- 1 -
MECHANISM OF ATTENUATION OF SKELETAL MUSCLE ATROPHY
BY D-MYO-INOSITOL 1,2,6-TRIPHOSPHATE
ST Russella, PMA Sirenb, MJ Sirenc, and MJ Tisdalea*
a Nutritional Biomedicine, School of Life and Health Sciences, Aston University,
Birmingham, B4 7ET, UK,
b Bioneris Ab, IAM, Adolf Fredriks Kyrkogata 13, 111 37, Stockholm, Sweden
c JGK Memorial Research Library and Laboratory, Töölön k 19 00260, Helsinki,
Finland
Running Title: Attenuation of skeletal muscle atrophy
* Correspondence M.J. Tisdale:
Email: [email protected] tel: +44 121 204 4021, fax: +44 121 204 3743
- 2 -
ABSTRACT
D-Myo-inositol 1,2,6-triphosphate (alpha trinositol, AT) has been shown to
attenuate muscle atrophy in a murine cachexia model through an increase in protein
synthesis and a decrease in degradation. The mechanism of this effect has been
investigated in murine myotubes using a range of catabolic stimuli, including
proteolysis-inducing factor (PIF), angiotensin II (Ang II), lipopolysaccharide, and
tumour necrosis factor- / interferon-. At a concentration of 100M AT was found
to attenuate both the induction of protein degradation and depression of protein
synthesis in response to all stimuli. The effect on protein degradation was
accompanied by attenuation of the increased expression and activity of the ubiquitin-
proteasome pathway. This suggests that AT inhibits a signalling step common to all
four agents. This target has been shown to be activation (autophosphorylation) of the
dsRNA-dependent protein kinase (PKR) and the subsequent phosphorylation of
eukaryotic initiation factor 2 on the -subunit, together with downstream signalling
pathways leading to protein degradation. AT also inhibited activation of caspase-3/-8,
which is thought to lead to activation of PKR. The mechanism of this effect may be
related to the ability of AT to chelate divalent metal ions, since the attenuation of the
increased activity of the ubiquitin-proteasome pathway by PIF and Ang II, as well as
the depression of protein synthesis by PIF, were reversed by increasing concentrations
of Zn2+. The ability of AT to attenuate muscle atrophy by a range of stimuli suggests
that it may be effective in several conditions.
- 3 -
1. Introduction
A number of chronic and end-stage diseases including cancer, chronic heart
failure (CHF), chronic obstructive pulmonary disease (COPD), sepsis and end-stage
renal failure are associated with muscle atrophy, leading to weakness and eventually
death [1]. For muscle atrophy to occur protein degradation must exceed protein
synthesis, but usually there is an increase in protein degradation together with a
depression of protein synthesis. A number of agents have been shown to induce
muscle atrophy including proteolysis-inducing factor (PIF) [2], angiotensin II (Ang II)
[3], tumour necrosis factor- [4] and lipopolysaccharide (LPS) [5]. These agents
cause a depression of protein synthesis in skeletal muscle, as well as an increase in
protein degradation, and recent results suggest that they all work through the same
cellular signalling pathway to induce muscle atrophy. Thus the depression of protein
synthesis induced by PIF [6], Ang II, TNF- and LPS [7] has been attributed to
activation of the dsRNA-dependent protein (PKR), with subsequent phosphorylation
of eukaryotic initiation factor 2 (eIF2) on the -subunit. This blocks translation
initiation by inhibiting binding of initiator methionyl tRNA to the 40S ribosomal
subunit [8]. They also increase phosphorylation of the elongation factor (eEF2),
decreasing its affinity for the ribosome and contributing to the depression of global
protein synthesis [9].
The predominant pathway responsible for protein degradation in muscle in a
range of catabolic conditions is the ubiquitin proteolytic pathway [10]. There is
increased expression of this pathway in response to PIF [6], Ang II, TNF- [11] and
LPS [5], mediated by activation of PKR leading to increased formation of reactive
oxygen species (ROS), via activation of p38 mitogen-activated protein kinase
(p38MAPK) [11]. The increased ROS leads to activation of nuclear factor-B (NF-
- 4 -
B), which is responsible for increased expression of proteasome subunits and the
ubiquitin ligase MuRF1 [12]. Activation (autophosphorylation) of PKR was shown to
occur through an increase in activity of caspases-3 and -8 [11]. Caspases-3, -7, and -8
have been reported [13] to cleave PKR at Asp251, releasing the kinase domain from
the control of the regulatory amino-terminal domain leading to autophosphorylation.
We have recently identified a polyanionic metal binding agent D-myo-
inositol-1,2,6-triphosphate (alpha trinositol, AT) which attenuated muscle atrophy in
mice bearing a cachexia-inducing tumour [14]. Muscle mass increased due to an
increase in protein synthesis and a decrease in protein degradation. The decrease in
protein degradation was associated with a decrease in activity of both the ubiquitin-
proteasome pathway and caspase-3 and -8, while protein synthesis was increased due
to reduced phosphorylation of both PKR and eIF2. In vitro studies also showed AT
to attenuate the increased protein degradation in murine myotubes in response to PIF
and Ang II.
The current study investigates the mechanism of this effect, as well as protein
degradation induced by TNF- and LPS and the ability of AT to attenuate the
depression of protein synthesis induced by PIF, Ang II, TNF- and LPS.
- 5 -
2. Materials and Methods
2.1 Materials Foetal calf serum (FCS), horse serum (HS) and Dulbecco’s modified
Eagle’s medium (DMEM) were purchased from Invitrogen (Paisley, UK). L-[2,6-3H]
Phenylalanine (sp.act.2.2TBq/mmole) was purchased from American Radiochemicals
(Cardiff, UK). Hybond A nitrocellulose membranes, and ECL development kits were
from Amersham Biosciences Ltd (Bucks, UK). Mouse monoclonal antibodies to 20S
proteasome -subunits and p42 were from Affiniti Research Products (Exeter, UK).
Rabbit monoclonal antibodies to phospho and total PKR were purchased from New
England Biolabs (Herts, UK). Rabbit polyclonal antisera to phospho eIF2 (Ser51)
and to total eIF2 was from Santa Cruz Biotechnology (CA). Rabbit polyclonal
antisera to myosin heavy chain was from Novocastra (Newcastle, UK). Rabbit
polyclonal antisera to mouse -actin, LPS from Ecoli O111:B4, TNF-, IFN-, Ang
II, the chymotrypsin substrate succinyl LLVY-7-amino-4-methylcoumarin (LLVY-
AMC) and dichlorodihydrofluorescein diacetate, were purchased from Sigma
Aldridge (Dorset, UK). Peroxidase-conjugated rabbit anti-mouse antibody and
peroxidase-conjugated goat anti-rabbit antibody were purchased from Dako Ltd
(Cambridge, UK). Electrophoretic mobility shift assay (EMSA) kits were from
Panomics (Redwood City, CA). 1-D-Myo-inositol 1,2,6-triphosphate (alpha
trinositol, AT) was supplied by Bioneris (Helsinki, Finland). Phosphosafe™
extraction reagent and rabbit polyclonal antisera to mouse PKC was from Merck
Eurolab Ltd (Leicestershire, UK). The caspase-3 and -8 substrates and inhibitors
were purchased from Biomol International (Devon, UK). PIF was purified from solid
MAC16 tumours using affinity chromatography with an anti-PIF monoclonal
antibody as previously described [15].
- 6 -
2.2 Myogenic cell culture C2C12 myoblasts were routinely propagated in DMEM
supplemented with 10% FCS, glutamine and 1% penicillin-streptomycin under an
atmosphere of 10% CO2 in air at 37°C. When the myoblasts reached confluence they
were allowed to differentiate into myotubes by replacing the growth medium with
DMEM containing 2% HS, with media changes every two days. Differentiation was
complete within 3 to 5 days and the myotubes were used for experimentation within a
4 day period.
2.3 Measurement of protein synthesis and degradation in myotubes Experiments were
carried out on myotubes formed in 6-well multiwell dishes, as described previously
[6]. Briefly for protein degradation myotubes were labelled with L-[2,6-3H]
phenylalanine for 24h prior to experimentation, washed extensively, and chased for 2h
in fresh DMEM without phenol red, to allow degradation of short-lived proteins. The
myotubes were then incubated with either PIF or Ang II, at the concentrations and
additions detailed in the figure legends, for 24h in the presence of excess (2mM)
phenylalanine, to prevent reincorporation of radioactivity. The extent of protein
degradation was determined from the radioactivity released into the medium, as a
fraction of the total radioactivity incorporated into the myotubes. Protein synthesis
was determined by the incorporation of L-[2,6-3H] phenylalanine into myotubes over
a 4h period in the presence of the additions described in the figure legends. Protein
synthesis was calculated as the radioactivity incorporated into acid (0.2M perchloric
acid) insoluble material.
2.4 Measurement of proteasome activity Functional 20S proteasome activity was
determined as the “chymotrypsin-like” enzyme activity by the release of 7-amino-4-
- 7 -
methylcoumarin (AMC) from the fluorogenic peptide succinyl-LLVY-7-AMC as
described by Orino et al [16]. We have previously described the method in detail for
murine myotubes [17]. Activity was measured in the absence and presence of the
specific proteasome inhibitor lactacystin (10M). Only lactacystin suppressible
activity was considered to be proteasome specific.
2.5 Caspase activity The activity of caspase 3 was determined by the relase of AMC
from the specific substrate AcDEVD-AMC in the presence or absence of the caspase
3 inhibitor AcDEVD-CHO, as described [11]. Myotubes were homogenised in lysis
buffer (150mmol/L NaCl, 1% NP40, 50mmol/L Tris HCl, pH7.4, 0.25% sodium
deoxycholate, 2mmol/L EGTA, 1mmol/EDTA, 0.2mmol/L sodium orthovanadate,
20mmol/L NaF and 1% proteasome inhibitor mixture), left at 4°C, and then room
temperature for 10min, followed by centrifugation at 15,000g for 15 min. The
supernatant (50g protein) was incubated with the caspase 3 substrate for 1h, and the
increase in fluorescence due to AMC was determined at an excitation wavelength of
370nm and an emission wavelength of 430nm. The difference in values in the
absence and presence of the caspase-3 inhibitor was a measure of activity. The
method for caspase 8 was similar with the substrate being Z-IEFTD-AFC and the
inhibitor IETD-CHO. The increase in fluorescence due to the release of 7-amino-4-
trifluoro-methylcoumarin (AFC) was measured with an excitation wavelength of
400nm and an emission wavelength of 505nm.
2.6 Measurement of ROS formation in myotubes The method has previously been
described in detail [18], and measures the conversion of the cell-permeable probe 2,7-
dichlorodihydrofluorescein diacetate, to 2,7-dichlorofluorescein upon oxidation by
- 8 -
ROS. Myotubes were incubated with PIF for 30min, washed with PBS and sonicated
at 4°C after scraping from the plate. An aliquot of the supernatant formed by
centrifugation at 2800g was read on a fluorimeter at an excitation wavelength of
480nm and an emission wavelength of 510nm. In all experiments the protein
concentration of the samples was determined using the Bio-Rad reagent.
2.7 Western blot analysis After the treatments as described in the figure legends,
myotubes were sonicated in Phosphosafe™ Extraction Reagent and centrifuged at
18000g for 5 min. Samples of cytosolic protein (10-15g) were resolved on 10%
sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (6% for
eIF2) at 180V for approximately 1h. The protein on the gels was then transferred to
0.45m nitrocellulose membranes, which were then blocked with 5% Marvel in Tris-
buffered saline, pH 7.5, at 4°C overnight. The primary antibodies were used at a
dilution of 1:1000, except for eIF2 (1:500), actin (1:200) and myosin (1:100). The
secondary antibodies were used at a dilution of 1:1000. Incubation was either for 1h
at room temperature, or overnight, and development was by ECL. Blots were scanned
by a densitometer to quantitate differences.
2.8 Electrophoretic mobility shift assay (EMSA) DNA binding proteins were
extracted from myotube nuclei by hypotonic lysis, followed by high salt extraction as
described [19]. The EMSA binding assay was carried out using a Panomics EMSA
“gel shift” kit according to the manufacturer’s instructions. Assays were conducted
using a biotin labelled double-stranded oligonucleotide having a consensus
recognition sequence for NF-B (5’AGTTGAGGGGACTTTCCCAGGC3’).
Unlabeled probe was added to negative controls, while a positive probe was also
- 9 -
supplied by the manufacturer. Protein-DNA complexes were separated using
nondenaturing PAGE.
2.9 Statistical analysis All results are shown as mean S.E. for at least three replicate
experiments. Differences in means between groups were determined by one-way
analysis of variance followed by Tukey-Kramer multiple comparison test. p values
less than 0.05 were considered ‘significant’.
- 10 -
3. Results
The effect of AT on total protein degradation in murine myotubes induced by
LPS over a 24h period is shown in Fig. 1A. LPS produced a dose-dependent increase
in protein degradation at concentrations up to 100ng/ml, and this was completely
attenuated by AT (100M), at all concentrations of LPS. LPS induced an increase in
expression of both the 20S proteasome, -subunits and p42, an ATPase subunit of the
19S regulator, at the same concentrations as that inducing protein degradation (Fig.
1B), suggesting that it was mediated through the ubiquitin-proteasome pathway. The
increase in expression of both the 20S proteasome and p42 in response to LPS was
completely attenuated by AT, although basal levels were not affected (Fig. 1B). LPS
also depressed protein synthesis in myotubes by 50-60% at the same concentrations as
that inducing protein degradation, and this was also completely attenuated by AT
(Fig. 1C).
TNF- (50ng/ml) either alone, or in combination with interferon-g (IFN-;
10ng/ml), also induced protein degradation in myotubes over a 24h period, and this
was also completely attenuated by AT down to basal levels (Fig. 2A). TNF- alone
produced a 40% decrease in protein synthesis in myotubes after 2h incubation, and
this was increased up to 60% depression in the presence of IFN-. Treatment with
AT, not only attenuated the depression of protein synthesis by TNF- or TNF-+
IFN-, but also caused a significant increase in protein synthesis above basal levels
(Fig. 2B).
We have previously shown [14] that protein degradation in myotubes in
response to PIF and Ang II was also attenuated by AT. Protein degradation induced
by PIF and Ang II is also mediated by the ubiquitin-proteasome pathway, and both
induced an increase in proteasome functional activity, as measured by the
- 11 -
‘chymotrypsin-like’ enzyme activity (Fig. 3A and B). As with total protein
degradation, the induction of ‘chymotrypsin-like’ enzyme activity by PIF and Ang II
was attenuated by AT, suggesting inhibition of the ubiquitin-proteasome pathway.
This was confirmed by measurement of expression of the 20S proteasome -subunits
(Fig. 3C) and p42 (Fig. 3D), which were increased in the presence of PIF and
completely attenuated by AT. These results show that AT attenuates protein
degradation induced by LPS, TNF-, PIF and Ang II by down-regulation of the
increased expression of the ubiquitin-proteasome pathway. It also suggests that AT
inhibits a common mechanism linking protein synthesis and degradation in skeletal
muscle.
One potential target is the activation (autophosphorylation) of PKR and the
subsequent phosphorylation of eIF2 on the -subunit [6]. The immunoblots in Fig. 4
show that PIF induced phosphorylation of both PKR (Fig. 4A) and eIF2 (Fig. 4B),
and that this was maximal at the same concentration (4.2nM) as that inducing
proteasome activity (Fig. 3A), and was completely attenuated by AT. Other
signalling pathways activated by PIF and leading to protein degradation including
activation of protein kinase C (PKC) (Fig. 5A) [20], formation of ROS (Fig. 5B) [18],
and nuclear accumulation of NF-B (Fig. 5C) [21], were all attenuated by AT. Since
these pathways are thought to be downstream of PKR [11], this suggests that AT
inhibits a signalling pathway upstream of PKR. One possible candidate could be
activation of caspase-3/-8, which has been shown to activate PKR in response to
TNF-/IFN- and Ang II [11]. PIF also induced an increase in activity of caspase-3
(Fig. 6A) and caspase-8 (Fig. 6B) in myotubes, which was completely attenuated by
AT. The mechanism by which this effect is manifested is not known, but could be
related to the ability of AT to chelate divalent metal ions. Thus the inhibition by AT
- 12 -
of the increase in chymotrypsin-like enzyme activity induced by both PIF (Fig. 6C)
and Ang II (Fig. 6D) were completely attenuated by concentrations of Zn2+ of 150M,
or above, while the AT-induced attenuation of protein synthesis inhibition by PIF was
also reversed by Zn2+ at concentrations of 100M or above (Fig. 6E).
- 13 -
4. Discussion
AT is a polyanionic compound capable of chelating divalent metal ions, such
as Ca2+ and Zn2+, which bind to phosphates P1 and P6 in the inositol ring structure
[22]. A previous study [14] showed that AT attenuated muscle atrophy in a murine
cachexia model and the current study suggests that it may be a potential therapy for a
range of catabolic conditions, since it attenuates both the depression of protein
synthesis and increase in protein degradation induced not only by PIF, but by Ang II,
LPS and TNF-/IFN-. Since all four agents follow the same cellular signalling
pathway inside of the target tissue, to induce muscle atrophy it suggests that AT
inhibits a common step. Since AT attenuates both the depression of protein synthesis
and increase in protein degradation in muscle, and since activation of PKR is thought
to be the key signal leading to both of these processes [6], it is likely that AT inhibits
a common step leading to activation of PKR. Indeed downstream signals from
PKRinvolved in both the depression of protein synthesis (phosphorylation of eIF2)
and increase in protein degradation (activation of PKC, ROS formation and nuclear
accumulation of NF-B) are inhibited by AT. Activation of PKR is thought to arise
from the caspase-3/-8 cleavage of the regulatory domain leading to
autophosphorylation [13] and the specific caspase-3 and -8 inhibitors were found to
attenuate activation of PKR by TNF- and Ang II, as well as the increase in ROS
formation [11].
The mechanism for activation of caspase-3/-8 is not known, but activation of
caspase-3 has been suggested to be triggered by Ca2+ release from the endoplasmic
reticulum (ER) [23]. An increase in Ca2+ concentration has also been reported to lead
to activation of caspase-3 [24], while depletion of ER Ca2+ stores has also been shown
to activate PKR and induce phosphorylation of eIF2 [25]. We have also shown
- 14 -
(unpublished results) that the membrane-permeable Ca2+ chelator BAPTA-AM
attenuated the PIF-induced activation of caspase-3/-8. These results suggest a role for
Ca2+ in caspase activation.
While AT can chelate Ca2+ its affinity for Zn2+ is higher. Also the polyanionic
nature of AT would suggest that it would not readily enter cells, and the previous
studies suggest that mobilization of Ca2+ from the ER is involved in the activation of
caspase-3/-8, rather than Ca2+ influx from the extracellular space. The ability of Zn2+
to reverse the attenuation by AT of both the depression in protein synthesis by PIF,
and the increased activity of the ubiquitin-proteasome pathway induced by PIF and
Ang II, suggests a role for Zn2+ in the signalling process. Ca2+ release from
intracellular pools in the coloncytic cell line HT29 has been linked to extracellular
Zn2+ through a zinc sensing receptor [26]. The Ca2+ release requires the formation of
inositol 1,4,5-triphosphate and is zinc specific. The Ca2+ response is mediated by a
Gq-coupled receptor that activates the inositol phosphate pathway and was inhibited
by phospholipase C (PLC) inhibitors [26, 27]. The Zn2+ receptor has also been
reported to be present on prostate cancer cells [27], but it is not known if it is present
on skeletal muscle. If it were it would link the ability of AT to modify intracellular
processes, even though the high negative charge would preclude its entry into the cell.
Certainly induction of protein degradation induced by both PIF [28] and Ang II [29]
was inhibited by both U-73122, which inhibits agonist-induced PLC activation, and
D609, a specific inhibitor of phosphatidylcholine-specific PLC. This suggests that the
zinc-receptor pathway may be operating, although PLC may form another part of the
signalling cascade. We have shown a clear inhibitory effect against muscle atrophy,
but we have yet to clarify the specific mode of action by, for example, identifying a
specific receptor which can be blocked by AT. Further studies are required to
- 15 -
investigate the possible, still unidentified, zinc receptor and to explain the Ca2+ release
from intracellular pools in muscle atrophy.
5. Acknowledgements
This work has been supported by a grant from Bioneris Ab.
MJS research effort have supported by Ms Kirsti Ilona Siren (Tampere, Finland).
- 16 -
References
[1] Tan HL, Fearon KCH. Cachexia: prevalence and impact in medicine. Cur
Opin Clin Nutr Metab Care 2008; 11: 400-407.
[2] Cariuk P, Lorite MJ, Todorov PT, Field WN, Wigmore SJ, Tisdale MJ.
Induction of cachexia in mice by a produce isolated from the urine of
cachectic cancer patients. Br J Cancer 1997; 76: 606-613.
[3] Brink M, Wellen J, Delafontaine P. Angiotensin II causes weight loss and
decreases circulating insulin-like growth factor 1 in rats through a pressor-
independent mechanism. J Clin Invest 1996; 97: 2509-2516.
[4] Llovera M, Lopez-Soriano FJ, Argiles JM. Effects of tumor necrosis factor-
on protein turnover in female Wistar rats. J Natl Cancer Inst 1993; 85: 1334-
1339.
[5] Dehoux MJ, van Beneden RP, Gernandez-Clemin L, Lause PL, Thissen JP.
Induction of Mafbx and Murf ubiquitin ligase mRNAs in rat skeletal muscle
after LPS injection. FEBS Lett 2003; 544: 214-217.
[6] Eley HL, Tisdale MJ. Skeletal muscle atrophy, a link between depression of
protein synthesis and increase in degradation. J Biol Chem 2007; 282: 7087-
7097.
[7] Eley HL, Russell ST, Tisdale MJ. Attenuation of depression of muscle
protein synthesis induced by lipopolysaccharide, tumor necrosis factor and
angiotensin II by -hydroxy--methylbutyrate. Am J Physiol 2008; 295:
E1409-E1416.
[8] Rowlands AG, Panniers R, Henshaw EC. The catalytic mechanism of
guanine nucleotide exchange factor action and competitive inhibition by
- 17 -
phosphorylated eukaryotic initiation factor 2. J Biol Chem 1998; 263: 5526-
5533.
[9] Carlberg U, Nisson A, Nygard O. Functional properties of phosphorylated
elongation factor 2. Eur J Biochem 1990; 191: 639-645.
[10] Lecker SH, Solomon V, Mitch WE, Goldberg AL. Muscle protein
breakdown and the critical role of the ubiquitin-proteasome pathway in
normal and disease states. J Nutr 1999; 129: 227S-237S.
[11] Eley HL, Russell ST, Tisdale MJ. Mechanism of attenuation of muscle
protein degradation induced by tumor necrosis factor- and angiotensin II by
-hydroxy--methylbutyrate. Am J Physiol 2008; 295: E1417-E1426.
[12] Cai D, Frantz JD, Tawa Jr NE, Melendez PA, Oh BC, Lidov GHW, et al.
IKK/NF-B activation causes severe muscle wasting in mice. Cell 2004;
119: 285-298.
[13] Saelens X, Kalai M, Vandenabeele P. Translation inhibition in apoptosis.
Caspase-dependent PKR activation and eIF2 phosphorylation. J Biol Chem
2001; 276: 41620-41628.
[14] Russell ST, Siren PMA, Siren MJ, Tisdale MJ. Attenuation of skeletal
muscle atrophy in cancer cachexia by D-myo-inositol 1, 2, 6-triphosphate.
Cancer Chemother Pharmacol 2009; DOI. 10.1007/s00280-008-0899-z.
[15] Todorov PT, McDevitt TM, Cariuk P, Coles B, Deacon M, Tisdale MJ.
Induction of muscle protein degradation and weight loss by a tumour product.
Cacner Res 1996; 56: 1256-1261.
[16] Orino E, Tanaka K, Tamura T, Sone S, Ogura T, Ichihara A. ATP-dependent
reversible association of proteasomes with multiple protein components to
- 18 -
form 26S complexes that degrade ubiquitinated proteins in human HL-60
cells. FEBS Lett 1991; 284: 206-210.
[17] Whitehouse AS, Tisdale MJ. Increased expression of the ubiquitin-
proteasome pathway in murine myotubes by proteolysis-inducing factor (PIF)
is associated with activation of the transcription factor NF-B. Br J Cancer
2003; 89: 1116-1122.
[18] Russell ST, Eley HL, Tisdale MJ. Role of reactive oxygen species in protein
degradation in murine myotubes induced by proteolysis-inducing factor and
angiotensin II. Cell Sig 2007; 19: 1797-1806.
[19] Andrews NC, Faller DV. A rapid micropreparation technique for extraction
of DNA-binding proteins from limited numbers of mammalian cells. Nucleic
Acid Res 1991; 19: 2499.
[20] Smith HJ, Wyke SM, Tisdale MJ. Role of protein kinase C and NF-B in
proteolysis-inducing factor-induced proteasome expression in C2C12
myotubes. Br J Cancer 2004; 90: 1850-1857.
[21] Wyke SM, Tisdale MJ. NF-B mediates proteolysis-inducing factor induced
protein degradation and expression of the ubiquitin-proteasome system in
skeletal muscle. Br J Cancer 2005; 92: 711-721.
[22] Felemez M, Speiss B. Investigation of the ternary D-myo-inositol 1,2,6-
tris(phosphate)-spermine-Zn2+ system in solution. J Inorg Biochem 2001; 84:
107-111.
[23] Suen K-C, Yu M-S, So K-F, Chang R C-C, Hugon J. Upstream signaling
pathways leading to the activation of double-stranded RNA-dependent
serine/threonine protein kinase in -amyloid peptide neurotoxicity. J Biol
Chem 2003; 278: 49819-49827.
- 19 -
[24] Juin P, Pelletier M, Oliver L, Tremblasis K, Gregoire M, Meflah K, et al.
Induction of caspase-3-like activity by calcium in normal cytosolic extracts
triggers nuclear apoptosis in a cell-free system. J Biol Chem 1998; 273:
17559-17564.
[25] Prostko CR, Dholakia JN, Brostrom MA, Brostrom CO. Activation of the
double-stranded RNA-regulated protein kinase by depletion of endoplasmic
reticular calcium stores. J Biol Chem 1995; 270: 6211-6215.
[26] Hershfinkel M, Moran A, Grossman N, Sekler I. A zinc-sensing receptor
triggers the release of intracellular Ca2+ and regulates ion transport. Proc Natl
Acad Sci USA 2001; 98: 11749-11754.
[27] Dubi N, Gheber L, Fishman D, Sekler I, Hershfinkel M. Extracellular zinc
and zinc-citrate, acting through a putative zinc-sensing receptor regulate
growth and survival of prostate cancer cells. Carinogenesis 2008; 29: 1692-
1700.
[28] Smith HJ, Tisdale MJ. Signal transduction pathways involved in proteolysis-
inducing factor induced proteasome expression in murine myotubes. Br J
Cancer 2003; 89: 1783-1788.
[29] Russell ST, Wyke SM, Tisdale MJ. Mechanism of induction of muscle
protein degradation by angiotensin II. Cell Sig 2006; 18: 1087-1096.
- 20 -
Figure Legends
Fig. 1 (A) Effect of LPS alone (▲), or in the presence of AT (100M;), added 2h
prior to LPS, on total protein degradation in murine myotubes over a 24h
period. (B) Western blots showing expression of the 20S proteasome -
subunits and p42 in murine myotubes 24h after addition of LPS, either alone,
or in the presence of AT (100M). The densitometric analysis is an average
of 3 separate Western blots. (C) Effect of LPS on protein synthesis in murine
myotubes after 4h incubation, either alone (), or in the presence of AT
(100M) (). Differences from control are indicated as c, p<0.001, while
differences in the presence of AT are indicated as f, p<0.001.
Fig. 2 Effect of TNF- (50ng/ml) alone, or in combination with IFN- (10ng/ml) on
total protein degradation in murine myotubes over a 24h period (A) and
protein synthesis over 2h (B), either alone (), or in the presence of AT
(100M) (), added 2h prior to the TNF-. Differences from control are
indicated as c, p<0.001, while differences in the presence of AT are shown as
f, p<0.001.
Fig. 3 Chymotrypsin-like enzyme activity in murine myotubes 24h after addition of
PIF (A), or Ang II (B), alone (▲), or in the presence of AT () (100M).
Western blotting of 20S proteasome -subunits (C) and p42 (D) in murine
myotubes 24h after addition of PIF alone, or in the presence of AT (100M).
Actin was used as a loading control. The densitometric analysis is the average
of three separate Western blots. Differences from control are indicated as c,
p<0.001, while differences in the presence of AT are shown as f, p<0.001.
Fig. 4 Western blots showing the effect of PIF on phosphorylation of PKR (A) and
eIF2 (B) after 4h, alone and in the presence of AT (100M) added 2h prior
- 21 -
to PIF. The densitometric analysis represents the average of three separate
Western blots. Differences from control are indicated as c, p<0.001, while
differences in the presence of AT are shown as f, p<0.001.
Fig. 5 Western blot of cytosolic and membrane bound PKC in murine myotubes 2h
after addition of PIF in the absence of presence of AT (100M). (B) Dose-
response curve for ROS production in murine myotubes 30min after addition
of PIF alone (▲), or in the presence of AT (). The results shown are an
average of three separate experiments, and are expressed taking basal
fluorescence of control cells as 100%. (C) Nuclear binding of NF-B
determined by EMSA after treatment of myotubes for 30min with either PIF
alone or in combination with AT. The lane marked +ve was a positive control
for NF-B (HeLa nuclear extract supplied by the manufacturer), while the lane
marked –ve contains the positive control for NF-B, plus a 100-fold excess of
unlabelled NF-B probe. Differences from control are indicated as c,
p<0.001, while differences in the presence of AT are shown as e, p<0.01 or f,
p<0.001.
Fig. 6 Activity of caspase 3 (A) and caspase 8 (B) in murine myotubes after treatment
with PIF alone (▲), or in the presence of AT (100M) () for 1h. The
chymotrypsin-like enzyme activity in murine myotubes treated with either
4.2nM PIF (C), or 0.5M Ang II (D), with or without AT (100M) for 24h is
shown in the presence of various concentrations of ZnSO4. (E) Protein
synthesis in murine myotubes after 4h incubation with PIF (4.2nM), with or
without AT (100M), and in the presence of various concentrations of ZnSO4.
Differences from control are shown as a, p<0.05, b, p<0.01 or c, p<0.001,