+ All Categories
Home > Documents > .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of...

.. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of...

Date post: 05-Jan-2016
Category:
Upload: melinda-carson
View: 221 times
Download: 3 times
Share this document with a friend
44
.
Transcript
Page 1: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

.

Page 2: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

What is DNA

DNA is also know as

DeoxyriboNucleic AcidDNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that is you?

Perhaps when you think of DNA, you think of something out of a sci fi film. Like poor Bryant here…

Page 3: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.
Page 4: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Who helped figure out DNA?• Griffith and Transformation

– Using strains of pneumonia figures out that DNA can “transform” harmless bacteria into harmful bacteria

Page 5: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Avery• discovered that DNA is the nucleic acid

that stores and transmits the genetic information from one generation of an organism to the next

Page 6: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Hershey and Chase – 1952

• Used Viruses to infect living organisms ***IMPORTANT NEW STUDIES/ RESEARCH HAVE COME FROM THIS EXPERIMENT

• Used radioactive markers on the protein coat vs the DNA

• Conclusion – genetic material of the bacteriophage (virus) they infected with bacteria was DNA – not protein.

Page 7: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.
Page 8: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Watson and Crick/ Rosalind Franklin - 1953

• Franklin studies DNA using x-Ray diffraction – and gives her pictures to Watson and Crick

• Watson and Crick Use her pattern and instantly realize that DNA was a Double Helix. Every Scientist around the world was feverishly working out this structure and without her work might not have figured it out –

• SHE was NEVER recognized!!!

Page 9: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.
Page 10: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

So let’s Look at the Basic’s DNA is held in your nucleus. It never leaves (copies get

sent out to do the dirty work but NEVER the DNA itself.)

The subunit of DNA is made of a

Sugar – a Phosphate – and a NITROGENOUS BASE.

5’

3’

Page 11: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Basic’s

There are 4 Nitrogenous Bases:

Adenine (A)

Guanine (G)

Thymine (T)

Cytosine (C)

A always bonds with T

G always bonds with C

Think – “A Tall Girl Called”

G C

T A

C G

A T

Purine

Pyrimidine3’

3’ 5’

5’

Page 12: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

• Sugar Phosphates are always facing outward.

• The two complementary strands of DNA are always oriented in opposite directions in the double helix, with one strand oriented 5’ to 3’ and the complementary strand pointing in the other direction

• The two strands for this reason are said to be anti parallel!

• Chargaff’s rules - # of A’s = T’s and G=C’s

Page 13: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

How is DNA kept in your Cells?

You have roughly 3’ of DNA in each of your billions of cells.

They need to be tightly coiled like a phone cord (remember those things) then coiled around protein.

These are the structures you see as chromosomes.

Genes, the basic unit of inheritance are contained in chromosomes and consist of DNA

Page 14: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Chromosomes

Page 15: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Karyotype

When a women has a child they can do what is called a karyotype This is a picture of the baby’s DNA before they are born. They pair up all the Chromosomes to see if there are any abnormalities.

Page 16: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

DNA fingerprints?

Everyone’s DNA is unique to them. Unless, they are an identical twin.

I’m sure you’ve seen on CSI, they take DNA evidence.

They do this by doing a DNA Gel Electrophoresis. (we will be doing one too)

On the following slide you will see a picture of several twin’s DNA fingerprints.

Page 17: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Twin DNA Fingerprints

Page 18: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

How do you make more?

Well we know you are more then the one cell you started at.

And every cell you have has the same DNA, so how do you make more DNA?

It’s called DNA Replication.

You’re DNA is in the shape of a Double Helix – like a twisted ladder. This shape is not really the best in aiding the replication process.

What to do, what to do …

Page 19: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Replication

First you UNTWIST a section

Then you must UNZIP

This is done by breaking the Hydrogen bonds between

the nitrogenous bases.

Now you find a new “complimentary base” partner

(A with T, G with C)

Once a section has been partnered up it

RETWISTS

Page 20: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Replication

Page 21: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Closer look at

Replication

This is a Semi-CONSERVATIVE replication because each new strand has half of the old strand.

The old strand is used as a TEMPLATE or guide of where to put the new bases

Page 22: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Bidirectional Replication

• Starts at the replication origin and creates 2 replication forks that move away in both directions.

• DNA Helicase opens the DNA

• DNA polymerases add to end of existing nucleotide elongating it (5’ – 3’ adding onto the 3’ end)

Page 23: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

• Since DNA polymerase can not start a new strand from scratch must add onto a short primer of RNA (made by RNA polymerase called primase.

• The continuous strand is called the leading stand

• The one in smaller pieces (called Okazaki fragments) is called the lagging strand.– A DNA polymerase fills in the gaps after the

RNA primer is removed from between the pieces.

• The sections of DNA are finally joined together by an enzyme called ligase

Page 24: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Finally

• The ends of eukaryotic chromosomes present a special problem for DNA replication – therfore the 5’ – 3’ direction can not copy both ends of linear eukaryotic chromosomes. The ends of the chromosomes have special repeating sequences called telomeres and a specialized enzymed called telomerase that copies the telomeres from an RNA template it carries rather than the usual method. Without telomerase, the ends of chromosomes would shrink with repeated rounds of the DNA replication.

Page 25: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

• The key to accurate replication dictates that unpaired bases will attract a free nucleotide ONLY if the nucleotide has a proper COMPLEMENTARY BASE!

• As DNA separates at weak hydrogen bonds, it also recombines at those same weak hydrogen bonds

Page 26: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

But how does DNA control Cell functions?

Well like any building site – there are a set of

blue prints. You don’t want to hand out the

original, you have to make a copy to give the

plumber, electrician, mason, etc.

So we make a messenger molecule called RNA.

RNA is kind of like DNA in that it is made up of

nucleotides (remember – sugar, phosphate,

base)

Page 27: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

RNA

However, RNA’s bases areAdenine (A)

Guanine (G)

Cytosine (C)

URACIL (U)

Also RNA is single Stranded, that’s how it can fit out of the nuclear pores.

The process in which we make RNA from DNA is like replication but the RNA strand leaves, and the DNA just retwists

Page 28: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Transcription

Page 29: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Transcription

So now you keep the original In the nucleus,

and the copy goes out into the cytoplasm.

The code is an exact copy of the DNA’s code

(with the exception of U’s instead of T’s)

So it looks something like -

AUGUUUAAAGGGCCCUAGCGCUUAAGGUUAAGGCCUUUGUAUUAAUAG

Page 30: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

OK so how does that RNA tell our cells what to do?

So now the RNA code is in the cytoplasm. A

ribosome bonds to an initiation site.

The ribosome “reads” this code and figures out

what amino acids to put together to make a

protein.

The proteins made are what influences the cells

behavior.

So let’s look at TRANSLATION in detail.

Page 31: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

The Ribosome reads the RNA three letters at a time.

This is called the codon.

If you look at the amino acid chart you will see there

are 20 amino acids but 64 different codon

possibilities. That means that several codons code

for the same amino acid. (This is called degeneracy

so if there is a mutation it may not change the amino

acid)

A T-RNA with the anti-codon brings the appropriate

amino acid to the M-RNA and links the amino acids

together.

Page 32: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Codon - Amino Acid Chart

Page 33: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Translation

Page 34: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

In the codon chart, you saw the amino acid

sequences. The ribosome knows where to start

reading based on the initiation codon AUG, and

where to end based on three termination

sequences: UAA, UGA, UAG

You saw in that second picture that the ribosome

held two T-RNA. The first one holds the chain of

amino acids, while the second one brings in the

new amino acid.

The following is an animation of the ribosome

traveling down the Messenger RNA

Page 35: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Translation

Page 36: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Here’s an animation of translation I found online

Page 37: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.
Page 38: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Many ribosomes can read the RNA strand at one time.

Page 39: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

What’s the big deal making proteins?

Proteins are what controls the activities going on in your cells.

Remember, enzymes are protein too.

IMPORTANT :

the sequence of the amino acids determines the SHAPE of the protein

The SHAPE determines the FUNCTION of the protein

Page 40: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

If the DNA changes (a mutation), the AMINO ACID could change, which WOULD change the shape, which WOULD change the function.

Remember since some codons code for the same amino acid, substituting one letter for another MAY change the amino acid. It is not a guarantee. However, If you delete or add a letter that would change the reading frame and would change almost all the amino acids.

Page 41: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Overview of Transcription and Translation

Page 42: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Mutations

• In a mutation – nucleotides can be added, deleted, or substituted.

• For example – PKU – phenylketoneria, you do not make the proper enzyme to metabolize phenylalanine (you get a toxic accumulation of phyenylpyruvic acid.

• Sickle Cell Anemia – red blood cells can not carry oxygen – one amino acid in hemoglobin gene wsa changed. The disorder is traced to the presence of valine (GUA or GUG instead of glutamic acid (GAA or GAG)

Page 43: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

Types of Mutations

• Point mutations – occurs when a single nucleotide is substituted by another nucleotide.

• THE CAT ATE THE RAT – original

• THE BAT ATE THE RAT - mutation

• THE CAT ATE THE BAT - mutation

Page 44: .. What is DNA DNA is also know as DeoxyriboNucleic Acid DNA is the basic “building Block” of life. But what does that mean? and how does something soooo.

• Frame Shift Mutation – addition or deletion that involves the loss or addition of a single nucleotide

• THE CAT ATE THE BAT – original

• THC ATA TET HEB AT – mutation

• THE CAA THT HEB AT – mutation


Recommended