© 2015 Apoorva Mohan - University of...

MISREGULATION OF RNA BINDING PROTEINS IN MICROSATELLITE EXPANSION DISEASES

By

APOORVA MOHAN

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2015

© 2015 Apoorva Mohan

To my loving family and friends

4

ACKNOWLEDGMENTS

First and foremost, I would like to thank my parents Mohan Anikara and

Vijayalakshmi Mohan for believing in me and letting me realize my dream through their

unconditional love and support. I owe all my accomplishments and success to them.

This journey wouldn’t have been possible without my brother Vidyabhushan Mohan who

has been a great source of inspiration and motivation. My heartfelt gratitude to my

husband Sudarshan Prasad for helping me stay calm and for the constant

encouragement and unequivocal love. I would like to thank Gayatri Vasudevan and my

parent’s in-law and my extended family for supporting me throughout. This has been an

enriching life experience, thanks to my guru Dr. Maurice Swanson. I am indebted to him

for giving me this great opportunity and for all his scientific advice. His quest for

knowledge and scientific acumen will always inspire me and will be my guiding force in

my future pursuits. I would like to thank my committee members Dr. John Aris, Dr.

Laura Ranum, Dr. Jada Lewis and Dr. Gerald Shaw for their valuable input and timely

guidance. It has been an immense pleasure working with Dr. Ranjan Batra and Dr.

Konstantinos Charizanis who have provided me great scientific advice. I am grateful to

Dr. Mini Manchanda and Ruan Oliviera for their emotional support and guidance during

my graduate school. A big shout out to all my lab members Dr. Kuang Yung Lee, Dr.

Marianne Goodwin, Dr. Moyi Li, James Thomas, Marina Scotti, Myrna Stenberg,

Catherine Marten for their constant words of support.

I would like to thank Madhumitha Ramesh and Priyamvada Jayaprakash for

taking this journey with me and being there for me for everything the past 9 years. I am

incredibly grateful to Vinita Chitoor, Deepika Awasthi, Shivashankar Halan, Ravi

Venkatraman, Ramya Sivakumar, Priya Saikumar, Amey Barde, Devesh Chugh,

5

Gayathri Balakrishnan, Sindhu Srinivasan, Poojitha Reddy for being a part of my life in

Gainesville, making it so much fun and providing me the much needed work life

balance. Finally I would like to thank the Almighty for everything!

6

TABLE OF CONTENTS

page

ACKNOWLEDGEMENTS ............................................................................................... 4

LIST OF TABLES ............................................................................................................ 9

LIST OF FIGURES ........................................................................................................ 10

LIST OF ABBREVIATIONS ........................................................................................... 12

ABSTRACT ................................................................................................................... 14

CHAPTER

1 INTRODUCTION .................................................................................................... 17

Unstable Microsatellites in Neurological Disease ................................................... 17 Origins of Microsatellite Expansions ....................................................................... 18 Overview of RNA Gain-of-Function Disease Mechanisms ...................................... 21

RNA Foci .......................................................................................................... 21 RNA Gain-of-Function ...................................................................................... 24

2 RNA GAIN OF FUNCTION IN C9 ALS/FTD ........................................................... 28

C9ORF72 ALS/FTS- A New Player in Repeat Expansion Diseases ....................... 28 C9ORF72 ALS/FTD Disease Mechanisms ............................................................. 29

C9ORF72 Haploinsufficiency ........................................................................... 29 RAN Translation in C9 ALS/FTD ...................................................................... 30 RNA Gain-of-Function Models for C9ORF72 ALS/FTD .................................... 31 Aberrant Nuclear Transport in C9 ALS/FTD ..................................................... 33

Testing The RNA Binding Protein Sequestration Mechanism In C9ORF72 ALS/FTD .............................................................................................................. 35

Increased Binding of a Protein Factor to GGGGCC RNA with Expanded Repeats ......................................................................................................... 35

The Interaction between G4C2 Binding Protein and GGGGCC RNA Is Specific.......................................................................................................... 37

HnRNP H Immunoprecipitates the 50kDa Activity Associated with GGGGCCexp RNA ....................................................................................... 37

In Cellulo Interaction of HnRNP H with Expanded GGGGCC Repeats ............ 38 Absence of HnRNP H Binding in Patient Frontal Cortex Sections .................... 39 Abnormal Nuclear Architecture in Cells Expressing Expanded G4C2

Repeats ......................................................................................................... 40 Discussion .............................................................................................................. 41

3 CIRCADIAN REGULATION OF RNA PROCESSING BY MBNL2 IN MOUSE PINEAL GLAND ...................................................................................................... 56

7

Circadian Rhythms - Synchronizing Internal Clocks with the Environment ............. 56 Suprachiasmatic Nucleus- the Circadian Pacemaker ....................................... 56 Regulation of Circadian Rhythms- Role of Molecular Clocks ........................... 58

Melatonin- the Neuroendocrine Arm of SCN ........................................................... 59 Signaling from the SCN to the Pineal Gland..................................................... 59 Light Induced Control of Gene Expression ....................................................... 60

Post-transcriptional Control of Circadian Rhythms ................................................. 61 Alternative Splicing in Circadian Clocks .......................................................... 61 Interplay among Polyadenylation Elements in Circadian Clocks ...................... 63 Regulation of Circadian Clock and Clock Outputs by MicroRNAs .................... 63 Circadian Regulation by RNA Binding Proteins ................................................ 64

Circadian Misregulation in Disease ......................................................................... 65 Myotonic Dystrophy ................................................................................................ 66

DM Pathogenic Mechanisms ............................................................................ 67 RNA Gain-of-Function Models for DM .............................................................. 68 Recapitulation of Altered Sleep Phenotype in Mbnl2 Knockout Mouse Model . 70

MBNL2 Regulation of Circadian RNA Processing in Mouse Pineal Gland.............. 70 Oscillation of Hundreds of RNA Transcripts in Mouse Pineal Gland between

Day and Night .............................................................................................. 71 Mbnl2 RNA Transcripts Do Not Oscillate between Day and Night in Mouse

Pineal Gland .................................................................................................. 72 Loss of Mbnl2 Causes Widespread Changes in Pineal Gland Transcriptome.. 72 Circadian Splicing Regulation by Mbnl2 ........................................................... 73 Mbnl2 Regulates the Splicing of Different Genes during Day and Night .......... 75

Discussion ............................................................................................................. 76

4 CONCLUDING REMARKS AND FUTURE DIRECTIONS ...................................... 91

5 MATERIALS AND METHODS ................................................................................ 93

Generation of GGGGCC Repeat Plasmids ............................................................. 93 In Vitro Transcription and UV Crosslinking ............................................................. 93 Immunoprecipitation of Protein-RNA Complexes .................................................... 93 Competition Assay .................................................................................................. 94 Combined RNA FISH and Immunofluorescence .................................................... 94 Confocal Microscopy............................................................................................... 95 Antibodies ............................................................................................................... 95 Mouse Housing for Circadian Studies ..................................................................... 95 RNA Extraction ....................................................................................................... 96 RNA-seq Library Preparation .................................................................................. 96 RNA-seq Analysis ................................................................................................... 96 Differential Expression Analysis .............................................................................. 97 Gene Ontology Analysis ......................................................................................... 97 Real Time qRT-PCR ............................................................................................... 97 Semi Quantitative Splicing PCR Analysis ............................................................... 98

8

APPENDIX

A RNA SEQ READS OF CIRCADIAN STUDY AND THEIR DISTRIBUTION ACROSS GENOME ................................................................................................ 99

B DIFFERENTIAL EXPRESSION DATA BETWEEN DAY AND NIGHT IN WT ....... 100

C DIFFERENTIAL EXPRESSION DATA BETWEEN DAY AND NIGHT IN KO ....... 102

D DIFFERENTIAL EXPRESSION DATA BETWEEN WT AND MBNL2 KO DURING DAY ....................................................................................................... 104

E DIFFERENTIAL EXPRESSION DATA BETWEEN WT AND MBNL2 KO DURING NIGHT ................................................................................................... 105

F ALTERNATIVE SPLICING CHANGES BETWEEN DAY AND NIGHT IN WT ...... 106

G ALTERNATIVE SPLICING CHANGES BETWEEN DAY AND NIGHT IN KO ....... 108

H ALTERNATIVE SPLICING CHANGES BETWEEN WT AND MBNL2 KO DURING DAY ....................................................................................................... 110

I ALTERNATIVE SPLICING CHANGES BETWEEN WT AND MBNL2 KO DURING NIGHT ................................................................................................... 111

LIST OF REFERENCES ............................................................................................. 112

BIOGRAPHICAL SKETCH .......................................................................................... 128

9

LIST OF TABLES

Table page 2-1 RNA binding proteins interacting with GGGGCCexp RNA ................................... 43

3-1 Primers used for validation of RNA-seq data in circadian study ......................... 90

10

LIST OF FIGURES

Figure page 1-1 Model showing the different pathogenic mechanisms of microsatellite

expansion diseases ............................................................................................ 26

2-1 Denaturing Polyacrylamide gel electrophoresis (PAGE) of repeat RNA ............. 44

2-2 Nuclear extract preparation from HeLa S3 cells ................................................. 45

2-3 Repeat length dependent binding of a 50kDa nuclear factor to GGGGCCexp RNA .................................................................................................................... 46

2-4 Denaturation of the G4C2 RNA results in increased binding of G4C2BP ........... 47

2-5 Binding of G4C2BP to GGGGCCexp is energy dependent. ................................. 48

2-6 Binding of G4C2BP is specific to GGGGCC RNA .............................................. 49

2-7 ALS associated proteins do not interact with GGGGCCexp RNA ......................... 50

2-8 hnRNP H interacts with GGGGCCexp RNA ......................................................... 51

2-9 hnRNP H colocalizes with GGGGCCexp RNA in cellulo ...................................... 52

2-10 hnRNP A2/B1 doesnot colocalize with GGGGCCexp RNA in cellulo ................... 53

2-11 hnRNP H does not colocalize with GGGGCCexp RNA in patient frontal cortex sections .............................................................................................................. 54

2-12 Nuclear architecture changes in cells with GGGGCCexp RNA ............................ 55

3-1 Illustration of the experimental setup .................................................................. 81

3-2 Mbnl2 RNA levels in mouse pineal gland do not oscillate between day and night .................................................................................................................... 82

3-3 Loss of Mbnl2 causes widespread circadian expression changes...................... 83

3-4 Mbnl2 loss leads to extensive changes in pineal transcriptome ......................... 84

3-5 Global circadian splicing alterations in the pineal gland of Mbnl2 KO mice ........ 85

3-6 Dysregulation of circadian splicing in Mbnl2 knockout mice ............................... 86

3-7 Mbnl2 regulates the splicing of different genes during day and night ................. 87

11

3-8 Biological processes regulated by Mbnl2 through splicing are different between day and night ....................................................................................... 88

3-9 Validation of altered splicing in Mbnl2 knockout mice ......................................... 89

12

LIST OF ABBREVIATIONS

AANAT arylalkylamine N-acetyl transferase

ALS Amyotrophic lateral sclerosis

APA Alternative polyadenylation

AS Alternative splicing

ATP Adenosine triphosphate

cAMP Cyclic adenosine monophosphate

CIRP Cold induced RNA binding protein

CRE cAMP response element

CSF Cerebrospinal fluid

DBP D-site of albumin promoter

DM Myotonic dystrophy

DNA Deoxyribo nucleic acid

EDS Excessive daytime sleepiness

eIF Elongation initiation factor

FTD Frontotemporal dementia

FXTAS Fragile X-associated tremor/ataxia syndrome

G4C2BP GGGGCC binding protein

HITS-CLIP Crosslinking and immunoprecipitation followed by high throughput sequencing

hnRNP Heterogeneous nuclear ribonucleoprotein

iPSC Induced pluripotent stem cell

KO Knockout

MBNL Muscleblind-like

miR MicroRNA

13

mRNA Messenger RNA

PG Pineal gland

RAN Repeat-associated non-ATG

RNA Ribo nucleic acid

SCN Suprachiasmatic nucleus

snRNP Small nuclear ribonucleoprotein particle

SR Serine arginine rich

UV Ultraviolet

ZT Zeitgeber

14

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

MISREGULATION OF RNA BINDING PROTEINS IN MICROSATELLITE EXPANSION

DISEASES

By

Apoorva Mohan

December 2015

Chair: Maurice Swanson Major: Medical Sciences

Myotonic dystrophy (DM) and C9ORF72- linked amyotrophic lateral sclerosis/

frontotemporal dementia (C9 ALS/FTD) are multisystemic, dominantly inherited non-

coding microsatellite expansion diseases caused by C(C)TGexp and GGGGCCexp,

respectively. The full range of the molecular pathways that are compromised in these

diseases remains to be determined. The RNA gain of function model proposes that non-

coding mutations are deleterious at the RNA level (RNAopathy) because they fold into

stable RNA structures that either inhibit or enhance the normal activities of important

cellular factors.

In this study we are exploring different events in the RNA toxicity model,

including protein sequestration in DM and C9 ALS/FTD and its downstream effects,

using molecular and high throughput sequencing approaches. Using both biochemical

and cell biological strategies, we identified heterogeneous nuclear ribonucleoprotein H

(hnRNP H) as a factor that interacts with the GGGGCC repeat expansions in C9

ALS/FTD. Though hnRNP H shows repeat length-dependent binding in vitro, the

sequestration of hnRNP H by GGGGCC RNA is not observed in patient autopsy

samples, which suggests that sequestration of this hnRNP in vivo does not occur. We

15

conclude that hnRNP H is not directly sequestered by the GGGGCC repeats in patient

brain, and further studies are required to identify the sequestered protein factors.

Next, we investigated the downstream effects of protein sequestration in DM, a

paradigm for diseases exhibiting RNA gain-of-function. The sequestration of

muscleblind-like proteins (MBNL), a family of pre-mRNA processing factors, by

C(C)UGexp RNA and the subsequent loss of normal MBNL function is a major

pathogenic event in DM. Upon loss of MBNL2, an alternative splicing factor highly

expressed in the brain, mice develop rapid eye movement (REM) sleep abnormalities

characteristic of DM. Using high-throughput sequencing, we investigated if MBNL2

regulates the circadian RNA processing in the pineal gland, a key endocrine organ of

the sleep/wake cycle, resulting in the REM sleep phenotype. Widespread changes in

the pineal gland transcriptome are triggered by Mbnl2 loss, although the circadian

expression and splicing of core clock genes important for maintaining the rhythm remain

unchanged. Interestingly, MBNL2 seems to regulate the circadian splicing of distinct set

of genes involved in RNA processing, ion channel signaling even though Mbnl2 RNA

does not show rhythmic expression. This observation suggests that MBNL2 is either

undergoing post-transcriptional and/or translational regulation leading to the oscillation

of its protein levels or MBNL2 preferentially binds to different partners during the

circadian period to mediate splicing changes. Furthermore, a major overlap was not

observed between differentially expressed genes and mis-splicing events suggesting

that alternative splicing is not a major regulator of rhythmic expression in pineal gland,

thereby pointing to other modes of regulation. We conclude that, MBNL2 plays an

indirect role in the circadian regulation of RNA processing in the pineal gland and

16

perhaps other tissues. Regulation of sleep and circadian rhythms is a complex process

controlled at different levels by the inner circadian clocks, humoral signals and also by

the activity of neurons in specific regions like the brain stem. Future studies should

focus on the role of Mbnl2 in suprachiasmatic nucleus, the master pacemaker of the

inner clocks or regions like pontine tegmentum known to regulate REM sleep for

insights into the dysregulated RNA processing events of key relevance to circadian

rhythms and sleep phenotype observed in DM patients.

17

CHAPTER 1 INTRODUCTION1

Unstable Microsatellites in Neurological Disease

Approximately 50% of the human genome consists of repetitive elements and 3%

of the genome consists of simple sequence repeats (SSR) (Treangen and Salzberg,

2012). These SSRs, more commonly referred to as microsatellites, are composed of

short tandem repeats of 2-10 base pairs (bp) that are dispersed throughout the genome.

Microsatellites have been proposed to function at multiple steps in gene expression

when present within or near genes in both prokaryotes and eukaryotes (Usdin, 2008).

These steps include transcription where tandem repeats act as transcriptional

regulatory elements (Meloni et al., 1998; Punga and Buhler, 2010), pre-mRNA splicing

with modulation of splicing activity by microsatellite polymorphisms (Pagani et al., 2000)

and translation by influencing 5’ UTR ribosomal scanning (Ludwig et al., 2011). Errors in

DNA replication, recombination and mismatch repair cause microsatellite instability

leading either to repeat tract expansion or contraction. Importantly, the majority of

microsatellite expansion diseases are neurological/neuromuscular disorders although

many of the affected genes are expressed ubiquitously. For example, polyglutamine

(polyQ) disorders, including Huntington disease (Rovsing et al.), spinocerebellar ataxias

(SCA1, 2, 3, 6, 7, 17) and spinobulbar muscular atrophy (SBMA or Kennedy’s disease),

are caused by protein coding region CAG repeat expansions.

1 Modified with permission from Mohan A., Goodwin M., Swanson M.S (2014), RNA protein interactions in

unstable microsatellite diseases, Brain Research, 1584: 3-14

18

These polyQ expansions induce protein aggregate formation leading to altered

homeostasis of multiple cellular pathways (La Spada and Taylor, 2010; Nalavade et al.,

2013). Alternatively, repeat expansion mutations also occur in the non-coding regions of

genes, which includes 5’ and 3’ untranslated regions (UTRs) and introns, and cause

dominantly inherited disorders such as myotonic dystrophy types 1 and 2 (DM1, DM2),

Fragile X-associated tremor/ataxia syndrome (FXTAS) and SCA types 8, 10 and 12

(Ranum and Cooper, 2006; Poulos et al., 2011). The recent discovery of a repeat

expansion mutation in chromosome 9-linked amyotrophic lateral sclerosis and

frontotemporal dementia (C9ORF72 ALS/FTD) has further highlighted the importance of

elucidating the molecular mechanisms underlying these non-coding expansion

disorders (DeJesus-Hernandez et al., 2011; Renton et al., 2011). The RNA toxicity

model proposes the formation of stable secondary structures by the mutant repeat

expanded RNA altering the activities of the proteins interacting with the RNA (Mohan et

al., 2014). In contrast, RNA repeat expansions are also prone to a non-canonical type of

protein translation, or repeat-associated non-ATG (RAN) translation, and the resulting

unusual peptides, which for SCA8 are composed of ATXN8 polyglutamine, polyserine

and polyalanine (polyQ, polyA, polyS) tracts, may induce disease-associated pathology

(proteinopathy) (Zu et al., 2011). These and other studies suggest that the full range of

molecular pathways that are compromised in these diseases remains to be determined.

Origins of Microsatellite Expansions

Microsatellite intergenerational instability is a major feature underlying expansion

diseases with subsequent generations experiencing anticipation, which is characterized

by increased disease severity and earlier onset age triggered by an increase in repeat

length (Pearson et al., 2005). Even within an individual, repeat tract length can exhibit

19

somatic mosaicism, or heterogeneity within and between tissues, with a positive

correlation existing between repeat number and tissue-specific pathology in diseases

like HD and DM1 (Kennedy et al., 2003). Although our understanding of the

mechanisms underlying repeat instability is incomplete, considerable evidence points to

pivotal roles for errors induced during DNA replication and repair depending on tissue

developmental and proliferative state (Budworth and McMurray, 2013; Lopez Castel et

al., 2010; Mirkin, 2007; Usdin, 2008). During DNA replication, instability is influenced by

both cis- and trans-acting factors and cell studies have shown that cis-elements (repeat

sequence, tract length, distance from the replication origin and replication direction) can

affect repeat instability by modulating replication fork dynamics during lagging strand

synthesis (Cleary et al., 2002). Additionally, epigenetic factors, including the CpG

methylation status of CTCF binding sites flanking the repeat locus and histone

modifications that affect chromatin structure and arrangement, impact repeat instability

(Dion and Wilson, 2009; Libby et al., 2008). Repeats also have the potential to form

non-canonical structures, such as non-B-form DNA-like triple helices, G-quadruplexes,

intra-strand hairpins and slipped strand structures, which result in replication fork

stalling and template switching (Lopez Castel et al., 2010).

Repeat instability in terminally differentiated cells is also affected by transcription.

The majority (>80%) of the genome undergoes transcription (Hangauer et al., 2013) and

widespread antisense transcription has been reported for many loci, including a majority

of microsatellite disease-associated genes (Batra et al., 2010; Budworth and McMurray,

2013). Both CTG and CAG repeat expansions have been shown to enhance repeat

instability by several fold upon unidirectional and bidirectional transcription induction in

20

mammalian cells (Lin et al., 2006; Nakamori et al., 2011). Although the mechanisms

underlying transcription-induced repeat instability are poorly defined, it is likely that the

separation of DNA strands during transcription results in secondary structure formation

by the repeats followed by protein-induced stabilization of these structures (McIvor et

al., 2010). During bidirectional transcription, head-on collision between RNA

polymerases may also occur and cause stalling and activation of downstream DNA

damage response pathways (Lin and Wilson, 2011).

Trans-acting factors, including the mismatch match repair (MMR) proteins MSH2,

MSH3, MSH6 and PMS2, are also critical drivers of repeat instability. Repeat

contractions and stabilization occur in mice harboring CTG-CAG repeats when they are

crossed with either Msh2 or Msh3 null mice or mice deficient in Msh2 ATPase activity

indicating a role for these proteins in promoting instability in DM1 (Pearson et al., 2005).

Similarly, Msh2 is important for promoting both intergenerational and somatic repeat

expansions in a FXTAS model expressing CGG-CCG repeats (Lokanga et al., 2014).

Naturally occurring Msh3 polymorphisms may act as a modifier of CAG repeat instability

by interfering with the stability of the Msh3 protein (Tome et al., 2013) and the resulting

variations in protein levels may account for some aspects of region-specific instability

seen in the striatum of HD patient brains (Gonitel et al., 2008; Pinto et al., 2013). How

do these proteins influence repeat expansions? Studies in S. cerevisiae demonstrate

that Msh2 and Msh3 alter the activities of proteins mediating Okazaki fragment

processing resulting in small yet incremental expansions (Kantartzis et al., 2012). Since

repeat instability is a complex phenomenon regulated by multiple DNA metabolic

pathways that influence the various tissue and developmental stage specific

21

expansion/contraction patterns, it is critical to understand the underlying mechanism.

Although repeat instability plays the primary role in determining the course of disease,

functional impairment for some non-coding expansion disorders lies at the next level

upon transcription of the DNA to produce RNAs with expanded repeats.

Overview of RNA Gain-of-Function Disease Mechanisms

RNA sequence and higher order structures are two critical features that determine how

the processing of a particular RNA occurs (Bugaut and Balasubramanian, 2012).

Alterations in normal RNA sequence/structure by mutations can interfere with multiple

steps in RNA biogenesis as well as the functions of the mature RNA and result in

widespread dysregulation. This phenomenon is exemplified in non-coding repeat

expansion diseases in which repeat expansions lead to a deleterious RNA gain-of-

function.

RNA Foci

A hallmark of many non-coding repeat expansion diseases is the formation of distinct

cellular aggregates of mutant RNA, such as the nuclear foci in DM1, DM2 and

C9ORF72 ALS/FTD, or the inclusions containing mutant RNA in FXTAS (DeJesus-

Hernandez et al., 2011; Greco et al., 2002; Taneja et al., 1995). RNA foci are dynamic

structures characterized by random formation and dissociation with the formation phase

mediated by RNA binding proteins, as shown for CUG RNA foci in stably transfected

C2C12 myoblasts (Querido et al., 2011). The dynamics of RNA foci for mutant repeat

RNAs associated with other repeat expansion diseases have not yet been determined.

These foci contain multiple copies of mutant repeat RNA and its interacting protein

partners in a complex (Taneja et al., 1995; Wojciechowska and Krzyzosiak, 2011).

Morphologically, RNA foci and inclusions are distinct. The C(C)UGexp foci in DM and the

22

rGGGGCCexp in C9ORF72 ALS/FTD appear more compact, likely due to tighter

interactions between the RNA and bound proteins, while rCGGexp-containing inclusions

in FXTAS are larger and more diffuse structures that contain many proteins, including

lamins and MBNL1 (Hagerman, 2013). FXTAS brains also contain ubiquitin-positive

neuronal protein inclusions that contain polyglycine (FMRpolyG) generated by RAN

translation (Todd et al., 2013). An important question to address in future studies will be

whether the structural distinctions between RNA foci and inclusions reflect fundamental

differences in the pathogenic pathway.

Although there is a lack of information on the structures of specific RNA-protein

complexes in RNA foci, several studies have analyzed synthetic repeat oligomers in

vitro. Biochemical and enzymatic structure probing, as well as biophysical studies using

CD and UV spectroscopy, reveal that (CNG)20 transcripts form stable, but slippery,

hairpins with the exception of the most stable CGG triplet (Krzyzosiak et al., 2012;

Sobczak et al., 2010). Crystal structures of short CUG, CAG, CGG oligomers indicate

that they adopt an A-form helical structure with non-canonical G-G, A-A and U-U wobble

base pairing flanked by stabilizing GC base pairs (Kiliszek et al., 2010, 2011; Mooers et

al., 2005). DM2-associated CCUG repeats also form RNA stem-loop structures like

CNG repeats but with CU mismatches and lower stability (Sobczak et al., 2003).

Notably, some sequestered proteins have been suggested to preferentially recognize

CNG RNA sequences and not secondary structures. For example, the MBNL proteins

bind to GC base pairs and then fold the CUGexp RNA into a pseudo A-form helix

(Teplova and Patel, 2008). Recent reports have also proposed a more complex

structure for ALS/FTD-associated GGGGCCexp RNA. Studies using 1D 1H NMR and CD

23

spectroscopy suggest that this expansion RNA forms thermostable inter- and intra-

molecular G-quadruplexes with a parallel orientation (Fratta et al., 2012; Reddy et al.,

2013). The structural details of GGGGCCexp RNA and its antisense transcript

CCCCGGexp, both of which form RNA foci in patient cells and tissues, requires

additional characterization although limitations exist with these in vitro analyses. For

example, prior studies have used repeats in the normal size range and the multiple RNA

and protein factors that likely influence expansion RNA structures in vivo are absent.

Nevertheless, in vitro evidence for higher-order structure formation by RNA repeat

expansions provides intriguing insights into the nature of RNA toxicity.

Another outstanding question is whether RNA foci have a causal role in disease

progression or are innocent bystanders. For DM1, the expression of mutant RNAs

above a repeat length threshold (Hamshere et al., 1997) leads to foci formation and

MBNL protein sequestration followed by disruption of normal MBNL functions, including

alternative splicing regulation (Ranum and Cooper, 2006). For C9ORF72 ALS/FTD,

antisense oligonucleotides (ASOs) targeting rGGGGCCexp cause a reduction of sense

RNA foci in patient-derived iPS cells with a concomitant rescue of the cells from

glutamate-induced toxicity (Donnelly et al., 2013). These results suggest that RNA foci

are not simply biomarkers but important mediators of toxicity. However, an opposing

viewpoint comes from studies on a DM mouse model expressing a GFP transgene

containing the DMPK 3’ UTR with a normal length (CTG)5 repeat (Mahadevan, 2012).

These mice fail to develop RNA foci but still exhibit pathological features associated

with DM1 disease including muscle pathology, splicing deficits and cardiac conduction

defects (Mahadevan et al., 2006). Interestingly, another DMPK transgenic model

24

expressing a normal length (CTG)20 repeat does not exhibit a pathological phenotype

(Seznec et al., 2001). Since it is not currently clear if the formation of RNA foci is an

essential step in pathogenesis, the possibility that overexpression of the GFP-DMPK

3’UTR transgene also results in MBNL functional deficiency should be tested by either

rAAV-induced Mbnl1 overexpression or crossing this transgenic line to MBNL1

overexpression mice (Chamberlain and Ranum, 2012; Kanadia et al., 2006).

RNA Gain-of-Function

Mounting evidence indicates that microsatellite expansions in DM1/DM2, FXTAS

and C9ORF72 ALS/FTD are pathogenic at the RNA level (Echeverria and Cooper,

2012; Poulos et al., 2011; Sicot and Gomes-Pereira, 2013) (Figure 1-1). These

diseases are characterized by a dominant inheritance pattern and are caused by

mutations in the non-coding regions of their respective genes, making a conventional

protein loss-of-function mechanism unlikely. Additionally, C(C)UGexp, rCGGexp,

rGGGGCCexp RNAs accumulate in either distinct nuclear foci or inclusions in patient

cells. Although full-length mutant DMPK mRNA accumulates in nuclear RNA foci, the

majority of DM-associated disease symptoms are caused by mutant RNA expansions or

by RAN translation and not by DMPK haploinsufficiency (Jansen et al., 1996; Mankodi

et al., 2000; Orengo et al., 2008; Reddy et al., 1996). For the CCTGexp and GGGGCCexp

intronic expansions in DM2 and C9ORF72 ALS/FTD, respectively, the repeats undergo

splicing and accumulate in nuclear RNA foci in the absence of flanking intronic

sequences (Donnelly et al., 2013; Margolis et al., 2006). Similarly, FXTAS is

characterized by ubiquitin-positive, neuronal and astrocytic intranuclear inclusions (2-5

μm) containing FMR1 mRNA and various proteins coupled with a 2-10 fold elevation in

FMR1 mRNA levels (Hagerman and Hagerman, 2013). In addition, Drosophila and

25

mouse models expressing expansion RNAs exhibit disease-relevant symptoms

irrespective of the gene context or the flanking sequence. Neurodegeneration and

ubiquitin-positive intranuclear inclusions are observed in Drosophila expressing rCGG90

repeats flanking an EGFP transgene (Jin et al., 2003) and mice expressing CTG250

repeats driven by the human skeletal actin promoter (HSALR) develop myotonia and

numerous ribonuclear foci in a transgene expression-dependent manner providing

strong evidence for a gain-of-function at the RNA level (Mankodi et al., 2000).

In this study we are interested in delineating the direct and downstream effects of

mutant repeat RNA expression in C9 ALS/FTD and DM. We hypothesize that the

expression of GGGGCC repeats in C9 ALS/FTD and C(C)TG repeats lead to toxic RNA

gain of function, sequestering cellular factors and altering downstream molecular

pathways normally regulated by these factors.

26

Figure 1-1: Illustration of the different pathogenic mechanisms of repeat expansion diseases. Both sense (blue line) and antisense (red line) DNA repeat expansions result in three major downstream deleterious effects (labeled 1–3). (1) Protein loss-of-function (LOF) results from hypermethylation of a GC-rich expanded microsatellite repeat in the 5′-UTR and/or promoter region of an affected gene and loss of transcriptional activity (e.g., FXS); (2) RNA gain-of-function (GOF) occurs following bidirectional transcription of expanded repeats and the synthesis of sense (sRNA) and antisense (asRNA), which fold into RNA hairpins (sRNA, blue; asRNA, red) or other stable structures and gain toxic functions either by sequestering an RNA binding protein(s) (RBP) and inhibiting pre-mRNA splicing (2a), pre-mRNA editing (2b), mRNA localization (2c), pri-miR processing (2d) or by triggering aberrant cellular activities such as protein kinase C (PKC) mediated CELF1 hyperphosphorylation (2e); (3) protein GOF due to altered post-translation modifications of other RNA binding proteins(3a) (CELF1 hyperphosphorylation, purple oval with white P in orange

http://www.sciencedirect.com/science/article/pii/S000689931400417X#200021883



















27

star) or RAN translation (3b) (three homopolymeric repeat proteins are shown with one undergoing translation by the ribosome (orange). In addition to these mechanisms, other pathways, including chromatin remodeling, proteome dysregulation and vesicular trafficking, may also contribute to disease pathogenesis, particularly in the CNS (Modified with permission from Mohan A et al., RNA–protein interactions in unstable microsatellite diseases, Brain Res (2014) 1584,3-14)



28

CHAPTER 2 RNA GAIN OF FUNCTION IN C9 ALS/FTD

C9orf72 ALS/FTS- A New Player in Repeat Expansion Diseases2

Recently, a non-coding GGGGCCexp mutation in the first intron of the C9ORF72

gene was discovered as a major cause of ALS/FTD (DeJesus-Hernandez et al., 2011;

Renton et al., 2011). ALS is a debilitating neurodegenerative disorder in which upper

and lower motor neuron death results in muscle weakness, wasting, difficulty in

swallowing/breathing leading to paralysis and death usually within 3-5 years of onset.

FTD causes the second most common form of presenile dementia (age of onset <65

years of age) and is a complex disorder affecting language, cognitive and behavioral

skills. Approximately 40% of FTD patients suffer from ALS-like motor symptoms and

50% of ALS patients exhibit FTD-associated behavioral and personality changes (Ling

et al., 2013). Although there is an overlap in patients affected with both of these

conditions, it is interesting to note the degree of phenotypic variability existing in the

remainder of the C9orf72 expansion carrier population. It is likely that genetic modifiers

play a major role in determining disease presentation. For example, an allelic variant of

TMEM106B protects carriers from developing FTD but not ALS (van Blitterswijk et al.,

2014). Importantly, the differential effects of genetic modifiers is highlighted by the

discovery that TMEM106B variants also act as risk factors for frontotemporal lobar

degeneration with neuronal inclusions of hyperphosphorylated and



29

ubiquinated TDP-43 (FTLD-TDP) (Van Deerlin et al., 2010).

C9orf72 ALS/FTD Disease Mechanisms3

Evidence that both C9orf72 sense rGGGGCCexp and antisense rCCCCGGexp

RNAs form nuclear RNA foci in neuronal and non-neuronal cells suggests a toxic RNA

gain-of-function and protein sequestration mechanisms for ALS/FTD (Zu et al., 2013a)In

situ hybridization experiments suggest that the incidence of sense foci is greater than

antisense foci, but the number of antisense foci per cell is greater (Mizielinska et al.,

2013). This result should be considered with caution because of potential differences in

FISH probe affinity for sense and antisense RNAs. Nonetheless, it will be interesting to

differentiate the pathogenic effect exerted by these individual entities. Transcriptome

analysis of patient fibroblasts treated with ASOs targeting C9ORF72 sense RNA reveals

that the disease-specific RNA signature is not reversed suggesting a possible role for

antisense transcripts in pathogenesis (Lagier-Tourenne et al., 2013).

C9orf72 Haploinsufficiency

The observation that expression of certain C9orf72 transcripts are downregulated

upon repeat expansion due to epigenetic modifications suggests that C9orf72

haploinsufficiency is a possible disease mechanism (Belzil et al., 2013a). However,

recent neuroimaging and neuropathological studies agree upon the fact that the

hypermethylation of the C9orf72 promoter confers a protective effect in the



30

patients, arguing against the haploinsufficiency model (Belzil et al., 2013b; Liu et al.,

2014). Homology modeling predicts that C9ORF72 is related to DENN proteins

belonging to the Rab GEF protein family, which are important for vesicular trafficking

(Levine et al., 2013). The physiological function of the protein, and its distribution across

tissues, is the focus of current studies and model systems are also being developed to

address this question. LacZ reporter mice reveal C9ORF72 expression in neuronal

regions sensitive to neurodegeneration, (ventral horn of the spinal cord, cortical layers,

hippocampus) but absent in non-neuronal cells like microglia and astrocytes (Suzuki et

al., 2013). For C9ORF72 haploinsufficiency models, knockdown of a zebrafish

C9ORF72 orthologue by antisense morpholinos and C. elegans null mutations of Alfa-1,

a C9ORF72 orthologue, have been developed (Ciura et al., 2013; Therrien et al., 2013).

These models exhibit neurodegeneration phenotypes such as age-dependent motility

defects, paralysis and motor neuron axonal degeneration. Contradicting these lower

vertebrate haploinsufficiency models, conditional knockout of C9ORF72 in Nestin

expressing neurons in mice does not affect its motor function and neuronal physiology

(Koppers et al., 2015). Backing this observation, reduction of C9ORF72 RNA levels in

mice by ASOs specifically in the CNS is well tolerated with no significant

pathological/behavioral changes (Lagier-Tourenne et al., 2013). These results argue

that C9ORF72 haploinsufficiency may not be the primary mode of pathogenesis in C9

ALS/FTD, but has the potential to contribute to the disease severity.

RAN Translation in C9 ALS/FTD

Another pathogenic mechanism that has been linked to C9ORF72 ALS/FTD

mutations is RAN translation of GGGGCCexp/ CCCCGGexp RNAs and the production of

six different dipeptide proteins that form intranuclear and cytoplasmic aggregates in

31

various brain regions (Ash et al., 2013; Mori et al., 2013c; Zu et al., 2013b). The majority

of cells expressing these RAN proteins do not contain C9ORF72 sense/antisense RNA

foci indicating a mutually exclusive mechanism in which the transcribed repeats are

either sequestered into foci or are exported to the cytoplasm for RAN translation

(Gendron et al., 2013). This observation suggests that some cell types may

preferentially express factors that promote the formation and nuclear retention of toxic

RNAs while other cells, which are deficient in these factors, are permissive for nuclear

export and RAN translation. Detailed investigations into the mechanisms of toxicity by

these RAN proteins suggest that these aggregating peptides induce ER and nucleolar

stress and also trigger apoptosis (Zhang et al., 2014b). Drosophila and cellular model

systems have been developed that determined the toxic effects of just the RAN

peptides. Using these models, the Arginine rich peptides especially Pro-Arg (PR) and

Gly-Arg (GR) have been shown to be neurotoxic, resulting in aggregates in the nucleoli,

which can subsequently affect ribosomal biogenesis and cause translational

dysregulation (Kwon et al., 2014; Wen et al., 2014).

RNA Gain-of-Function Models for C9orf72 ALS/FTD4

A Drosophila model expressing (GGGGCC)30 repeats flanking EGFP shows

severely disrupted eye morphology and locomotor defects compared to control flies

expressing (GGGGCC)3 – EGFP (Xu et al., 2013b). One limitation of this model is that



32

this repeat size may be in the normal range so the effects of expanded repeats are still

unknown. Recently, a mouse model in which adeno-associated virus 2/9 (AAV) was

used to induce robust neuronal expression of (GGGGCC)2 repeats and (GGGGCC)66

repeats was developed. This model recapitulated different aspects of the disease like

RNA foci formation, presence of poly GP,GR and GA RAN peptides in cerebellum,

cortex, spinal cord and hippocampus and the phophorylated TDP43 pathology widely

seen in C9 ALS/FTD patients. Also, behavioral features of the disease, such as

impaired motor functions and anti-social behavior accompanied with neuronal loss, are

exhibited by this mice. It is interesting to note that these phentoypes are observed

around 6 months of age after the injection of the AAVs, mirroring the late-adult onset in

the patients.

A number of RNA binding proteins have been identified that interact with

rGGGGCCexp RNA (See Table 1). Examples include: 1) hnRNP A3, a protein involved in

cytoplasmic RNA trafficking; 2) Pur-α, a transcriptional activator; 3) ADARB2, a protein

with homology to adenosine deaminases involved in adenosine to inosine RNA editing;

4) hnRNP H, a protein involved in pre-mRNA processing (Gendron et al., 2014); 5)

ALYREF, a component of nuclear export adaptor protein complex TREX, which plays a

role in coupled mRNA processing and transport (Zhou et.al,2001) . Both hnRNP A3 and

Purα bind to GGGGCC RNA in vitro, but colocalization with nuclear RNA foci and loss-

of-function is not observed in patients. Interestingly, hnRNP A3 is a component of the

p62 positive cytoplasmic inclusions observed in patient brain and Pur-α forms

intranuclear inclusions and rescues the neurodegenerative eye phenotype in

(rGGGGCC)30-EGFP expressing flies implicating these proteins in pathogenesis (Mori

33

et al., 2013a; Xu et al., 2013b). Through UV crosslinking and immunohistochemistry

studies, ALYREF was identified to interact with rGGGGCC5 sequence, although the

mechanism of pathogenesis is still unclear (Cooper-Knock et al., 2014). A proteome

array hybridized with (rGGGGCC)6.5 RNA identified ADARB2, a protein with a possible

regulatory role in RNA editing. ADARB2 colocalizes with C9orf72 sense RNA foci in

both patient and iPS cell lines and is important for RNA foci formation in iPS cells

(Donnelly et al., 2013). However, the extent of ADARB2 sequestration and the

downstream pathways possibly affected by sequestration of this protein requires further

study. In addition, hnRNP H, a protein originally classified as a poly(G) binding protein

(Swanson and Dreyfuss, 1988), has been shown to interact with rGGGGCCexp RNA in

vitro and in patient brain sections (Lee et al., 2013b). In contrast, the colocalization of

hnRNP H and rGGGGCCexp RNA is not observed in patient-derived iPS cells (Almeida

et al., 2013). Further studies examining hnRNP H specific splicing alterations in patient

tissues, either by microarray or RNA-seq, will be important to validate the potential

effects of hnRNP H sequestration. Additionally, the presence of antisense CCCCGGexp

RNA foci in ALS/FTD cells spotlights the need to identify proteins sequestered by

C9orf72 antisense RNA.

Aberrant Nuclear Transport in C9 ALS/FTD

The most recent model is that GGGGCCexp repeats affects the nuclear

cytoplasmic transport pathway. Drosophila melanogaster expressing G4C22,28, 58

repeats exhibit a repeat length dependent rough eye degeneration phenotype, which is

either rescued or exacerbated in the presence of genetic modifiers, mostly components

of the nuclear export/import pathway. Additionally, the overall nuclear architecture

seems compromised in C9 ALS/FTD iPSC derived neurons accompanied by nuclear

34

retention of polyA+ RNA affecting the distribution of the total RNA (Freibaum et al.,

2015). An accompanying study also supports the role of faulty nuclear cytoplasmic

transport as a mediator of the disease. RANGAP1 protein, a key protein involved in

transporting the proteins in and out of the nucleus binds to the GGGGCCexp RNA in

neurons derived from patient iPSC cell lines and is mislocalized in motor cortex tissues.

The nuclear import pathway seems to be aberrant resulting in the altered distribution of

proteins with a classical nuclear localization signal (NLS), such as TDP43 and Ran

GTPase, causing them to accumulate in the cytoplasm. Also destabilization of the G

quadraplex structures or inhibition of the nuclear export pathway using chemical

compounds like TmPyP4 rescues the toxic phenotype seen in flies (Zhang et al., 2015).

These observations point to aberrations in the transport of macromolecules across the

nucleus and provide insights into the pathway that can be targeted for future therapy. It

will be interesting to perform proteomic analysis of C9 patients to see if there is an

overall dysregulation of translation because of impaired nuclear transport of polyA RNA

and also if defects in nucleolar components occur.

Meanwhile, transcriptome sequencing studies of C9 ALS and sporadic ALS

patients revealed widespread dysregulation of RNA processing events like alternative

splicing and alternative polyadenylation with the cerebellum showing many more

changes than the frontal cortex, indicating either the higher neuronal density in the

cerebellum or the involvement of cerebellar pathology in ALS. Moreover, ontology

analysis detected the genes misregulated belonging to pathways such as RNA

processing and synaptic trafficking.

35

Because of the RNA processing defects observed in patients, it is compelling to

speculate that the proteins possibly sequestered by the GGGGCCexp RNA are critical

regulators of pre-mRNA processing. We wanted to explore the effects of GGGGCCexp

RNA expression and determine if novel cellular factors are sequestered by the

expanded repeats.

Testing the RNA Binding Protein Sequestration Mechanism in C9orf72 ALS/FTD

Increased Binding of a Protein Factor to GGGGCC RNA with Expanded Repeats

To elucidate the protein factors interacting with GGGGCCexp RNA, we adopted a

UV crosslinking approach, which was successfully utilized before to identify

muscleblind-like proteins interacting with the C(C)UGexp RNA in myotonic dystrophy

types 1 and 2. UV crosslinking identifies factors that are directly bound to the RNA by

inducing a covalent bond between the RNA and the bound protein, thus eliminating the

non-specific signals that are usually observed in RNA affinity pulldown studies. Also, the

addition of ATP and creatine phosphate mimics the native cellular conditions, where the

proteins are loaded actively onto the RNA, similar to the splicing reaction that consumes

energy in the form of ATP to remodel nascent RNA-RNP complex. Plasmids containing

GGGGCC repeats with different repeat numbers were generated using a sequential

ligation approach in pcDNA 3.1 vector under the CMV and T7 promoters for use in both

in vitro and in vivo model systems (Zu et al., 2013a). After linearization of the plasmids

using the appropriate restriction enzyme, they were subjected to in vitro transcription

using T7 and SP6 RNA polymerases in the presence of α-32P CTP, as cytidine is

considered a better crosslinker, and the RNA was subjected to denaturing urea

polyacrylamide gel electrophoresis (PAGE) (Figure 2-1). The gel purified RNA was then

incubated with freshly prepared HeLa nuclear extract, the integrity of HeLa nuclear

36

proteins was checked using immunoblotting analysis of nuclear and the cytoplasmic

markers (Figure 2-2) and UV crosslinking was performed. CUG54 RNA, which is known

to bind MBNL proteins, acted as the positive control and TAR RNA, known to form

stable hairpin structures, served as the negative control for structured RNAs.

Studies have shown that even r(GGGGCC)4 RNA forms multimolecular G

quadruplex structures in the presence of monovalent cations K+ and Na+ (Reddy

et.al,2013). Also, heating RNA to ~100°C followed by slow cooling leads to disruption of

these structures formed by the GGGGCC RNA. To examine the binding of proteins to

the sequence rather than the structure, we added HeLa NE to heat-treated and flash

frozen (GGGGCC) 4, 33, 60, 120 RNA and subjected them to UV crosslinking followed by

RNase digestion and electrophoresis. Interestingly, as shown in Figure 2-3 we observed

the binding of a 50kDa nuclear factor, referred as G4C2 binding protein (G4C2 BP),

which displayed negligible binding to GGGGCC4 RNA and exhibited repeat length

dependence (as quantified in B). This suggests that as repeat length increases, more

binding sites become available for protein binding resulting in an increase in signal

intensity. As expected, CUG54 RNA showed binding of MBNL proteins but no binding

was observed to TAR RNA. RNA denaturation resulted in increased binding of G4C2

BP compared to non-denatured RNA (Figure 2-4), suggesting the importance of

sequence-specific binding.

Next, we wanted to test if the interaction between G4C2BP and GGGGCC RNA

is an active process requiring energy. The UV crosslinking reaction was performed in

the absence of ATP and creatine phosphate and surprisingly the G4C2 BP activity was

completely ablated for GGGGCC 33, 60, 120 RNA, but some activity around the same

37

molecular weight was observed for GGGGCC 4 RNA (Figure 2-5). Thus, the binding of

G4C2BP to GGGGCCexp RNA is an active process requiring ATP.

Sequence-Specific Interaction between G4C2 Binding Protein and rGGGGCC RNA

To determine if G4C2BP binding activity was specific for GGGGCCexp RNA and

resistant to other structured RNAs a competition assay was developed. In this assay the

binding of G4C2BP to radiolabeled GGGGCC60 RNA was challenged using a 1500 fold

molar excess of unlabeled GGGGCC60 RNA. While the activity was resistant to 1000

fold molar excess of unlabeled GGGGCC60 RNA, at a 1500 fold molar excess, the

activity of G4C2BP diminished. On the other hand, addition of a 1500 fold molar excess

of TAR RNA failed to compete off the binding of G4C2BP from GGGGCCexp RNA

indicating that the binding is specific to GGGGCCexp RNA. CUG54 acted as the positive

control with the MBNL activity being challenged by unlabeled CUG54 RNA (Figure 2-6).

hnRNP H Immunoprecipitates the 50 kDa Activity Associated with GGGGCCexp RNA

After demonstrating that G4C2BP activity is repeat length dependent and specific

for GGGGCCexp RNA, we wanted to confirm the identity of the protein interacting with

GGGGCCexp RNA. To achieve this, first we performed a series of immunoprecipitation

experiments using antibodies against proteins that have either been previously

implicated in ALS/FTD or have known affinities to polyG RNA. Heterogeneous nuclear

ribonucleoproteins (hnRNPs) comprise a class of ~20 abundant RNA binding proteins

with diverse cellular functions , including transcription, pre-mRNA processing and RNA

transport, that recognize specific RNA sequence elements. HnRNPs are generally

ubiquitously expressed and often shuttle between nucleus and cytoplasm. To identify

the G4C2BP protein, we initially carried out the UV crosslinking of GGGGCCexp RNA

38

with HeLa nuclear extract and pulled down the protein-RNA complex using MBNL1

(binds YGCY motifs), GRSF1 (G-rich sequence factor), hnRNP H/F proteins (bind to

polyrG homopolymers and associate with other proteins including hnRNP A2/B1,

TDP43, FUS, HuR, Pur α which have been implicated in ALS).

Interestingly, anti-hnRNP H was able to specifically pull down the rGGGGCC60

binding (Figure 2-7 and Figure 2-8). This result was confirmed using two different

hnRNP H antibodies raised against different epitopes (data not shown). hnRNP H is a

pre-mRNA processing factor known to regulate alternative splicing by binding to G

triplets near 5’ and 3’ splice sites, while CLIP-seq and RNA-seq studies in cells

implicate hnRNP H as a regulator of alternative cleavage and polyadenylation (Katz et

al., 2010). Previously, RNA pulldown studies using GGGGCC6.5 RNA identified hnRNP

H as an interacting protein, thus validating our results observed in vitro (Lee et al.,

2013b).

In cellulo Interaction of hnRNP H with Expanded GGGGCC Repeats

Next, we wanted to examine if the interaction of hnRNP H with GGGGCCexp RNA

occurs in a different model system. HeLa JW86 cells were transfected with 500 ng of

the control pcDNA3.1 (GGGGCC)4 and the mutant p(GGGGCC)120 plasmid and the

distribution of the transcribed RNA and endogenous hnRNP H protein was observed by

RNA fluorescent in situ hybridization (RNA FISH) using a complementary Cy3 labeled

CCCCGG4 DNA probe and anti-hnRNP H antibodies. Around 30% of the cells

transfected with the (GGGGCC)120 plasmid showed large, distinct RNA foci in the

nucleus that were absent in cells with the control plasmid. In 40% of the cells positive

for foci, hnRNP H, which normally shows a strong nucleoplasmic distribution, formed

discrete aggregates and these colocalized with the RNA foci providing suggesting

39

hnRNP H interact with the GGGGCCexp RNA (Figure 2-9 B-C). However, the

endogenous hnRNP H is not completely sequestered by the GGGGCCexp RNA foci as

observed by residual fluorescence signal in the nucleoplasm thereby causing a partial

loss of function. Other proteins, such as hnRNP A2/B1 (Figure 2-10) and MBNL1 (data

not shown), did not show co-localization with (GGGGCC)exp RNA foci further

demonstrating the specificity of the interaction.

Absence of hnRNP H Binding in Patient Frontal Cortex Sections

To extend these observations to disease relevant patient tissues, we performed

RNA FISH combined with immunofluorescence for GGGGCC RNA foci and hnRNP H in

C9 ALS/FTD patient frontal cortex (FCx) sections. The RNA foci observed in the

patients were morphologically different from the foci seen in transfected cells since they

exhibited a focused and smaller diameter structure and were observed in a very small

proportion of cells (~10%). Interestingly, the staining of hnRNP H was similar to that

observed in HeLa JW86 cells showing nucleoplasmic distribution although

immunoblotting revealed that the protein levels were at least 50 fold less in human brain

lysates compared to HeLa nuclear extract (Figure 2-11).

We observed that in patient FCx sections, hnRNP H did not colocalize with

GGGGCC RNA foci (Figure 2-11), suggesting that, at least in FCx, hnRNP H is not

sequestered by GGGGCC RNA. This result is supported by studies in neurons from

iPSC-derived cell lines from C9 patients, in which hnRNP H fails to colocalize with

sense RNA foci although contradictory reports have indicated that hnRNP H colocalizes

with GGGGCC RNA foci in the cerebellum of C9 ALS/FTD patients (Lee et al., 2013b).

HITS-CLIP analysis is a widely used high-throughput approach to characterize

the genome wide RNA targets of a particular RNA binding protein. In our lab, we have

40

successfully utilized this methodology to provide strong experimental support for the

sequestration hypothesis for the MBNL2 protein in DM1 and DM2 brain samples

(Goodwin et al., 2015). This is the first evidence of direct binding of MBNL proteins to

the C(C)UGexp RNA in DM. To visualize if the GGGGCCexp RNA in C9 ALS/FTD

sequesters hnRNP H, we performed high-throughput binding analysis of hnRNP H to its

RNA targets in C9 patients by HITS-CLIP (unpublished data). However, we failed to

detect a significant increase in read density at the GGGGCC repeat locus of the

C9orf72 gene in the patients compared to the controls. While this result suggests that

hnRNP H is not sequestered by GGGGCCexp RNA in the frontal cortex of the patients,

recent evidence indicates that the RNA-seq strategy was not able to sequence across

>1 GGGGCC repeat. Therefore, other experimental strategies are being pursued to

overcome this problem.

Abnormal Nuclear Architecture in Cells Expressing Expanded G4C2 Repeats

The nuclear envelope and the underlying meshwork, consisting of nuclear lamina

and associated proteins as well as nuclear pore complexes, mediate critical structural

and functional aspects of cellular function. For example, transcription factors like

retinoblastoma, sterol response element binding protein (SREBP1) and heterochromatin

protein 1 (HP1) bind to the nuclear lamina, regulate transcription and aid in chromatin

organization (Capell and Collins, 2006). Disruption of this nuclear architecture is

observed in nearly a dozen laminopathies and also manifests during the normal ageing

process. Evidence of altered nuclear morphology in some diseases is emerging from

studies in Parkinson’s disease where neuronal stem cells (NSC) derived from iPSC

from patients with the leucine-rich repeat kinase-2 mutation (LRRK2) G2019S show

progressive deterioration of nuclear architecture and this phenotype is rescued by

41

inhibiting the toxic action of the LRRK2 enzyme (Liu et al., 2012) . Also, fibroblasts

isolated from DM1 patients exhibit abnormal distribution of lamin proteins like lamin A,

B1 and emerin and show defects in the nuclear shape (Rodriguez et al., 2015). It is not

apparent how, or if, these nuclear aberrations contribute to the underlying pathology but

it may be possible to exploit these alterations for diagnostic and therapeutic purposes.

An interesting observation that emerged from our cell transfection studies is that

HeLa cells expressing mutant repeat RNA displayed an atypical nuclear morphology.

Compared to the cells expressing GGGGCC4, cells with the GGGGCC120 plasmid

showed an increase in nuclear blebs, which were enriched in cells with higher RNA foci

load. In a proportion of these cells, RNA foci were present at the periphery of the

nucleus suggesting that they were in the process of being exported into the cytoplasm

where they might undergo RAN translation. The local lamin architecture was disrupted

in this population of cells as observed by absence of lamin A1 staining (Figure 2-12).

Alterations in lamin B1 have been reported in C9 iPSC-derived cell lines accompanied

by defective nuclear-cytoplasmic transport, but there are no reports of lamin defects in

patient brain tissues.

Discussion

Similar to other repeat expansion disorders, the GGGGCC expansion has been

proposed to cause pathogenesis though multiple pathways including toxic gain of

function of the sense and antisense RNAs, RAN translation and C9orf72

haploinsufficiency. A number of mouse and Drosophila lines have been developed to

model the disease, and it is becoming increasingly clear that RNA gain of function and

RAN translation play a central role (Freibaum et al., 2015; Kwon et al., 2014; Wen et al.,

2014; Zhang et al., 2015) .However the predominant mechanism that underlies

42

pathogenesis, the molecular trigger(s) underlying degeneration and the cell specificity

are some of the questions that are unanswered.

In this study, we have focused on the RNA gain of function mechanism and

identified a nuclear factor that binds to GGGGCCexp RNA in vitro using UV crosslinking

studies followed by validations using biochemical assays. Our study agrees with the

previous work implicating hnRNP H as an rGGGGCC expansion binding protein.

However, we were not able to detect colocalization with mutant allele transcripts in

patient frontal cortex sections contradicting other studies where they observed this

interaction in cerebellum. This discrepancy could be due to altered protein-protein

interactions in different brain regions that stimulates the binding to the RNA in

cerebellum but not in frontal cortex. Also, the cutoff that is set for colocalization, which

is generally used as the gold standard for interaction, is widely different between

investigators. This discrepancy could cause significant differences in the way results are

interpreted.

It is known that proliferating cells in culture express higher levels of hnRNP

proteins compared to differentiated tissues. One possibility for the differences observed

in binding of hnRNP H between the in vitro system and patient brains could be the

reduced steady state protein levels in the brain and the presence of a brain specific

factor with a greater affinity for rGGGGCCexp RNA that masks binding sites. It will be

critical to ascertain RNA binding using approaches, such as interactome capture and

HITS-CLIP, to avoid the time-consuming development of loss of function models that fail

to model disease pathology.

43

Table 2-1: List of RNA binding proteins identified to bind to GGGGCC RNA

G4C2 binding factor

Methodology used

Cellular/animal models used

Colocalization with G4C2

exp RNA

foci in patient brain

Regions showing colocalization/mislocalization

References

RANGAP1 Drosophila-

based modifier screen

Drosophila melanogaster

Yes Aggregates in motor cortex (Zhang et al., 2015)

hnRNP A3 Biotin G4C223

with competition HEK293 Cells No

Cytoplasmic and nuclear inclusions in hippocampal CA

layers (Mori et al., 2013b)

Pur α Biotin-labeled G4C210 RNA

pulldown

Mouse spinal cord lysates

No Inclusions in cerebellum (Xu et al., 2013a)

hnRNP H

Biotin-labeled G4C272 RNA

pulldown Biotinylated RNA

pulldown, UV crosslinking with

G4C25

SH-SY5Y lysates

Nuclear extracts from SHSY5Y cells

Yes

Neurons in cerebellar granular

and purkinje layer

(Cooper-Knock et al., 2014; Lee et al., 2013b)

Yes Motor neurons

ADARB2 G4C26.5 coated proteome array

16,368 full-length array of human proteins

Yes Motor cortex,

iPSCs from patients (Donnelly et al., 2013)

Nucleolin

Conformational dependent

G4C24 RNA-SILAC method

HEK293T cells Yes Motor cortex

Mislocalization in iPSCs (Haeusler et al., 2014)

ALYREF

Biotinylated RNA pulldown, UV

crosslinking with G4C25


Yes Neurons in cerebellar granular

layer Motor neurons

(Cooper-Knock et al., 2014)

hnRNP A1





layer (Cooper-Knock et al.,

2014)

SRSF2





layer Motor neurons

(Cooper-Knock et al., 2014)

44

Figure 2-1: Denaturing polyacrylamide gel electrophoresis (PAGE) of 32P-labeled TAR RNA and different repeat length RNAs. Transactivating region (TAR) RNA, CUG54, G4C24, 33, 60, 120 RNA were transcribed in vitro using SP6 and T7 RNA polymerases and electrophoresed using 10% (A) and 6% (B) TBE-Urea gels and autoradiographed

45

Figure 2-2: Nuclear extract preparation from HeLa S3 cells. Immunoblot showing the fractionation of nuclear compartment from HeLa S3 cells by probing for nuclear marker with nucleolin antibody and cytoplasmic marker using lactate dehydrogenase (LDHA) antibody

46

Figure 2-3: Repeat length dependent binding of a 50kDa nuclear factor to GGGGCCexp RNA. A) Autoradiogram showing equal counts of 32P labeled CUG54 and GGGGCCn>=4 RNA, crosslinked to proteins in HeLa nuclear extract and subjected to RNase digestion, electrophoresed using a 10% Tris-Cl Criterion gel followed by autoradiography. B) Histogram showing the quantification of the signal intensity in A) with the G4C2 binding protein (G4C2 BP) showing increased binding with increasing repeat number.

47

Figure 2-4: Denaturation of the G4C2 RNA results in increased binding of G4C2BP.

Before the addition of the HeLa nuclear extract, G4C2exp RNA were boiled at 100°C for 5 min, flash frozen and then UV crosslinked to HeLa NE. (Lanes 4-6) and electrophoresed as described in Figure 2-3.

48

Figure 2-5: Binding of G4C2BP to GGGGCCexp is ATP-dependent. Autoradiogram

showing equal counts of 32P labeled GGGGCC RNA, crosslinked to proteins and subjected to RNase digestion in HeLa nuclear extract in the absence of ATP and creatine phosphate. Note that the binding of G4C2BP is absent in lanes 2-4.

49

Figure 2-6: Binding of G4C2BP is specific to GGGGCC RNA. Competition assay

showing the specificity of binding of G4C2BP to G4C2 RNA. A 1500 fold molar excess of unlabeled G4C260 RNA competes off the binding from 32P-labeled G4C260 RNA while TAR RNA does not. CUG54 RNA serves as a positive control with MBNL binding removed by a 500 fold molar excess of unlabeled CUG54 RNA

50

Figure 2-7: ALS associated proteins do not interact with GGGGCCexp RNA. Immunoprecipitation experiment showing pulldown of UV-crosslinked RNA repeat-protein complexes with the respective antibodies against proteins previously implicated in ALS.

51

Figure 2-8: hnRNP H interacts with rGGGGCCexp RNAs. Immunoprecipitation experiment showing pulldown of UV-crosslinked repeat RNA-protein complexes with antibodies against proteins with high affinity to polyrG motifs. CUG54 pulldown by MBNL1 acts as a positive control.

52

Figure 2-9: hnRNP H colocalizes with GGGGCCexp RNA in HeLa cells. RNA-FISH probing for GGGGCCexp RNA using a (CCCCGG)4-Cy3 DNA probe and endogenous hnRNP H using a C terminal primary antibody together with AF488-conjugated anti-rabbit secondary antibody in HeLa JW86 cells transfected with 500 ng of G4C2120 plasmid. Examples of different hnRNP H co-localization patterns are shown in A and B.

53

Figure 2-10: hnRNP A2/B1 fails to colocalize with GGGGCCexp RNA transfected HeLa cells. RNA-FISH for GGGGCCexp RNA using (CCCCGG)4-Cy3 DNA probe and endogenous hnRNP A2/B1 using an antibody against full length hnRNP A2/B1 and AF488 conjugated anti-mouse secondary antibody in HeLa JW86 cells transfected with 500 ng of G4C2120 plasmid (A)

54

Figure 2-11: hnRNP H does not colocalize with GGGGCCexp RNA in patient frontal cortex sections. RNA-FISH for GGGGCCexp RNA using a (CCCCGG)4-Cy3 DNA probe and endogenous hnRNP H using a C-terminal primary antibody and AF488 conjugated anti-rabbit secondary antibody in control (A) and C9 ALS/FTD patient frontal cortex brain sections (B,C)

55

Figure 2-12: Abnormal lamin staining in (GGGGCC)120 HeLa JW86 cells. RNA FISH for GGGGCCexp RNA using (CCCCGG)4- Cy3 DNA probe and endogenous lamin A using AF488 conjugated anti-mouse secondary antibody in GGGGCC4 (A) and (GGGGCC)120 cells (B,C). Note the complete disruption of lamin staining in the region around the arrowhead.

56

CHAPTER 3 CIRCADIAN REGULATION OF RNA PROCESSING BY MBNL2

Circadian Rhythms

Most biological processes follow a daily 24 hour rhythm based on the earth’s

rotation. This temporal coordination, which is observed in organisms from single-cell

cyanobacteria to humans, is essential for proper organismal function. As organisms

evolved, they acquired a more sophisticated circadian clock. This clock allowed the

anticipation of external environmental, physiological, as well as internal behavioral.

changes, including light, feeding patterns and temperature that increased the chances

of survival (Bell-Pedersen et al., 2005). Circadian processes include body temperature,

hormonal production/secretion and sleep patterns and the environmental or external

cues that entrain the body’s internal clock with the external 24 hr light/dark cycle are

called as Zeitgebers.

A process can be termed circadian if it adheres to the following criteria: 1) the

rhythm in the process should persist under constant conditions such as constant

light/darkness (i.e., during the absence of time information); 2) the process is

entrainable (i.e., the phase and period of the process has to be synchronized to external

cues like the dark/light cycle or other stimuli which helps in adjusting the body’s

circadian clock during daylight savings and traveling across time zones); 3 the rhythm is

temperature compensated (i.e., the oscillation is maintained through a wide range of

physiological temperatures).

Suprachiasmatic Nucleus- the Circadian Pacemaker

In mammals, circadian timekeeping is maintained through molecular clocks

residing in every cell of the organism generating rhythms of ~24 hours. These molecular

57

clocks are basically network of genes whose expression and activity exhibit rhythmicity

through a series of positive and negative feedback loops. The central, hierarchical

control of the circadian clock resides in the suprachiasmatic nucleus (SCN) of the

hypothalamus. The SCN is the central pacemaker and is the only clock that receives the

photic information (i.e., daylight information from the retina) and it transmits this

information to molecular clocks in peripheral tissues through systemic and endocrine

cues. The SCN is a tiny region, which is located in the anterior part of the hypothalamus

and directly above the optic chiasma, is contains ~20,000 neurons (Coomans et al.,

2015; Mohawk et al., 2012). These neurons possess cell autonomous oscillators and

are tightly coupled to the other SCN neurons thereby maintaining the phase and period

of the oscillations.

At the molecular level, the various transcriptional and translational events that

generate oscillations are common to both the SCN and peripheral oscillators in multiple

tissues including the heart, liver, skeletal muscle. The distinguishing property of the

central pacemaker is that it is entrainable by light, thereby acting as a key link between

the external environment and the internal molecular clocks (Mohawk et al., 2012).

Culturing of SCN neurons in vitro produces robust, self-sustaining, molecular

oscillations, which can last up to several weeks, whereas the cells from the peripheral

tissues cannot sustain the rhythm for prolonged periods. The oscillations in the SCN

neurons are immune to physiological perturbations, such as feeding times, while the

phase and the period of the peripheral oscillators are inherently susceptible to those

perturbations.

58

Regulation of Circadian Rhythms- Role of Molecular Clocks

The molecular clock that controls the oscillations are a set of core circadian

genes that cycle rhythmically. There are eight clock controlled genes - Bmal1, Clock,

Cry1, Cry2, Period1 (Per1), Per2, Per3, Casein Kinase ε (CKIε). These proteins act at

the level of transcription and translation to regulate protein levels and generate a

constant rhythm with positive and negative feedback loops (Sehgal, 2008).

There are several basic events in the circadian clock. The protein levels of Clock

remain constant throughout while Bmal1 levels oscillates between day and night, being

high during the beginning of subjective day (the daylight phase of 24 hr light dark cycle)

and low during the start of subjective night. The high levels of Bmal1 trigger the

formation of Bmal1-Clock heterodimers that bind to E box elements present in the

promoters of Cry, Per and Nr1d1 activating their transcription at the beginning of the

day. Nr1d1 undergoes translation and upon translocation to the nucleus inhibits Bmal1

transcription. Meanwhile, the Per proteins in the cytoplasm are subject to regulation at

different levels. As they accumulate in the cytoplasm, they are phosphorylated by CKIε,

which makes them unstable, leading to their ubiquitylation and subsequent degradation

by the proteosome. However, as the day proceeds, the cytoplasmic level of Cry

increases causing the formation of Cry-Per-CKI complexes, which upon translocation to

the nucleus disrupts the Bmal1/Clock heterodimers resulting in inhibition of transcription

of Cry, Per and Nr1d1 and activation of Bmal1 transcription. This continuous positive

and negative feedback loop ensures that Bmal1 levels are maintained high during

beginning of the subjective day and slowly wanes as the day proceeds (Fu and Lee,

2003; Ko and Takahashi, 2006).

59

Melatonin- the Neuroendocrine Arm of SCN

The SCN is the principal circadian pacemaker regulating all circadian rhythms

and entraining the internal clocks according to environmental day/night conditions. The

SCN directs its signals to the other organs through direct innervation and by action of

neuropeptides like VIP. Other regions in the brain, such as the pineal gland (PG),

pituitary gland and paraventricular nucleus, exhibit circadian rhythmic expression as

observed in in vitro cultures from Per1-Luc rats, a transgenic rat model in which the

luciferase reporter gene is under the control of mouse Per1 promoter (Abe et al., 2002)

although the phase and amplitude of rhythmicity is different from that of the SCN

(Benarroch, 2008) .

The pineal gland is the neuroendocrine organ that secretes melatonin, which

regulates sleep/wake cycles, circadian rhythms and seasonal changes in metabolism.

The secretion of melatonin is a rhythmic process with peak expression during the dark

period and, like other cyclical processes, it is controlled by the SCN. There is evidence

of feedback loops between the PG and the SCN wherein melatonin produced by the PG

binds melatonin receptors in the SCN and causes subtle SCN phase shifting (Sapede

and Cau, 2013).

Signaling from the SCN to the PG

The rhythmic melatonin production by the PG is regulated by the SCN through a

multisynaptic pathway alternating between day and night. The whole pathway is geared

towards controlling the production of the rate limiting enzyme arylalkylamine N-acetyl

transferase (AANAT) in the melatonin biosynthesis pathway. From the SCN, the signals

reach the paraventricular nucleus (PVN) to the intermediolateral nucleus via the

superior cervical ganglion to the pineal gland. This is a well-defined circuit involving the

60

neurotransmitters glutamate, PACAP and norepinephrine. During the day, light from the

retina reaches the SCN via the RHT, which activates SCN neurons that are primarily

GABAergic, to maintain an inhibitory effect on the neurons they are innervating and thus

pineal gland activity is suppressed. However, during the night this inhibition is relieved

and the intrapineal nerve fibers that innervate the PG, release norephinephrine (NE)

and trigger a cascade of reactions. Binding of NE to the G protein coupled receptors on

the PG initiates the cyclic AMP (cAMP) signaling pathway. The cAMP accumulates,

leading to the activation of protein kinase A (PKA) followed by phosphorylation of cAMP

response element binding (CREB) proteins. CREB proteins are transcription factors,

which upon phosphorylation bind to the CRE elements in the promoter of AANAT

mRNA. This results in a 100-fold increase in AANAT mRNA levels during the night.

Thus, control is present only at the level of transcription since the melatonin produced

by the enzymatic reaction gets secreted immediately into the bloodstream and the

cerebrospinal fluid (Macchi and Bruce, 2004)

Light-Induced Control of Gene Expression

In addition to the rhythmic secretion of melatonin, the pineal gland is an excellent

tissue to understand the regulation of rhythmic nature of gene expression by light.

Around 600 genes, including certain long non-coding RNAs and genes belonging to

different families, exhibit differential expression between day and night in rat pineal

gland (Bailey et al., 2009; Coon et al., 2012). Many of these genes have CREB binding

sites in their promoter similar to AANAT suggesting that they are under the control of

SCN and light (Bustos et al., 2011). RNA-seq studies in different mouse tissues reveal

that only around 10 genes oscillate between day and night in the sampling of 12

different organs in mice. But ~43% of protein coding genes show rhythmic expression in

61

at least one organ, which indicates the presence of tight regulation (Zhang et al.,

2014a). This could be exerted at the level of transcription, like AANAT, or could occur

post transcriptionally at the level of splicing, alternative polyadenylation, polyA tailing

and mRNA decay (Kojima et al., 2011). Additionally, the control can also be at the

co/post-translational level with kinases and phosphatases playing a predominant role as

observed in eIF4E phosphorylation by MAP kinases (Cao et al., 2015) and

phosphorylation of Per proteins by CKI (Lee et al., 2009) thereby modulating the extent

of translation or the stability of the proteins, respectively.

Post-Transcriptional Control of Circadian Rhythms

Circadian clocks are internal oscillators with self-sustained rhythms, previously

thought to be regulated mainly by transcriptional feedback loops and post-translational

modifications of the core clock proteins. Now it is becoming increasingly clear that post-

transcriptional mechanisms and RNA binding proteins play a pivotal role in sustaining

this rhythm and maintaining homeostasis in the organism (Lim and Allada, 2013). The

advent of high throughput technologies has aided in elucidating the different regulatory

checkpoints, but the finer details of many processes are yet to be discovered.

Alternative Splicing in Circadian Clocks

Around 95% of the multi-exonic genes are alternatively spliced. Alternative

splicing (AS) is an efficient way to produce multiple isoforms with varying mRNA

stability, protein structure and function. Circadian regulation of alternative splicing is

observed in different organisms across evolution from fungi to mammals. Temperature

is an important zeitgeber similar to light and causes significant resetting of circadian

clocks. While almost all biochemical reactions are susceptible to variations in

temperature, most of them are temperature compensated.

62

The Neurospora crassa FREQUENCY (FRQ) protein is a central clock protein

that functions in temperature-dependent control of alternative splicing. Higher

temperatures result in the retention of an intron with an upstream translation initiation

codon producing a longer protein product LFRQ that differs with the shorter FRQ protein

by 99 amino acids. The ratio of LFRQ to SFRQ is critical for maintaining robust free-

running rhythms and for temperature compensation (Colot et al., 2005; Diernfellner et

al., 2007; Kojima et al., 2011; Lim and Allada, 2013). The trans-acting factors that

promote this temperature dependent control are still unclear. Similarly, in Arabidopsis

thaliana the RNA binding proteins AtgRP7 and AtgRP8, whose transcription is clock

controlled and are negatively regulated by alternative splicing. When AtgRP7 and

AtgRP8 protein levels reach a certain threshold they bind to their own pre-mRNAs

producing a spliced isoform containing a premature termination codon (PTC) triggering

nonsense mediated decay (NMD) (Staiger et al., 2003). Interestingly, AtgRP7 and

AtgRP8 mRNA expression is induced by cold temperatures (4°C) thus integrating the

external stimuli with internal endogenous cues.

An example of splicing being indirectly controlled by the clock is observed in

Arabidopsis thaliana, where epigenetic modifiers such as protein arginine methyl

transferase (PRMT5), a methyl transferase, which is a clock controlled gene that

modulates the expression of another clock gene, pseudo response regulator 9 (PRR9).

In Prmt5 mutants, which are characterized by a long period phenotype, the non-

functional isoforms of PRR9 containing PTCs are overexpressed while the functional

isoform is diminished compared to wildtype plants (Sanchez et al., 2010). One

speculation is that PRMT5 methylates spliceosomal proteins that can alter its efficiency

63

in recognizing weak 5’ splice sites resulting in productive splicing. Prmt5 mutants exhibit

widespread dysregulation of AS, thus introducing a global connection between circadian

clocks and alternative splicing (Sanchez et al., 2011).

Trans-acting factors, such as alternative splicing factors, work in concert with

basal splicing factors like SR proteins and snRNPs to regulate the spatio-temporal

expression of specific splice isoforms. The rhythmic expression of these alternative

splicing factors could add another regulatory layer to circadian splicing.

Interplay among Polyadenylation Elements in Circadian Clocks

Recent studies attribute rhythmic transcription to only a small fraction of

oscillating transcripts, emphasizing the importance of post transcriptional and

downstream regulatory mechanisms. PolyA tailing, or the addition of adenosines to the

3’ end of mRNA, plays a main role in mRNA stability and improving the efficiency of

translation through interaction with cap-binding proteins. Nocturnin, a cytoplasmic

deadenylase, is under the control of clock and is rhythmically expressed in Drosophila

pacemaker neurons and Xenopus laevis retinal photoreceptor cells (Baggs and Green,

2003). Similarly, cytoplasmic polyA binding proteins (CPEBs), the polyA polymerase

Gld2 and polyA-specific RNase (PARN) also exhibit rhythmic oscillation (Kojima and

Green, 2015). For some transcripts whose mRNA levels do not show oscillation, their

polyA tail peak correlates with the expression peak of these proteins. This suggests that

these proteins are involved in a circadian temporal regulation of the polyA tails thereby

affecting mRNA stability and translation in a post-transcriptional manner.

Regulation of Circadian Clock and Clock Outputs by MicroRNAs

MicroRNAs (miRNAs) are short ~21-26 nt long non-coding RNAs involved in the

control of translation and mRNA degradation. Bioinformatic analyses suggest that ~30%

64

of genes have binding sites for miRNAs. Therefore, it is not surprising that circadian

clock genes and the downstream clock-controlled pathways are targets of miRNAs

(Nolte and Staiger, 2015). Studies in mouse retina, mouse SCN, Drosophila brain and

Arabidopsis show rhythmic expression of certain miRNAs. For example, miR 219-1 and

miR 132 are differentially regulated either by light or by the clock itself as shown by

ChIP-seq studies. Knockdown of miR 219-1 using antagomirs in mice produces long

period phenotypes suggesting it regulates circadian period lengths, possibly by altering

the cellular excitability and expression of key circadian proteins (Cheng et al., 2007).

In mouse liver, the orphan nuclear receptor REV-ERBalpha drives the

transcription of miR 122, a major miR, in a circadian fashion. Even though the pri-miR of

miR-122 accumulates rhythmically, because of a long half-life, the mature miR doesn’t

exhibit oscillation (Lim and Allada, 2013). Nevertheless, miR-122 targets a variety of

transcripts that accumulate in a circadian fashion including the Nocturnin mRNA and

transcripts involved in cholesterol and lipid metabolism (Gatfield et al., 2009).

Circadian Regulation by RNA Binding Proteins

RNA binding proteins are a critical component of several molecular pathways,

including transcription, mRNA splicing, miRNA biogenesis, mRNA stability and

translation (Keene, 2007). Multiple studies suggest that some trans-acting factors, like

hnRNPs, are under clock control (Wang et al., 2013). It is expected that these proteins

play significant roles in maintaining circadian rhythmicity.

Body temperature cycles regulate the expression of cold-induced RNA binding

proteins (Cirp), both mRNA and protein levels, in mouse liver. This regulation is required

for high amplitude circadian gene expression, as shown by knockdown studies in

65

cultured fibroblasts where depletion of Cirp leads to oscillation dampening of genes

important for clock function, such as Clock, Per3, Bmal1 and Dbp (Morf et al., 2012).

CLIP-seq studies reveal that Cirp binds to 3’ UTRs, close to stop codons ~150 nt

upstream of polyA sites, suggesting that Cirp is exerting post-transcriptional control.

Interestingly, another report shows the regulation of alternative polyadenylation by Cirp

wherein Cirp represses proximal polyA site usage in mouse embryonic fibroblasts (Liu

et al., 2013). Utilization of varying alternative polyadenylation sites can affect mRNA

stability, miRNA-binding sites and mRNA transport and rhythmic circadian control can

be exerted by the alteration of the expression of APA factors.

Some hnRNP proteins like hnRNP I, hnRNP D and hnRNP Q exhibit rhythmic

expression, sometimes in different cellular compartments, thereby controlling different

cellular processes in a circadian manner. The AANAT levels in the melatonin

biosynthesis pathway are regulated at the level of transcription by light and at the level

of translation by various hnRNPs. HnRNP Q, whose expression is rhythmic, binds to

IRES elements in the AANAT 5’ UTR to promote translation, oscillating in the same

phase as hnRNP Q (Kim 2005 et.al). Along with hnRNP L and hnRNP R, hnRNP Q

binds to the 3’ UTR of the AANAT transcript and contributes to its degradation. Thus the

oscillation in the trans-acting factor governs the rhythmicity in the melatonin levels,

which acts as a systemic cue for daylight information to the internal clock.

Circadian Misregulation in Disease

Recent evidence points to the dysregulation of circadian rhythms and sleep

disturbances in several neurological diseases like Parkinson’s disease (PD), myotonic

dystrophy, Alzheimer’s disease (AD), bipolar disorders, Huntington disease (Rovsing et

al.), ALS as well as in certain cancers (Fu and Lee, 2003; Videnovic et al., 2014). In PD

66

and AD, reports suggest that sometimes the sleep symptoms appear earlier than motor

or cognitive dysfunction. It is not evident if circadian dysregulation is a direct

consequence of the disease or plays a role in the disease cascade. Intriguingly,

mutations in RNA binding proteins or their impaired function are observed in some of

these diseases, and because of the trans-acting factor involvement in circadian

functions it is compelling to speculate of a crosstalk between these two entities. One

such disease is myotonic dystrophy and we are interested in delineating the relationship

between MBNL proteins and their role in the generation of altered rhythms.

Myotonic Dystrophy5

Myotonic dystrophy (DM) has served as a paradigm for repeat expansion

diseases caused by RNA gain-of-function mechanisms, also referred to as RNA

dominance (Caillet-Boudin et al., 2014; Poulos et al., 2011; Ranum and Cooper, 2006).

DM1 is the most common form of adult onset muscular dystrophy (1/8000 worldwide)

(O'Rourke and Swanson, 2009). DM1 and DM2 are multisystemic disorders with

symptoms that include progressive skeletal muscle wasting, delayed muscle relaxation

(myotonia), cardiac arrhythmias, insulin resistance, gastrointestinal problems and CNS

symptoms such as cerebral atrophy, hypersomnolence, memory deficits,

cognitive/behavioral abnormalities and intellectual disability (in the congenital form of

the disease). DM is caused by unstable repeat expansions in the non-coding region of



67

two genes: 1) a CTGexp in the 3’ UTR of the dystrophia myotonica protein kinase

(DMPK) gene in DM1; 2) a CCTGexp in the first intron of CCHC-type zinc finger nucleic

acid binding protein (CNBP/ZNF9) gene in DM2 (Liquori et al., 2001; Ranum and

Cooper, 2006). For DM1, the normal CTG repeat length ranges from 5-37, while

individuals with >50 repeats exhibit the classical disease symptoms of DM1 and >1000

repeats is associated with the severe congenital form (CDM). For DM2, the pathogenic

range of CCTG repeats varies from 75 - ~11,000 in patients compared to 11-26 repeats

in normal individuals. Anticipation is a prominent feature of DM1 but not DM2, although

somatic mosaicism and intergenerational instability have been widely reported in both

DM1 and DM2 (Udd and Krahe, 2012).

DM Pathogenic Mechanisms

The expression of C(C)UGexp RNA, which folds into a stable stem-loop structure,

alters the activities of two developmentally regulated RNA binding protein families,

MBNL and CELF, causing misregulation of multiple cellular pathways (Echeverria and

Cooper, 2012; Fernandez-Costa et al., 2013; Kalsotra et al., 2014a; Rau et al., 2011;

Wang et al., 2012). Although CELF1, an alternative splicing factor that promotes fetal

splicing patterns, is not sequestered by CUGexp RNAs, CELF1 protein levels increase in

DM1 heart and muscle tissues through a mechanism mediated by protein kinase C

(PKC) (Kuyumcu-Martinez et al., 2007). The details of how CUGexp RNA activates PKC,

and if this activation is specific to DM1, still needs to be clarified. In contrast, the MBNL

proteins, which activate adult splicing patterns, are sequestered by C(C)UGexp RNAs

(Miller et al., 2000) and thus the combination of an increase in CELF1 and a decrease in

MBNL activity causes a shift to fetal splicing patterns of specific target transcripts in

adult tissues (Osborne and Thornton, 2006). These two events make alternative splicing

68

dysregulation a major pathogenic event in DM. In addition, abnormal DNA methylation

(Castel et al., 2011), altered miRNA and mRNA expression (through decreased

expression of transcription factors) (Fernandez-Costa et al., 2013; Kalsotra et al.,

2014a; Rau et al., 2011), bidirectional transcription of the repeats (Batra et al., 2010),

and repeat associated non-ATG translation (RAN translation) (Zu et al., 2011) have also

been implicated in DM pathogenesis.

RNA Gain-of-Function Models for DM

The first convincing proof that DM is an RNA-mediated disease was obtained

from the HSALR mouse model, which expresses a human skeletal muscle (HSA)

transgene with CTG250 repeats specifically in the skeletal muscle (Mankodi et al., 2000).

This model shows features reminiscent of DM including myopathy, myotonia,

intranuclear CUG RNA foci and centralized myonuclei with a positive correlation

between pathology and transgene expression. Additional mouse models have also been

generated to overcome the limitations of this model, which include a relatively short

CTGexp, the absence of the endogenous DMPK 3’ UTR sequence and restricted muscle

expression (Gomes-Pereira et al., 2011). These models include Cre-inducible

transgenic mice expressing interrupted CTG960 repeats (EpA960) or CTG0 repeats

(EpA0) and transgenic mice carrying insertions of a ~45 kb human genomic region with

20, 55, and 300 CTG repeats (Seznec et al., 2000; Wang et al., 2007). DMSXL, derived

from the DM300 line, is another transgenic model with >1000 CTG repeats due to

intergenerational instability that led to ‘big jumps’ in CTG repeat number (Gomes-

Pereira et al., 2007). These models exhibit different aspects of DM disease, such as

muscle pathology, cardiac conduction problems, behavioral abnormalities accompanied

by intranuclear RNA foci pathology and some tissue-specific splicing deficits (Gomes-

69

Pereira et al., 2011; Hernandez-Hernandez et al., 2013; Huguet et al., 2012). Taken

together, these mouse models serve as valuable tools to gain insight into DM disease

mechanisms and for preclinical assessment of therapeutics targeting repeat expansion

RNAs.

An important consequence of C(C)UGexp RNA toxicity is the sequestration of

MBNL proteins resulting in their functional insufficiency. The MBNL proteins were first

discovered as factors that bind to CUG repeat RNA in a length-dependent manner in

vitro and accumulate in nuclear RNA foci in patient myoblasts (Miller et al., 2000).

Several Mbnl knockout (KO) mouse models have validated this sequestration

hypothesis including Mbnl1Δ3/ΔE3 isoform KO mice, which develop DM-relevant and

multisystemic symptoms including myotonia, ocular dust-like cataracts and abnormal

splicing of developmentally regulated splicing events (Kanadia et al., 2003). Moreover,

recombinant adeno-associated virus (rAAV)-mediated MBNL1 overexpression in the

HSALR model results in phenotypic rescue of myotonia and correction of dysregulated

splicing (Kanadia et al., 2006).

In contrast to MBNL1, MBNL2 is highly expressed in the adult CNS but not in

skeletal muscle and MBNL2 is the major MBNL family member that regulates alternative

splicing in the brain. Mbnl2ΔE2/ΔE2 isoform KO mice develop DM-associated neurological

symptoms including hypersomnia, learning/memory deficits, altered GABA sensitivity

and disease specific mis-splicing (Charizanis et al., 2012). The differences observed in

these Mbnl KO models indicate tissue-specific splicing regulation by the Mbnl family.

Interestingly, MBNL2 compensates for loss of MBNL1 activity in heart and skeletal

muscle while the absence of both proteins leads to embryonic lethality (Lee et al.,

70

2013a). Mbnl1; Mbnl2 conditional double KO (DKO) mice are viable but exhibit

phenotypes not observed in single Mbnl KOs, such as muscle wasting, cardiac

conduction defects and severe splicing defects suggesting that DM is caused by

compound loss of MBNL function triggered by the production of toxic C(C)UGexp RNAs

(Goodwin et al., 2015; Lee et al., 2013a).

Recapitulation of Altered Sleep Phenotype in Mbnl2 Knockout Mouse Model

The most common non-muscle complaint by the DM1 patients is excessive

daytime sleepiness (EDS) severely affecting their quality of life. Obstructive sleep

apnea, REM sleep dysregulation are reported in high proportion of patients (Dauvilliers

and Laberge, 2012). The etiologies of the symptoms are largely uncharacterized mainly

due to the complexity in the circadian and sleep associated pathways. Interestingly,

electroencephalographic studies (EEG) of the Mbnl2ΔE2/ΔE2 mice show altered REM

sleep propensity reminiscent of DM (Chemelli et al., 1999). Though the overall time of

sleep/wake periods is not affected, during the active period, the mice exhibit increased

REM sleep episodes accompanied by decreased REM sleep latency compared to the

controls. This directly implicates the sequestration of MBNL2 by CUGexp RNA as an

important mechanism in the sleep dysregulation in DM and also highlights the suitability

of this mouse model for further characterizing the downstream molecular changes.

MBNL2 Regulation of Circadian RNA Processing In Mouse Pineal Gland

We were interested in delineating the role of MBNL2 in the circadian regulation of

pre-mRNA processing focusing on alternative splicing and also regulation of gene

expression in the pineal gland, which is a central organ involved in the maintenance of

sleep/wake cycle and relays daylight information to the peripheral circadian clocks in the

body.

71

Oscillation of Hundreds of RNA Transcripts in Mouse Pineal Gland between Day and Night

The alterations in the input from the SCN triggers circadian changes in the pineal

gland and in rats hundreds of transcripts, including certain long non-coding RNAs,

exhibit oscillation in their mRNA levels between day and night. To gain insights into the

role played by MBNL2, a developmental and tissue specific pre-mRNA processing

factor, we performed RNA sequencing of pineal glands isolated from Mbnl2+/+ and

Mbnl2-/- mice during different zeitgeber times (ZT- time after lights on/off) ZT 7 and ZT

19 representing the light and dark period, respectively (Figure 3-1a). Previous studies

have utilized microarray technologies to analyze the changes in the pineal gland

transcriptome in Crx knockout mouse models (Rovsing et al., 2011). Our study is the

first time RNA sequencing has been employed to study the pineal transcriptome.

Comparison of the day and night differential expression data in the WT mice indicated

that around 28 transcripts showed >30-fold difference while 62 transcripts showed 10-

30 fold difference and 1000 transcripts showed a 2-10 fold change, either upregulated

or downregulated upon lights off (Figure 3-1b). Transcripts that showed rhythmic

expression include AANAT (the rate limiting enzyme in the melatonin secretion

pathway), Mat2a (the methyl acetyl transferase), transcripts belonging to the visual

perception pathway (Rdh8, a retinol dehydrogenase), transcription factors (cAMP

response element modulator Crem) and Cone/rod homeobox domain (Crx) important in

the photoreceptor function. There is a strong correlation between our data and

previously published day/night differential expression data from rats (Bailey et al., 2009)

suggesting signaling mechanisms like the cAMP pathway/ adrenergic pathways could

be conserved between the two species.

72

Mbnl2 RNA Transcripts Fail to Oscillate between Day and Night in Mouse Pineal Gland

An interesting observation from the day/night differential expression analysis and

hybridization data from rats is the oscillation of the RNA and protein levels of

Muscleblind like-2, which peaked at night (ZT 18) and changes ~8 fold. This

upregulation is induced by the action of norepinephrine on the pineal gland and requires

the second messenger cAMP (Kim et al., 2009). This led to our hypothesis that MBNL2

exhibits rhythmicity even in mice and this differential expression could result in the

regulation of alternative splicing and alternative polyadenylation of RNA transcripts in a

circadian manner.

In our RNA-seq data, we observed that the expression of Mbnl2 did not change

between day and night. We validated this using real time qRT-PCR measuring the

relative mRNA levels between day and night (Figure 3-2) with AANAT acting as the

positive control for night expression. However, we cannot discount the possibilty that the

Mbnl2 transcript could be subjected to post-transcriptional or post-translational

regulation thereby altering its protein levels between the two circadian times.MBNL2

protein levels could not be measured because of difficulties in obtaining substantial

amounts of Pineal gland tissue for protein quantification. Even though Mbnl2 RNA

transcripts did not show changes, we proceeded with our analysis of the Mbnl2

knockout mice to look for interesting changes.

Loss of MBNL2 causes Widespread Changes in Pineal Gland Transcriptome

Differential expression analysis between the different groups revealed that

hundreds of circadian gene expression changes are aberrant in the Mbnl2 knockout

mice compared to the wildtype controls. Upon MBNL2 loss, there is an overall reduction

73

in the number of genes exhibiting differential expression between day and night in the

knockout mice (Figure 3-3b). We also observed that in the mutant animals, there was a

complete reversal in the directionality of the changes (i.e., more genes showed a

negative fold change in the knockouts compared to controls and vice versa) (Figure 3-3

a,b). This could be attributed to an indirect effect of MBNL2, in which perhaps MBNL2 is

controlling a negative regulator of transcription during the night in the control animals

and MBNL2 loss leads to misregulation of this proposed factor resulting in increased

transcription globally at night in the knockouts.

Further analyzing the breakdown of the genes, we observed that out of the 1200

genes that show rhythmic expression in the wildtype animals, only 481 genes follow a

similar expression pattern in the knockout animals while the remaining 688 genes

(~50%) lose their rhythmicity in the knockout animals and 237 genes exhibit circadian

changes only in the mutant animals (Figure 3-3b).

Additionally, comparison of wildtype and mutant animals during the two time

points, ZT7 and ZT19, showed that genes are differentially expressed between the two

circadian periods (Figure 3-4a), suggesting that loss of MBNL2 is altering the pineal

gland transcriptome and affecting its various downstream functions. Upon analysis of

the genes dysregulated by MBNL2 loss, we observed a wide variety of pathways that

are affected including rhythmic process transcription factors (Dbp, Egr2), signaling

receptors (Drd1a, Cngb3), RNA binding proteins (Rbm44) and intracellular calcium

transport (Slc8a1, Ptprc). Further studies in different tissues and fibroblast cell culture

models are required to characterize the relevance of these defects to the phenotype.

74

Circadian Splicing Regulation by MBNL2

Reports suggest that post-transcriptional modifications, in particular alternative

splicing plays a major role in fine-tuning the expression levels thereby adding another

layer of regulation. RNA binding proteins like Gemin2 (a spliceosomal assembly factor),

PRMT5 (a methyl transferase), SKIP (a component of the spliceosome and

transcriptional regulator) have been shown to control the alternative splicing of several

clock genes and its components. The AS regulation in plant circadian clocks has been

intensely studied (Wang et al., 2013). However studies identifying the role of alternative

splicing factors in circadian clock especially in the mammalian brain are lacking. Since

our Mbnl2 knockout mice exhibit circadian and REM sleep phenotypes and MBNL2 is a

major pre-mRNA processing factor in the brain, we sought to determine if there was any

causative relationship between the two. Interestingly, the C57/BL6 background strain

produces low detectable levels of melatonin (Goto et al., 1989) due to a truncation

mutation in the Aanat gene (Roseboom et al., 1998) suggesting that the phenotype is

probably independent of strong melatonin rhythms. Even with this mutation,

transcriptional rhythms and intracellular signaling events remain intact in this strain (von

Gall et al., 2000) making it an interesting model system to study circadian changes.

Paired end RNA-seq data was analyzed for alternative cassette exon splicing

changes using the Olego program (Wu et al., 2013). The comparison of the ZT7 and

ZT19 time point in wildtype controls indicated that around 336 genes exhibited

differential splicing changes suggesting widespread prevalence of alternative splicing in

the mouse pineal gland (Figure 3-6A). Gene ontology analysis using the DAVID tool

indicated the spliced genes were enriched for biological processes (phosphate

metabolism), protein modifications (ubiquitination), intracellular transport and membrane

75

organization. Phosphorylation by various kinases and protein degradation by

ubiquitination are key steps by which protein levels are controlled by the circadian

molecular clock. This suggests splicing adds a new layer of regulation to the clock.

Next, we compared the circadian alternative cassette exon splicing between

controls and Mbnl2-/- knockout mice and observed that there is an overall reduction in

the number of splicing events in the knockout animals (Figure 3-5A). This global effect

on splicing could be attributed to the fact that MBNL2 is a major splicing factor in the

brain and its loss leads to extensive misregulation. We believe that the dysregulation

will be more severe if there is loss of both MBNL1 and MBNL2 as seen in DM patients,

since our RNA-seq data suggests that MBNL2 regulates cassette splicing of Mbnl1

exon 5, which codes for the nuclear localization signal (Figure 3-5B). This exon is

subjected to intense autoregulation by MBNL1 itself (Gates et al., 2011) and our data

suggests that MBNL2 negatively regulates exon 5 inclusion thereby modulating the

nuclear levels of MBNL1 proteins and subsequently its downstream splicing function.

Examination of the splicing changes occurring during day and night in the

MBNL2 knockout animals revealed that only 20% of the splicing events observed in the

wildtype animals are recapitulated in the mutants. The remaining changes are absent in

the knockouts and around 100 completely different genes exhibit differential cassette

exon splicing in the mutants.

MBNL2 Regulates the Splicing of Different Genes during Day and Night

Comprehensive RNA-seq studies in mouse liver suggest that only in 22% of

genes, the rhythmicity is driven at the level of transcription (Koike et al., 2012),

underlining the importance of post-transcriptional and post-translational mechanisms in

controlling the circadian clock. Next we analyzed the transcripts that are affected by

76

MBNL2 loss during day and night. To our surprise, there was disparity in the genes

regulated by MBNL2 during the two circadian times showing only a very small overlap (

Figure 3-7a,b and Figure 3-8). We further analyzed the functional significance of the

genes regulated by MBNL2 during day and night and observed that they belong to

distinct biological processes regulating processes like synaptic transmission, organelle

localization and secretion enriched during the day while intracellular transport and

phosphorylation, which are key pathways associated with the pineal function, are

enriched during the night period (Figure 3-8a,b).

Discussion

The role of MBNL proteins in alternative splicing, alternative polyadenylation and

miRNA processing in tissue specific development and embryonic cell (ES) cell

differentiation has been intensely studied (Han et al., 2013; Kalsotra et al., 2014b;

O'Rourke and Swanson, 2009). In contrast, studies on MBNL roles in circadian rhythms

and potential roles in co/post-transcriptional modification of molecular clocks are

lacking. In this research, we studied the role of MBNL2 in alternative splicing and gene

expression in the pineal gland, a central organ in maintaining sleep/wake cycles and

one of the few organs receiving neuronal input from the SCN. Regulation of sleep and

circadian rhythms is a complex phenomenon involving different neurons, inputs from the

SCN and the action of hormones like melatonin (Gandhi et al., 2015). Mbnl2ΔE2/ΔE2 mice

exhibit altered REM sleep phenotype and also defects in the circadian period during

free-running rhythms. Interestingly, loss of the central clock components Per, Cry,

Bmal1, Clock results in a similar behavioral phenotype as observed in different mutant

models (Ko and Takahashi, 2006) suggesting that, similar to core clock genes, MBNL2

77

plays a critical role in the maintenance of circadian rhythms, which may directly/

indirectly affect downstream pathways including sleep regulation.

To understand the role played by MBNL2, we have delineated transcriptomic

changes occurring between light/dark periods in the pineal gland of mice utilized RNA-

seq technology and also demonstrated the occurrence of circadian alternative splicing

changes. Additionally, we have shown that loss of MBNL2 elicits extensive changes to

the transcriptome affecting genes involved in multiple cellular pathways. However,

genes belonging to the central pathways of pineal gland like visual perception,

biosynthesis of amines, cyclic AMP biosynthesis are not altered by the loss of MBNL2.

But the rhythmic expression of certain transcription factors like DBP (Albumin D-box

binding protein), Egr2 (Early growth factor 2), receptors like Drd1a (Dopamine receptor

1a), Chrna7 (Cholinergic, nicotinic alpha 7) is lost in the mutant mice.

DBP, a PAR leucine zipper transcription factor under the control of dimers Bmal-

Clock (Yamaguchi et al., 2000) is one of 10 genes found to oscillate in all 12 mouse

organs in a comprehensive RNA-seq study (Zhang et al., 2014a). Loss of DBP in mice

leads to changes in the REM sleep even though the overall sleep pattern remains

unaffected along with changes in hippocampal theta frequency when measured by EEG

(Franken et al., 2000) similar to the phenotype observed in the Mbnl2 knockout mice. It

will be interesting to examine the oscillation pattern in the SCN of Mbnl2 knockout mice

for alterations in expression that could possibly account for the phenotype seen in the

Mbnl2ΔE2/ΔE2 mice.

Another gene of interest is PTGDS, prostaglandin D synthase (L-PGDS) which

produces prostaglandin D(2) (PGD2) in the brain. PGD2 along with adenosine are

78

important signaling molecules regulating physiological sleep (Urade and Hayaishi,

2011). Serum and cerebrospinal fluid levels of L-PGDS in narcoleptic patients suffering

from excessive daytime sleepiness are altered (Barcelo et al., 2007; Bassetti et al.,

2006). Our RNA-seq studies show that Mbnl2-/- mice show diminished RNA levels of

Ptgds RNA during the day. Interestingly, diminished levels of L-PGDS is also associated

with increased susceptibility to pentylenetetrazole (PTZ)-induced seizures (Kaushik et

al., 2014), a phenotype that is seen the Mbnl2 knockout mice. Hence it will be

interesting to evaluate the L-PGDS protein levels and PGD2 levels in the knockouts to

determine if there is any correlation between their sleep and PTZ-induced seizure

phenotypes. Furthermore, analysis of the serum and CSF levels of PGD2 and L-PGDS

in DM patients can be performed.

Curiously, MBNL2 loss affected the expression of a plethora of genes involved in

the activation of immune and inflammatory responses that are normally expressed in

wild type mice. This is in agreement with prior microarray studies in rat and chicken

pineal glands showing the rhythmic expression of abundant immune related genes,

attributed to the presence of perivascular phagocytes in the pineal gland. Further

studies are required to understand the role of pineal gland in immune response.

Expectedly, MBNL2 loss resulted in widespread splicing changes during both

light and dark periods but interestingly absence of MBNL2 caused splicing alterations in

different genes during the light and dark period. Possible scenarios include: 1) while

Mbnl2 RNA does not exhibit rhythmic transcription, Mbnl2 RNA is subjected to post-

transcriptional or translational changes that could subsequently induce rhythmicity in

protein levels or its activity; 2) since trans-acting factors may work in concert with other

79

proteins to mediate splicing, interacting partners could undergo rhythmic expression and

modulate the regulated genes; 3) the time points studied are not ideal to identify MBNL2

rhythmicity in mice. The time points in our study were chosen based on previous studies

in rat pineal gland in which Mbnl2 mRNA and protein peaked at ZT 19. However, mouse

Mbnl2 mRNA levels might peaks earlier than ZT 19 while the protein level peaks at ZT

19, as often seen for RNAs undergoing post-transcriptional modifications. This

suggests that it will be important to perform sampling at different time points to obtain a

complete picture of the oscillations.

In our dataset, though we did not observe the splicing of the core clock genes or

their paralogs but we did detect misregulated splicing of different RNA binding proteins

(Rbm34, Gemin8), ubiquitination factors (Ubn1, Fbxl21) and genes belonging to

translation and secretion pathways that could affect RNA levels or downstream

functions. Comparison of splicing and expression datasets revealed negligible overlap

suggesting that the oscillation in RNA levels is through mechanisms other than cassette

exon splicing, such as alternative polyadenylation.

Our splicing data suggests increased inclusion of the exon coding for one of the

MBNL1 NLSs in the Mbnl2 knockouts, which would relocalize MBNL1 to the nucleus

and allow this MBNL paralog to functionally compensate for MBNL2 loss. Indeed, this

type of functional compensation has been observed previously in skeletal muscle (Lee

et al., 2013a). This suggests that in DM patients, with sequestration of both MBNL1 and

MBNL2, the extent of circadian splicing misregulation will be even higher and probably

result in the observed sleep phenotypes. Hence, it will be interesting to analyze

80

Mbnl1ΔE3/ΔE3; Mbnl2ΔE2/ΔE2 DKO mutants for circadian sleep abnormalities as well as

pre-mRNA processing defects.

81

Figure 3-1: A) Illustration of the mouse genotypes and time points used for circadian RNA-seq analysis of the pineal gland. B) Table showing the number of genes exhibiting expression changes in WT pineal gland as determined by RNA-seq

82

Figure 3-2: Mbnl2 RNA levels in mouse pineal gland do not oscillate between day and

night. Bar graphs showing steady state RNA levels of Aanat (left) and Mbnl2 as measured by qPCR. Aanat RNA shows an ~46-fold difference between ZT7 (day) and ZT19 (Kwon et al.) Mbnl2 levels do not show a significant difference between day and night in Mbnl2+/+ mice (n=3), **p<0.01, n.s- not significant

83

Figure 3-3: Loss of Mbnl2 causes widespread circadian expression changes. A) Volcano plot showing the gene expression changes occurring between day and night in WT (left) and in Mbnl2 KO mice. Each dot represents a gene, blue–negative fold change and red-positive fold change. The directionality of the fold change is reversed in Mbnl2 KO mice compared to WT. B) Venn diagram (left panel) displaying the number of genes differentially expressed between day and night in WT and Mbnl2-/- animals. The right panel shows the percentage of genes upregulated or downregulated in the two groups on the left

84

Figure 3-4: Mbnl2 loss leads to extensive changes in pineal transcriptome. A) Heatmap showing global changes in expression comparing Mbnl2 WT and KO during day and night periods (n=2). B) Bar graphs indicating the relative mRNA levels of Rbm44 in all four groups with the rhythmic expression observed only in the Mbnl2-/- mice as measured by qPCR (n=3). ** p<0.01 C) Bar graphs showing the relative mRNA levels of Cngb3 in Day WT and Day KO as measured by real time qPCR (n=3). * p<0.05. Error bars indicate +/- SEM values.

85

Figure 3-5: Global circadian splicing alterations in the pineal gland of Mbnl2 KO mice. A) Scatter plot showing splicing changes in WT (left) and Mbnl2 KO mice B) Wiggle plot showing splicing of Mbnl1 in Mbnl2+/+ and Mbnl2-/- mice during day and night. Note the increased inclusion of exon 5 in Mbnl2 knockouts during both periods.

86

Figure 3-6: Dysregulation of circadian splicing in Mbnl2 knockout mice. A) Venn diagram showing the number of misregulated genes between wild type and Mbnl2 knockout pineal gland. Note that genes showing circadian changes in wild type mice are not present in the knockouts and vice versa. Right panel shows the percentage of changes with positive or negative dI in the WT only, common and the KO only groups.

87

Figure 3-7: MBNL2 regulates the splicing of different genes during day and night. A) Venn diagram showing the number of genes mis-spliced between WT and knockout mice during day and night. Note the very small overlap between the two groups. B) Wiggle plots showing the differential regulation of splicing of Cyb5r4 exon 12 by MBNL2.

88

Figure 3-8: Validation of altered splicing in Mbnl2 knockout mice using semi-quantitative radioactive PCR. Rbm34 and Kif1b are examples of changes between Day WT and KO, while Ubn and Numb show differences between Night WT and KO and also between Day WT and Night WT. Sgip1 is an example of how loss of Mbnl2 affects both Day KO and Night KO.

89

Figure 3-9: Biological processes regulated by MBNL2 through splicing are different between day and night. Gene ontology analysis using DAVID of genes showing alternative splicing changes between WT and Mbnl2-/- mice in day (top panel) and night (bottom).

90

Table 3-1. List of primers used for alternative splicing and expression analysis Primer Name Primer sequence

Rbm44 Forward CCGTCCAGGAAGCAAGTGAAGACTG

Rbm44 Reverse ACGTGTATCAAAAAGCCCTGACCTTTTC

Cngb3 Forward CTTCCCAGAAGCATAGACTCCTACACAG

Cngb3 Reverse GCATGGAAAGACGAGGCGCACT

Mbnl2 Forward GCGATGCTTGCCCAGCAGATG

Mbnl2 Reverse GAGAAGTTTCTGAGTTGCAGTTGAGCC

AANAT Forward TGAGCGGGAAGCCTTTATCTC

AANAT Reverse CTCCTGAGTAAGTCTCTCCTTGTCC

Dbp Forward CTCAACCAATCATGAAGAAGGC

Dbp Reverse GGCTGCTTCATTGTTCTTGTAC

Kif1b Forward CATCATCTCTGCTAAGTCCCTGAAGGC

Kif1b Reverse CAGAAGGAGGGAGTTATGTAGGGAGCTG

Ubn Forward TAAGGATGCCATTGTCACAGGTCCAG

Ubn Reverse GTCATTCAGTTCCATCCTCCAAAGTGG

Numb Forward TCTCCTCCGCCCCAATGACC

Numb Reverse GGAAGAGACCTGGAGAGGCAGCA

Sgip1 Forward CCACCTCTGCCTCCAAAAACTGTACC

Sgip1 Reverse CGGAGTGGTGCTGCAAGGAACTAAG

Rbm34 Forward GAGAGGACTGTGTTTGTTGGCAATTTG

Rbm34 Reverse TGCAGCCAACTTCTTGGTTAGTGTCC

91

CHAPTER 4 CONCLUSION AND FUTURE DIRECTIONS

Microsatellite expansions in non-coding regions are the causal factors of ~10

dominantly inherited neurological and/or neuromuscular diseases and more diseases

are being discovered (Du et al., 2015). Multiple pathogenic mechanisms, such as RNA

dominance, haploinsufficiency and RAN translation have been proposed and different

model systems have been developed to validate or reject these hypotheses. Their exact

contributions to the pathogenecity are yet to be elucidated, but the consensus in the

field is there is a complex interplay between different pathogenic mechanisms. We are

interested in understanding the direct as well as downstream effects of repeat

expansion RNA expression in two phenotypically different yet mechanistically similar

non-coding expansion diseases, C9 ALS/FTD and DM1, using in vitro biochemical

approaches and high-throughput techniques.

First, we have identified hnRNP H as a factor that interacts with the GGGGCCexp

RNA in vitro showing repeat length dependence and specificity. But our studies in

patient autopsy tissues using imaging techniques and global binding analysis shows a

lack of binding in situ contradicting previously published results exploring the interaction

of hnRNP H with GGGGCCexp RNA. Detailed analysis using more patient samples and

complementary techniques, such as interactome capture of the GGGGCCexp RNA and

bound protein is required to assess sequestration and subsequent loss of function of

hnRNP H in C9 ALS/FTD. Misregulation of the endogenous targets of hnRNP H must

also be tested in patient tissues and animal models expressing GGGGCC expanded

repeats. But since the nuclear transport and additional pathways are affected in

ALS/FTD, it will have a global impact on the overall regulation imposed on the RNAs by

92

the RNA binding proteins, confounding the results observed. Developing hnRNP H

knockout mouse models using CRISPR/Cas technology will be a better strategy to

visualize the contribution of hnRNP H loss to the C9 ALS/FTD phenotype. Additionally,

the binding of proteins to the GGGGCCexp RNA that are not non-crosslinkable by UV-

light cannot be discounted. Moreoever, GGGGCCexp RNA might base pair with another

RNA that sequesters proteins. Finally, the presence of abundant antisense CCCCGGexp

RNA foci in patient tissues introduces the importance of elucidating the binding partners

of these antisense RNAs and determining their relative contribution to disease.

Another goal of this study was to characterize one of the downstream effects of

MBNL protein sequestration in Mbnl2 knockout mice. We examined the circadian

transcriptomic changes and circadian splicing changes that accompany MBNL2 loss in

the pineal gland and identified the misregulation of genes, like Dbp and Ptgds, with

important roles in circadian and sleep regulation, respectively. Future studies will

involve validations in other tissues and identifying the downstream pathways affected.

Our studies suggest there could be increased nuclear localization of MBNL1, which

could result in functional compensation and lead to a diminution of the RNA processing

defects observed. It will be interesting to determine if there is a severe sleep phenotype

in Mbnl1; Mbnl2 DKO mice that are representative of the sleep disturbances seen in

DM. Analyzing these changes and characterizing the molecular changes in SCN, the

central pacemaker and controller of circadian rhythms, will be an important step in

identifying the pathogenic mechanisms behind the sleep abnormalities in DM.

93

CHAPTER 5 MATERIALS AND METHODS

Generation of GGGGCC Repeat Plasmids

The construction of pGGGGCC 4,33,60,120 (kind gift of Drs. Laura Ranum and Tao

Zu) and pCUG54, pTAR are described previously (Miller et al., 2000; Zu et al., 2013a).

The GGGGCC repeats are cloned between the NheI and XhoI restriction sites in

pcDNA3.1 under the T7 promoter.

In vitro Transcription and UV Crosslinking Assay

pGGGGCC 4,33,60,120 were linearized with XhoI, pCTG54 with BamHI and

transcribed in vitro in the presence of [α-32P] CTP using T7 RNA polymerase (USA

Scientific). pTAR was linearized with HindIII and transcribed using SP6 RNA

polymerase. After in vitro transcription, electrophoresis was performed using 6% or 10%

TBE-7M urea gels [Life technologies] and the products were gel purified. The

photocrosslinking assay was performed as described previously [Miller et al, 2000] with

minor modifications. Before the addition of 50 μg HeLa nuclear extract, GGGGCC

repeat RNA was denatured at 100°C for 5 min and placed immediately on dry ice. The

band intensities in Figure 2-3A (left panel) were quantified using a Typhoon 9200

imager and ImageQuant TL software (GE Healthcare) and plotted in Fig 2-3 B (right

panel).

Immunoprecipitation of Protein RNA Complexes

Immunoprecipitation of G4C2 RNA-protein complexes was performed using

Protein A/G dynabeads [Life technologies] as described previously (Timchenko et al.,

1996). The following antibodies were used for immunoprecipitation – anti-MBNL1

(A2764- gift of Dr. Charles Thornton), rabbit polyclonal NB100-385 (Novus) against

94

hnRNP H, anti hnRNP F (a gift of Dr. Douglas Black), G rich sequence factor (1G2

antibody- a gift of Dr. Jeffrey Wilusz), anti-TDP43, anti FUS (Proteintech), anti nucleolin

(Abcam) and 5 ug of the antibody was used for immunoprecipitation of crosslinked

RNA-protein complexes. After incubation for 2 hr at 4C, beads were washed 3X with

RIPA buffer and the eluted products were electrophoresed in 10% Tris-HCl Criterion

gels (Biorad).

Competition Assay

To identify the binding affinity, 1500 molar excess of unlabeled TAR and G4C260

RNA was mixed with radiolabeled G4C260 RNA and incubated with HeLa nuclear

extracts

Combined RNA FISH and Immunoflourescence

HeLa JW86 cells (5 X104) were seeded on 4-well slide chambers overnight and

500 ng of G4C24 and G4C2120 plasmids were transfected using Fugene HD reagent.

The cells were harvested after 48 hr and the slides were processed for combined RNA

fluorescent in situ hybridization (RNA-FISH) and immunoflourescence. For RNA-FISH,

cells were fixed with 10% buffered formalin for 8 min at RT, dehydrated with 70%

ethanol for 90 min at 4C, rehydrated with 40% formamide in 2X SSC buffer and

hybridization was performed using 400 ng/mL of Cy3 labeled complementary C4G2

probe resuspended in hybridization buffer (40% formamide, 2× SSC, 20 μg/mL BSA,

100 mg/mL dextran sulfate, and 10 μg/mL yeast tRNA, 2 mM Vanadyl Sulfate

Ribonucleosides) at 37C for 3 hr followed by three washes at 45C using 40%

formamide in 2X SSC buffer. For immunoflourescence, the cells were permeabilized

with 0.15% Triton-X 100 in 1X PBS for 15 min at RT followed by brief washes using 1X

PBS. This is followed by incubation with primary antibody in blocking buffer at 4C

95

overnight and finally incubation with goat anti-rabbit and goat anti-mouse secondary

antibodies conjugated with Alexa Fluor 488 at a dilution of 1:500. The slides were then

mounted with Vectashield DAPI for nuclei staining. For human brain autopsy samples, 5

m frozen sections were collected and fixed using 4% PFA for 10 min at RT and RNA

FISH/immunoflourescence was performed as described above.

Confocal Microscopy

The slides were observed using Leica confocal microscope under 63X

magnification and 20 z-stacks with 0.2 m between stacks. For HeLa cells, ~100 cells

were counted in three separate transfection experiments. For the patient sections, two

C9 positive patients and two C9 controls and ~50 cells were counted.

Antibodies

For immunoprecipitation and immunoflourescence experiments, the following

antibodies were used. MBNL1- A2764 (gift of Dr.Charles Thornton), hnRNP H- NB100-

385 (Novus), hnRNP F –gift of Dr.Douglas Black, GRSF- gift of Dr.Jeff Wilusz,

Nucleolin- Ab13541 (Abcam), Pur α- Ab125200 (Abcam), TDP43- MCA-3H8 (Encor

Biotechnology), Fus- 11570-1 (Proteintech), hnRNPA2B1-DP3B3 (Santa Cruz), Lamin

A – H102 (Santa Cruz), LDHA –Cell signaling technology

Mouse Housing for Circadian Studies

Mbnl2+/+ and Mbnl2−/− mice (male, 3-5 months of age) were transferred to a

specially designed room and kept in a 12L: 12 D light cycle for 2 weeks for

acclimatization with food and water ad libitum. To collect tissue, animals were

euthanized with CO2 and decapitated at ZT (zeitgeber time) 7 or ZT19. The skull cap

was removed carefully, not to alter the position of the superficial pineal gland, and the

pineal gland was dissected looking through a microscope. The gland was then located

96

on the skull, removed and cleaned of extraneous tissue and blood in PBS. At ZT 19,

dim red light of 630 nm was used and no white light leakage was allowed.

RNA Extraction

After dissection of the pineal gland (PG), PGs were immediately placed in TRI

reagent (Invitrogen) and frozen in dry ice and placed at -80C until ready for extraction.

For isolating total RNA for RNA-seq analysis, the frozen gland in TRI reagent was

crushed using plastic pestle (USA Scientific) and chloroform extraction was performed,

followed by precipitation using isopropanol. The RNA pellet was washed with 70%

ethanol in DEPC water and after air-drying it was dissolved in 10 L of DEPC water.

RNA quantification was performed using both Nanodrop and Quant-iT™ RNA Assay

Kits (Thermo Fisher).

RNA-Seq Library Preparation

Total RNA obtained from 2 mice (same age) were pooled for 1 biological

replicate. Three biological replicates were prepared for each genotype and each time

point (ZT7 and ZT19). RNA integrity numbers were measured using a Bioanalyzer.

Samples with RIN >7 were used for further analysis and 125 ng total RNA served as the

template for making non-stranded, mRNA libraries at New York Genome Centre

(NYGC). The libraries were sequenced using Illumina Hiseq2500 generating paired

reads of 125 bp. The total reads and the distribution of the reads are tabled in Appendix

A.

RNA-Seq Analysis

RNA-seq analysis was performed using the Olego program (Wu et al., 2013) as

described (Charizanis et.al, 2012). Briefly, reads obtained from sequencing were

aligned using the Olego aligner employing Burroughs Wheeler transformation to the

97

mouse reference genome (mm10). After counting the number of exons and exon

junction fragments uniquely supporting the inclusion and exclusion of the cassette exon,

additional filtering criteria were applied for a stringent analysis. Pairwise comparison of

the groups was carried out by Fisher’s exact t-test followed by Benjamini multiple testing

to estimate the false discovery rate (FDR). Furthermore, differential inclusion/skipping

was calculated based on the exon junction reads. Splicing events with an FDR <0.05

and |ΔI| >0.15 were considered for gene ontology analysis and further testing.

Differential Expression Analysis

Differential gene expression analysis between Mbnl2+/+ and Mbnl2-/- in pineal

gland during different circadian times was performed using the statistical programming

language R. The analysis was performed using R Bioconductor package edgeR (Ritchie

et al., 2015)in which a negative binomial model was fitted followed by estimation of

common dispersion. Pairwise comparison was performed between each group resulting

in 4 different comparisons. P values were calculated using the Fishers exact test and

these values were further corrected using Benjamini method to calculate the FDR,

which were then used to filter out the significantly differentially expressed genes.

Gene Ontology Analysis

For each of the groups, functional annotation of the genes based on biological

processes was carried out using Gene Ontology (GO) analysis available in DAVID

(Database for Annotation, Visualization and Integrated Discovery) v6.7, a web based

tool.

Real Time qRT-PCR

To assess the differential expression changes, quantitative RT-PCR was

performed. cDNA was prepared from 500 ng of total RNA and used as the template for

98

real time analysis using the iQSYBR mix. Melting curve analysis was performed to

assess the specificity of the primers. For measuring the relative mRNA levels, the cycle

threshold values (Ct) were subjected to ΔΔCt method, with Gapdh acting as the

reference gene. Three biological replicates were used and Fishers unpaired t-test was

performed and the error bars represent mean +/- SEM.

Semi-Quantitative Splicing PCR Analysis

Validations of splicing changes were performed using semi-quantitative PCR

analysis. cDNA prepared from 500 ng RNA was subjected to PCR analysis in the

presence of 250 Ci α-32P dCTP to label PCR products and the amplicons were run on

5% TBE polyacrylamide gels and after electrophoresis, autoradiography was carried

out.

99

APPENDIX A RNA SEQ READS OF CIRCADIAN STUDY AND THEIR DISTRIBUTION ACROSS

GENOME

100

APPENDIX B DIFFERENTIAL EXPRESSION DATA OF TOP 80 GENES BETWEEN DAY AND

NIGHT IN WT

101

102

APPENDIX C DIFFERENTIAL EXPRESSION DATA OF TOP 80 GENES BETWEEN DAY AND

NIGHT IN KO

103

104

APPENDIX D DIFFERENTIAL EXPRESSION DATA OF TOP 40 GENES BETWEEN WT AND

MBNL2 KO DURING DAY

105

APPENDIX E DIFFERENTIAL EXPRESSION DATA OF TOP 40 GENES BETWEEN WT AND

MBNL2 KO DURING NIGHT

106

APPENDIX F CIRCADIAN ALTERNATIVE SPLICING- TOP 80 GENES SHOWING CHANGES

BETWEEN DAY AND NIGHT IN WT

107

108

APPENDIX G CIRCADIAN ALTERNATIVE SPLICING -TOP 80 GENES SHOWING CHANGES

BETWEEN DAY AND NIGHT IN MBNL2 KNOCKOUT MICE

109

110

APPENDIX H TOP 40 GENES SHOWING CASSETTE EXON CHANGES BETWEEN WT AND

MBNL2 KO DURING DAY

111

APPENDIX I TOP 40 GENES SHOWING CASSETTE EXON CHANGES BETWEEN WT AND

MBNL2 KO DURING NIGHT

112

LIST OF REFERENCES

Abe, M., Herzog, E.D., Yamazaki, S., Straume, M., Tei, H., Sakaki, Y., Menaker, M., and Block, G.D. (2002). Circadian rhythms in isolated brain regions. J.Neurosci 22, 350-356. Almeida, S., Gascon, E., Tran, H., Chou, H.J., Gendron, T.F., Degroot, S., Tapper, A.R., Sellier, C., Charlet-Berguerand, N., Karydas, A., et al. (2013). Modeling key pathological features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human neurons. Acta Neuropathol 126, 385-399. Ash, P.E., Bieniek, K.F., Gendron, T.F., Caulfield, T., Lin, W.L., Dejesus-Hernandez, M., van Blitterswijk, M.M., Jansen-West, K., Paul, J.W., 3rd, Rademakers, R., et al. (2013). Unconventional translation of C9ORF72 GGGGCC expansion generates insoluble polypeptides specific to c9FTD/ALS. Neuron 77, 639-646. Baggs, J.E., and Green, C.B. (2003). Nocturnin, a deadenylase in Xenopus laevis retina: A mechanism for posttranscriptional control of circadian-related mRNA. Curr Biol 13, 189-198. Bailey, M.J., Coon, S.L., Carter, D.A., Humphries, A., Kim, J.S., Shi, Q., Gaildrat, P., Morin, F., Ganguly, S., Hogenesch, J.B., et al. (2009). Night/Day Changes in Pineal Expression of > 600 Genes CENTRAL ROLE OF ADRENERGIC/cAMP SIGNALING. J.biol.chem284, 7606-7622. Barcelo, A., de la Pena, M., Barbe, F., Pierola, J., Bosch, M., and Agusti, A.G.N. (2007). Prostaglandin D synthase (beta trace) levels in sleep apnea patients with and without sleepiness. Sleep Med 8, 509-511. Bassetti, C.L., Hersberger, M., and Baumann, C.R. (2006). CSF prostaglandin D synthase is reduced in excessive daytime sleepiness. J.neurol 253, 1030-1033. Batra, R., Charizanis, K., and Swanson, M.S. (2010). Partners in crime: bidirectional transcription in unstable microsatellite disease. Hum.Mol.Genet 19, R77-82. Bell-Pedersen, D., Cassone, V.M., Earnest, D.J., Golden, S.S., Hardin, P.E., Thomas, T.L., and Zoran, M.J. (2005). Circadian rhythms from multiple oscillators: Lessons from diverse organisms. Nat.Rev.Genet 6, 544-556. Belzil, V.V., Bauer, P.O., Prudencio, M., Gendron, T.F., Stetler, C.T., Yan, I.K., Pregent, L., Daughrity, L., Baker, M.C., Rademakers, R., et al. (2013a). Reduced C9orf72 gene expression in c9FTD/ALS is caused by histone trimethylation, an epigenetic event detectable in blood. Acta Neuropathol 126, 895-905.

113

Benarroch, E.E. (2008). Suprachiasmatic nucleus and melatonin - Reciprocal interactions and clinical correlations. Neurology 71, 594-598. Budworth, H., and McMurray, C.T. (2013). Bidirectional transcription of trinucleotide repeats: roles for excision repair. DNA repair 12, 672-684. Bugaut, A., and Balasubramanian, S. (2012). 5'-UTR RNA G-quadruplexes: translation regulation and targeting. Nucleic Acids Res 40, 4727-4741. Bustos, D.M., Bailey, M.J., Sugden, D., Carter, D.A., Rath, M.F., Moller, M., Coon, S.L., Weller, J.L., and Klein, D.C. (2011). Global daily dynamics of the pineal transcriptome. Cell Tissue Res 344, 1-11. Caillet-Boudin, M.L., Fernandez-Gomez, F.J., Tran, H., Dhaenens, C.M., Buee, L., and Sergeant, N. (2014). Brain pathology in myotonic dystrophy: when tauopathy meets spliceopathy and RNAopathy.Front.Mol.Neurosci 6, 57. Cao, R.F., Gkogkas, C.G., de Zavalia, N., Blum, I.D., Yanagiya, A., Tsukumo, Y., Xu, H.Y., Lee, C., Storch, K.F., Liu, A.C., et al. (2015). Light-regulated translational control of circadian behavior by eIF4E phosphorylation. Nature neuroscience 18, 855-U287. Capell, B.C., and Collins, F.S. (2006). Human laminopathies: nuclei gone genetically awry. Nat.Rev.Genet 7, 940-952. Castel, A.L., Nakamori, M., Tome, S., Chitayat, D., Gourdon, G., Thornton, C.A., and Pearson, C.E. (2011). Expanded CTG repeat demarcates a boundary for abnormal CpG methylation in myotonic dystrophy patient tissues. Hum.Mol.Genet 20, 1-15. Chamberlain, C.M., and Ranum, L.P. (2012). Mouse model of muscleblind-like 1 overexpression: skeletal muscle effects and therapeutic promise. Hum.Mol.Genet 21, 4645-4654. Charizanis, K., Lee, K.Y., Batra, R., Goodwin, M., Zhang, C., Yuan, Y., Shiue, L., Cline, M., Scotti, M.M., Xia, G., et al. (2012). Muscleblind-like 2-mediated alternative splicing in the developing brain and dysregulation in myotonic dystrophy. Neuron 75, 437-450. Chemelli, R.M., Willie, J.T., Sinton, C.M., Elmquist, J.K., Scammell, T., Lee, C., Richardson, J.A., Williams, S.C., Xiong, Y.M., Kisanuki, Y., et al. (1999). Narcolepsy in orexin knockout mice: Molecular genetics of sleep regulation. Cell 98, 437-451. Cheng, H.Y.M., Papp, J.W., Varlamova, O., Dziema, H., Russell, B., Curfman, J.P., Nakazawa, T., Shimizu, K., Okamura, H., Impey, S., et al. (2007). microRNA modulation of circadian-clock period and entrainment. Neuron 54, 813-829. Ciura, S., Lattante, S., Le Ber, I., Latouche, M., Tostivint, H., Brice, A., and Kabashi, E. (2013). Loss of function of C9orf72 causes motor deficits in a zebrafish model of Amyotrophic Lateral Sclerosis. Ann Neurol 74, 180-187.

114

Cleary, J.D., Nichol, K., Wang, Y.H., and Pearson, C.E. (2002). Evidence of cis-acting factors in replication-mediated trinucleotide repeat instability in primate cells. Nature Genet31, 37-46. Colot, H.V., Loros, J.J., and Dunlap, J.C. (2005). Temperature-modulated alternative splicing and promoter use in the circadian clock gene frequency. Mol Biol Cell 16, 5563-5571. Coomans, C.P., Ramkisoensing, A., and Meijer, J.H. (2015). The suprachiasmatic nuclei as a seasonal clock. Front Neuroendocrin 37, 29-42. Coon, S.L., Munson, P.J., Cherukuri, P.F., Sugden, D., Rath, M.F., Moller, M., Clokie, S.J.H., Fu, C., Olanich, M.E., Rangel, Z., et al. (2012). Circadian changes in long noncoding RNAs in the pineal gland.Proc.Natl.Acad.Sci USA109, 13319-13324. Cooper-Knock, J., Walsh, M.J., Higginbottom, A., Robin Highley, J., Dickman, M.J., Edbauer, D., Ince, P.G., Wharton, S.B., Wilson, S.A., Kirby, J.,et al. Brain (2014). Sequestration of multiple RNA recognition motif-containing proteins by C9orf72 repeat expansions. Brain : a journal of neurology 137, 2040-2051. Dauvilliers, Y.A., and Laberge, L. (2012). Myotonic dystrophy type 1, daytime sleepiness and REM sleep dysregulation. Sleep Med Rev 16, 539-545. DeJesus-Hernandez, M., Mackenzie, I.R., Boeve, B.F., Boxer, A.L., Baker, M., Rutherford, N.J., Nicholson, A.M., Finch, N.A., Flynn, H., Adamson, J., et al. (2011). Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS. Neuron 72, 245-256. Diernfellner, A., Colot, H.V., Dintsis, O., Loros, J.J., Dunlap, J.C., and Brunner, M. (2007). Long and short isoforms of Neurospora clock protein FRQ support temperature-compensated circadian rhythms. Febs Lett 581, 5759-5764. Dion, V., and Wilson, J.H. (2009). Instability and chromatin structure of expanded trinucleotide repeats. Trends in genetics : TIG 25, 288-297. Donnelly, C.J., Zhang, P.W., Pham, J.T., Heusler, A.R., Mistry, N.A., Vidensky, S., Daley, E.L., Poth, E.M., Hoover, B., Fines, D.M., et al. (2013). RNA Toxicity from the ALS/FTD C9ORF72 Expansion Is Mitigated by Antisense Intervention. Neuron 80, 415-428. Du, J.T., Aleff, R.A., Soragni, E., Kalari, K., Nie, J.F., Tang, X.J., Davila, J., Kocher, J.P., Patel, S.V., Gottesfeld, J.M., et al. (2015). RNA Toxicity and Missplicing in the Common Eye Disease Fuchs Endothelial Corneal Dystrophy. J.biol.chem290, 5979-5990.

115

Echeverria, G.V., and Cooper, T.A. (2012). RNA-binding proteins in microsatellite expansion disorders: mediators of RNA toxicity. Brain Res 1462, 100-111. Fernandez-Costa, J.M., Garcia-Lopez, A., Zuniga, S., Fernandez-Pedrosa, V., Felipo-Benavent, A., Mata, M., Jaka, O., Aiastui, A., Hernandez-Torres, F., Aguado, B., et al. (2013). Expanded CTG repeats trigger miRNA alterations in Drosophila that are conserved in myotonic dystrophy type 1 patients. Hum.Mol.Genet 22, 704-716. Franken, P., Lopez-Molina, L., Marcacci, L., Schibler, U., and Tafti, M. (2000). The transcription factor DBP affects circadian sleep consolidation and rhythmic EEG activity. J.Neurosci 20, 617-625. Fratta, P., Mizielinska, S., Nicoll, A.J., Zloh, M., Fisher, E.M.C., Parkinson, G., and Isaacs, A.M. (2012). C9orf72 hexanucleotide repeat associated with amyotrophic lateral sclerosis and frontotemporal dementia forms RNA G-quadruplexes. Scientific Reports . Freibaum, B.D., Lu, Y., Lopez-Gonzalez, R., Kim, N.C., Almeida, S., Lee, K.H., Badders, N., Valentine, M., Miller, B.L., Wong, P.C., et al. (2015). GGGGCC repeat expansion in C9orf72 compromises nucleocytoplasmic transport. Nature 525, 129-133. Fu, L.N., and Lee, C.C. (2003). The circadian clock: Pacemaker and tumour suppressor. Nat Rev Cancer 3, 350-361. Gandhi, A.V., Mosser, E.A., Oikonomou, G., and Prober, D.A. (2015). Melatonin Is Required for the Circadian Regulation of Sleep. Neuron 85, 1193-1199. Gates, D.P., Coonrod, L.A., and Berglund, J.A. (2011). Autoregulated splicing of muscleblind-like 1 (MBNL1) Pre-mRNA. J.biol.chem286, 34224-34233. Gatfield, D., Le Martelot, G., Vejnar, C.E., Gerlach, D., Schaad, O., Fleury-Olela, F., Ruskeepaa, A.L., Oresic, M., Esau, C.C., Zdobnov, E.M., et al. (2009). Integration of microRNA miR-122 in hepatic circadian gene expression. Gene Dev 23, 1313-1326. Gendron, T.F., Belzil, V.V., Zhang, Y.J., and Petrucelli, L. (2014). Mechanisms of toxicity in C9FTLD/ALS. Acta Neuropathol. Gendron, T.F., Bieniek, K.F., Zhang, Y.J., Jansen-West, K., Ash, P.E., Caulfield, T., Daughrity, L., Dunmore, J.H., Castanedes-Casey, M., Chew, J., et al. (2013). Antisense transcripts of the expanded C9ORF72 hexanucleotide repeat form nuclear RNA foci and undergo repeat-associated non-ATG translation in c9FTD/ALS. Acta Neuropathol 126, 829-844. Gomes-Pereira, M., Cooper, T.A., and Gourdon, G. (2011). Myotonic dystrophy mouse models: towards rational therapy development. Trends. Mol. Med 17, 506-517.

116

Gomes-Pereira, M., Foiry, L., Nicole, A., Huguet, A., Junien, C., Munnich, A., and Gourdon, G. (2007). CTG trinucleotide repeat "big jumps": large expansions, small mice. PLoS genetics 3, e52. Gonitel, R., Moffitt, H., Sathasivam, K., Woodman, B., Detloff, P.J., Faull, R.L., and Bates, G.P. (2008). DNA instability in postmitotic neurons.Proc.Natl.Acad.Sci USA105, 3467-3472. Goodwin, M., Mohan, A., Batra, R., Lee, K.Y., Charizanis, K., Gomez, F.J., Eddarkaoui, S., Sergeant, N., Buee, L., Kimura, T., et al. (2015). MBNL Sequestration by Toxic RNAs and RNA Misprocessing in the Myotonic Dystrophy Brain. Cell Rep12, 1159-1168. Goto, M., Oshima, I., Tomita, T., and Ebihara, S. (1989). Melatonin Content of the Pineal-Gland in Different Mouse Strains. J Pineal Res 7, 195-204. Greco, C.M., Hagerman, R.J., Tassone, F., Chudley, A.E., Del Bigio, M.R., Jacquemont, S., Leehey, M., and Hagerman, P.J. (2002). Neuronal intranuclear inclusions in a new cerebellar tremor/ataxia syndrome among fragile X carriers. Brain : a journal of neurology 125, 1760-1771. Haeusler, A.R., Donnelly, C.J., Periz, G., Simko, E.A.J., Shaw, P.G., Kim, M.S., Maragakis, N.J., Troncoso, J.C., Pandey, A., Sattler, R., et al. (2014). C9orf72 nucleotide repeat structures initiate molecular cascades of disease. Nature 507, 195-+. Hagerman, P. (2013). Fragile X-associated tremor/ataxia syndrome (FXTAS): pathology and mechanisms. Acta Neuropathol 126, 1-19. Hagerman, R., and Hagerman, P. (2013). Advances in clinical and molecular understanding of the FMR1 premutation and fragile X-associated tremor/ataxia syndrome.Lancet Neurol12, 786-798. Hamshere, M.G., Newman, E.E., Alwazzan, M., Athwal, B.S., and Brook, J.D. (1997). Transcriptional abnormality in myotonic dystrophy affects DMPK but not neighboring genes.Proc.Natl.Acad.Sci USA 94, 7394-7399. Han, H., Irimia, M., Ross, P.J., Sung, H.K., Alipanahi, B., David, L., Golipour, A., Gabut, M., Michael, I.P., Nachman, E.N., et al. (2013). MBNL proteins repress ES-cell-specific alternative splicing and reprogramming. Nature 498, 241. Hangauer, M.J., Vaughn, I.W., and McManus, M.T. (2013). Pervasive transcription of the human genome produces thousands of previously unidentified long intergenic noncoding RNAs. PLoS genetics 9, e1003569. Hernandez-Hernandez, O., Guiraud-Dogan, C., Sicot, G., Huguet, A., Luilier, S., Steidl, E., Saenger, S., Marciniak, E., Obriot, H., Chevarin, C., et al. (2013). Myotonic

117

dystrophy CTG expansion affects synaptic vesicle proteins, neurotransmission and mouse behaviour. Brain : a journal of neurology 136, 957-970. Huguet, A., Medja, F., Nicole, A., Vignaud, A., Guiraud-Dogan, C., Ferry, A., Decostre, V., Hogrel, J.Y., Metzger, F., Hoeflich, A., et al. (2012). Molecular, physiological, and motor performance defects in DMSXL mice carrying >1,000 CTG repeats from the human DM1 locus. PLoS genetics 8, e1003043. Jansen, G., Groenen, P.J., Bachner, D., Jap, P.H., Coerwinkel, M., Oerlemans, F., van den Broek, W., Gohlsch, B., Pette, D., Plomp, J.J., et al. (1996). Abnormal myotonic dystrophy protein kinase levels produce only mild myopathy in mice. Nature Genet13, 316-324. Jin, P., Zarnescu, D.C., Zhang, F., Pearson, C.E., Lucchesi, J.C., Moses, K., and Warren, S.T. (2003). RNA-Mediated Neurodegeneration Caused by the Fragile X Premutation rCGG Repeats in Drosophila. Neuron 39, 739-747. Kalsotra, A., Singh, R.K., Gurha, P., Ward, A.J., Creighton, C.J., and Cooper, T.A. (2014a). The Mef2 Transcription Network Is Disrupted in Myotonic Dystrophy Heart Tissue, Dramatically Altering miRNA and mRNA Expression. Cell Rep 6, 336-345. Kalsotra, A., Singh, R.K., Gurha, P., Ward, A.J., Creighton, C.J., and Cooper, T.A. (2014b). The Mef2 Transcription Network Is Disrupted in Myotonic Dystrophy Heart Tissue, Dramatically Altering miRNA and mRNA Expression. Cell Rep6, 336-345. Kanadia, R.N., Johnstone, K.A., Mankodi, A., Lungu, C., Thornton, C.A., Esson, D., Timmers, A.M., Hauswirth, W.W., and Swanson, M.S. (2003). A muscleblind knockout model for myotonic dystrophy. Science 302, 1978-1980. Kanadia, R.N., Shin, J., Yuan, Y., Beattie, S.G., Wheeler, T.M., Thornton, C.A., and Swanson, M.S. (2006). Reversal of RNA missplicing and myotonia after muscleblind overexpression in a mouse poly(CUG) model for myotonic dystrophy.Proc.Natl.Acad.Sci USA103, 11748-11753. Kantartzis, A., Williams, G.M., Balakrishnan, L., Roberts, R.L., Surtees, J.A., and Bambara, R.A. (2012). Msh2-Msh3 interferes with Okazaki fragment processing to promote trinucleotide repeat expansions. Cell Rep2, 216-222. Katz, Y., Wang, E.T., Airoldi, E.M., and Burge, C.B. (2010). Analysis and design of RNA sequencing experiments for identifying isoform regulation. Nature methods 7, 1009-U1101. Kaushik, M.K., Aritake, K., Kamauchi, S., Hayaishi, O., Huang, Z.L., Lazarus, M., and Urade, Y. (2014). Prostaglandin D(2) is crucial for seizure suppression and postictal sleep. Experimental neurology 253, 82-90.

118

Keene, J.D. (2007). RNA regulons: coordination of post-transcriptional events. Nat.Rev.Genet 8, 533-543. Kennedy, L., Evans, E., Chen, C.M., Craven, L., Detloff, P.J., Ennis, M., and Shelbourne, P.F. (2003). Dramatic tissue-specific mutation length increases are an early molecular event in Huntington disease pathogenesis. Hum.Mol.Genet 12, 3359-3367. Kiliszek, A., Kierzek, R., Krzyzosiak, W.J., and Rypniewski, W. (2010). Atomic resolution structure of CAG RNA repeats: structural insights and implications for the trinucleotide repeat expansion diseases. Nucleic Acids Res 38, 8370-8376. Kiliszek, A., Kierzek, R., Krzyzosiak, W.J., and Rypniewski, W. (2011). Crystal structures of CGG RNA repeats with implications for fragile X-associated tremor ataxia syndrome. Nucleic Acids Res 39, 7308-7315. Kim, J.S., Coon, S.L., Weller, J.L., Blackshaw, S., Rath, M.F., Moller, M., and Klein, D.C. (2009). Muscleblind-like 2: circadian expression in the mammalian pineal gland is controlled by an adrenergic-cAMP mechanism. J.Neurochem 110, 756-764. Ko, C.H., and Takahashi, J.S. (2006). Molecular components of the mammalian circadian clock. Hum.Mol.Genet 15, R271-R277. Koike, N., Yoo, S.H., Huang, H.C., Kumar, V., Lee, C., Kim, T.K., and Takahashi, J.S. (2012). Transcriptional Architecture and Chromatin Landscape of the Core Circadian Clock in Mammals. Science 338, 349-354. Kojima, S., and Green, C.B. (2015). Circadian Genomics Reveal a Role for Post-transcriptional Regulation in Mammals. Biochemistry 54, 124-133. Kojima, S., Shingle, D.L., and Green, C.B. (2011). Post-transcriptional control of circadian rhythms. J Cell Sci 124, 311-320. Koppers, M., Blokhuis, A.M., Westeneng, H.J., Terpstra, M.L., Zundel, C.A., Vieira de Sa, R., Schellevis, R.D., Waite, A.J., Blake, D.J., Veldink, J.H., et al. (2015). C9orf72 ablation in mice does not cause motor neuron degeneration or motor deficits. Annals of neurology. Krzyzosiak, W.J., Sobczak, K., Wojciechowska, M., Fiszer, A., Mykowska, A., and Kozlowski, P. (2012). Triplet repeat RNA structure and its role as pathogenic agent and therapeutic target. Nucleic Acids Res 40, 11-26. Kuyumcu-Martinez, N.M., Wang, G.S., and Cooper, T.A. (2007). Increased steady-state levels of CUGBP1 in myotonic dystrophy 1 are due to PKC-mediated hyperphosphorylation. Mol Cell 28, 68-78.

119

Kwon, I., Xiang, S.H., Kato, M., Wu, L., Theodoropoulos, P., Wang, T., Kim, J., Yun, J., Xie, Y., and McKnight, S.L. (2014). Poly-dipeptides encoded by the C9orf72 repeats bind nucleoli, impede RNA biogenesis, and kill cells. Science 345, 1139-1145. La Spada, A.R., and Taylor, J.P. (2010). Repeat expansion disease: progress and puzzles in disease pathogenesis. Nat.Rev.Genet 11, 247-258. Lagier-Tourenne, C., Baughn, M., Rigo, F., Sun, S.Y., Liu, P., Li, H.R., Jiang, J., Watt, A.T., Chun, S., Katz, M., et al. (2013). Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration. Proc.Natl.Acad.Sci USA 110, E4530-E4539. Lee, H., Chen, R.M., Lee, Y., Yoo, S., and Lee, C. (2009). Essential roles of CKI delta and CKI epsilon in the mammalian circadian clock.Proc.Natl.Acad.Sci USA 106, 21359-21364. Lee, K.Y., Li, M., Manchanda, M., Batra, R., Charizanis, K., Mohan, A., Warren, S.A., Chamberlain, C.M., Finn, D., Hong, H., et al. (2013a). Compound loss of muscleblind-like function in myotonic dystrophy. EMBO molecular medicine 5, 1887-1900. Lee, Y.B., Chen, H.J., Peres, J.N., Gomez-Deza, J., Attig, J., Stalekar, M., Troakes, C., Nishimura, A.L., Scotter, E.L., Vance, C., et al. (2013b). Hexanucleotide repeats in ALS/FTD form length-dependent RNA foci, sequester RNA binding proteins, and are neurotoxic. Cell Rep5, 1178-1186. Levine, T.P., Daniels, R.D., Gatta, A.T., Wong, L.H., and Hayes, M.J. (2013). The product of C9orf72, a gene strongly implicated in neurodegeneration, is structurally related to DENN Rab-GEFs. Bioinformatics 29, 499-503. Libby, R.T., Hagerman, K.A., Pineda, V.V., Lau, R., Cho, D.H., Baccam, S.L., Axford, M.M., Cleary, J.D., Moore, J.M., Sopher, B.L., et al. (2008). CTCF cis-regulates trinucleotide repeat instability in an epigenetic manner: a novel basis for mutational hot spot determination. PLoS genetics 4, e1000257. Lim, C., and Allada, R. (2013). Emerging roles for post-transcriptional regulation in circadian clocks. Nature neuroscience 16, 1544-1550. Lin, Y., Dion, V., and Wilson, J.H. (2006). Transcription promotes contraction of CAG repeat tracts in human cells.Nat.Struct.Mol.Biol 13, 179-180. Lin, Y., and Wilson, J.H. (2011). Transcription-induced DNA toxicity at trinucleotide repeats: Double bubble Is trouble. Cell Cycle 10, 611-618. Ling, S.C., Polymenidou, M., and Cleveland, D.W. (2013). Converging mechanisms in ALS and FTD: disrupted RNA and protein homeostasis. Neuron 79, 416-438.

120

Liquori, C.L., Ricker, K., Moseley, M.L., Jacobsen, J.F., Kress, W., Naylor, S.L., Day, J.W., and Ranum, L.P. (2001). Myotonic dystrophy type 2 caused by a CCTG expansion in intron 1 of ZNF9. Science 293, 864-867. Liu, E.Y., Russ, J., Wu, K., Neal, D., Suh, E., McNally, A.G., Irwin, D.J., Van Deerlin, V.M., and Lee, E.B. (2014). C9orf72 hypermethylation protects against repeat expansion-associated pathology in ALS/FTD. Acta Neuropathol 128, 525-541. Liu, G.H., Qu, J., Suzuki, K., Nivet, E., Li, M., Montserrat, N., Yi, F., Xu, X., Ruiz, S., Zhang, W., et al. (2012). Progressive degeneration of human neural stem cells caused by pathogenic LRRK2. Nature 491, 603-607. Liu, Y., Hu, W., Murakawa, Y., Yin, J., Wang, G., Landthaler, M., and Yan, J. (2013). Cold-induced RNA-binding proteins regulate circadian gene expression by controlling alternative polyadenylation. Scientific reports 3, 2054. Lokanga, R.A., Zhao, X.N., and Usdin, K. (2014). The mismatch repair protein MSH2 is rate limiting for repeat expansion in a fragile X premutation mouse model. Human mutation 35, 129-136. Lopez Castel, A., Cleary, J.D., and Pearson, C.E. (2010). Repeat instability as the basis for human diseases and as a potential target for therapy. Nature reviews Molecular cell biology 11, 165-170. Ludwig, A.L., Hershey, J.W., and Hagerman, P.J. (2011). Initiation of translation of the FMR1 mRNA Occurs predominantly through 5'-end-dependent ribosomal scanning. Journal of molecular biology 407, 21-34. Macchi, M.M., and Bruce, J.N. (2004). Human pineal physiology and functional significance of melatonin. Front Neuroendocrin 25, 177-195. Mahadevan, M.S. (2012). Myotonic dystrophy: is a narrow focus obscuring the rest of the field? Current opinion in neurology 25, 609-613. Mahadevan, M.S., Yadava, R.S., Yu, Q., Balijepalli, S., D Frenzel-McCardell, C., Bourne, T.D., and Phillips, L.H. (2006). Reversible model of RNA toxicity and cardiac conduction defects in myotonic dystrophy. Nature Genet38, 1066-1070. Mankodi, A., Logigian, E., Callahan, L., McClain, C., White, R., Henderson, D., Krym, M., and Thornton, C.A. (2000). Myotonic dystrophy in transgenic mice expressing an expanded CUG repeat. Science 289, 1769-1772. Margolis, J.M., Schoser, B.G., Moseley, M.L., Day, J.W., and Ranum, L.P. (2006). DM2 intronic expansions: evidence for CCUG accumulation without flanking sequence or effects on ZNF9 mRNA processing or protein expression. Hum.Mol.Genet 15, 1808-1815.

121

McIvor, E.I., Polak, U., and Napierala, M. (2010). New insights into repeat instability: role of RNA*DNA hybrids. RNA Biol 7, 551-558. Meloni, R., Albanese, V., Ravassard, P., Treilhou, F., and Mallet, J. (1998). A tetranucleotide polymorphic microsatellite, located in the first intron of the tyrosine hydroxylase gene, acts as a transcription regulatory element in vitro. Hum.Mol.Genet 7, 423-428. Miller, J.W., Urbinati, C.R., Teng-Umnuay, P., Stenberg, M.G., Byrne, B.J., Thornton, C.A., and Swanson, M.S. (2000). Recruitment of human muscleblind proteins to (CUG)(n) expansions associated with myotonic dystrophy. The EMBO journal 19, 4439-4448. Mirkin, S.M. (2007). Expandable DNA repeats and human disease. Nature 447, 932-940. Mizielinska, S., Lashley, T., Norona, F.E., Clayton, E.L., Ridler, C.E., Fratta, P., and Isaacs, A.M. (2013). C9orf72 frontotemporal lobar degeneration is characterised by frequent neuronal sense and antisense RNA foci. Acta Neuropathol 126, 845-857. Mohan, A., Goodwin, M., and Swanson, M.S. (2014). RNA-protein interactions in unstable microsatellite diseases. Brain Res 1584, 3-14. Mohawk, J.A., Green, C.B., and Takahashi, J.S. (2012). Central and Peripheral Circadian Clocks in Mammals. Annu Rev Neurosci 35, 445-462. Mooers, B.H., Logue, J.S., and Berglund, J.A. (2005). The structural basis of myotonic dystrophy from the crystal structure of CUG repeats.Proc.Natl.Acad.Sci USA 102, 16626-16631. Morf, J., Rey, G., Schneider, K., Stratmann, M., Fujita, J., Naef, F., and Schibler, U. (2012). Cold-inducible RNA-binding protein modulates circadian gene expression posttranscriptionally. Science 338, 379-383. Mori, K., Lammich, S., Mackenzie, I.R., Forne, I., Zilow, S., Kretzschmar, H., Edbauer, D., Janssens, J., Kleinberger, G., Cruts, M., et al. (2013a). hnRNP A3 binds to GGGGCC repeats and is a constituent of p62-positive/TDP43-negative inclusions in the hippocampus of patients with C9orf72 mutations. Acta Neuropathol 125, 413-423. Mori, K., Lammich, S., Mackenzie, I.R.A., Forne, I., Zilow, S., Kretzschmar, H., Edbauer, D., Janssens, J., Kleinberger, G., Cruts, M., et al. (2013b). hnRNP A3 binds to GGGGCC repeats and is a constituent of p62-positive/TDP43-negative inclusions in the hippocampus of patients with C9orf72 mutations. Acta Neuropathol 125, 413-423.

122

Mori, K., Weng, S.M., Arzberger, T., May, S., Rentzsch, K., Kremmer, E., Schmid, B., Kretzschmar, H.A., Cruts, M., Van Broeckhoven, C., et al. (2013c). The C9orf72 GGGGCC repeat is translated into aggregating dipeptide-repeat proteins in FTLD/ALS. Science 339, 1335-1338. Nakamori, M., Pearson, C.E., and Thornton, C.A. (2011). Bidirectional transcription stimulates expansion and contraction of expanded (CTG)*(CAG) repeats. Hum Mol Genet 20, 580-588. Nalavade, R., Griesche, N., Ryan, D.P., Hildebrand, S., and Krauss, S. (2013). Mechanisms of RNA-induced toxicity in CAG repeat disorders. Cell death & disease 4, e752. Nolte, C., and Staiger, D. (2015). RNA around the clock - regulation at the RNA level in biological timing. Front Plant Sci 6. O'Rourke, J.R., and Swanson, M.S. (2009). Mechanisms of RNA-mediated disease. The J.Biol.Chem 284, 7419-7423. Orengo, J.P., Chambon, P., Metzger, D., Mosier, D.R., Snipes, G.J., and Cooper, T.A. (2008). Expanded CTG repeats within the DMPK 3' UTR causes severe skeletal muscle wasting in an inducible mouse model for myotonic dystrophy.Proc.Natl.Acad.Sci USA 105, 2646-2651. Osborne, R.J., and Thornton, C.A. (2006). RNA-dominant diseases. Hum.Mol.Genet 15 R162-169. Pagani, F., Buratti, E., Stuani, C., Romano, M., Zuccato, E., Niksic, M., Giglio, L., Faraguna, D., and Baralle, F.E. (2000). Splicing factors induce cystic fibrosis transmembrane regulator exon 9 skipping through a nonevolutionary conserved intronic element. J.biol.chem275, 21041-21047. Pearson, C.E., Nichol Edamura, K., and Cleary, J.D. (2005). Repeat instability: mechanisms of dynamic mutations. Nat.Rev.Genet 6, 729-742. Pinto, R.M., Dragileva, E., Kirby, A., Lloret, A., Lopez, E., St Claire, J., Panigrahi, G.B., Hou, C., Holloway, K., Gillis, T., et al. (2013). Mismatch Repair Genes Mlh1 and Mlh3 Modify CAG Instability in Huntington's Disease Mice: Genome-Wide and Candidate Approaches. PLoS genetics 9, e1003930. Poulos, M.G., Batra, R., Charizanis, K., and Swanson, M.S. (2011). Developments in RNA splicing and disease. Cold Spring Harbor perspectives in biology 3, a000778. Punga, T., and Buhler, M. (2010). Long intronic GAA repeats causing Friedreich ataxia impede transcription elongation. EMBO molecular medicine 2, 120-129.

123

Querido, E., Gallardo, F., Beaudoin, M., Menard, C., and Chartrand, P. (2011). Stochastic and reversible aggregation of mRNA with expanded CUG-triplet repeats. Journal of Cell Science 124, 1703-1714. Ranum, L.P.W., and Cooper, T.A. (2006). RNA-mediated neuromuscular disorders. Annual Review of Neuroscience 29, 259-277. Rau, F., Freyermuth, F., Fugier, C., Villemin, J.P., Fischer, M.C., Jost, B., Dembele, D., Gourdon, G., Nicole, A., Duboc, D., et al. (2011). Misregulation of miR-1 processing is associated with heart defects in myotonic dystrophy.Nat.Struct.Mol.Biol 18, 840-845. Reddy, K., Zamiri, B., Stanley, S.Y., Macgregor, R.B., Jr., and Pearson, C.E. (2013). The disease-associated r(GGGGCC)n repeat from the C9orf72 gene forms tract length-dependent uni- and multimolecular RNA G-quadruplex structures. J.biol.chem288, 9860-9866. Reddy, S., Smith, D.B., Rich, M.M., Leferovich, J.M., Reilly, P., Davis, B.M., Tran, K., Rayburn, H., Bronson, R., Cros, D., et al. (1996). Mice lacking the myotonic dystrophy protein kinase develop a late onset progressive myopathy. Nature Genet 13, 325-335. Renton, A.E., Majounie, E., Waite, A., Simon-Sanchez, J., Rollinson, S., Gibbs, J.R., Schymick, J.C., Laaksovirta, H., van Swieten, J.C., Myllykangas, L., et al. (2011). A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron 72, 257-268. Ritchie, M.E., Phipson, B., Wu, D., Hu, Y.F., Law, C.W., Shi, W., and Smyth, G.K. (2015). limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res 43. Rodriguez, R., Hernandez-Hernandez, O., Magana, J.J., Gonzalez-Ramirez, R., Garcia-Lopez, E.S., and Cisneros, B. (2015). Altered nuclear structure in myotonic dystrophy type 1-derived fibroblasts. Mol Biol Rep 42, 479-488. Roseboom, P.H., Namboodiri, M.A.A., Zimonjic, D.B., Popescu, N.C., Rodriguez, I.R., Gastel, J.A., and Klein, D.C. (1998). Natural melatonin 'knockdown' in C57BL/6J mice: rare mechanism truncates serotonin N-acetyltransferase. Mol Brain Res 63, 189-197. Rovsing, L., Clokie, S., Bustos, D.M., Rohde, K., Coon, S.L., Litman, T., Rath, M.F., Moller, M., and Klein, D.C. (2011). Crx broadly modulates the pineal transcriptome. J.Neurochem 119, 262-274. Sanchez, S.E., Petrillo, E., Beckwith, E.J., Zhang, X., Rugnone, M.L., Hernando, C.E., Cuevas, J.C., Herz, M.A.G., Depetris-Chauvin, A., Simpson, C.G., et al. (2010). A

124

methyl transferase links the circadian clock to the regulation of alternative splicing. Nature 468, 112-+. Sanchez, S.E., Petrillo, E., Kornblihtt, A.R., and Yanovsky, M.J. (2011). Alternative splicing at the right time. RNA Biol 8, 954-959. Sapede, D., and Cau, E. (2013). The Pineal Gland from Development to Function. Curr Top Dev Biol 106, 171-215. Sehgal, A. (2008). Ac-ing the clock. Neuron 57, 8-10. Seznec, H., Agbulut, O., Sergeant, N., Savouret, C., Ghestem, A., Tabti, N., Willer, J.C., Ourth, L., Duros, C., Brisson, E., et al. (2001). Mice transgenic for the human myotonic dystrophy region with expanded CTG repeats display muscular and brain abnormalities. Hum.Mol.Genet 10, 2717-2726. Seznec, H., Lia-Baldini, A.S., Duros, C., Fouquet, C., Lacroix, C., Hofmann-Radvanyi, H., Junien, C., and Gourdon, G. (2000). Transgenic mice carrying large human genomic sequences with expanded CTG repeat mimic closely the DM CTG repeat intergenerational and somatic instability. Hum.Mol.Genet 9, 1185-1194. Sicot, G., and Gomes-Pereira, M. (2013). RNA toxicity in human disease and animal models: from the uncovering of a new mechanism to the development of promising therapies. Biochimica et biophysica acta 1832, 1390-1409. Sobczak, K., de Mezer, M., Michlewski, G., Krol, J., and Krzyzosiak, W.J. (2003). RNA structure of trinucleotide repeats associated with human neurological diseases. Nucleic Acids Res 31, 5469-5482. Sobczak, K., Michlewski, G., de Mezer, M., Kierzek, E., Krol, J., Olejniczak, M., Kierzek, R., and Krzyzosiak, W.J. (2010). Structural Diversity of Triplet Repeat RNAs. J.Biol.Chem 285, 12755-12764. Staiger, D., Zecca, L., Kirk, D.A.W., Apel, K., and Eckstein, L. (2003). The circadian clock regulated RNA-binding protein AtGRP7 autoregulates its expression by influencing alternative splicing of its own pre-mRNA. Plant J 33, 361-371. Suzuki, N., Maroof, A.M., Merkle, F.T., Koszka, K., Intoh, A., Armstrong, I., Moccia, R., Davis-Dusenbery, B.N., and Eggan, K. (2013). The mouse C9ORF72 ortholog is enriched in neurons known to degenerate in ALS and FTD. Nat Neurosci 16, 1725-1727. Swanson, M.S., and Dreyfuss, G. (1988). Classification and purification of proteins of heterogeneous nuclear ribonucleoprotein particles by RNA-binding specificities. Mol.Cell.Biol 8, 2237-2241.

125

Taneja, K.L., Mccurrach, M., Schalling, M., Housman, D., and Singer, R.H. (1995). Foci of Trinucleotide Repeat Transcripts in Nuclei of Myotonic-Dystrophy Cells and Tissues. J.Cell.Biol128, 995-1002. Teplova, M., and Patel, D.J. (2008). Structural insights into RNA recognition by the alternative-splicing regulator muscleblind-like MBNL1.Nat.Struct.Mol.Biol 15, 1343-1351. Therrien, M., Rouleau, G.A., Dion, P.A., and Parker, J.A. (2013). Deletion of C9ORF72 results in motor neuron degeneration and stress sensitivity in C. elegans. PloS one 8, e83450. Timchenko, L.T., Miller, J.W., Timchenko, N.A., DeVore, D.R., Datar, K.V., Lin, L., Roberts, R., Caskey, C.T., and Swanson, M.S. (1996). Identification of a (CUG)n triplet repeat RNA-binding protein and its expression in myotonic dystrophy. Nucleic Acids Res 24, 4407-4414. Todd, P.K., Oh, S.Y., Krans, A., He, F., Sellier, C., Frazer, M., Renoux, A.J., Chen, K.C., Scaglione, K.M., Basrur, V., et al. (2013). CGG repeat-associated translation mediates neurodegeneration in fragile X tremor ataxia syndrome. Neuron 78, 440-455. Tome, S., Manley, K., Simard, J.P., Clark, G.W., Slean, M.M., Swami, M., Shelbourne, P.F., Tillier, E.R., Monckton, D.G., Messer, A., et al. (2013). MSH3 polymorphisms and protein levels affect CAG repeat instability in Huntington's disease mice. PLoS genetics 9, e1003280. Treangen, T.J., and Salzberg, S.L. (2012). Repetitive DNA and next-generation sequencing: computational challenges and solutions. Nat.Rev.Genet 13, 36-46. Udd, B., and Krahe, R. (2012). The myotonic dystrophies: molecular, clinical, and therapeutic challenges. Lancet Neurol 11, 891-905. Urade, Y., and Hayaishi, O. (2011). Prostaglandin D2 and sleep/wake regulation. Sleep Med Rev 15, 411-418. Usdin, K. (2008). The biological effects of simple tandem repeats: Lessons from the repeat expansion diseases.Genome Res 18, 1011-1019. van Blitterswijk, M., Mullen, B., Nicholson, A.M., Bieniek, K.F., Heckman, M.G., Baker, M.C., Dejesus-Hernandez, M., Finch, N.A., Brown, P.H., Murray, M.E., et al. (2014). TMEM106B protects C9ORF72 expansion carriers against frontotemporal dementia. Acta Neuropathol. Van Deerlin, V.M., Sleiman, P.M., Martinez-Lage, M., Chen-Plotkin, A., Wang, L.S., Graff-Radford, N.R., Dickson, D.W., Rademakers, R., Boeve, B.F., Grossman, M., et al.

126

(2010). Common variants at 7p21 are associated with frontotemporal lobar degeneration with TDP-43 inclusions. Nature Genet 42, 234-239. Videnovic, A., Lazar, A.S., Barker, R.A., and Overeem, S. (2014). 'The clocks that time us'-circadian rhythms in neurodegenerative disorders. Nat.Rev.Neurol 10, 683-693. von Gall, C., Lewy, A., Schomerus, C., Vivien-Roels, B., Pevet, P., Korf, H.W., and Stehle, J.H. (2000). Transcription factor dynamics and neuroendocrine signalling in the mouse pineal gland: a comparative analysis of melatonin-deficient C57BL mice and melatonin-proficient C3H mice. Eur J Neurosci 12, 964-972. Wang, D.N., Liang, X.D., Chen, X.Y., and Guo, J.H. (2013). Ribonucleoprotein Complexes That Control Circadian Clocks. Int J Mol Sci 14, 9018-9036. Wang, E.T., Cody, N.A., Jog, S., Biancolella, M., Wang, T.T., Treacy, D.J., Luo, S., Schroth, G.P., Housman, D.E., Reddy, S., et al. (2012). Transcriptome-wide regulation of pre-mRNA splicing and mRNA localization by muscleblind proteins. Cell 150, 710-724. Wang, G.S., Kearney, D.L., De Biasi, M., Taffet, G., and Cooper, T.A. (2007). Elevation of RNA-binding protein CUGBP1 is an early event in an inducible heart-specific mouse model of myotonic dystrophy. J.Clin.Invest 117, 2802-2811. Wen, X., Tan, W., Westergard, T., Krishnamurthy, K., Markandaiah, S.S., Shi, Y., Lin, S., Shneider, N.A., Monaghan, J., Pandey, U.B., et al. (2014). Antisense proline-arginine RAN dipeptides linked to C9ORF72-ALS/FTD form toxic nuclear aggregates that initiate in vitro and in vivo neuronal death. Neuron 84, 1213-1225. Wojciechowska, M., and Krzyzosiak, W.J. (2011). Cellular toxicity of expanded RNA repeats: focus on RNA foci. Hum.Mol.Genet 20, 3811-3821. Wu, J., Anczukow, O., Krainer, A.R., Zhang, M.Q., and Zhang, C.L. (2013). OLego: fast and sensitive mapping of spliced mRNA-Seq reads using small seeds. Nucleic Acids Res 41, 5149-5163. Xu, Z., Poidevin, M., Li, X., Li, Y., Shu, L., Nelson, D.L., Li, H., Hales, C.M., Gearing, M., Wingo, T.S., et al. (2013a). Expanded GGGGCC repeat RNA associated with amyotrophic lateral sclerosis and frontotemporal dementia causes neurodegeneration.Proc.Natl.Acad.Sci USA 110, 7778-7783. Xu, Z.H., Poidevin, M., Li, X.K., Li, Y.J., Shu, L.Q., Nelson, D.L., Li, H., Hales, C.M., Gearing, M., Wingo, T.S., et al. (2013b). Expanded GGGGCC repeat RNA associated with amyotrophic lateral sclerosis and frontotemporal dementia causes neurodegeneration.Proc.Natl.Acad.Sci USA 110, 7778-7783.

127

Yamaguchi, S., Mitsui, S., Yan, L.L., Yagita, K., Miyake, S., and Okamura, H. (2000). Role of DBP in the circadian oscillatory mechanism. Mol Cell Biol 20, 4773-4781. Zhang, K., Donnelly, C.J., Haeusler, A.R., Grima, J.C., Machamer, J.B., Steinwald, P., Daley, E.L., Miller, S.J., Cunningham, K.M., Vidensky, S., et al. (2015). The C9orf72 repeat expansion disrupts nucleocytoplasmic transport. Nature 525, 56-61. Zhang, R., Lahens, N.F., Ballance, H.I., Hughes, M.E., and Hogenesch, J.B. (2014a). A circadian gene expression atlas in mammals: Implications for biology and medicine.Proc.Natl.Acad.Sci USA 111, 16219-16224. Zhang, Y.J., Jansen-West, K., Xu, Y.F., Gendron, T.F., Bieniek, K.F., Lin, W.L., Sasaguri, H., Caulfield, T., Hubbard, J., Daughrity, L., et al. (2014b). Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress. Acta Neuropathol 128, 505-524. Zu, T., Gibbens, B., Doty, N.S., Gomes-Pereira, M., Huguet, A., Stone, M.D., Margolis, J., Peterson, M., Markowski, T.W., Ingram, M.A.C., et al. (2011). Non-ATG-initiated translation directed by microsatellite expansions.Proc.Natl.Acad.Sci USA 108, 260-265. Zu, T., Liu, Y., Banez-Coronel, M., Reid, T., Pletnikova, O., Lewis, J., Miller, T.M., Harms, M.B., Falchook, A.E., Subramony, S.H., et al. (2013a). RAN proteins and RNA foci from antisense transcripts in C9ORF72 ALS and frontotemporal dementia.Proc.Natl.Acad.Sci USA 110, E4968-4977. Zu, T., Liu, Y.J., Baez-Coronel, M., Reid, T., Pletnikova, O., Lewis, J., Miller, T.M., Harms, M.B., Falchook, A.E., Subramony, S.H., et al. (2013b). RAN proteins and RNA foci from antisense transcripts in C9ORF72 ALS and frontotemporal dementia.Proc.Natl.Acad.Sci USA 110, E4968-E4977.

128

BIOGRAPHICAL SKETCH

Apoorva Mohan was born and brought up in Chennai, India. She majored in

Industrial Biotechnology in the Centre for Biotechnology, Anna University. She secured

the prestigious Indian Academy of Sciences summer research fellowship during her

junior year in 2009 and performed research at National Center for Biological Sciences

under the mentorship of Dr. Yamuna Krishnan. She used biophysical techniques to

characterize the folding and denaturation kinetics of microRNAs. She pursued her PhD

in molecular genetics under the mentorship of Dr. Maurice Swanson and graduated in

the fall 2015. Her research interests lie in using high throughput techniques to

understand the RNA processing events in neurological diseases and circadian biology.

In January 2016, she plans to perform postdoctoral work in similar areas and wants to

join biotech/pharmaceutical industry.

Date post:	25-Aug-2020
Category:	Documents
Upload:	others
View:	0 times
Download:	0 times

© 2015 Apoorva Mohan - University of...

Documents