient transfection experiments and U2OS cells

stable expressing OD mutants. Under overexpression condi-

tions OD mutants might favor the formation of complexes

up to saturating levels and therefore no differences could be

appreciated. The establishment of a system where OD mu-

tants are expressed to fairly equal levels than endogenous

WT p53 was required to assess differences between mutants.

However, the molecular characterization of tightly regulated

systems such as p53 is impossible with high protein concen-

trations. Thus, our work shows that the inhibitory potential

of p53 OD mutants could be better assessed using a stable

expression system and differences could be better evaluated

in response to a genotoxic insult such as ADR.

Thus, collected data allow us to correlate the effects of olig-

omerization deficient ODmutants on p53-mediated transcrip-

tion with their ubiquitylation pattern. One can speculate that

ubiquitin proteases or ubiquitin-ligases such as USP7/HAUSP

or E4F1might contribute tomodulate the ubiquitylation status

of p53 controlling its functions (Le Cam et al., 2006). Further

exploration of the ubiquitin-mediated transcription processes

will be crucial to understand how transcriptionally silent p53

OD mutants end up suppressing WT p53 functions and result

in tumor development. This could be particularly important in

pathologies such as the Li-Fraumeni syndrome also known as

the Sarcoma, breast, leukemia and adrenal gland (SBLA) syn-

drome, where there is a predisposition to develop tumors

due to the presence of a mutated p53 allele. Understanding

the role of ubiquitylation in the control of p53-mediated tran-

scription and tumor development process will open new pos-

sibilities for treatment development.

5. Conclusion

In this work, we found that p53 ODmutants unable to form tet-

ramers show ubiquitylation defects and are not transcription-

ally active. However, when co-transfected with WT p53, p53

ODmutants are able to integrate into non-functional heterote-

tramers, acting as dominant-negative proteins over WT p53.

Further exploration of the mechanism of OD mutants trans-

dominance allowed us to establish a link between ubiquityla-

tion defects and changes in the pattern of p53-dependent

gene expression. The study presented herein is of physiological

relevance andmight help to explain in part, the role of cancer-

related p53 missense mutations within the oligomerization

domain (OD) thatoccur inpatientswithLi-Fraumeni syndrome.

Acknowledgments

This work was funded by the MINECO-Spain grants BFU2008-

01108/BMC and BFU2011-28536 (MSR), and BIO2010-22324, and

the Department of Industry of the Government of the Basque

Country, Etortek Research Programmes 2011/2012. Our group

at Inbiomed is supported by the Obra Social KUTXA and the

Diputaci�on Foral de Gipuzkoa. MT-R was supported with a

fellowship from the Autonomous Community of the Basque

Country. A.C. is supported by the Ram�on y Cajal award Span-

ish Ministry of Education, the Basque Department of Industry,

Tourism and Trade (Etortek), Marie Curie Reintegration grant

(277043), Movember Global Action Plan, ISCIII (PI13/00031)

and the Basque Government of Health (2012111086) and Bas-

que Government of Education (PI2012-03) and the European

Research Council (336343).

We sincerely thank Adriana Rojas for her advice on struc-

tural biology aspects.

Appendix A.Supplementary data

Supplementary data related to this article can be found at

http://dx.doi.org/10.1016/j.molonc.2014.04.002.

R E F E R E N C E S

Aillet, F., Lopitz-Otsoa, F., Hjerpe, R., Torres-Ramos, M., Lang, V.,Rodriguez, M.S., 2012. Isolation of ubiquitylated proteins using

tandem ubiquitin-binding entities. Methods Mol Biol 832,173e183.

Alarcon-Vargas, D., Ronai, Z., 2002. SUMO in cancerewrestlerswanted. Cancer Biol. Ther. 1, 237e242.

Asher, G., Reuven, N., Shaul, Y., 2006. 20S proteasomes andprotein degradation “by default”. BioEssays: News Rev. Mol.Cell. Dev. Biol. 28, 844e849.

Blattner, C., Knebel, A., Radler-Pohl, A., Sachsenmaier, C.,Herrlich, P., Rahmsdorf, H.J., 1994. DNA damaging agents andgrowth factors induce changes in the program of expressedgene products through common routes. Environ. Mol.Mutagen. 24, 3e10.

Canutescu, A.A., Shelenkov, A.A., Dunbrack Jr., R.L., 2003. Agraph-theory algorithm for rapid protein side-chainprediction. Protein Sci.: Publ. Protein Soc. 12, 2001e2014.

Case, D.A., Cheatham 3rd, T.E., Darden, T., Gohlke, H., Luo, R.,Merz Jr., K.M., Onufriev, A., Simmerling, C., Wang, B.,Woods, R.J., 2005. The Amber biomolecular simulationprograms. J. Comput. Chem. 26, 1668e1688.

Catic, A., Suh, C.Y., Hill, C.T., Daheron, L., Henkel, T.,Orford, K.W., Dombkowski, D.M., Liu, T., Liu, X.S.,Scadden, D.T., 2013. Genome-wide map of nuclear proteindegradation shows NCoR1 turnover as a key to mitochondrialgene regulation. Cell 155, 1380e1395.

Chene, P., 1997. Semiquantitative comparison of the DNA-bindingactivity of in vitro-synthesized proteins. BioTechniques 23,792e794.

Chene, P., Bechter, E., 1999. Cellular characterisation of p53mutants with a single missense mutation in the beta-strand326-333 and correlation of their cellular activities with in vitroproperties. J. Mol. Biol. 288, 891e897.

Chene, P., Mittl, P., Grutter, M., 1997. In vitro structure-functionanalysis of the beta-strand 326-333 of human p53. J. Mol. Biol.273, 873e881.

Cheng, T.M., Blundell, T.L., Fernandez-Recio, J., 2007. pyDock:electrostatics and desolvation for effective scoring of rigid-body protein-protein docking. Proteins 68, 503e515.

Chowdary, D.R., Dermody, J.J., Jha, K.K., Ozer, H.L., 1994.Accumulation of p53 in a mutant cell line defective in theubiquitin pathway. Mol. Cell. Biol. 14, 1997e2003.

Chuikov, S., Kurash, J.K., Wilson, J.R., Xiao, B., Justin, N.,Ivanov, G.S., McKinney, K., Tempst, P., Prives, C., Gamblin, S.J.,Barlev, N.A., Reinberg, D., 2004. Regulation of p53 activitythrough lysine methylation. Nature 432, 353e360.

Clore, G.M., Ernst, J., Clubb, R., Omichinski, J.G., Kennedy, W.M.,Sakaguchi, K., Appella, E., Gronenborn, A.M., 1995. Refinedsolution structure of the oligomerization domain of thetumour suppressor p53. Nat. Struct. Biol. 2, 321e333.

Duddy, P.M., Hanby, A.M., Barnes, D.M., Camplejohn, R.S., 2000.Improving the detection of p53 mutations in breast cancer byuse of the FASAY, a functional assay. J. Mol. Diagn.: JMD 2,139e144.

Fang, S., Jensen, J.P., Ludwig, R.L., Vousden, K.H., Weissman, A.M.,2000. Mdm2 is a RING finger-dependent ubiquitin proteinligase for itself and p53. J. Biol. Chem. 275, 8945e8951.

Feng, L., Lin, T., Uranishi, H., Gu, W., Xu, Y., 2005. Functionalanalysis of the roles of posttranslational modifications at thep53 C terminus in regulating p53 stability and activity. Mol.Cell. Biol. 25, 5389e5395.

Friedman, P.N., Chen, X., Bargonetti, J., Prives, C., 1993. The p53protein is an unusually shaped tetramer that binds directly toDNA. Proc. Natl. Acad. Sci. U S A 90, 3319e3323.

Funk, W.D., Pak, D.T., Karas, R.H., Wright, W.E., Shay, J.W., 1992. Atranscriptionally active DNA-binding site for human p53protein complexes. Mol. Cell. Biol. 12, 2866e2871.

Gabb, H.A., Jackson, R.M., Sternberg, M.J., 1997. Modelling proteindocking using shape complementarity, electrostatics andbiochemical information. J. Mol. Biol. 272, 106e120.

Hjerpe, R., Aillet, F., Lopitz-Otsoa, F., Lang, V., England, P.,Rodriguez, M.S., 2009. Efficient protection and isolation ofubiquitylated proteins using tandem ubiquitin-bindingentities. EMBO Rep. 10, 1250e1258.

Hjerpe, R., Aillet, F., Lopitz-Otsoa, F., Lang, V., Torres-Ramos, M.,Farras, R., Hay, R.T., Rodriguez, M.S., 2010. Oligomerizationconditions Mdm2-mediated efficient p53 polyubiquitylationbut not its proteasomal degradation. Int. J. Biochem. Cell Biol.42, 725e735.

Hollstein, M., Sidransky, D., Vogelstein, B., Harris, C.C., 1991. p53mutations in human cancers. Science 253, 49e53.

Jeffrey, P.D., Gorina, S., Pavletich, N.P., 1995. Crystal structure ofthe tetramerization domain of the p53 tumor suppressor at 1.7angstroms. Science 267, 1498e1502.

Kato, S., Han, S.Y., Liu, W., Otsuka, K., Shibata, H., Kanamaru, R.,Ishioka, C., 2003. Understanding the function-structure andfunction-mutation relationships of p53 tumor suppressorprotein by high-resolution missense mutation analysis. Proc.Natl. Acad. Sci. U S A 100, 8424e8429.

Kawaguchi, T., Kato, S., Otsuka, K., Watanabe, G., Kumabe, T.,Tominaga, T., Yoshimoto, T., Ishioka, C., 2005. Therelationship among p53 oligomer formation, structure andtranscriptional activity using a comprehensive missensemutation library. Oncogene 24, 6976e6981.

Kopp, F., Oak, P.S., Wagner, E., Roidl, A., 2012. miR-200c sensitizesbreast cancer cells to doxorubicin treatment by decreasingTrkB and Bmi1 expression. PloS One 7, e50469.

Krummel, K.A., Lee, C.J., Toledo, F., Wahl, G.M., 2005. The C-terminal lysines fine-tune P53 stress responses in a mousemodel but are not required for stability control ortransactivation. Proc. Natl. Acad. Sci. U S A 102, 10188e10193.

Le Cam, L., Linares, L.K., Paul, C., Julien, E., Lacroix, M., Hatchi, E.,Triboulet, R., Bossis, G., Shmueli, A., Rodriguez, M.S., Coux, O.,Sardet, C., 2006. E4F1 is an atypical ubiquitin ligase thatmodulates p53 effector functions independently ofdegradation. Cell 127, 775e788.

Lee, W., Harvey, T.S., Yin, Y., Yau, P., Litchfield, D.,Arrowsmith, C.H., 1994. Solution structure of the tetramericminimum transforming domain of p53. Nat. Struct. Biol. 1,877e890.

Levine, A.J., 1997. p53, the cellular gatekeeper for growth anddivision. Cell 88, 323e331.

Maki, C.G., 1999. Oligomerization is required for p53 to beefficiently ubiquitinated by MDM2. J. Biol. Chem. 274,16531e16535.

Maki, C.G., Howley, P.M., 1997. Ubiquitination of p53 and p21 isdifferentially affected by ionizing and UV radiation. Mol. Cell.Biol. 17, 355e363.

Maki, C.G., Huibregtse, J.M., Howley, P.M., 1996. In vivoubiquitination and proteasome-mediated degradation ofp53(1). Cancer Res. 56, 2649e2654.

Maltzman, W., Czyzyk, L., 1984. UV irradiation stimulates levelsof p53 cellular tumor antigen in nontransformed mouse cells.Mol. Cell. Biol. 4, 1689e1694.

Mateu, M.G., Fersht, A.R., 1998. Nine hydrophobic side chains arekey determinants of the thermodynamic stability andoligomerization status of tumour suppressor p53tetramerization domain. EMBO J. 17, 2748e2758.

McShane, E., Selbach, M., 2014. Gene expression: degrade toderepress. EMBO J. 33, 407e408.

Mehrpour, M., Esclatine, A., Beau, I., Codogno, P., 2010. Overviewof macroautophagy regulation in mammalian cells. Cell Res.20, 748e762.

Meyer, T., D’Abramo, M., Hospital, A., Rueda, M., Ferrer-Costa, C.,Perez, A., Carrillo, O., Camps, J., Fenollosa, C., Repchevsky, D.,Gelpi, J.L., Orozco, M., 2010. MoDEL (Molecular DynamicsExtended Library): a database of atomistic moleculardynamics trajectories. Structure 18, 1399e1409.

Miller, M., Lubkowski, J., Rao, J.K., Danishefsky, A.T.,Omichinski, J.G., Sakaguchi, K., Sakamoto, H., Appella, E.,Gronenborn, A.M., Clore, G.M., 1996. The oligomerizationdomain of p53: crystal structure of the trigonal form. FEBSLett. 399, 166e170.

Milner, J., Medcalf, E.A., 1991. Cotranslation of activated mutantp53 with wild type drives the wild-type p53 protein into themutant conformation. Cell 65, 765e774.

Mittl, P.R., Chene, P., Grutter, M.G., 1998. Crystallization andstructure solution of p53 (residues 326-356) by molecularreplacement using an NMR model as template. ActaCrystallograph. Sec D Biolog. Crystallogr. 54, 86e89.

Olivier, M., Eeles, R., Hollstein, M., Khan, M.A., Harris, C.C.,Hainaut, P., 2002. The IARC TP53 database: new onlinemutation analysis and recommendations to users. Hum.Mutat. 19, 607e614.

Petitjean, A., Mathe, E., Kato, S., Ishioka, C., Tavtigian, S.V.,Hainaut, P., Olivier, M., 2007. Impact of mutant p53 functionalproperties on TP53 mutation patterns and tumor phenotype:lessons from recent developments in the IARC TP53 database.Hum. Mutat. 28, 622e629.

Riley, T., Sontag, E., Chen, P., Levine, A., 2008. Transcriptionalcontrol of human p53-regulated genes. Nature reviews. Mole.Cell Biol. 9, 402e412.

Rodriguez, M.S., Desterro, J.M., Lain, S., Lane, D.P., Hay, R.T., 2000.Multiple C-terminal lysine residues target p53 for ubiquitin-proteasome-mediateddegradation.Mol.Cell. Biol. 20, 8458e8467.

Rodriguez, M.S., Desterro, J.M., Lain, S., Midgley, C.A., Lane, D.P.,Hay, R.T., 1999. SUMO-1 modification activates thetranscriptional response of p53. EMBO J. 18, 6455e6461.

Rodriguez, M.S., Wright, J., Thompson, J., Thomas, D., Baleux, F.,Virelizier, J.L., Hay, R.T., Arenzana-Seisdedos, F., 1996.Identification of lysine residues required for signal-inducedubiquitination and degradation of I kappa B-alpha in vivo.Oncogene 12, 2425e2435.

Slee, E.A., Zhu, H., Chow, S.C., MacFarlane, M., Nicholson, D.W.,Cohen, G.M., 1996. Benzyloxycarbonyl-Val-Ala-Asp (OMe)fluoromethylketone (Z-VAD.FMK) inhibits apoptosis byblocking the processing of CPP32. Biochem. J. 315 (Pt. 1), 21e24.

Soussi, T., Beroud, C., 2001. Assessing TP53 status in humantumours to evaluate clinical outcome. Nature reviews. Cancer1, 233e240.

Steinbrecher, T., Latzer, J., Case, D.A., 2012. Revised AMBERparameters for bioorganic phosphates. J. Chem. TheoryComput. 8, 4405e4412.

Sturzbecher, H.W., Brain, R., Addison, C., Rudge, K., Remm, M.,Grimaldi, M., Keenan, E., Jenkins, J.R., 1992. A C-terminalalpha-helix plus basic region motif is the major structuraldeterminant of p53 tetramerization. Oncogene 7, 1513e1523.

Vogelstein, B., Lane, D., Levine, A.J., 2000. Surfing the p53network. Nature 408, 307e310.

Zilfou, J.T., Lowe, S.W., 2009. Tumor suppressive functions of p53.Cold Spring Harbor Perspectives in Biology 1, a001883.

Tetramerization-defects of p53 result in aberrant ubiquitylation and transcriptional activity

Documents